HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Full Text Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chung, D. C. Articles by Tillotson, L. G. Search for Related Content PubMed PubMed Citation Articles by Chung, D. C. Articles by Tillotson, L. G. Social Bookmarking                      What's this?

Volume 270, Number 15, Issue of April 14, pp. 8829-8836, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

---

Daniel C. Chung , Stephen J. Brand , Loyal G. Tillotson

The gastrin gene is transiently expressed in fetal pancreatic islets during islet neogenesis but then switched off after birth when islet cells become fully differentiated. Previous studies identified a cis-regulatory sequence between -109 and -75 in the human gastrin promoter which binds islet cell-specific activators and a nonspecific repressor and thus may act as a molecular switch. The present study identified another cis-regulatory sequence (ACACTAAATGAAAGGGCGGGGCAG) which bound two islet nuclear proteins in a mutually exclusive manner, as defined by gel shift competition, methylation interference, and DNase I footprinting assays. The general transactivator Sp1 recognized the downstream GGGCGGGG sequence, but Sp1 binding was prevented when another islet factor bound to the adjacent AT-rich sequence (CTAAATGA). This gastrin AT-rich element is nearly identical to the binding site (ATAAATGA) for the islet-specific transcription factor TF-1. However, the gastrin AT-binding factor appeared to differ from TF-1 in its gel mobility shift pattern. Transfections of rat insulinoma cells revealed that mutations which blocked binding to the AT-rich element but allowed Sp1 binding up-regulated transcriptional activity. These results suggest that the gastrin AT-binding factor blocks transactivation by Sp1 and may have a role in the repression of gastrin transcription seen at the end of islet differentiation.

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				X. Zhang, I. H. Diab, and Z. E. Zehner ZBP-89 represses vimentin gene transcription by interacting with the transcriptional activator, Sp1 Nucleic Acids Res., June 1, 2003; 31(11): 2900 - 2914. [Abstract] [Full Text] [PDF]

				K. Kinoshita, D. R. Taupin, H. Itoh, and D. K. Podolsky Distinct Pathways of Cell Migration and Antiapoptotic Response to Epithelial Injury: Structure-Function Analysis of Human Intestinal Trefoil Factor Mol. Cell. Biol., July 1, 2000; 20(13): 4680 - 4690. [Abstract] [Full Text]

				L. G. Tillotson RIN ZF, a Novel Zinc Finger Gene, Encodes Proteins That Bind to the CACC Element of the Gastrin Promoter J. Biol. Chem., March 19, 1999; 274(12): 8123 - 8128. [Abstract] [Full Text] [PDF]

				O. G. Opitz, T. D. Jenkins, and A. K. Rustgi Transcriptional Regulation of the Differentiation-linked Human K4 Promoter Is Dependent upon Esophageal-specific Nuclear Factors J. Biol. Chem., September 11, 1998; 273(37): 23912 - 23921. [Abstract] [Full Text] [PDF]

				H. Nakagawa, T. Inomoto, and A. K. Rustgi A CACCC Box-like cis-Regulatory Element of the Epstein-Barr Virus ED-L2 Promoter Interacts with a Novel Transcriptional Factor in Tissue-specific Squamous Epithelia J. Biol. Chem., June 27, 1997; 272(26): 16688 - 16699. [Abstract] [Full Text] [PDF]