HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pirtle, R. M. Articles by Inouye, M. Search for Related Content PubMed PubMed Citation Articles by Pirtle, R. M. Articles by Inouye, M. Social Bookmarking                      What's this?

J. Biol. Chem., Vol. 255, Issue 1, 199-209, Jan, 1980

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA

RM Pirtle, IL Pirtle and M Inouye

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGC ACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.
CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				E. Blum, A. J. Carpousis, and C. F. Higgins Polyadenylation Promotes Degradation of 3'-Structured RNA by the Escherichia coli mRNA Degradosome in Vitro J. Biol. Chem., February 12, 1999; 274(7): 4009 - 4016. [Abstract] [Full Text] [PDF]