Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abrams, C. S.
Right arrow Articles by Zhao, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abrams, C. S.
Right arrow Articles by Zhao, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 1, Issue of January 6, 1995 pp. 333-339
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
SH3 Domains Specifically Regulate Kinase Activity of Expressed Src Family Proteins (*)

(Received for publication, May 4, 1994; and in revised form, October 13, 1994)

Charles S. Abrams (§) Wei Zhao

From the Division of Hematology-Oncology, Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The Src homology 2 (SH2) and Src homology 3 (SH3) domain are approximately 50% conserved in various Src family kinase members. Several lines of evidence suggest that in Src these domains are sequence motifs that direct substrate recognition, regulate kinase activity, or control subcellular localization. We sought to investigate the function of the homology domains in human Lyn, and to determine whether the differences between various SH3 domains affect function. To do this, we generated variant forms of Lyn lacking SH2 and SH3 domains, and created chimeras in which the SH3 domains in human c-Src and Lyn were replaced with SH3 domains from other family members. In contrast to similar deletions in Src, forms of Lyn lacking SH2 or SH3 had decreased kinase activity. The SH3 chimeras all had individual characteristics. Insertion of the Blk SH3 domain into Lyn restored kinase activity, while insertion of the Fyn or Src SH3 into Lyn enhanced the kinase activity 2-3-fold. Insertion of the Lyn SH3 into Src also doubled kinase activity. Expression of the Lyn-Src SH3 chimera in mammalian cells induced cell transformation. This study 1) demonstrates that the regulation of Lyn is different than Src, and 2) provides new evidence that despite their homology, there are important functional differences between the SH3 domains of the various Src family members.


INTRODUCTION

The Rous sarcoma virus contains the v-src gene which encodes a 60-kilodalton plasma membrane-associated protein capable of inducing neoplastic transformation(1, 2) . The Src protein has protein tyrosine kinase activity which is essential for its oncogenic capabilities(3) . Genetic screening has revealed nine Src family members which are all normal cellular components: c-Src, c-Yes, Lyn, Fyn, Lck, c-Fgr, Hck, Blk, Yrk(4, 5) . Gene knockout experiments have demonstrated specific roles for some of these proteins, and immunoprecipitation and receptor cross-linking studies have implicated various potential signaling pathways.

Each of the Src family proteins can be divided into multiple domains with distinct functional properties. The largest domain is located in the carboxyl-terminal half of the protein and contains the kinase catalytic activity and a short stretch of approximately 19 amino acids that contains a kinase activity regulating tyrosine residue(6, 7) . Deletion mapping has shown that amino acids 1-14 are necessary for N-myristylation of p60 a process that appears necessary for membrane association as well as anchoring to several receptors of the immunoglobulin supergene family (8, 9, 10, 11) . Adjacent to this site is a stretch of approximately 60 amino acids, termed the unique domain, where the Src family members diverge most dramatically(4) .

Two domains situated between this unique region and the catalytic kinase region are found in a wide variety of intracytoplasmic signaling molecules(4) . These domains are called Src homology region 2 (SH2) (^1)and Src homology region 3 (SH3). Both have been implicated in protein-protein interactions(12) . There is a substantial body of evidence that SH2 domains, which are composed of a conserved stretch of approximately 100 amino acids, bind to phosphorylated tyrosine residues(12, 13) . SH2 domains may bind to the tyrosine in the regulatory tail of Src and modulate the kinase activity of this protein. SH3 domains, composed of a module of approximately 60 amino acids, are less understood. Several SH3 domains have been found to bind proline-rich sequences(14, 15) . Recently, attention has been drawn to the fact that SH3-containing proteins are usually membrane-associated, suggesting a role in subcellular localization (16, 17, 18) .

Specific deletion or point mutations in SH2 or SH3 regions can activate or inactivate kinase activity and alter the transforming potential of tyrosine kinases in avian and mammalian cells(19, 20, 21, 22, 23, 24, 25, 26) . Interestingly, several mutations in the SH2 and SH3 domains create a phenotype that varies according to the host cell, suggesting that environment as well as protein sequence is important(25, 26) . In addition, other work has shown that SH3 domains may participate in substrate recognition(14, 18, 24, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37) . Genetic evidence demonstrates that mutations in the SH3 domain of sem5 severely impairs nematode vulva development, showing direct evidence that SH3 domains are critical in cellular signaling (38) . Taken together, these results imply that SH3 regions may regulate kinase activity and direct interaction with specific cellular proteins.

Lyn is a member of the Src family which is widely expressed in hematopoietic cells and has been implicated in intracellular signaling from receptors of the immunoglobulin supergene family(4) . To determine the functional significance of the Src homology domains in Lyn, we constructed a set of eukaryotic vectors containing domain deletion variants of Lyn. Our results demonstrate that Lyn behaves differently than Src with respect to specific kinase activity, sites of in vivo phosphorylation, and association with intracellular tyrosine-phosphorylated proteins. We further addressed whether we could restore wild-type phosphorylating activity of the Lyn SH3 deletion polypeptide by substituting a SH3 domain from other Src kinases. Expression of several SH3 chimerics all demonstrated individual in vivo and in vitro characteristics. These results imply that the regulation for Lyn is different than Src and suggest a modulating role for the SH3 domain that is individually specific for each Src family member.


MATERIALS AND METHODS

DNA Constructs

The wild-type p56 construct was cloned into PCMV5 as described previously(11) . The Lyn mutants were constructed by using the PCR splice overlap extension technique to fuse the regions flanking the deletions(39) . For all mutants, the external sense primer was 5` GCGGTAGGCGTGTACGGTGGGAGGTCT 3` and the external antisense primer was 5` CTGGAGTGGCAACTTCCAAGGCCAGGA 3`. The sense and antisense mutagenesis primers for the Lyn unique (20-66) were 5` GTAGATTTGATTGTGGTAGCCTTGTAC 3` and 5` TACCACAATCAAATCTACTCCATCGTC 3`. The sense and antisense primers for the Lyn SH3 (67-117) were 5` CAAGGAGACGTGGCCAAACTCAACACC 3` and 5` TTTGGCCACGTCTCCTTGTTCCTCTGG 3`, and for the Lyn SH2 (118-229) were 5` AGCAACTATAAGCCACAGAAGCCATGGG 3` and 5` CTGTGGCTTATAGTTGCTGGGGATGAAG 3`. The final product was then digested with EcoRI and BamHI and cloned back into PCMV5.

The Src and Lyn chimeric mutants were constructed using a two-step overlap extension technique, first fusing the amino portion of Src or Lyn with a substituted SH3 domain, and then fusing this product with the carboxyl terminus of the kinase. The template for human c-Src was a gift of Don Fujita, and the template for human Fyn was a gift from Keith Robbins. Murine Blk SH3 cDNA was generated by reverse transcription-PCR from HL-60 RNA. Lyn-SH3-Src was generated using PCR primers 5` CAAGGAGACACCTTTGTGGCCCTCTAT 3`, 5` CACAAAGGTGTCTCCTTGTTCCTCTGG 3`, 5` AGCAACTACGTGGCCAAACTCAACACC 3`, 5` TTTGGCCACGTAGTTGCTGGGGATGTA 3`. The primers for Lyn-SH3-Fyn were 5` CAAGGAGACCTCTTTGTGGCCCTTTAT 3`, 5` CACAAAGAGGTCTCCTTGTTCCTCTGG 3`, 5` AGCAATTATGTGGCCAAACTCAACACC 3`, 5` TTTGGCCACATAATTGCTGGGAATGTA 3`. Lyn-SH3-Blk was generated using PCR primers 5` CAAGGAGACGTGGTGGCTCTGTTTGAC 3`, 5` AGCCACCACGTCTCCTTGTTCCTCTGG 3`, 5` AGCAACTTTGTGGCCAAACTCAACACC 3`, 5` TTTGGCCACAAAGTTGCTGGGCACATA 3`. The primers for Src-SH3-Lyn were 5` GGAGTGACCATTGTGGTAGCCTTGTAC 3`, 5` TACCACAATGGTCACTCCACCGGCCAG 3`, 5` AGCAACTATGTGGCGCCCTCCGACTCC 3`, GGGCGCCACATAGTTGCTGGGGATGAA 3`. The final product was then digested with EcoRI and BamHI and cloned back into PCMV5. The full sequences of all cloned PCR-generated products were correct as determined by the dideoxy method using the Sequenase version 2.0 kit (U. S. Biochemical Corp.).

Cell Culture, Transfections, and Metabolic Labeling

Transient transfections of COS-1 and NIH 3T3 cells were performed as described previously(40, 41) . All transients were examined 2-3 days after transfection. NIH 3T3 stables were selected by adding G418 24 h after transfection and selecting for single isolates approximately 2 weeks later. These isolates were expanded and subsequently assayed for expression of the individual proteins by immunoblotting or in vitro kinase assays.

Metabolic labeling with [S]methionine of COS-1 cells was performed by changing the medium to 10% DMEM, 90% methionine-free DMEM with 10% FCS and 50 µCi/ml TranS-label (ICN) overnight. In vivo labeling of cells with free P was performed by starving COS-1 cells for 20 min with phosphate-free DMEM with 10% fetal calf serum, and then adding 1 mCi/ml orthophosphate for 3.5 h.

Immunoprecipitation, in Vitro Kinase Assays, and Immunoblotting

Transiently or stably transfected NIH 3T3 or COS-1 cells were washed twice with phosphate-buffered saline, scraped off the plates, pelleted, and lysed in radioimmune precipitation buffer (58 mM NaCl, 5 mM EDTA, 10 mM Tris (pH 7.2), 0.1% SDS, 1% sodium deoxycholate, and 1% Triton X-100) with 1% aprotinin (Miles Pharm), 50 µg/ml leupeptin (Sigma), 1 mM phenylmethylsulfonyl fluoride, and 1 mM vanadate (Fisher). After clarification at 18,000 times g, the lysates were normalized arbitrarily for transfection efficiency, and saturating quantities of AR1, rabbit polyclonal anti-Lyn peptide (amino acids 20-229), or LAO74, murine monoclonal anti-Src were added and incubated at 4 °C overnight. Pansorbin (Calbiochem, catalog no. 507858) with 1% bovine serum albumin was added for 15 min, pelleted, and washed twice with lysis buffer. Samples were then used for in vitro kinase assays as described below. For immunoblotting or S-labeled protein gels, the samples were then boiled in sample loading buffer, fractionated on a 7.5% SDS-PAGE, and either transferred to nitrocellulose and immunoblotted as described below or soaked in sodium salicylate for 1 h, dried, and exposed to XAR film at -70 °C.

Samples for in vitro kinase assays were washed once with low salt buffer (100 mM NaCl, 10 mM Tris (pH 7.0), 2.5 mM MnCl(2), 2.5 mM MgCl(2)) and resuspended in 30 µl of low salt buffer with 1 µM ATP and 25 µCi of [-P]ATP and 10 µg of acid-treated exogenous enolase (Boehringer Manheim) and incubated at room temperature for 15 min as described previously(42) . The reaction was stopped by dilution with 1 ml of lysis buffer and then pelleted. The pellet was resuspended in sample buffer and boiled prior to fractionation on 7.5% SDS-PAGE, dried, and exposed at -70 °C to XAR film. Phosphorylation of enolase was quantitated on a PhosphoImager or Densitometer (Molecular Dynamics). Significance was determined by one-tailed Student's t test analysis.

Immunoblotting was performed to detect phosphotyrosine-containing proteins(43) . Briefly, proteins fractionated on 7.5% PAGE were transferred to nitrocellulose, incubated for at least 2 h with blocking buffer (5% crystallized bovine serum albumin, 170 mM NaCl, 0.2% Nonidet P-40, 50 mM Tris (pH 7.5)). The blots were probed with a mixture of murine anti-phosphotyrosine antibodies (4G10 and PY20). A horseradish peroxidase-coupled secondary antibody was used and detected by enhanced chemiluminescence (Amersham Corp.). Alternatively, Lyn or Src protein was detected with AR1 or LA074 primary antibody. This was followed with I-conjugated secondary donkey antibody, and the blot was exposed to XAR film.

CNBr Digestion of Proteins

Transiently transfected COS-1 cells were labeled in vivo with P(i) or in vitro labeled in a kinase assay as described above. Cyanogen bromide mapping was performed basically as described previously except that the final fractionation was performed on a Tricine gel(44, 45) .


RESULTS

Construction of Lyn/Src Deletion and Chimeric Mutants

We sought to investigate the function of the homology domains in human Lyn and the qualitative differences in SH3 domains of human Src family kinases. Three deletion mutants and three SH3 chimeric mutations were introduced into Lyn. One SH3 chimeric mutation was introduced into c-Src. The boundaries of the studied SH3 domains are shown in Fig. 1A. The constructs are summarized in Fig. 1B.


Figure 1: Amino acid sequence of Src family SH3 domains and schematic diagrams of human p56 Lyn and human p60 Src constructions. A, alignment of Src family SH3 domains. The 14 amino acids thought to interact with ligands are marked with an asterisk(16) . The numbering on top corresponds to the residue from chicken c-Src. B, schematic diagram of p56 Lyn, Lyn deletion mutants, Lyn SH3 chimerics, c-Src and Src SH3 chimerics



In Vitro Kinase Assays

To determine the effects of deletion of the unique, SH3, or SH2 domains on the kinase activity of Lyn expressed in mammalian cells, we determined the specific activity of each of the mutant proteins by an in vitro immunoprecipitation kinase assay with enolase as exogenous substrate using electrophoresis to separate the phosphorylated proteins. Shown in Fig. 2, the wild-type Lyn runs at 56 kDa, the unique deletion mutant at 51 kDa, SH3 deletion at 50 kDa, and the SH2 deletion at 45 kDa. This is consistent with their predicted molecular masses. A typical experiment is demonstrated in Fig. 2A. As summarized in Table 1, deletion of the unique, SH3, or SH2 domains in human Lyn expressed in mammalian cells decreased the activity for autophosphorylation and phosphorylation of an exogenous substrate. Fig. 2B demonstrates that comparable amounts of proteins were immunoprecipitated. This decrease in Lyn kinase activity is in contrast to the findings of SH2 or SH3 deletion mutations in c-Src which have a 30-fold enhanced phosphorylating activity(24) .


Figure 2: Determination of specific activity of human Lyn and Lyn deletion mutant polypeptides. Lyn was immunoprecipitated from [S]methionine-labeled COS cells which were transiently transfected with Lyn or Lyn mutant proteins. A, one half of immunoprecipitate was used in an in vitro kinase assay with enolase as the exogenous substrate; B, the other half was used to quantitate the level of [S]methionine labeled Lyn protein by fractionating on a 7.5% SDS-PAGE, treating with sodium salicylate, and exposing to film.





We next questioned whether we could restore wild-type phosphorylating activity of the Lyn SH3 deletion polypeptide by substituting a SH3 domain from another Src kinase. When the SH3 domain of Lyn was replaced with the SH3 domain of Blk, Fyn, or c-Src, the mobilities of the metabolically labeled proteins were faster (Lyn-SH3-Blk) or slower (Lyn-SH3-Fyn) than predicted (Fig. 3). DNA sequencing confirmed that the mutations were accurate, hence it is probable that the difference in apparent size reflects folding or post-translational processing of the protein. The in vitro kinase assays of these chimeric proteins revealed that replacing the SH3 domain of Lyn with Blk essentially restores wild-type activity (Fig. 3A). When the SH3 domain of Lyn was replaced with the SH3 of Fyn or Src, the specific activity of Lyn went up severalfold (Table 1). Paired comparison demonstrated that the kinase activity of Lyn-SH3-Blk was significantly different from Lyn-SH3-Fyn (p < 0.001), but experimental variability prevented determining whether Lyn-SH3-Blk was different from Lyn-SH3-Src.


Figure 3: Determination of specific activity of human Lyn and Lyn SH3 chimeric mutant polypeptides. Lyn was immunoprecipitated from [S]methionine labeled cells. A, one half of immunoprecipitate was used in an in vitro kinase assay with enolase as the exogenous substrate; B, the other half was used to quantitate the level of [S]methionine-labeled Lyn protein.



We questioned whether the reciprocal SH3 chimeric mutation in Src would also alter its in vitro kinase activity. When the SH3 of c-Src was replaced with the SH3 of Lyn, the apparent mobility of the mutant protein did not change (Fig. 4). Like the Lyn chimeras, replacement of the c-Src SH3 domain with the SH3 domain of Lyn elevated the specific activity of Src 2-fold (Fig. 4A, Table 1).


Figure 4: Determination of specific activity of human Src and Src-SH3-Lyn chimeric mutant polypeptide. Src was immunoprecipitated from [S]methionine-labeled cells. A, One half of immunoprecipitate was used in an in vitro kinase assay with enolase as the exogenous substrate; B, the other half was used to quantitate the level of [S]methionine-labeled Lyn protein.



In summary, we found that deletion of the SH2, SH3, or unique domains caused a loss of Lyn activity. This is in contrast to the reported gain in Src kinase activity following SH2 or SH3 deletion. Replacing the deleted Lyn SH3 domain with the corresponding portion of Blk restored the kinase activity to base line, but substituting the Fyn or Src SH3 domain caused an increase in kinase activity.

In Vivo Phosphorylation Mapping

Other investigators have demonstrated that the sites of tyrosine phosphorylation on Src and Lck reflect the state of activation. We examined the tyrosine phosphorylation sites of the variant kinases by performing peptide maps after in vivo phosphorylation. Previous work has shown that cyanogen bromide digestion of Src produces three phosphate-labeled fragments; a small 6-kDa fragment containing Tyr-527, a 10-kDa fragment containing Tyr-416, and a 32-kDa fragment containing Ser-17(46) . Wild-type c-Src is predominately phosphorylated on Tyr-527 in vivo by Csk, while activated variants of Src are phosphorylated on Tyr-416.

As seen in Fig. 5A, cyanogen bromide digestion of c-Src labeled in vitro yields a product that is almost exclusively labeled on Tyr-416 corresponding to the 10-kDa fragment. In contrast, cyanogen bromide digestion of c-Src labeled in vivo produced a phosphorylated 6- and 10-kDa fragment. This implies that overexpressed c-Src is phosphorylated on both Tyr-416 and Tyr-527. This might be attributable to the high levels of transiently overexpressed c-Src which could overwhelm the regulating activity of Csk, the kinase that phosphorylates Tyr-527 on Src. Cyanogen bromide digestion of in vivo labeled Src-SH3-Lyn, which is the Src chimeric which contains the Lyn SH3 domain, demonstrated a phosphorylated 10-kDa fragment and no 6-kDa fragment. This indicates that, in contrast to c-Src, the Src-SH3-Lyn variant is phosphorylated on Tyr-416, but not on Tyr-527. The peptide map of Src-SH3-Lyn labeled in vivo also demonstrated the predicted change in the size of the Ser-17 containing a fragment from 32 to 12 kDa. This is attributable to the presence of a methionine in the Lyn SH3 domain which produces an additional cyanogen bromide cleavage site in Src-SH3-Lyn that is not found in c-Src.


Figure 5: Cyanogen bromide cleavage of kinase variant proteins. A, immunoprecipitated Src or Src-SH3-Lyn polypeptide from P(i)-labeled cells were purified and digested with cyanogen bromide. The lane labeled Auto-P contains c-Src, which was labeled with P(i) in an in vitro kinase reaction and then cleaved with cyanogen bromide as a marker for the Tyr-416-containing peptide. The positions of peptides containing the three sites of Src phosphorylation Ser-17, Try-416, and Tyr-527 are shown. B, immunoprecipitated Lyn polypeptide from P(i)-labeled cells was purified and digested with cyanogen bromide. The lane labeled Lyn in Vitro contains Lyn which was labeled with P(i) in an in vitro kinase reaction and then cleaved with cyanogen bromide.



We next examined the sites of phosphorylation on in vitro and in vivo phosphorylated Lyn. By analogy with Src, resting Lyn should be phosphorylated on Tyr-508 and activated Lyn should be phosphorylated on Tyr-397. These sites of phosphorylation are located on cyanogen bromide digest fragments of size 4 and 8 kDa, respectively. Lyn does not have a serine in its unique region corresponding to Ser-17 of Src, but does have several other potential phosphorylation sites in its unique domain, all of which would be located on a cyanogen bromide digest fragment of 10 kDa. Fig. 5B demonstrates that cyanogen bromide digestion of in vivo and in vitro labeled Lyn produces three fragments of 4, 8, and 10 kDa. In contrast to c-Src, there is no dramatic difference between the peptide map of in vitro and in vivo phosphorylated Lyn. Peptide mapping of the Lyn variants also did not reveal any change in their sites in vivo phosphorylation (data not shown).

Thus, we found that substitution of the Lyn SH3 into Src results in a change in the site of in vivo phosphorylation consistent with in vivo activation. We also found that Lyn, in contrast to Src, does not change its pattern of phosphorylation upon activation.

Ability of Src or Lyn Variants to Transform NIH 3T3 Cells

In view of this increased kinase activity, we questioned whether the SH3 chimeric mutations would transform 3T3 fibroblasts. Mouse NIH 3T3 cells were transfected with plasmids encoding for the appropriate human kinase polypeptide along with a neomycin resistant plasmid, and selected for growth in G418-containing medium. Several independent isolates of Lyn, Src, and each variant were studied. Expression of c-Src, wild-type Lyn, the Lyn SH3 deletion polypeptide, and the SH3 chimeric polypeptides were roughly comparable as determined by immunoblotting (data not shown).

The morphology of multiple cellular isolates expressing each of the mutants were studied. Typical examples are shown in Fig. 6. Overexpression of c-Src or Lyn in NIH 3T3 cells resulted in a morphology similar to untransfected NIH 3T3 cells or cells transfected with the neomycin resistant plasmid alone. In contrast, cells expressing the Lyn SH3 deletion polypeptide or Lyn-SH3-Src polypeptide displayed a weakly transformed morphology. The cells were refractile, rounded, and displayed thin neuronal-like processes. None of the other Lyn or Src variants displayed a transformed morphology (Table 2).


Figure 6: Cell morphology. NIH 3T3 cells expressing roughly equivalent levels of various human Lyn or Src polypeptides were photographed under light microscopy. A, neomycin plasmid with empty expression vector; B, wild-type Lyn; C, Lyn SH3 deletion; D, Lyn-SH3-Blk; E, Lyn-SH3-Fyn; F, Lyn-SH3-Src; G, c-Src; and H, Src-SH3-Lyn.





To test each mutant for anchorage independent growth, we assayed for the induction of colony formation in soft agar. Several isolates of each mutant were assayed in at least two separate experiments. Three out of three clones expressing the Lyn SH3 deletion polypeptide and three out of three clones expressing the Lyn-SH3-Src polypeptide formed approximately 200 small colonies in soft agar (0.4% of cells plated). None of the other cells expressing wild-type or mutant polypeptides formed colonies in soft agar (data not shown).

Thus, cells overexpressing Lyn lacking an SH3 domain, or Lyn containing the SH3 domain of Src, have a mildly transformed phenotype. This is seen by alterations in cell morphology and demonstration of anchorage-independent cell growth. In contrast, substitution of the Blk or Fyn SH3 into Lyn or the Lyn SH3 into Src failed to induce cell transformation.

Phosphorylation of Cellular Substrates

Cells expressing SH2 and SH3 deletion mutants of Src and Lck contain increased phosphotyrosine-containing proteins(22, 24, 26) . We tested the role of the unique, SH3, and SH2 domains in directing critical protein-protein interactions necessary for Lyn function by examining the level of phosphotyrosine proteins in cells expressing the Lyn deletion mutants. Whole cell lysates of transiently transfected NIH 3T3 cells (Fig. 7) were immunoblotted with anti-phosphotyrosine antibodies.


Figure 7: Anti-phosphotyrosine immunoblots. The identification of phosphotyrosine-containing proteins, in NIH 3T3 cells expressing mutant Src or Lyn polypeptides, was assessed by anti-phosphotyrosine immunoblots as described under ``Materials and Methods.''



As is shown in Fig. 7, overexpression of wild-type Lyn in 3T3 cells caused only a mild increase in phosphotyrosine-containing proteins compared to mock-transfected 3T3 cells. Like a similar deletions in Src or Lck, we found that deletion of the SH2 in Lyn increased the tyrosine phosphorylation of cellular proteins. Interestingly, although the level of intracellular phosphorylation was increased with the Lyn SH2 deletion variant, this was one of the mutations that lowered the specific activity of Lyn. In addition to an overall increase in intracellular tyrosine phosphorylation, several proteins appear to be particularly targeted for phosphorylation with apparent molecular masses of 36 and 49 kDa. In contrast to the SH2 domain, deletion of the unique or SH3 region of Lyn did not alter its ability to phosphorylate other intracellular proteins.

We next tested the Lyn SH3 chimeric mutant polypeptides for their ability to phosphorylate intracellular proteins. Although several of the chimeric mutants phosphorylated enolase, in vitro, more than wild-type Lyn, none of the chimeras were associated with an elevated level of intracellular phosphorylation. In addition, we could not detect any novel substrates associated with the Lyn chimerics.

As described by others, we found that cells overexpressing c-Src had an increased amount of phosphotyrosine-containing proteins compared to wild-type 3T3(47, 48, 49) . When the SH3 region of Src was replaced with the SH3 region of Lyn, the phosphorylation of cellular proteins went up dramatically. This effect does not appear to be related to the level of kinase expression, since immunoblotting indicated that there were roughly equivalent amounts of Src protein in the cell lysates used in Fig. 7(data not shown). This increase in phosphotyrosine-containing proteins was also seen in NIH 3T3 cells stably expressing our polypeptides (data not shown). In addition to a dramatic increase in the overall amount of various phosphotyrosine-containing proteins, several proteins are preferentially phosphorylated by Src-SH3-Lyn. The most prominent of these phosphoproteins migrated at 36, 68, 80, and 110 kDa. Comparison of the phosphorylation pattern of Src-SH3-Lyn-transfected 3T3 cells with v-Src-transformed 3T3 cells demonstrates a prominent phosphorylated 85-kDa band associated with v-Src and not with Src-SH3-Lyn (data not shown).


DISCUSSION

Lyn Deletion Polypeptides

Deletion of the SH3 or SH2 of Lyn causes a decrease in tyrosine kinase activity in vitro. This is in contrast to the 15-30-fold increase in kinase activity found with similar mutations in Src. Interestingly, Seidel-Dugan et al.(24) and Hirai and Varmus (25) showed that deletion of the SH3 domain from activated variants of c-Src, caused a similar decrease in specific activity in vitro and no change in the Src variant's phosphorylation profile. In this regard, the role of the SH3 domain of Lyn behaves more similarly to the SH3 domain of an activated Src variant than to the SH3 of c-Src.

Overexpression of the Lyn SH3 deletion polypeptide, gives subtle signs of cell transformation. The cells acquired a neuronal morphology and produced evidence of anchorage independence by some growth in soft agar. It is remarkable that the cell transformation is associated with a Lyn variant polypeptide that has a lower intrinsic specific kinase activity than the wild-type Lyn. However, this is not without precedent since it has been shown that some mutations in Src which lower kinase activity can still transform murine 3T3 cells(26) .

Of all the Lyn mutants examined, only the SH2 deletion caused an increase of phosphotyrosine-containing proteins in COS cells. This occurred despite its lower specific kinase activity, suggesting that the SH2 region may play a role in the repressing the ability of Lyn to phosphorylate substrates through a mechanism independent of regulating the intrinsic kinase activity of Lyn. This mechanism of regulation again appears different from the SH2 regulation of Src.

Deletion Mutations in Lyn Demonstrate Intrinsic Differences between Lyn and c-Src

SH2 and SH3 deletion mutations in Src have been shown to elevate their specific kinase activity(24, 25) . This report demonstrates that similar mutations in Lyn decrease kinase activity and implies that the regulation of one Src family member cannot necessarily be extrapolated onto another. The findings of this study also demonstrate that Lyn, in contrast to Src, does not change its sites of phosphorylation upon activation. The tyrosine kinase activity of c-Src is negatively regulated by phosphorylation of a tyrosine located at the carboxyl terminus, tyrosine 527. Upon activation, Src undergoes a dephosphorylation of tyrosine 527 and a phosphorylation on tyrosine 416. The phosphorylation pattern of Lyn remains constant regardless of whether Lyn is activated in vitro or in vivo. Since human Lyn is a kinase implicated in several hematopoietic signaling pathways, knowledge that the lessons of Src cannot be applied automatically to Lyn may have strong implications.

SH3 Chimeric Mutations Demonstrate That Src Family SH3 Domains Cannot Completely Substitute for Each Other

This study shows that the Src family SH3 domains, although highly homologous, appear to have specificity in their function. We were struck by the marked difference between in vitro kinase activity of our chimeric kinase polypeptides. There are two explanations for why the wild-type SH3 regulates a Src family kinase, while other closely related SH3 regions fails to do so. First, the SH3 region might exert its negative regulation via an intramolecular mechanism. There is a substantial body of evidence that the SH2 domain interacts with the phosphorylated regulatory carboxyl terminus to inhibit kinase activity. It is possible that the SH3 region has a similar effect. The SH3 domain could interact with the regulatory tail or elsewhere in the catalytic region. Recent evidence suggests that the SH3 domain may cooperate with the SH2 domain and the regulatory tail to inhibit kinase activity(50, 51, 52) .

Second, the SH3 region may regulate kinase activity through an intermolecular mechanism. This might occur by impairing the direct interaction with a negative regulator. Imamoto and Soriano (53) have demonstrated that the phosphorylation of the regulatory site, tyrosine 527, in c-Src is mediated by Csk and at least one other cellular protein tyrosine kinase. It is possible that in the Src family, the SH3 domain directs interaction with other proteins that activate or inactivate kinase activity. It has been proposed that the Abl kinase SH3 domain may interact with an intracellular regulator(23) . Perhaps the Src family SH3 domains direct interactions with specific regulators, and substitution of a different SH3 domain alters this resultant regulation. This is consistent with evidence of decreased intracellular phosphorylating ability of the Lyn variants but elevated kinase activity after immunoprecipitation under harsh lysis conditions.

As noted in Fig. 1A, the SH3 of Fyn has complete identity with Src in 42 out of 52 amino acids. In contrast, Lyn and Blk share only 29 and 28 amino acids, respectively, with Src. Of the 12 SH3 conserved residues that are proposed to be critical for interaction with ligands, Lyn and Src share only 3 residues(26) . In this context, it is not surprising that the Src family SH3 domains cannot substitute for each other. Grandori (54) postulated that Src kinase activity is regulated in part by Arg-95 of chicken Src. His model proposed that kinase activity is inhibited by binding to substrate-like sequences. Potts et al.(55) demonstrated that a single Arg-95 to Trp mutation is sufficient to activated c-Src. It is remarkable that both Src and Fyn contain an Arg at this site, but Lyn and Blk have an isoleucine and valine, respectively. It is tempting to speculate that the substitution of Src or Fyn SH3 domain into Lyn leads to a consistent increase in kinase activity perhaps in part due to the substitution of the isoleucine in Lyn for an arginine. Consistent with this, Lyn-SH3-Blk's essentially identical kinase activity with wild-type Lyn is possibly attributable to the relatively conservative substitution of valine for isoleucine.

Other studies have demonstrated that the SH3 domain of Src can target substrates(30, 31) . We are not able to detect binding of the p85 subunit of PI3K to c-Src or Src-SH3-Lyn in our system. (^2)Since p85 is thought to interact only with activated Src, it is interesting that the activated variant, Src-SH3-Lyn, does not associate with p85. Perhaps the Lyn SH3 domain is not able to associate with p85, even when substituted into Src. Although we were not able to detect novel substrates of the Lyn chimeric proteins, we did observe phosphorylation of currently unknown proteins with molecular mass of 36 and 49 kDa with the Lyn SH2 deletion.

It is interesting that Src-SH3-Lyn and Lyn SH2 deletion both phosphorylate a band of molecular mass of 36 kDa. Potentially the Lyn SH3 domain is directing this interaction, thus allowing Src-SH3-Lyn to phosphorylate it. Since the Lyn SH2 deletion polypeptide is a more activated form of Lyn, as demonstrated by the total cell lysate anti-phosphotyrosine blot, it may phosphorylate p36 more readily than wild-type Lyn even though the association could be present in both. Alternatively, this phosphoprotein is calpactin I which becomes phosphorylated by activated variants of Src. Further identification of this protein is ongoing.

Since the protein kinase activity of Src family members is critical for their transforming potential, determination of their target proteins is important for understanding their mechanism of oncogenesis. This study provides evidence for individual characteristics of different Src family members as demonstrated by the contrasting consequences of SH2 or SH3 deletions in Lyn or Src. This work also demonstrates the inability of one SH3 domain to completely substitute for another and implies that SH3-substituted forms of human c-Src and Lyn may be useful for studying the regulatory role of the SH3 module.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of National Institutes of Health Physician Scientist Award 5-K11-HL-02464. To whom correspondence should be addressed: Division of Hematology-Oncology, University of Pennsylvania School of Medicine, 415 Curie Blvd, Rm. 678, Philadelphia, PA 19104. Tel.: 215-898-1058; Fax: 215-573-2189; Abrams{at}mail.med.upenn.edu.

(^1)
The abbreviations used are: SH2, Src homology region 2; SH3, Src homology region 3; DMEM, Dulbecco's modified Eagle's medium; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.

(^2)
C. S. Abrams and W. Zhao, unpublished observation.


ACKNOWLEDGEMENTS

We thank L. Brass, S. Shattil, and J. Brugge for their helpful discussions and critical reading of this manuscript, and F. Yue for his assistance in the preparation of the figures.


REFERENCES

  1. Cooper, J. A. (1990) in Peptides and Protein Phosphorylation (Kemp, B., and Alewood, P. F., eds) pp. 85-113, CRC Press, Boca Raton, FL
  2. Parsons, J. T., and Weber, M. J. (1989) Curr. Top. Microbiol. Immunol. 147, 79-127 [Medline] [Order article via Infotrieve]
  3. Sefton, B. M., Hunter, T., Ball, E. H., and Singer, S. J. (1980) Cell 20, 807-816 [CrossRef][Medline] [Order article via Infotrieve]
  4. Bolen, J. (1991) Cell Growth & Diff. 2, p409-414
  5. Sudol, M., Greulich, H., Newman, L., Sarkar, A., Sukegawa, J., and Yamamoto, T. (1993) Oncogene 8, 823-831 [Medline] [Order article via Infotrieve]
  6. Brugge, J. S., and Darrow, D. (1984) J. Biol. Chem. 259, 4550-4557 [Abstract/Free Full Text]
  7. Levinson, A. D., Courtneidge, S. A., and Bishop, J. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 78, 1624-1628
  8. Cross, F. R., Garber, E. A., Pellman, D., and Hanafusa, H. (1984) Mol. Cell. Biol. 4, 1834-1842 [Abstract/Free Full Text]
  9. Kaplan, J. M., Mardon, G., Bishop, J. M., and Varmus, H. E. (1988) Mol. Cell. Biol. 8, 2435-2441 [Abstract/Free Full Text]
  10. Gauen, L. K., Kong, A-N, T., Samelson, L. E., and Shaw, A. S. (1992) Mol. Cell. Biol. 12, 5438-5446 [Abstract/Free Full Text]
  11. Pleiman, C. M., Abrams, C. S., Gauen, L. T., Bedzyk, W., Clark, M. R., Shaw, A. S., and Cambier, J. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4268-4272 [Abstract/Free Full Text]
  12. Koch, C. A., Anderson, D., Moran, M. F., Ellis, C., and Pawson, T. (1991) Science 252, 668-674 [Abstract/Free Full Text]
  13. Cantley, L. C., Auger, K. R., Carpenter, C., Duckworth, B., Graziani, A., Kappeler, R., and Soltoff, S. (1991) Cell 64, 281-302 [CrossRef][Medline] [Order article via Infotrieve]
  14. Ren, R., Mayer, B. J., Cicchetti, P., and Baltimore, D. (1993) Science 259, 1157-1161 [Abstract/Free Full Text]
  15. Yu, H., Chen, J. K, Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S. L. (1994) Cell 76, 933-945 [CrossRef][Medline] [Order article via Infotrieve]
  16. Booker, G. W., Gout, J., Downing, A. K., Driscoll, P. C., Boyd, J., Waterfield, M. D., and Campbell, J. D. (1993) Cell 73, 813-822 [CrossRef][Medline] [Order article via Infotrieve]
  17. Rodaway, A. R., Sternberg, M. J. E., and Bentley, D. L. (1989) Nature 342, 624 [Medline] [Order article via Infotrieve]
  18. Bar-Sagi, D., Rotin, D., Batzer, A., Mandiyan, V., and Schlessinger, J. (1993) Cell 74, 83-91 [CrossRef][Medline] [Order article via Infotrieve]
  19. Kato, J.-Y., Takeya, T., Grandori, C., Iba, H., Levy, J. B., and Hanafusa, H. (1986) Mol. Cell. Biol. 6, 4155-4160 [Abstract/Free Full Text]
  20. Nemeth, S. P., Fox, L. G., DeMarco, M., and Brugge, J. S. (1989) Mol. Cell. Biol. 9, 1109-1119 [Abstract/Free Full Text]
  21. Jackson, P., and Baltimore, D. (1989) EMBO J. 8, 449-456 [Medline] [Order article via Infotrieve]
  22. Veillette, A., Caron, L., Fournel, M., and Parsons, J. T. (1992) Oncogene 7, 971-980 [Medline] [Order article via Infotrieve]
  23. Pendergast, A. M., Muller, A. J., Havlik, M. H., Clark, R., McCormick, F, and Witte, O. N. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5927-5931 [Abstract/Free Full Text]
  24. Seidel-Dugan, C., Meyer, B. E., Thomas, S. M., and Brugge, J. S. (1992) Mol. Cell. Biol. 12, 1835-1845 [Abstract/Free Full Text]
  25. Hirai, H., and Varmus, H. E. (1990) Mol. Cell. Biol. 10, 1307-1318 [Abstract/Free Full Text]
  26. Hirai, H., and Varmus, H. E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8562-8596
  27. Kanner, S. B., Reynolds, A. B., Wang, H.-C., R., Vines, R. R., and Parsons, J. T. (1991) EMBO J. 10, 1689-1698 [Medline] [Order article via Infotrieve]
  28. Cicchetti, P., Mayer, B. J., Thiel, G., and Baltimore, D. (1992) Science 257, 803-806 [Abstract/Free Full Text]
  29. Duchesne, M., Schweighofer, F., Parker, F., Clerc, F., Frobert, Y., Thang, M. N., and Tocque, B. (1993) Science 259, 525-528 [Abstract/Free Full Text]
  30. Weng, Z., Taylor, J. A., Turner, C. E., Brugge, J. S., and Seidel-Dugan, C. (1993) J. Biol. Chem. 268, 14956-14963 [Abstract/Free Full Text]
  31. Liu, Y., Marehgere, E. M., Koch, C. A., and Pawson, T. (1993) Mol. Cell. Biol. 13, 5225-5232 [Abstract/Free Full Text]
  32. Egan, S. E., Giddings, B. W., Brooks, M. W., Buday, L., Sizeland, A. M., and Weinberg, R. A. (1993) Nature 363, 45-51 [CrossRef][Medline] [Order article via Infotrieve]
  33. Rozakis-Adcock, M., Fernley, R., Wade, J., Pawson, T., and Bowtell, D. (1993) Nature 363, 83-85 [CrossRef][Medline] [Order article via Infotrieve]
  34. Li, N., Batzer, A., Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Bar-Sagi, D., Margolis, B., and Schlessinger, J. (1993) Nature 363, 85-88 [CrossRef][Medline] [Order article via Infotrieve]
  35. Gale, N. W., Kaplan, S., Lowenstein, E. J., Schlessinger, J., and Bar-Sai, D. (1993) Nature 363, 88-92 [CrossRef][Medline] [Order article via Infotrieve]
  36. Barfod, E. T., Zheng, Y., Kuang, W. J., Hart, M. J., Evans, T., Cerione, R. A., and Ashkenazi, A. (1993) J. Biol. Chem. 268, 26059-26062 [Abstract/Free Full Text]
  37. Gout, I., Dhand, R., Hiles, I. D., Fry, M. J., Panayotou, G., Das, P., Truong, O., Totty, N. F., Hsuan, J., Booker, G. W., Campbell, I. D., and Waterfield, M. D. (1993) Cell 75, 25-36 [CrossRef][Medline] [Order article via Infotrieve]
  38. Clark, S. G., Stern, M. J., and Horvitz, H. R. (1992) Nature 356, 340-344 [CrossRef][Medline] [Order article via Infotrieve]
  39. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51-59 [CrossRef][Medline] [Order article via Infotrieve]
  40. Morris, J. F., Madden, S. L., Tournay, O. E., Cook, D. M., Sukatme, V. P., and Rauscher, F. J. (1991) Oncogene 6, 2339-2348 [Medline] [Order article via Infotrieve]
  41. Sambrook, J., Fitsch, E. F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manuel , 2nd ed., p. 16.33, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  42. Levy, J. B., and Brugge, J. S. (1989) Mol. Cell. Biol. 9, 3332-3341 [Abstract/Free Full Text]
  43. Nemeth, S. P., Fox, L. C., DeMarco, M., and Brugge, J. S. (1989) Mol. Cell. Biol. 9, 1109-1119
  44. Schuh, S. M., and Brugge, J. S. (1988) Mol. Cell. Biol. 8, 2465-2471 [Abstract/Free Full Text]
  45. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379 [CrossRef][Medline] [Order article via Infotrieve]
  46. Jove, R., Kornbluth, S., and Hanafusa, H. (1987) Cell 50, 937-943 [CrossRef][Medline] [Order article via Infotrieve]
  47. Iba, H., Takeya, T., Cross, F., Hanafusa, T., and Hanafusa, H. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 4424-4428 [Abstract/Free Full Text]
  48. Johnson, P. J., Coussens, O. M., Danko, A. V., and Shalloway, D. (1985) Mol. Cell. Biol. 5, 1073-1083 [Abstract/Free Full Text]
  49. Parker, R., Varmus, H. E., and Bishop, J. M. (1984) Cell 37, 131-139 [CrossRef][Medline] [Order article via Infotrieve]
  50. Okada, M., Howell, B. W., Broome M. A., and Cooper, J. A. (1993) J. Biol. Chem. 268, 18070-18075 [Abstract/Free Full Text]
  51. Murphy, S. M., Bergman, M., and Morgan, D. O. (1993) Mol. Cell. Biol. 13, 5290-5300 [Abstract/Free Full Text]
  52. Superti-Furga, G., Fumagalli, S., Koegl, M., Courtneidge, S. A., and Draetta, G. (1993) EMBO J. 12, 2625-2634 [Medline] [Order article via Infotrieve]
  53. Imamoto, A., and Soriano, P. (1993) Cell 73, 1117-1124 [CrossRef][Medline] [Order article via Infotrieve]
  54. Grandori, C. (1989) Nature 338, 467 [Medline] [Order article via Infotrieve]
  55. Potts, W. M., Reynolds, A. B., Lansing, T., and Parsons, J. T. (1988) Oncogene Res. 3, 343-355 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
N. Kato, M. Nakanishi, and N. Hirashima
Flotillin-1 Regulates IgE Receptor-Mediated Signaling in Rat Basophilic Leukemia (RBL-2H3) Cells
J. Immunol., July 1, 2006; 177(1): 147 - 154.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Kamei, S. R. Jones, B. M. Chapman, K. L. MCGonigle, G. Dai, and M. J. Soares
The Phosphatidylinositol 3-Kinase/Akt Signaling Pathway Modulates the Endocrine Differentiation of Trophoblast Cells
Mol. Endocrinol., July 1, 2002; 16(7): 1469 - 1481.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. F. Denny, H. C. Kaufman, A. C. Chan, and D. B. Straus
The Lck SH3 Domain Is Required for Activation of the Mitogen-activated Protein Kinase Pathway but Not the Initiation of T-cell Antigen Receptor Signaling
J. Biol. Chem., February 19, 1999; 274(8): 5146 - 5152.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Weijland, J. C. Williams, G. Neubauer, S. A. Courtneidge, R. K. Wierenga, and G. Superti-Furga
Src regulated by C-terminal phosphorylation is monomeric
PNAS, April 15, 1997; 94(8): 3590 - 3595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhang, J. R. Falck, K. K. Reddy, C. S. Abrams, W. Zhao, and S. E. Rittenhouse
Phosphatidylinositol(3, 4, 5) -Trisphosphate Stimulates Phosphorylation of Pleckstrin in Human Platelets
J. Biol. Chem., September 29, 1995; 270(39): 22807 - 22810.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abrams, C. S.
Right arrow Articles by Zhao, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abrams, C. S.
Right arrow Articles by Zhao, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement