|
|
|
|||||||
|
|||||||||
(Received for publication, October 21, 1994; and in revised form, December 22, 1994) From the
A monomeric rat
Galectins (Barondes et al., 1994a, 1994b) are a family
of animal lectins formerly known as S-type or S-Lac lectins. Members of
the galectin family are defined by two properties: shared
characteristic amino acid sequences and affinity for
In previous studies, we identified yet another
In subsequent work (Leffler et
al., 1989), we found RL-18 in other rat tissues, but when we
perfused tissues to remove blood before homogenization, the lectin was
no longer present in the extracts. This suggested that RL-18 was a
component of blood. This is consistent with the observation by
Whitney(1988) that rat erythrocytes contained a lectin that appeared to
be RL-18. To further characterize RL-18, we purified it from rat
lung extracts, prepared peptide fragments, and determined their
sequence. To our surprise, the peptide sequences matched the deduced
amino acid sequence of an incomplete cDNA presumed to have been derived
from malaria parasites (GenBank
Figure 2:
Galectin-5 cDNA sequence. The open reading
frame has the translated amino acid sequence above it. Arrows under the nucleotide sequence correspond to oligonucleotides, with forward and backwardarrows representing the
sense and antisense directions, respectively. The putative
polyadenylation signal at the 3`-end of the cDNA sequence is underlined. Numbers refer to the amino acid residue or
nucleotide at the beginning of each line.
Cerra et al.(1985) reported the isolation of the
We
searched GenBank Given the match of the RL-18 peptides with the cDNA
clone, it seemed very likely that the cDNA had been derived from rat
reticulocyte mRNA rather than malaria parasite mRNA. We verified this
by amplifying two overlapping cDNA fragments (Le1h and Le2b) (Fig. 1) out of a rat reticulocyte library that spanned the
entire sequence of the initial cDNA (Pb46). The sequences of the two
reticulocyte isolates were identical to the relevant portions of the
Pb46 cDNA. However, we discovered a small region in the 3`-portion of
the coding region that was not reported in the original GenBank
Figure 1:
Sequencing strategy. The galectin-5
cDNA is represented by a bar. The two EcoRV
restriction sites used in subcloning are indicated. Sequences obtained
from the P. berghei cDNA library isolate (Pb46) and two
subclones (Pb46RV and Pb65RV) are presented as arrows under
the appropriate clones. Similarly, sequences obtained from the two
PCR-amplified clones from the rat reticulocyte cDNA library (Le1h and
Le2b) are represented below. bp, base
pairs.
The conclusion that the isolated cDNA contains the coding
sequence for RL-18 was confirmed by comparing the deduced protein
sequence (Fig. 2) with data about peptides derived from RL-18 (Table 1). The seven peptides whose sequences were determined
match exactly with residues 29-92 and 123-145 deduced from
the cDNAs, as numbered in Table 1. In addition, the mass of
peptide 1 (Table 1) matches that for the expected N-terminal
clostripain fragment, assuming that Met-1 has been cleaved and Ser-2
has been acetylated. These are common post-translational modifications
of the N terminus of cytoplasmic proteins, including all galectins that
have been analyzed. This strongly supports our identification of the
putative initiator methionine as residue 1 and our conclusion that the
cDNA contains the full-length coding sequence. Furthermore, the
presence of a consensus polyadenylation signal (AATAAA) at nucleotide
821 (with the initiator codon as residue 1) suggests that this cDNA
contains most of the 3`-untranslated region. Compared with other
galectin genes, galectin-5 cDNA has a long 3`-untranslated region (400
base pairs). Stretches of from 150 to over 350 base pairs of the
sequence of this 3`-region are >50% identical to the 3`-tail regions
of several other rodent and human cDNAs, including those encoding
myeloperoxidase, microtubule-associated proteins, and a glucose
transporter. Although the significance of these conserved sequences is
unknown, there is evidence that 3`-tail regions play a role in the
regulation of translation (Jackson and Standart, 1990). The protein
sequence deduced from the cDNAs has many similarities to those of other
galectins (Fig. 3). In fact, this protein shares all the
absolutely conserved residues found in other members of the galectin
family (designated by asterisks in Fig. 3). Since the
protein meets both criteria for membership in the galectin family
(
Figure 3:
Sequence comparison of galectin-1-5.
All the sequences are from rat (galectin-1, Clerch et al. (1988); galectin-3, Albrandt et al.(1987); galectin-4,
Oda et al.(1993)), except galectin-2, which is human (Gitt et al., 1992). Only the C-terminal partial sequences of
galectin-4 (residues 180-324) and galectin-3 (residues
114-262) are shown. Shaded residues are identical to the
corresponding galectin-5 residue. Dashes represent gaps
introduced to aid in alignment. The dashedunderline demarcates the exon that contains the majority of the conserved
residues (Gitt and Barondes, 1991; Barondes et al., 1994b)
that have been shown to be involved in saccharide binding (Lobsanov et al., 1993). Asterisks indicate residues that are
conserved in all known galectin sequences (Barondes et al.,
1994b). Residue numbers of the last residue on the line are given at
the right.
The isolation of a cDNA encoding galectin-5 from a
reticulocyte library suggested that this lectin is a constituent of
erythroblasts and erythrocytes. To evaluate this further, we prepared
rat erythrocytes by separating them from plasma and leucocytes and then
applied an extract of the erythrocytes to a lactosyl-Sepharose column
and eluted with lactose to obtain galactoside-binding proteins. The
eluate from the affinity column showed one band when examined by
SDS-polyacrylamide gel electrophoresis (Fig. 4). This band had a
mobility identical to that of RL-18, which was previously assigned a M
Figure 4:
Gel electrophoresis and Western blot of
galectin-5 purified from rat lung and rat erythrocytes. Purified
galactoside-binding lectins from either rat lung (lane1) or rat erythrocytes (lanes2 and 3) were analyzed on a 20% gel and visualized with silver
staining (lanes 1 and 2) or by probing with
anti-RL-18 after Western blotting (lane3). Molecular
mass markers (indicated by arrows to the left) used were
recombinant human galectin-3 (26.2 kDa) and its C-terminal collagenase
fragment (16.0 kDa) (Massa et al., 1993) and recombinant
domain I of rat galectin-4 (17.0 kDa) (Oda et al.,
1993).
On gel
filtration, galectin-5 eluted with an estimated M
Figure 5:
Schematic of domain and quaternary
structures of galectin-1-5. Carbohydrate-binding domains are
represented by black bars above and by sectors below.
The repetitive domain of galectin-3 and homologous regions in
galectin-4 and -5 are white, and the N-terminal domain of
galectin-3 is striped.
To our surprise, despite its monomeric state,
galectin-5 at a concentration of 300 µg/ml agglutinated rat
erythrocytes. Partial agglutination was observed at 150 µg/ml,
while no agglutination was observed at 30 µg/ml. The agglutination
by 300 µg/ml galectin-5 was completely abolished in the presence of
30 mM lactose. In contrast, complete agglutination of rat
erythrocytes by galectin-1 and -3 occurred at 100 µg/ml, and
partial agglutination occurred at 10 µg/ml. Hence, galectin-5 acts
as an agglutinin of rat erythrocytes, but is weaker than galectin-1 and
-3 in this system. To test whether the previous isolation of
galectin-5 from lung (Cerra et al., 1985) was due to the
presence of blood in the lung tissue, we analyzed galectins from lung
that had been extensively perfused with saline to remove blood (data
not shown). Only traces of galectin-5 were detected in the perfused
lung, whereas galectin-1 and 3 were present as prominent components of
lung tissue. Therefore, galectin-5 is present in lung as a component of
blood. To map the chromosomal location of the mouse homolog, we
first analyzed a Southern blot of restricted genomic DNA isolated from
two widely different inbred strains (C57BL/6J and M. spretus)
and the F1 hybrid produced from a cross of these strains. The probe
hybridized to only one band in both XbaI- and EcoRI-digested DNAs, supporting the existence of a unique gene
encoding the mouse homolog (Fig. 6). Several restriction enzymes
produced restriction fragment length polymorphisms, including TaqI, which yielded a 3.2-kilobase pair band and a
9.2-kilobase pair band, specific to C57BL/6J and M. spretus,
respectively. This restriction fragment length polymorphism was mapped
in TaqI-restricted genomic DNA isolated from progeny of a
backcross of the F1 hybrid described above and the C57BL/6J parental
strain as described under ``Materials and Methods.'' The
3.2-kilobase pair TaqI band exhibited linkage to three already
mapped polymorphic markers on chromosome 11 in the region
Figure 6:
Southern blot of genomic DNA isolated from
parental strains C57BL/6J and M. spretus and the F1 hybrid of
the parental cross. For each triplet of lanes (labeled A and B), DNA from C57BL/6J is in the firstlane, M. spretus DNA is in the secondlane, and
DNA from the F1 hybrid is in the thirdlane. DNAs in A and B lanes were cut with XbaI and EcoRI, respectively. Approximate sizes are given in kilobase
pairs on the right.
Figure 7:
Schematic of the arrangement of the LGALS5 gene and three nearby polymorphic markers. cM,
centimorgans.
Herein we report the cDNA sequence and deduced protein
sequence of galectin-5, the fifth protein to fulfill criteria for
membership in the mammalian galectin family. It shares all the
apparently critical amino acid residues known to be involved in
galactoside binding (Lobsanov et al., 1993; Liao et
al., 1994), and it has a demonstrated specificity for binding
Galectin-5 is found in erythrocytes, and its
mRNA is found in reticulocytes. Its cell-specific expression suggests
that it is related to a Galectin-5 resembles the other galectins in that it exhibits
characteristics of a cytoplasmic protein: its cDNA lacks an encoded
signal peptide, and the protein's N terminus is apparently
blocked with an acetyl group. However, this does not necessarily mean
that galectin-5 is always confined to the cytosol since galectin-1 and
-3, which share these properties, nevertheless are secreted by
nonclassical mechanisms under specific conditions (Cooper and Barondes,
1990; Lindstedt et al., 1993; Sato et al., 1993). Of the other galectins that have been sequenced, galectin-5 most
closely resembles galectin-4 (Fig. 3) (Oda et al.,
1993). This is especially true in the protein region defined by the
exon that contains the majority of the conserved residues (Gitt and
Barondes, 1991; Barondes et al., 1994b) and that is known to
interact directly with the carbohydrate ligand (Lobsanov et
al., 1993). In this region, galectin-5 and the second domain of
galectin-4 have 54% amino acid identity. In contrast, comparable
domains of galectin-1, -2, and -3 show 31, 37, and 48% identities,
respectively. Although galectin-5 is close in size to galectin-1 and
-2 (subunit M The gene encoding the mouse
homolog of galectin-5 has been mapped to chromosome 11
Volume 270,
Number 10,
Issue of March 10, 1995 pp. 5032-5038
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
-Galactoside-binding Lectin, Found in
Rat Erythrocytes (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-galactoside-binding lectin previously
purified from extracts of rat lung has been localized to erythrocytes,
and the cDNA encoding it has been isolated from a rat reticulocyte cDNA
library. The deduced amino acid sequence of the cDNA predicts a protein
with a M
of 16,199, with no evidence of a signal
peptide. The deduced sequence is identical to the sequences of seven
proteolytic peptides derived from the purified lectin. Peptide analysis
by mass spectrometry indicates that the N-terminal methionine is
cleaved and that serine 2 is acetylated. The lectin shares all the
strictly conserved amino acid residues of other members of the
mammalian galectin family and is designated galectin-5 (GenBank
accession number L36862). Galectin-5 is a weak agglutinin of rat
erythrocytes, despite its monomeric structure. The gene encoding
galectin-5 (LGALS5) has been mapped in mouse to chromosome 11,
50 centimorgans from the centromere and 1.8 ± 1.8
centimorgans from the polymorphic marker D11Mit34n, a region
syntenic with human chromosome 17q11.
-galactoside-containing glycoconjugates. Galectins are found in
many animal species, ranging from mammals to nematodes and sponges.
Mammalian galectins have been most extensively studied, and four
(galectin-1, -2, -3, and -4) have been well characterized based on
isolation of their cDNAs (reviewed by Barondes et al. (1994b)).-galactoside-binding lectin in extracts of rat lung. This putative
galectin had an apparent subunit molecular weight on SDS-polyacrylamide
gel electrophoresis of 18,000 and was called RL-18 (Cerra et
al., 1985). Like other galectins, it was purified by binding to a
-galactoside-derivatized affinity column and eluting with lactose.
Its carbohydrate binding properties resemble those of other galectins,
but some significant differences in its specificity were observed
(Leffler and Barondes, 1986). accession number L21711).
Since the library also contained transcripts derived from the rat
reticulocytes that the parasites had infected (van Belkum et
al., 1990), it seemed likely that the actual source of the
matching cDNA was the rat cells rather than the malaria cells. This
inference was confirmed by isolation of cDNAs with identical sequence
from a rat reticulocyte cDNA library. Here we report the structure of
the cDNA that encodes this rat lectin and its deduced amino acid
sequence. Since this protein shares certain absolutely conserved amino
acid residues with other galectins and fulfills the -galactoside
binding requirement, we designate it as galectin-5. We also determined
the chromosomal location of the mouse gene encoding the homolog of rat
galectin-5.
General
All materials, equipment, and
experimental conditions were the same as described by Gitt et
al.(1992) and Oda et al.(1993) unless stated otherwise.Purification of RL-18 and Digestion with Trypsin and
Clostripain
RL-18 was purified from rat lung extracts by
affinity chromatography followed by anion-exchange chromatography as
described by Cerra et al.(1985) and as modified by Leffler et al.(1989). About 600 µg of purified RL-18 was denatured
and alkylated with vinylpyridine (Friedman et al., 1970) or
iodoacetamide. The alkylated protein was digested with either trypsin
or clostripain (Sigma) in 200 µl of 100 mM ammonium
bicarbonate (pH 8.2) at 37 °C for 6 h (50:1 (w/w)
substrate/enzyme). The clostripain was preactivated for 2 h in the same
buffer containing 2.5 mM dithiothreitol and 1 mM CaCl
. Peptides were isolated by reverse-phase HPLC. (
)Mass Spectrometry
The molecular
weights of peptides were determined by liquid secondary ion mass
spectrometry (Falick and Maltby, 1989). The peptide sequence was
analyzed by high energy collision-induced dissociation as described
(Walls et al., 1990; Medzihradszky et al., 1992).
Spectra were interpreted as described (Biemann, 1988; Medzihradszky et al., 1992). To simplify the interpretation of mass spectra, 
O was incorporated at the C terminus of tryptic peptides
by including HO in the digestion buffer (Rose et al., 1988; Oda et al., 1993).Isolation of Galectin-5 from Rat
Erythrocytes
Erythrocytes were purified from 12 ml of freshly
drawn rat blood by centrifugation through Ficoll (Joshi et
al., 1993). The erythrocytes were washed with PBS (58 mM NaHPO
, 18 mM KHPO, 75 mM NaCl) and finally
mixed with 2 volumes of MEPBS (PBS with 4 mM 2-mercaptoethanol, 2 mM EDTA) containing 1.25% Triton
X-100 and 2 mM phenylmethanesulfonyl fluoride. After vigorous
shaking, the solution was centrifuged for 40 min at 17,000 
g, and the supernatant was applied to a 50-ml
lactosyl-Sepharose column (Leffler et al., 1989; Levi and
Teichberg, 1981) at a rate of 75 ml/h. After extensive washing with
MEPBS, the lectin was eluted with MEPBS plus 150 mM lactose.
Samples of 5-ml fractions were assayed for protein by the Bio-Rad
protein assay.Gel Filtration, Gel Electrophoresis, and Western
Blotting
We used a Superdex 75 HR 10/30 HPLC gel filtration
column (Pharmacia Biotech Inc.) to determine the quaternary structure
of galectin-5 and to remove lactose from the lectin for
hemagglutination studies (see below). The lectin fractions eluted from
lactosyl-Sepharose were first concentrated to 1 mg/ml in a
Centriprep 10 apparatus (Amicon, Inc., Beverly, MA) and applied to the
gel filtration column under the same conditions and with the same
standards as reported by Gitt et al.(1992). Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis, silver staining, and
Western blotting were done on a PHAST system (Pharmacia Biotech Inc.)
according to the manufacturer's instructions. The Western blot
was probed with anti-RL-18 antiserum prepared by Cerra et al. (1985) diluted 1:200 in PBS containing 3% bovine serum albumin,
0.5% Tween 20, 0.1% NaN
. Bound antibody was detected with
biotinylated goat anti-rabbit antibody and avidin-conjugated peroxidase
(Vectastain, Vector Laboratories, Inc., Burlingame, CA) using
4-chloronaphthol as the substrate.Rat Erythrocyte Agglutination by Galectins
Fresh
rat blood was collected after decapitation into a 30-fold excess volume
of 150 mM NaCl, 30 mM sodium citrate, 5 mM EDTA (pH 7.4). The erythrocytes were harvested by centrifugation
at 400 g, washed once in PBS, and resuspended in PBS
to a final concentration of 5% (v/v). Galectin-5 was purified from rat
erythrocytes, chromatographed on a gel filtration column to remove
lactose, and concentrated as described above. Recombinant rat
galectin-1 was prepared as described by Cooper et al.(1991)
and alkylated with iodoacetamide to maintain activity (Leffler and
Barondes, 1986). Recombinant human galectin-3 was prepared as described
by Massa et al.(1993), and lactose was removed as described
above. Carbohydrate-binding activity of the lectins after purification
and storage was confirmed by lactose-specific elution from
asialofetuin-conjugated silica (made from tresyl-activated silica
(Pierce) according to the manufacturer's instructions) in an HPLC
system. For agglutination, 20 µl of lectin solution and an equal
volume of 5% rat erythrocyte suspension were mixed in a V-shaped
microtiter well and incubated for 1 h at room temperature.
Agglutination was scored by observation of sedimentation pattern of the
erythrocytes according to standard criteria (Harrison et al.,
1984) and confirmed by microscopy.Screening of cDNA Library from Plasmodium
berghei-infected Reticulocytes
A cDNA library in the expression
vector 
gt11 was prepared from P. berghei (ANKA HP8417
strain)-infected rat reticulocytes as described (van Belkum et
al., 1990). The library was screened with monoclonal antibodies
that recognize different proteins associated with the host erythrocyte
membrane of P. berghei-infected cells (Wiser et al.,
1988). A single recombinant, which was recognized by several different
antibodies individually, was detected and plaque-purified. The
recombinant clone was designated PbURF, and the insert DNA was
subcloned in pBluescript II KS
(Stratagene, La Jolla,
CA) in both orientations, generating clones Pb46 and Pb65. The insert
was further subcloned by digestion of the above clones with EcoRV and reclosure, forming clones Pb46RV and Pb65RV. The
above clones were sequenced with both vector- and gene-specific primers
using a modified Sanger technique (Gitt and Barondes, 1991).Isolation and Sequencing of Rat Reticulocyte
cDNA
A rat reticulocyte cDNA library was prepared in gt10
using phenylhydrazineinduced reticulocytes (van Belkum et al.,
1990). For PCR, primers L18A and L18B were synthesized based on the
sequence of the P. berghei isolate, with sequences as
indicated in Fig. 2. A 1-µl sample of the library or
dilutions thereof was mixed with 25 pmol of each primer (a gt10
vector-specific primer, CTTTTGAGCAAGTTCAGCCTGG, and either L18A or
L18B) and other solution constituents and boiled for 10 min before
commencing PCR. We used the buffer provided by Perkin-Elmer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl, 0.001% (w/v) gelatin) and 250 µM deoxynucleotides. Conditions for PCR were five cycles of
denaturation for 40 s at 96 °C, annealing for 1 min at 60 °C,
and extension for 3 min at 72 °C, followed by 40 cycles of the same
parameters but with denaturation at 94 °C. Amplified fragments were
visualized on ethidium bromide-stained 1% agarose gels. Solutions
yielding one pure band were used to directly clone the fragment into
plasmid pCR1000 (Invitrogen, San Diego, CA) according to the
manufacturer's directions. Double-strand DNA of the resultant
clones was isolated and sequenced using both vector- and gene-specific
(L18F, L18G, L18H, and L18M) (see Fig. 2) primers using
Sequenase (U. S. Biochemical Corp.) as described previously (Gitt and
Barondes, 1991). Sequence was confirmed on both strands using both
reticulocyte isolates (Le1h and Le2b) and the initial clone (Pb46) and
subclones (Pb46RV and Pb65RV) as templates.
Chromosomal Mapping
We mapped the galectin-5 gene
in mouse by the method described by Wen et al.(1993). Briefly,
a galectin-5 cDNA probe was prepared by amplification of the Pb46
template with primers L18E and L18F under the same PCR conditions as
described above. The probe was labeled by random primer polymerization
(Feinberg and Vogelstein, 1984). Genomic DNA was isolated from two
different parental strains (C57BL/6J and Mus. spretus) and the
F1 hybrid of a cross between these strains and digested with a panel of
restriction enzymes. A Southern blot of these digested DNAs was
screened with the galectin-5 probe under high stringency conditions. A
restriction fragment length polymorphism was found for the enzyme TaqI, so this enzyme was used to digest genomic DNA from 55
progeny of a backcross of the F1 hybrid with the C57BL/6J parental
strain. A Southern blot of these digests was again probed with the
galectin-5 cDNA and scored for the presence of the two parental bands.
The pattern of band inheritance was compared with patterns obtained
from other markers.
-galactoside-binding lectin originally called RL-18 from rat lung
extracts by affinity chromatography followed by ion-exchange
chromatography. To characterize this lectin, we digested a sample with
either trypsin or clostripain, fractionated the peptides, and
determined their mass and amino acid sequences (Table 1).
for cDNAs encoding galectin-like
sequences and found one (GenBank accession number L21711)
that encoded peptides identical to those isolated from RL-18. This cDNA
had been isolated from an expression library constructed from
malaria-infected rat reticulocytes and probed with monoclonal
antibodies. Out of 12 monoclonal antibodies reacting with different
malarial proteins, 11 reacted weakly but specifically with clones
containing this cDNA. Since the antibodies are each directed against
different proteins, this indicated that the reaction between the
antibodies and a protein in the plaques was probably not a specific
antigen-antibody reaction and raised the possibility that the protein
in the plaques was reacting with a common feature of the monoclonal
antibodies. Since we now have shown that the recombinant protein is a
lectin, the binding of the recombinant protein to the antibodies is
assumed to have been by association of the lectin's
carbohydrate-binding site with complementary carbohydrate chains of the
immunoglobulins. submission because the original subcloning strategy had missed
the presence of a second EcoRV site 27 base pairs downstream
from the first EcoRV site. The complete sequence of the cDNA (Fig. 2) is now stored in GenBank (accession number
L36862).
-galactoside binding (Cerra et al., 1985; Leffler and
Barondes, 1986; this paper) and conservation of certain characteristic
amino acid residues), we designate it as galectin-5. As with the other
galectins, we found no evidence in the cDNA sequence for a signal
peptide.
of 18,000 based on comparison with commercial
molecular weight markers (Cerra et al., 1985). When compared
with other galectin carbohydrate-binding domains, we found that it had
a calculated M of 16,200 (Fig. 4). This
mobility is consistent with the calculated M of
16,108 for galectin-5 from its deduced amino acid sequence (assuming
cleavage of Met-1 and acetylation of Ser-2). Furthermore, the
galectin-5 band from rat erythrocytes reacted strongly with antiserum
that had been raised against RL-18 purified from rat lung (Fig. 4). The yield of galectin-5 was 0.6 mg/2 g of protein in
the initial extract applied to the affinity column.
of 17,000. It thus behaves as a monomer under the nondenaturing
conditions employed here, in contrast to the dimeric galectin-1 and -2
(Gitt et al., 1992). A schematic summarizing the domain and
subunit structures of the known members of the galectin family is shown
in Fig. 5.
50
centimorgans from the centromere ( Fig. 7and Table 2and Table 3). The closest marker appears to be D11Mit34n,
only 1.8 ± 1.8 centimorgans away from LGALS5.
Neighboring genes in this region of the chromosome include tipsy (a locomotion defect (Searle, 1961)), Edp1 (an
endothelial cell protein (Buckwalter et al., 1991)), Tcf2 (a T cell transcription factor (Karolyi et al., 1992)), Idd4 (insulin-dependent diabetes susceptibility (Todd et
al., 1991)), and Glut4 (an insulin-responsive glucose
transporter (Hogan et al., 1991)). LGALS5 also occurs
near a neurofibromatosis gene, Nf-1 (Seizinger, 1987), just as LGALS1 and LGALS2 occur near Nf-2 (Mehrabian et al., 1993).
-galactosides.-galactoside-binding lectin previously
observed in rabbit erythrocytes and at higher levels in erythroblasts
in bone marrow (Harrison and Chesterton, 1980; Harrison and Catt,
1986). The biochemical properties of the rabbit lectin (Harrison et
al., 1984) support this conclusion: the apparent molecular weight
of the rabbit lectin on SDS-polyacrylamide gel electrophoresis is
13,000; its isoform isoelectric points are 5.2-5.65 (compare with
5.1 for galectin-5 (Leffler et al., 1989)); and, like
galectin-5 (Cerra et al., 1985; this paper), it is monomeric.
The rabbit lectin agglutinated rabbit erythrocytes just as rat
galectin-5 agglutinated rat erythrocytes, although both lectins were
weaker agglutinins compared with the dimeric galectin-1 (Harrison et al., 1984; this paper). The rabbit lectin, originally
called erythroid developmental agglutinin, was found mainly in the
cytosol, but also at the cell surface (Harrison and Catt, 1986), and
was proposed to mediate cell-cell adhesion during erythropoiesis. In
view of that proposal, galectin-5 may well function primarily in
erythrocyte differentiation rather than in the mature red blood cell. = 14,840 and 14,650,
respectively) and, like them, has only one carbohydrate-binding site,
it behaves as a monomer on gel filtration under nondenaturing
conditions (Cerra et al., 1985; Leffler et al., 1989;
this paper), whereas galectin-1 and -2 are dimers under these same
conditions (Fig. 5) (Barondes et al., 1994b; Gitt et al., 1992). Despite its monomeric form and monovalency,
galectin-5 acts as a weak agglutinin of fresh rat erythrocytes. The
agglutination by galectin-5 may be through a mechanism similar to that
proposed for galectin-3, involving an induced aggregation of the lectin
at the ligand-coated surface (Hsu et al., 1992; Massa et
al., 1993), which requires at least some of the N-terminal domain
of galectin-3. Since galectin-5 contains very little sequence in
addition to its carbohydrate-binding domain and therefore lacks a
domain homologous to this galectin-3 region, the galectin-5-induced
agglutination probably occurs by protein-protein interactions different
from those employed by galectin-3.50
centimorgans from the centromere, a region syntenic with human
chromosome 17q11, suggesting that the human homolog of the galectin-5
gene (LGALS5) may be found in this region as well. Hence, LGALS5 is probably not linked to any of the other already
mapped galectin genes, LGALS1 and LGALS2 on human
chromosome 22 (Mehrabian et al., 1993) and LGALS3 on
chromosome 1 (Raz et al., 1991).
)
We thank Chris Turck for help with preliminary
experiments. Drs. A. van Belkum and L. J. van Doorn are gratefully
acknowledged for providing the gt11 cDNA library prepared from P. berghei mRNA and the gt10 cDNA library prepared from
rat reticulocytes.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Yamamoto, N. Nishi, H. Shoji, A. Itoh, L.-H. Lu, M. Hirashima, and T. Nakamura Induction of Cell Adhesion by Galectin-8 and its Target Molecules in Jurkat T-Cells J. Biochem., March 1, 2008; 143(3): 311 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nagae, N. Nishi, T. Murata, T. Usui, T. Nakamura, S. Wakatsuki, and R. Kato Crystal Structure of the Galectin-9 N-terminal Carbohydrate Recognition Domain from Mus musculus Reveals the Basic Mechanism of Carbohydrate Recognition J. Biol. Chem., November 24, 2006; 281(47): 35884 - 35893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Wu, T. Singh, J. H. Wu, M. Lensch, S. Andre, and H.-J. Gabius Interaction profile of galectin-5 with free saccharides and mammalian glycoproteins: probing its fine specificity and the effect of naturally clustered ligand presentation Glycobiology, June 1, 2006; 16(6): 524 - 537. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Nio, Y. Kon, and T. Iwanaga Differential Cellular Expression of Galectin Family mRNAs in the Epithelial Cells of the Mouse Digestive Tract J. Histochem. Cytochem., November 1, 2005; 53(11): 1323 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Maeda, N. Kawada, S. Seki, T. Arakawa, K. Ikeda, H. Iwao, H. Okuyama, J. Hirabayashi, K.-i. Kasai, and K. Yoshizato Stimulation of Proliferation of Rat Hepatic Stellate Cells by Galectin-1 and Galectin-3 through Different Intracellular Signaling Pathways J. Biol. Chem., May 23, 2003; 278(21): 18938 - 18944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ahmed, M. A. Bianchet, L. M. Amzel, J. Hirabayashi, K.-i. Kasai, Y. Giga-Hama, H. Tohda, and G. R. Vasta Novel carbohydrate specificity of the 16-kDa galectin from Caenorhabditis elegans: binding to blood group precursor oligosaccharides (type 1, type 2, T{alpha}, and T{beta}) and gangliosides Glycobiology, August 1, 2002; 12(8): 451 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Leal-Pinto, B. E. Cohen, M. S. Lipkowitz, and R. G. Abramson Functional analysis and molecular model of the human urate transporter/channel, hUAT Am J Physiol Renal Physiol, July 1, 2002; 283(1): F150 - F163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. E. Pace, T. Lebestky, T. Hummel, P. Arnoux, K. Kwan, and L. G. Baum Characterization of a Novel Drosophila melanogaster Galectin. EXPRESSION IN DEVELOPING IMMUNE, NEURAL, AND MUSCLE TISSUES J. Biol. Chem., April 5, 2002; 277(15): 13091 - 13098. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shoji, N. Nishi, M. Hirashima, and T. Nakamura Purification and cDNA cloning of Xenopus liver galectins and their expression Glycobiology, March 1, 2002; 12(3): 163 - 172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sato, N. Nishi, H. Shoji, M. Seki, T. Hashidate, J. Hirabayashi, K.-i. Kasai, Y. Hata, S. Suzuki, M. Hirashima, et al. Functional analysis of the carbohydrate recognition domains and a linker peptide of galectin-9 as to eosinophil chemoattractant activity Glycobiology, March 1, 2002; 12(3): 191 - 197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Z. Rappoport, M. S. Lipkowitz, and R. G. Abramson Localization and topology of a urate transporter/channel, a galectin, in epithelium-derived cells Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1926 - C1939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. DAHAN, A. FUCHSHUBER, S. ADAMIS, M. SMAERS, S. KROISS, G. LOUTE, J.-P. COSYNS, F. HILDEBRANDT, C. VERELLEN-DUMOULIN, and Y. PIRSON Familial Juvenile Hyperuricemic Nephropathy and Autosomal Dominant Medullary Cystic Kidney Disease Type 2: Two Facets of the Same Disease? J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2348 - 2357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Solis, M. I.F. Lopez-Lucendo, S. Leon, J. Varela, and T. Diaz-Maurino Description of a monomeric prototype galectin from the lizard Podarcis hispanica Glycobiology, December 1, 2000; 10(12): 1325 - 1331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Matsushita, N. Nishi, M. Seki, R. Matsumoto, I. Kuwabara, F.-T. Liu, Y. Hata, T. Nakamura, and M. Hirashima Requirement of Divalent Galactoside-binding Activity of Ecalectin/Galectin-9 for Eosinophil Chemoattraction J. Biol. Chem., March 17, 2000; 275(12): 8355 - 8360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Wasano and Y. Hirakawa Two Domains of Rat Galectin-4 Bind to Distinct Structures of the Intercellular Borders of Colorectal Epithelia J. Histochem. Cytochem., January 1, 1999; 47(1): 75 - 82. [Abstract] [Full Text]
|
|
|
|
|
|
A. T. Ogden, I. Nunes, K. Ko, S. Wu, C. S. Hines, A.-F. Wang, R. S. Hegde, and R. A. Lang GRIFIN, a Novel Lens-specific Protein Related to the Galectin Family J. Biol. Chem., October 30, 1998; 273(44): 28889 - 28896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Matsumoto, H. Matsumoto, M. Seki, M. Hata, Y. Asano, S. Kanegasaki, R. L. Stevens, and M. Hirashima Human Ecalectin, a Variant of Human Galectin-9, Is a Novel Eosinophil Chemoattractant Produced by T Lymphocytes J. Biol. Chem., July 3, 1998; 273(27): 16976 - 16984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Rabinovich, M. M. Iglesias, N. M. Modesti, L. F. Castagna, C. Wolfenstein-Todel, C. M. Riera, and C. E. Sotomayor Activated Rat Macrophages Produce a Galectin-1-Like Protein That Induces Apoptosis of T Cells: Biochemical and Functional Characterization J. Immunol., May 15, 1998; 160(10): 4831 - 4840. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Gitt, C. Colnot, F. Poirier, K. J. Nani, S. H. Barondes, and H. Leffler Galectin-4 and Galectin-6 Are Two Closely Related Lectins Expressed in Mouse Gastrointestinal Tract J. Biol. Chem., January 30, 1998; 273(5): 2954 - 2960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Gitt, Y.-R. Xia, R. E. Atchison, A. J. Lusis, S. H. Barondes, and H. Leffler Sequence, Structure, and Chromosomal Mapping of the Mouse Lgals6 Gene, Encoding Galectin-6 J. Biol. Chem., January 30, 1998; 273(5): 2961 - 2970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Arata, J. Hirabayashi, and K.-i. Kasai Structure of the 32-kDa Galectin Gene of the Nematode Caenorhabditis elegans J. Biol. Chem., October 17, 1997; 272(42): 26669 - 26677. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Huflejt, E. T. Jordan, M. A. Gitt, S. H. Barondes, and H. Leffler Strikingly Different Localization of Galectin-3 and Galectin-4 in Human Colon Adenocarcinoma T84 Cells. GALECTIN-4 IS LOCALIZED AT SITES OF CELL ADHESION J. Biol. Chem., May 30, 1997; 272(22): 14294 - 14303. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Tureci, H. Schmitt, N. Fadle, M. Pfreundschuh, and U. Sahin Molecular Definition of a Novel Human Galectin Which Is Immunogenic in Patients with Hodgkin's Disease J. Biol. Chem., March 7, 1997; 272(10): 6416 - 6422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wada and Y. S. Kanwar Identification and Characterization of Galectin-9, a Novel beta -Galactoside-binding Mammalian Lectin J. Biol. Chem., February 28, 1997; 272(9): 6078 - 6086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Wasano and Y. Hirakawa Recombinant Galectin-1 Recognizes Mucin and Epithelial Cell Surface Glycocalyces of Gastrointestinal Tract J. Histochem. Cytochem., February 1, 1997; 45(2): 275 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N.W. Cooper, R. P. Boulianne, S. Charlton, E. M. Farrell, A. Sucher, and B. C. Lu Fungal Galectins, Sequence and Specificity of Two Isolectins from Coprinus cinereus J. Biol. Chem., January 17, 1997; 272(3): 1514 - 1521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Leal-Pinto, W. Tao, J. Rappaport, M. Richardson, B. A. Knorr, and R. G. Abramson Molecular Cloning and Functional Reconstitution of a Urate Transporter/Channel J. Biol. Chem., January 3, 1997; 272(1): 617 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ahmed, J. Pohl, N. E. Fink, F. Strobel, and G. R. Vasta The Primary Structure and Carbohydrate Specificity of a beta -Galactosyl-binding Lectin from Toad (Bufo arenarum Hensel) Ovary Reveal Closer Similarities to the Mammalian Galectin-1 than to the Galectin from the Clawed Frog Xenopus laevis J. Biol. Chem., December 20, 1996; 271(51): 33083 - 33094. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hirabayashi, T. Ubukata, and K.-i. Kasai Purification and Molecular Characterization of a Novel 16-kDa Galectin from the Nematode Caenorhabditis elegans J. Biol. Chem., February 2, 1996; 271(5): 2497 - 2505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mazurek, J. Conklin, J. C. Byrd, A. Raz, and R. S. Bresalier Phosphorylation of the beta -Galactoside-binding Protein Galectin-3 Modulates Binding to Its Ligands J. Biol. Chem., November 10, 2000; 275(46): 36311 - 36315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R.-Y. Yang, D. K. Hsu, L. Yu, J. Ni, and F.-T. Liu Cell Cycle Regulation by Galectin-12, a New Member of the Galectin Superfamily J. Biol. Chem., June 1, 2001; 276(23): 20252 - 20260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hotta, T. Funahashi, Y. Matsukawa, M. Takahashi, H. Nishizawa, K. Kishida, M. Matsuda, H. Kuriyama, S. Kihara, T. Nakamura, et al. Galectin-12, an Adipose-expressed Galectin-like Molecule Possessing Apoptosis-inducing Activity J. Biol. Chem., August 31, 2001; 276(36): 34089 - 34097. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |