| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 32, 24857-24864, August 11, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Synthesis of aortic elastin peaks in the
perinatal period and then is strongly down-regulated with postnatal
development and growth. Decreased stability of elastin mRNA
contributes to this developmental decrease in chick aortic elastin
production. We have previously shown that destabilization of elastin
mRNA is correlated with decreased binding of cytosolic protein(s)
to a large, GC-rich region of secondary structure in the
3'-untranslated region (3'-UTR) of elastin mRNA. In this study,
using gel migration shift assays, deletion constructs, and antisense
competition assays, we identify a major protein-binding site in
the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA),
which we have designated the G3A motif. This motif is present in the
3'-UTR of elastin from several species. Binding proteins are present in
both nuclear and cytoplasmic extracts, and their abundance is
associated with tissues producing elastin and correlated with
circumstances in which elastin mRNA is stable. These results
suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an
important element in the regulation of stability of the elastin mRNA.
Identification of a GA-rich Sequence as a Protein-binding Site in
the 3'-Untranslated Region of Chicken Elastin mRNA with a Potential
Role in the Developmental Regulation of Elastin mRNA Stability*
§¶,¶
,, and§**
Cardiovascular Research Program, Research Institute,
Hospital for Sick Children and Departments of § Biochemistry and of
Laboratory Medicine and Pathobiology, University of Toronto,
Ontario, Canada M5G 1X8
*
This work was supported by a grant from the Medical Research
Council of Canada.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Yang, M. A. Nugent, and M. P. Panchenko EGF antagonizes TGF-{beta}-induced tropoelastin expression in lung fibroblasts via stabilization of Smad corepressor TGIF Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L143 - L151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Mao, X. Pan, and L. Gu Evidence That a Mutation in the MLH1 3'-Untranslated Region Confers a Mutator Phenotype and Mismatch Repair Deficiency in Patients with Relapsed Leukemia J. Biol. Chem., February 8, 2008; 283(6): 3211 - 3216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Deschenes-Furry, K. Mousavi, F. Bolognani, R. L. Neve, R. J. Parks, N. I. Perrone-Bizzozero, and B. J. Jasmin The RNA-Binding Protein HuD Binds Acetylcholinesterase mRNA in Neurons and Regulates its Expression after Axotomy J. Neurosci., January 17, 2007; 27(3): 665 - 675. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Akagawa, A. Tajima, Y. Sakamoto, B. Krischek, T. Yoneyama, H. Kasuya, H. Onda, T. Hori, M. Kubota, T. Machida, et al. A haplotype spanning two genes, ELN and LIMK1, decreases their transcripts and confers susceptibility to intracranial aneurysms Hum. Mol. Genet., May 15, 2006; 15(10): 1722 - 1734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Mukudai, S. Kubota, T. Eguchi, S. Kondo, K. Nakao, and M. Takigawa Regulation of Chicken ccn2 Gene by Interaction between RNA cis-Element and Putative trans-Factor during Differentiation of Chondrocytes J. Biol. Chem., February 4, 2005; 280(5): 3166 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bunda, N. Kaviani, and A. Hinek Fluctuations of Intracellular Iron Modulate Elastin Production J. Biol. Chem., January 21, 2005; 280(3): 2341 - 2351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Marano, M. Brankov, and P. E. Rakoczy Discovery of a Novel Control Element within the 5'-Untranslated Region of the Vascular Endothelial Growth Factor: REGULATION OF EXPRESSION USING SENSE OLIGONUCLEOTIDES J. Biol. Chem., September 3, 2004; 279(36): 37808 - 37814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Deschenes-Furry, G. Belanger, N. Perrone-Bizzozero, and B. J. Jasmin Post-transcriptional Regulation of Acetylcholinesterase mRNAs in Nerve Growth Factor-treated PC12 Cells by the RNA-binding Protein HuD J. Biol. Chem., February 14, 2003; 278(8): 5710 - 5717. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Mazumder, V. Seshadri, H. Imataka, N. Sonenberg, and P. L. Fox Translational Silencing of Ceruloplasmin Requires the Essential Elements of mRNA Circularization: Poly(A) Tail, Poly(A)-Binding Protein, and Eukaryotic Translation Initiation Factor 4G Mol. Cell. Biol., October 1, 2001; 21(19): 6440 - 6449. [Abstract] [Full Text] [PDF]
|
|
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
