HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Full Text Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhang, M. Articles by Siegal, G. P. Search for Related Content PubMed PubMed Citation Articles by Zhang, M. Articles by Siegal, G. P. Social Bookmarking                      What's this?

Volume 272, Number 22, Issue of May 30, 1997 pp. 14139-14146
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Epidermal Growth Factor Induces CD44 Gene Expression through a Novel Regulatory Element in Mouse Fibroblasts

(Received for publication, December 30, 1996, and in revised form, March 24, 1997)

Ming Zhang , Ming Hui Wang , Raj K. Singh , Alan Wells ^§¶ and Gene P. Siegal ^§¶**

From the Departments of  Pathology,  Cell Biology and Surgery, the ^** Cell Adhesion and Matrix Research Center, and the ^§ University of Alabama Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, Alabama 35233-1924, and the ^¶ Birmingham Veterans Affairs Medical Center, Birmingham, Alabama 35233

Growth factors coordinately regulate a variety of genes associated with pathological states including tumor invasion and metastasis. Overexpressed epidermal growth factor receptor (EGFR) on tumor cell surfaces is associated with enhanced cell attachment and migration into extracellular matrices, which promotes tumor aggressiveness. We have demonstrated that epidermal growth factor (EGF) up-regulates the cell surface adhesion molecule CD44 at both the mRNA and protein levels on mouse fibroblasts expressing full-length wild-type EGFR (NR6-WT) but not on EGFR-deficient cells (NR6-P). This increases cell attachment to hyaluronic acid. In this investigation, transcriptional regulation of CD44 by EGF was confirmed by defining an EGF-regulatory element. By employing human CD44 gene promoter-chloramphenicol acetyltransferase (CAT) constructs transfected into NR6-WT cells, EGF inducibility was observed within a 120-base pair (bp) DNA fragment located 450 bp upstream of the RNA initiation site. Differential EGF inducibility was found among different cell lines chosen, indicating a 3.2- and 1.8-fold enhancement in DU145 cells carrying exogenous wild-type EGFR and in MCF-7 cells, respectively, while minimal EGF induction was found in cervical cancer HeLa cells. Utilizing gel shift assays, a time-dependent increase of DNA-protein complex formation was found upon EGF stimulation in NR6-WT cells but not in NR6-P cells. Based upon these observations, a novel 22-bp EGF regulatory element (ERE) (5-⁶⁰⁴CCCTCTCTCCAGCTCCTCTCCC⁵⁸³-3) was isolated from the CD44 gene promoter. This ERE conferred DNA-protein binding ability in vitro, as well as the full functional recovery of EGF inducibility of CAT activity when linked to a homologous CD44 promoter or a SV40 promoter driving a CAT reporter gene. A two-base mutation of the ERE completely eliminated its binding activity as well as its EGF inducibility of CAT expression. Our studies indicate that EGF induces CD44 gene expression through an interaction between a specific ERE and putative novel transcriptional factor so as to regulate cell attachment to extracellular matrix.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				J.-G. Jiang, Y.-G. Ning, C. Chen, D. Ma, Z.-J. Liu, S. Yang, J. Zhou, X. Xiao, X. A. Zhang, M. L. Edin, et al. Cytochrome P450 Epoxygenase Promotes Human Cancer Metastasis Cancer Res., July 15, 2007; 67(14): 6665 - 6674. [Abstract] [Full Text] [PDF]

				J. P. Mishra, S. Mishra, K. Gee, and A. Kumar Differential Involvement of Calmodulin-dependent Protein Kinase II-activated AP-1 and c-Jun N-terminal Kinase-activated EGR-1 Signaling Pathways in Tumor Necrosis Factor-{alpha} and Lipopolysaccharide-induced CD44 Expression in Human Monocytic Cells J. Biol. Chem., July 22, 2005; 280(29): 26825 - 26837. [Abstract] [Full Text] [PDF]

				J. C. Tsai, L. Liu, J. Guan, and W. C. Aird The Egr-1 gene is induced by epidermal growth factor in ECV304 cells and primary endothelial cells Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1414 - C1424. [Abstract] [Full Text] [PDF]

				L. C. FOSTER, P. WIESEL, G. S. HUGGINS, R. PAÑARES, M. T. CHIN, A. PELLACANI, and M. A. PERRELLA Role of activating protein-1 and high mobility group-I(Y) protein in the induction of CD44 gene expression by interleukin-1{beta} in vascular smooth muscle cells FASEB J, February 1, 2000; 14(2): 368 - 378. [Abstract] [Full Text]

				W Reinisch, K-H Heider, G Oberhuber, C Dejaco, M Mullner, G R Adolf, and C Gasche Poor diagnostic value of colonic CD44v6 expression and serum concentrations of its soluble form in the differentiation of ulcerative colitis from Crohn's disease Gut, September 1, 1998; 43(3): 375 - 382. [Abstract] [Full Text] [PDF]

				L. C. Foster, B. M. Arkonac, N. E. S. Sibinga, C. Shi, M. A. Perrella, and E. Haber Regulation of CD44 Gene Expression by the Proinflammatory Cytokine Interleukin-1beta in Vascular Smooth Muscle Cells J. Biol. Chem., August 7, 1998; 273(32): 20341 - 20346. [Abstract] [Full Text] [PDF]