Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gitt, M. A.
Right arrow Articles by Barondes, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gitt, M. A.
Right arrow Articles by Barondes, S. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 10, Issue of March 10, 1995 pp. 5032-5038
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Sequence and Mapping of Galectin-5, a -Galactoside-binding Lectin, Found in Rat Erythrocytes (*)

(Received for publication, October 21, 1994; and in revised form, December 22, 1994)

Michael A. Gitt (1) Mark F. Wiser (4) Hakon Leffler (1) (3) Joerg Herrmann (1)(§) Yu-Rong Xia (5) Stephen M. Massa (1)(¶) Douglas N. W. Cooper (1) (2) Aldons J. Lusis (5) Samuel H. Barondes (1)(**)

From the  (1)Center for Neurobiology and Psychiatry, Department of Psychiatry and the Departments of (2)Anatomy and (3)Pharmaceutical Chemistry, University of California, San Francisco, California 94143-0984, the (4)Department of Tropical Medicine and Parasitology, School of Public Health and Tropical Medicine, Tulane University Medical Center, New Orleans, Louisiana 70112-2824, and the (5)Department of Microbiology and Molecular Genetics, UCLA School of Medicine, Los Angeles, California 90024

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A monomeric rat beta-galactoside-binding lectin previously purified from extracts of rat lung has been localized to erythrocytes, and the cDNA encoding it has been isolated from a rat reticulocyte cDNA library. The deduced amino acid sequence of the cDNA predicts a protein with a M(r) of 16,199, with no evidence of a signal peptide. The deduced sequence is identical to the sequences of seven proteolytic peptides derived from the purified lectin. Peptide analysis by mass spectrometry indicates that the N-terminal methionine is cleaved and that serine 2 is acetylated. The lectin shares all the strictly conserved amino acid residues of other members of the mammalian galectin family and is designated galectin-5 (GenBank accession number L36862). Galectin-5 is a weak agglutinin of rat erythrocytes, despite its monomeric structure. The gene encoding galectin-5 (LGALS5) has been mapped in mouse to chromosome 11, 50 centimorgans from the centromere and 1.8 ± 1.8 centimorgans from the polymorphic marker D11Mit34n, a region syntenic with human chromosome 17q11.


INTRODUCTION

Galectins (Barondes et al., 1994a, 1994b) are a family of animal lectins formerly known as S-type or S-Lac lectins. Members of the galectin family are defined by two properties: shared characteristic amino acid sequences and affinity for beta-galactoside-containing glycoconjugates. Galectins are found in many animal species, ranging from mammals to nematodes and sponges. Mammalian galectins have been most extensively studied, and four (galectin-1, -2, -3, and -4) have been well characterized based on isolation of their cDNAs (reviewed by Barondes et al. (1994b)).

In previous studies, we identified yet another beta-galactoside-binding lectin in extracts of rat lung. This putative galectin had an apparent subunit molecular weight on SDS-polyacrylamide gel electrophoresis of 18,000 and was called RL-18 (Cerra et al., 1985). Like other galectins, it was purified by binding to a beta-galactoside-derivatized affinity column and eluting with lactose. Its carbohydrate binding properties resemble those of other galectins, but some significant differences in its specificity were observed (Leffler and Barondes, 1986).

In subsequent work (Leffler et al., 1989), we found RL-18 in other rat tissues, but when we perfused tissues to remove blood before homogenization, the lectin was no longer present in the extracts. This suggested that RL-18 was a component of blood. This is consistent with the observation by Whitney(1988) that rat erythrocytes contained a lectin that appeared to be RL-18.

To further characterize RL-18, we purified it from rat lung extracts, prepared peptide fragments, and determined their sequence. To our surprise, the peptide sequences matched the deduced amino acid sequence of an incomplete cDNA presumed to have been derived from malaria parasites (GenBank accession number L21711). Since the library also contained transcripts derived from the rat reticulocytes that the parasites had infected (van Belkum et al., 1990), it seemed likely that the actual source of the matching cDNA was the rat cells rather than the malaria cells. This inference was confirmed by isolation of cDNAs with identical sequence from a rat reticulocyte cDNA library. Here we report the structure of the cDNA that encodes this rat lectin and its deduced amino acid sequence. Since this protein shares certain absolutely conserved amino acid residues with other galectins and fulfills the beta-galactoside binding requirement, we designate it as galectin-5. We also determined the chromosomal location of the mouse gene encoding the homolog of rat galectin-5.


MATERIALS AND METHODS

General

All materials, equipment, and experimental conditions were the same as described by Gitt et al.(1992) and Oda et al.(1993) unless stated otherwise.

Purification of RL-18 and Digestion with Trypsin and Clostripain

RL-18 was purified from rat lung extracts by affinity chromatography followed by anion-exchange chromatography as described by Cerra et al.(1985) and as modified by Leffler et al.(1989). About 600 µg of purified RL-18 was denatured and alkylated with vinylpyridine (Friedman et al., 1970) or iodoacetamide. The alkylated protein was digested with either trypsin or clostripain (Sigma) in 200 µl of 100 mM ammonium bicarbonate (pH 8.2) at 37 °C for 6 h (50:1 (w/w) substrate/enzyme). The clostripain was preactivated for 2 h in the same buffer containing 2.5 mM dithiothreitol and 1 mM CaCl(2). Peptides were isolated by reverse-phase HPLC. (^1)

Mass Spectrometry

The molecular weights of peptides were determined by liquid secondary ion mass spectrometry (Falick and Maltby, 1989). The peptide sequence was analyzed by high energy collision-induced dissociation as described (Walls et al., 1990; Medzihradszky et al., 1992). Spectra were interpreted as described (Biemann, 1988; Medzihradszky et al., 1992). To simplify the interpretation of mass spectra, ^18O was incorporated at the C terminus of tryptic peptides by including H(2)^18O in the digestion buffer (Rose et al., 1988; Oda et al., 1993).

Isolation of Galectin-5 from Rat Erythrocytes

Erythrocytes were purified from 12 ml of freshly drawn rat blood by centrifugation through Ficoll (Joshi et al., 1993). The erythrocytes were washed with PBS (58 mM Na(2)HPO(4), 18 mM KH(2)PO(4), 75 mM NaCl) and finally mixed with 2 volumes of MEPBS (PBS with 4 mM 2-mercaptoethanol, 2 mM EDTA) containing 1.25% Triton X-100 and 2 mM phenylmethanesulfonyl fluoride. After vigorous shaking, the solution was centrifuged for 40 min at 17,000 times g, and the supernatant was applied to a 50-ml lactosyl-Sepharose column (Leffler et al., 1989; Levi and Teichberg, 1981) at a rate of 75 ml/h. After extensive washing with MEPBS, the lectin was eluted with MEPBS plus 150 mM lactose. Samples of 5-ml fractions were assayed for protein by the Bio-Rad protein assay.

Gel Filtration, Gel Electrophoresis, and Western Blotting

We used a Superdex 75 HR 10/30 HPLC gel filtration column (Pharmacia Biotech Inc.) to determine the quaternary structure of galectin-5 and to remove lactose from the lectin for hemagglutination studies (see below). The lectin fractions eluted from lactosyl-Sepharose were first concentrated to 1 mg/ml in a Centriprep 10 apparatus (Amicon, Inc., Beverly, MA) and applied to the gel filtration column under the same conditions and with the same standards as reported by Gitt et al.(1992). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis, silver staining, and Western blotting were done on a PHAST system (Pharmacia Biotech Inc.) according to the manufacturer's instructions. The Western blot was probed with anti-RL-18 antiserum prepared by Cerra et al. (1985) diluted 1:200 in PBS containing 3% bovine serum albumin, 0.5% Tween 20, 0.1% NaN(3). Bound antibody was detected with biotinylated goat anti-rabbit antibody and avidin-conjugated peroxidase (Vectastain, Vector Laboratories, Inc., Burlingame, CA) using 4-chloronaphthol as the substrate.

Rat Erythrocyte Agglutination by Galectins

Fresh rat blood was collected after decapitation into a 30-fold excess volume of 150 mM NaCl, 30 mM sodium citrate, 5 mM EDTA (pH 7.4). The erythrocytes were harvested by centrifugation at 400 times g, washed once in PBS, and resuspended in PBS to a final concentration of 5% (v/v). Galectin-5 was purified from rat erythrocytes, chromatographed on a gel filtration column to remove lactose, and concentrated as described above. Recombinant rat galectin-1 was prepared as described by Cooper et al.(1991) and alkylated with iodoacetamide to maintain activity (Leffler and Barondes, 1986). Recombinant human galectin-3 was prepared as described by Massa et al.(1993), and lactose was removed as described above. Carbohydrate-binding activity of the lectins after purification and storage was confirmed by lactose-specific elution from asialofetuin-conjugated silica (made from tresyl-activated silica (Pierce) according to the manufacturer's instructions) in an HPLC system. For agglutination, 20 µl of lectin solution and an equal volume of 5% rat erythrocyte suspension were mixed in a V-shaped microtiter well and incubated for 1 h at room temperature. Agglutination was scored by observation of sedimentation pattern of the erythrocytes according to standard criteria (Harrison et al., 1984) and confirmed by microscopy.

Screening of cDNA Library from Plasmodium berghei-infected Reticulocytes

A cDNA library in the expression vector gt11 was prepared from P. berghei (ANKA HP8417 strain)-infected rat reticulocytes as described (van Belkum et al., 1990). The library was screened with monoclonal antibodies that recognize different proteins associated with the host erythrocyte membrane of P. berghei-infected cells (Wiser et al., 1988). A single recombinant, which was recognized by several different antibodies individually, was detected and plaque-purified. The recombinant clone was designated PbURF, and the insert DNA was subcloned in pBluescript II KS (Stratagene, La Jolla, CA) in both orientations, generating clones Pb46 and Pb65. The insert was further subcloned by digestion of the above clones with EcoRV and reclosure, forming clones Pb46RV and Pb65RV. The above clones were sequenced with both vector- and gene-specific primers using a modified Sanger technique (Gitt and Barondes, 1991).

Isolation and Sequencing of Rat Reticulocyte cDNA

A rat reticulocyte cDNA library was prepared in gt10 using phenylhydrazineinduced reticulocytes (van Belkum et al., 1990). For PCR, primers L18A and L18B were synthesized based on the sequence of the P. berghei isolate, with sequences as indicated in Fig. 2. A 1-µl sample of the library or dilutions thereof was mixed with 25 pmol of each primer (a gt10 vector-specific primer, CTTTTGAGCAAGTTCAGCCTGG, and either L18A or L18B) and other solution constituents and boiled for 10 min before commencing PCR. We used the buffer provided by Perkin-Elmer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl(2), 0.001% (w/v) gelatin) and 250 µM deoxynucleotides. Conditions for PCR were five cycles of denaturation for 40 s at 96 °C, annealing for 1 min at 60 °C, and extension for 3 min at 72 °C, followed by 40 cycles of the same parameters but with denaturation at 94 °C. Amplified fragments were visualized on ethidium bromide-stained 1% agarose gels. Solutions yielding one pure band were used to directly clone the fragment into plasmid pCR1000 (Invitrogen, San Diego, CA) according to the manufacturer's directions. Double-strand DNA of the resultant clones was isolated and sequenced using both vector- and gene-specific (L18F, L18G, L18H, and L18M) (see Fig. 2) primers using Sequenase (U. S. Biochemical Corp.) as described previously (Gitt and Barondes, 1991). Sequence was confirmed on both strands using both reticulocyte isolates (Le1h and Le2b) and the initial clone (Pb46) and subclones (Pb46RV and Pb65RV) as templates.


Figure 2: Galectin-5 cDNA sequence. The open reading frame has the translated amino acid sequence above it. Arrows under the nucleotide sequence correspond to oligonucleotides, with forward and backwardarrows representing the sense and antisense directions, respectively. The putative polyadenylation signal at the 3`-end of the cDNA sequence is underlined. Numbers refer to the amino acid residue or nucleotide at the beginning of each line.



Chromosomal Mapping

We mapped the galectin-5 gene in mouse by the method described by Wen et al.(1993). Briefly, a galectin-5 cDNA probe was prepared by amplification of the Pb46 template with primers L18E and L18F under the same PCR conditions as described above. The probe was labeled by random primer polymerization (Feinberg and Vogelstein, 1984). Genomic DNA was isolated from two different parental strains (C57BL/6J and Mus. spretus) and the F1 hybrid of a cross between these strains and digested with a panel of restriction enzymes. A Southern blot of these digested DNAs was screened with the galectin-5 probe under high stringency conditions. A restriction fragment length polymorphism was found for the enzyme TaqI, so this enzyme was used to digest genomic DNA from 55 progeny of a backcross of the F1 hybrid with the C57BL/6J parental strain. A Southern blot of these digests was again probed with the galectin-5 cDNA and scored for the presence of the two parental bands. The pattern of band inheritance was compared with patterns obtained from other markers.


RESULTS

Cerra et al.(1985) reported the isolation of the beta-galactoside-binding lectin originally called RL-18 from rat lung extracts by affinity chromatography followed by ion-exchange chromatography. To characterize this lectin, we digested a sample with either trypsin or clostripain, fractionated the peptides, and determined their mass and amino acid sequences (Table 1).



We searched GenBank for cDNAs encoding galectin-like sequences and found one (GenBank accession number L21711) that encoded peptides identical to those isolated from RL-18. This cDNA had been isolated from an expression library constructed from malaria-infected rat reticulocytes and probed with monoclonal antibodies. Out of 12 monoclonal antibodies reacting with different malarial proteins, 11 reacted weakly but specifically with clones containing this cDNA. Since the antibodies are each directed against different proteins, this indicated that the reaction between the antibodies and a protein in the plaques was probably not a specific antigen-antibody reaction and raised the possibility that the protein in the plaques was reacting with a common feature of the monoclonal antibodies. Since we now have shown that the recombinant protein is a lectin, the binding of the recombinant protein to the antibodies is assumed to have been by association of the lectin's carbohydrate-binding site with complementary carbohydrate chains of the immunoglobulins.

Given the match of the RL-18 peptides with the cDNA clone, it seemed very likely that the cDNA had been derived from rat reticulocyte mRNA rather than malaria parasite mRNA. We verified this by amplifying two overlapping cDNA fragments (Le1h and Le2b) (Fig. 1) out of a rat reticulocyte library that spanned the entire sequence of the initial cDNA (Pb46). The sequences of the two reticulocyte isolates were identical to the relevant portions of the Pb46 cDNA. However, we discovered a small region in the 3`-portion of the coding region that was not reported in the original GenBank submission because the original subcloning strategy had missed the presence of a second EcoRV site 27 base pairs downstream from the first EcoRV site. The complete sequence of the cDNA (Fig. 2) is now stored in GenBank (accession number L36862).


Figure 1: Sequencing strategy. The galectin-5 cDNA is represented by a bar. The two EcoRV restriction sites used in subcloning are indicated. Sequences obtained from the P. berghei cDNA library isolate (Pb46) and two subclones (Pb46RV and Pb65RV) are presented as arrows under the appropriate clones. Similarly, sequences obtained from the two PCR-amplified clones from the rat reticulocyte cDNA library (Le1h and Le2b) are represented below. bp, base pairs.



The conclusion that the isolated cDNA contains the coding sequence for RL-18 was confirmed by comparing the deduced protein sequence (Fig. 2) with data about peptides derived from RL-18 (Table 1). The seven peptides whose sequences were determined match exactly with residues 29-92 and 123-145 deduced from the cDNAs, as numbered in Table 1. In addition, the mass of peptide 1 (Table 1) matches that for the expected N-terminal clostripain fragment, assuming that Met-1 has been cleaved and Ser-2 has been acetylated. These are common post-translational modifications of the N terminus of cytoplasmic proteins, including all galectins that have been analyzed. This strongly supports our identification of the putative initiator methionine as residue 1 and our conclusion that the cDNA contains the full-length coding sequence. Furthermore, the presence of a consensus polyadenylation signal (AATAAA) at nucleotide 821 (with the initiator codon as residue 1) suggests that this cDNA contains most of the 3`-untranslated region.

Compared with other galectin genes, galectin-5 cDNA has a long 3`-untranslated region (400 base pairs). Stretches of from 150 to over 350 base pairs of the sequence of this 3`-region are >50% identical to the 3`-tail regions of several other rodent and human cDNAs, including those encoding myeloperoxidase, microtubule-associated proteins, and a glucose transporter. Although the significance of these conserved sequences is unknown, there is evidence that 3`-tail regions play a role in the regulation of translation (Jackson and Standart, 1990).

The protein sequence deduced from the cDNAs has many similarities to those of other galectins (Fig. 3). In fact, this protein shares all the absolutely conserved residues found in other members of the galectin family (designated by asterisks in Fig. 3). Since the protein meets both criteria for membership in the galectin family (beta-galactoside binding (Cerra et al., 1985; Leffler and Barondes, 1986; this paper) and conservation of certain characteristic amino acid residues), we designate it as galectin-5. As with the other galectins, we found no evidence in the cDNA sequence for a signal peptide.


Figure 3: Sequence comparison of galectin-1-5. All the sequences are from rat (galectin-1, Clerch et al. (1988); galectin-3, Albrandt et al.(1987); galectin-4, Oda et al.(1993)), except galectin-2, which is human (Gitt et al., 1992). Only the C-terminal partial sequences of galectin-4 (residues 180-324) and galectin-3 (residues 114-262) are shown. Shaded residues are identical to the corresponding galectin-5 residue. Dashes represent gaps introduced to aid in alignment. The dashedunderline demarcates the exon that contains the majority of the conserved residues (Gitt and Barondes, 1991; Barondes et al., 1994b) that have been shown to be involved in saccharide binding (Lobsanov et al., 1993). Asterisks indicate residues that are conserved in all known galectin sequences (Barondes et al., 1994b). Residue numbers of the last residue on the line are given at the right.



The isolation of a cDNA encoding galectin-5 from a reticulocyte library suggested that this lectin is a constituent of erythroblasts and erythrocytes. To evaluate this further, we prepared rat erythrocytes by separating them from plasma and leucocytes and then applied an extract of the erythrocytes to a lactosyl-Sepharose column and eluted with lactose to obtain galactoside-binding proteins. The eluate from the affinity column showed one band when examined by SDS-polyacrylamide gel electrophoresis (Fig. 4). This band had a mobility identical to that of RL-18, which was previously assigned a M(r) of 18,000 based on comparison with commercial molecular weight markers (Cerra et al., 1985). When compared with other galectin carbohydrate-binding domains, we found that it had a calculated M(r) of 16,200 (Fig. 4). This mobility is consistent with the calculated M(r) of 16,108 for galectin-5 from its deduced amino acid sequence (assuming cleavage of Met-1 and acetylation of Ser-2). Furthermore, the galectin-5 band from rat erythrocytes reacted strongly with antiserum that had been raised against RL-18 purified from rat lung (Fig. 4). The yield of galectin-5 was 0.6 mg/2 g of protein in the initial extract applied to the affinity column.


Figure 4: Gel electrophoresis and Western blot of galectin-5 purified from rat lung and rat erythrocytes. Purified galactoside-binding lectins from either rat lung (lane1) or rat erythrocytes (lanes2 and 3) were analyzed on a 20% gel and visualized with silver staining (lanes 1 and 2) or by probing with anti-RL-18 after Western blotting (lane3). Molecular mass markers (indicated by arrows to the left) used were recombinant human galectin-3 (26.2 kDa) and its C-terminal collagenase fragment (16.0 kDa) (Massa et al., 1993) and recombinant domain I of rat galectin-4 (17.0 kDa) (Oda et al., 1993).



On gel filtration, galectin-5 eluted with an estimated M(r) of 17,000. It thus behaves as a monomer under the nondenaturing conditions employed here, in contrast to the dimeric galectin-1 and -2 (Gitt et al., 1992). A schematic summarizing the domain and subunit structures of the known members of the galectin family is shown in Fig. 5.


Figure 5: Schematic of domain and quaternary structures of galectin-1-5. Carbohydrate-binding domains are represented by black bars above and by sectors below. The repetitive domain of galectin-3 and homologous regions in galectin-4 and -5 are white, and the N-terminal domain of galectin-3 is striped.



To our surprise, despite its monomeric state, galectin-5 at a concentration of 300 µg/ml agglutinated rat erythrocytes. Partial agglutination was observed at 150 µg/ml, while no agglutination was observed at 30 µg/ml. The agglutination by 300 µg/ml galectin-5 was completely abolished in the presence of 30 mM lactose. In contrast, complete agglutination of rat erythrocytes by galectin-1 and -3 occurred at 100 µg/ml, and partial agglutination occurred at 10 µg/ml. Hence, galectin-5 acts as an agglutinin of rat erythrocytes, but is weaker than galectin-1 and -3 in this system.

To test whether the previous isolation of galectin-5 from lung (Cerra et al., 1985) was due to the presence of blood in the lung tissue, we analyzed galectins from lung that had been extensively perfused with saline to remove blood (data not shown). Only traces of galectin-5 were detected in the perfused lung, whereas galectin-1 and 3 were present as prominent components of lung tissue. Therefore, galectin-5 is present in lung as a component of blood.

To map the chromosomal location of the mouse homolog, we first analyzed a Southern blot of restricted genomic DNA isolated from two widely different inbred strains (C57BL/6J and M. spretus) and the F1 hybrid produced from a cross of these strains. The probe hybridized to only one band in both XbaI- and EcoRI-digested DNAs, supporting the existence of a unique gene encoding the mouse homolog (Fig. 6). Several restriction enzymes produced restriction fragment length polymorphisms, including TaqI, which yielded a 3.2-kilobase pair band and a 9.2-kilobase pair band, specific to C57BL/6J and M. spretus, respectively. This restriction fragment length polymorphism was mapped in TaqI-restricted genomic DNA isolated from progeny of a backcross of the F1 hybrid described above and the C57BL/6J parental strain as described under ``Materials and Methods.'' The 3.2-kilobase pair TaqI band exhibited linkage to three already mapped polymorphic markers on chromosome 11 in the region 50 centimorgans from the centromere ( Fig. 7and Table 2and Table 3). The closest marker appears to be D11Mit34n, only 1.8 ± 1.8 centimorgans away from LGALS5. Neighboring genes in this region of the chromosome include tipsy (a locomotion defect (Searle, 1961)), Edp1 (an endothelial cell protein (Buckwalter et al., 1991)), Tcf2 (a T cell transcription factor (Karolyi et al., 1992)), Idd4 (insulin-dependent diabetes susceptibility (Todd et al., 1991)), and Glut4 (an insulin-responsive glucose transporter (Hogan et al., 1991)). LGALS5 also occurs near a neurofibromatosis gene, Nf-1 (Seizinger, 1987), just as LGALS1 and LGALS2 occur near Nf-2 (Mehrabian et al., 1993).


Figure 6: Southern blot of genomic DNA isolated from parental strains C57BL/6J and M. spretus and the F1 hybrid of the parental cross. For each triplet of lanes (labeled A and B), DNA from C57BL/6J is in the firstlane, M. spretus DNA is in the secondlane, and DNA from the F1 hybrid is in the thirdlane. DNAs in A and B lanes were cut with XbaI and EcoRI, respectively. Approximate sizes are given in kilobase pairs on the right.




Figure 7: Schematic of the arrangement of the LGALS5 gene and three nearby polymorphic markers. cM, centimorgans.








DISCUSSION

Herein we report the cDNA sequence and deduced protein sequence of galectin-5, the fifth protein to fulfill criteria for membership in the mammalian galectin family. It shares all the apparently critical amino acid residues known to be involved in galactoside binding (Lobsanov et al., 1993; Liao et al., 1994), and it has a demonstrated specificity for binding beta-galactosides.

Galectin-5 is found in erythrocytes, and its mRNA is found in reticulocytes. Its cell-specific expression suggests that it is related to a beta-galactoside-binding lectin previously observed in rabbit erythrocytes and at higher levels in erythroblasts in bone marrow (Harrison and Chesterton, 1980; Harrison and Catt, 1986). The biochemical properties of the rabbit lectin (Harrison et al., 1984) support this conclusion: the apparent molecular weight of the rabbit lectin on SDS-polyacrylamide gel electrophoresis is 13,000; its isoform isoelectric points are 5.2-5.65 (compare with 5.1 for galectin-5 (Leffler et al., 1989)); and, like galectin-5 (Cerra et al., 1985; this paper), it is monomeric. The rabbit lectin agglutinated rabbit erythrocytes just as rat galectin-5 agglutinated rat erythrocytes, although both lectins were weaker agglutinins compared with the dimeric galectin-1 (Harrison et al., 1984; this paper). The rabbit lectin, originally called erythroid developmental agglutinin, was found mainly in the cytosol, but also at the cell surface (Harrison and Catt, 1986), and was proposed to mediate cell-cell adhesion during erythropoiesis. In view of that proposal, galectin-5 may well function primarily in erythrocyte differentiation rather than in the mature red blood cell.

Galectin-5 resembles the other galectins in that it exhibits characteristics of a cytoplasmic protein: its cDNA lacks an encoded signal peptide, and the protein's N terminus is apparently blocked with an acetyl group. However, this does not necessarily mean that galectin-5 is always confined to the cytosol since galectin-1 and -3, which share these properties, nevertheless are secreted by nonclassical mechanisms under specific conditions (Cooper and Barondes, 1990; Lindstedt et al., 1993; Sato et al., 1993).

Of the other galectins that have been sequenced, galectin-5 most closely resembles galectin-4 (Fig. 3) (Oda et al., 1993). This is especially true in the protein region defined by the exon that contains the majority of the conserved residues (Gitt and Barondes, 1991; Barondes et al., 1994b) and that is known to interact directly with the carbohydrate ligand (Lobsanov et al., 1993). In this region, galectin-5 and the second domain of galectin-4 have 54% amino acid identity. In contrast, comparable domains of galectin-1, -2, and -3 show 31, 37, and 48% identities, respectively.

Although galectin-5 is close in size to galectin-1 and -2 (subunit M(r) = 14,840 and 14,650, respectively) and, like them, has only one carbohydrate-binding site, it behaves as a monomer on gel filtration under nondenaturing conditions (Cerra et al., 1985; Leffler et al., 1989; this paper), whereas galectin-1 and -2 are dimers under these same conditions (Fig. 5) (Barondes et al., 1994b; Gitt et al., 1992). Despite its monomeric form and monovalency, galectin-5 acts as a weak agglutinin of fresh rat erythrocytes. The agglutination by galectin-5 may be through a mechanism similar to that proposed for galectin-3, involving an induced aggregation of the lectin at the ligand-coated surface (Hsu et al., 1992; Massa et al., 1993), which requires at least some of the N-terminal domain of galectin-3. Since galectin-5 contains very little sequence in addition to its carbohydrate-binding domain and therefore lacks a domain homologous to this galectin-3 region, the galectin-5-induced agglutination probably occurs by protein-protein interactions different from those employed by galectin-3.

The gene encoding the mouse homolog of galectin-5 has been mapped to chromosome 11 50 centimorgans from the centromere, a region syntenic with human chromosome 17q11, suggesting that the human homolog of the galectin-5 gene (LGALS5) may be found in this region as well. Hence, LGALS5 is probably not linked to any of the other already mapped galectin genes, LGALS1 and LGALS2 on human chromosome 22 (Mehrabian et al., 1993) and LGALS3 on chromosome 1 (Raz et al., 1991).


FOOTNOTES

*
This work was supported by grants from the Cigarette and Tobacco Surtax Fund of the State of California through the Tobacco-related Disease Research Program of the University of California (to H. L.), National Institutes of Health National Center for Research Resources Grant RRO1614 (to A. L. Burlingame, University of California-San Francisco Mass Spectrometry Facility), and National Institutes of Health Grants HL38627 (to S. H. B.) and AI31083 (to M. F. W.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Present address: Glycomed, 860 Atlantic Ave., Alameda, CA 94501.

Present address: Dept. of Neurology, VA Medical Center, 4150 Clement St., San Francisco, CA 941212.

**
To whom correspondence should be addressed: Center for Neurobiology and Psychiatry, Dept. of Psychiatry, University of California, 401 Parnassus Ave., San Francisco, CA 94143-0984. Tel.: 415-476-7066; Fax: 415-476-7320.

(^1)
The abbreviations used are: HPLC, high pressure liquid chromatography; PCR, polymerase chain reaction.


ACKNOWLEDGEMENTS

We thank Chris Turck for help with preliminary experiments. Drs. A. van Belkum and L. J. van Doorn are gratefully acknowledged for providing the gt11 cDNA library prepared from P. berghei mRNA and the gt10 cDNA library prepared from rat reticulocytes.


REFERENCES

  1. Albrandt, K., Orida, N. K., and Liu, F.-T. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 6859-6863 [Abstract/Free Full Text]
  2. Barondes, S. H., Castronovo, V., Cooper, D. N. W., Cummings, R. D., Drickamer, K., Feizi, T., Gitt, M. A., Hirabayashi, J., Hughes, C., Kasai, K., Leffler, H., Liu, F.-T., Lotan, R., Mercurio, A. M., Monsigny, M., Pillai, S., Poirier, F., Raz, A., Rigby, P., Rini, J. M., and Wang, J. L. (1994a) Cell 76, 597-598 [CrossRef][Medline] [Order article via Infotrieve]
  3. Barondes, S. H., Cooper, D. N. W., Gitt, M. A., and Leffler, H. (1994b) J. Biol. Chem. 269, 20807-20810 [Free Full Text]
  4. Biemann, K. (1988) Biomed. Environ. Mass Spectrom. 16, 99-111 [CrossRef][Medline] [Order article via Infotrieve]
  5. Buckwalter, M. S., Katz, R. W., and Camper, S. A. (1991) Genomics 10, 515-526 [CrossRef][Medline] [Order article via Infotrieve]
  6. Cerra, R. F., Gitt, M. A., and Barondes, S. H. (1985) J. Biol. Chem. 260, 10474-10477 [Abstract/Free Full Text]
  7. Clerch, L. B., Whitney, P., Hass, M., Brew, K., Miller, T., Werner, R., and Massaro, D. (1988) Biochemistry 27, 692-699 [CrossRef][Medline] [Order article via Infotrieve]
  8. Cooper, D. N. W., and Barondes, S. H. (1990) J. Cell Biol. 110, 1681-1691 [Abstract/Free Full Text]
  9. Cooper, D. N. W., Massa, S. M., and Barondes, S. H. (1991) J. Cell Biol. 115, 1437-1448 [Abstract/Free Full Text]
  10. Falick, A. M., and Maltby, D. A. (1989) Anal. Biochem. 182, 165-169 [CrossRef][Medline] [Order article via Infotrieve]
  11. Feinberg, A. P., and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267 [CrossRef][Medline] [Order article via Infotrieve]
  12. Friedman, M., Krull, L. H., and Cavins, J. F. (1970) J. Biol. Chem. 245, 3868-3871 [Abstract/Free Full Text]
  13. Gitt, M. A., and Barondes, S. H. (1991) Biochemistry 30, 82-89 [CrossRef][Medline] [Order article via Infotrieve]
  14. Gitt, M. A., Massa, S. M., Leffler, H., and Barondes, S. H. (1992) J. Biol. Chem. 267, 10601-10606 [Abstract/Free Full Text]
  15. Harrison, F. L., and Catt, J. W. (1986) J. Cell Sci. 84, 201-212 [Abstract]
  16. Harrison, F. L., and Chesterton, C. J. (1980) Nature 286, 502-504 [CrossRef][Medline] [Order article via Infotrieve]
  17. Harrison, F. L., Fitzgerald, J. E., and Catt, J. W. (1984) J. Cell Sci. 72, 147-162 [Abstract]
  18. Hogan, A., Heyner, S., Charron, M. J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Thorens, B., and Schultz, G. A. (1991) Development 113, 363-372 [Abstract]
  19. Hsu, D. K., Zuberi, R. I., and Liu, F.-T. (1992) J. Biol. Chem 267, 14167-14174 [Abstract/Free Full Text]
  20. Jackson, R. J., and Standart, N. (1990) Cell 62, 15-24 [CrossRef][Medline] [Order article via Infotrieve]
  21. Joshi, N., Usuku, K., and Hauser, S. L. (1993) Ann. Neurol. 34, 385-393 [CrossRef][Medline] [Order article via Infotrieve]
  22. Karolyi, I. J., Guenet, J.-L., Rey-Campos, J., and Camper, S. A. (1992) Mamm. Genome 3, 184-185 [CrossRef][Medline] [Order article via Infotrieve]
  23. Leffler, H., and Barondes, S. H. (1986) J. Biol. Chem. 261, 10119-10126 [Abstract/Free Full Text]
  24. Leffler, H., Masiarz, F. R., and Barondes, S. H. (1989) Biochemistry 28, 9222-9229 [CrossRef][Medline] [Order article via Infotrieve]
  25. Levi, G., and Teichberg, V. I. (1981) J. Biol. Chem. 256, 5735-5740 [Abstract/Free Full Text]
  26. Liao, D. I., Kapadia, G., Ahmed, H., Vasta, G. R., and Herzberg, O. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1428-1432 [Abstract/Free Full Text]
  27. Lindstedt, R., Apodaca, G., Barondes, S. H., Mostov, K., and Leffler, H. (1993) J. Biol. Chem. 268, 11750-11757 [Abstract/Free Full Text]
  28. Lobsanov, Y. D., Gitt, M. A., Leffler, H., Barondes, S. H., and Rini, J. M. (1993) J. Biol. Chem. 268, 27034-27038 [Abstract/Free Full Text]
  29. Massa, S. M., Cooper, D. N. W., Leffler, H., and Barondes, S. H. (1993) Biochemistry 32, 260-267 [CrossRef][Medline] [Order article via Infotrieve]
  30. Medzihradszky, K. F., Gibson, B. W., Kaur, S., Yu, Z., Medzihradszky, D., Burlingame, A. L., and Bass, N. M. (1992) Eur. J. Biochem. 203, 327-339 [Medline] [Order article via Infotrieve]
  31. Mehrabian, M., Gitt, M. A., Sparkes, R. S., Leffler, H., Barondes, S. H., and Lusis, A. J. (1993) Genomics 15, 418-420 [CrossRef][Medline] [Order article via Infotrieve]
  32. Oda, Y., Herrmann, J., Gitt, M. A., Turck, C. W., Burlingame, A. L., Barondes, S. H., and Leffler, H. (1993) J. Biol. Chem. 268, 5929-5939 [Abstract/Free Full Text]
  33. Raz, A., Carmi, P., Raz, T., Hogan, V., Mohamed, A., and Wolman, S. R. (1991) Cancer Res. 51, 2173-2178 [Abstract/Free Full Text]
  34. Rose, K., Savoy, L. A., Simona, M. G., Offord, R. E., and Wingfield, P. (1988) Biochem. J. 252, 191-198 [Medline] [Order article via Infotrieve]
  35. Sato, S., Burdett, I., and Hughes, R. C. (1993) Exp. Cell Res. 207, 8-18 [CrossRef][Medline] [Order article via Infotrieve]
  36. Searle, A. G. (1961) Genet. Res 2, 122-126
  37. Seizinger, B. R. (1987) Cell 49, 589-594 [CrossRef][Medline] [Order article via Infotrieve]
  38. Todd, J. A., Aitman, T. J., Cornall, R. J., Ghosh, S., Hall, J. R. S., Hearne, C. M., Knight, A. M., Love, J. M., McAleer, M. A., Prins, J.-B., Rodrigues, N., Lathrop, M., Pressey, A., DeLarato, N. H., Peterson, L. B., and Wicker, L. S. (1991) Nature 351, 542-547 [CrossRef][Medline] [Order article via Infotrieve]
  39. van Belkum, A., van Doorn, L. J., Waters, A., McCutchan, T., Janse, C., Mons, B., and Schellekens, H. (1990) UCLA Symp. Mol. Cell. Biol. New Ser. 130, 7-25
  40. Walls, F. C., Baldwin, M. A., Falick, A. M., Gibson, B. W., Kaur, S., Maltby, D. A., Gillece-Castro, B. L., Medzihradszky, K. F., Evans, S., and Burlingame, A. L. (1990) in Biological Mass Spectrometry (Burlingame, A. L., and McClosky, J. A., eds) pp. 197-216, Elsevier Science Publishers B. V., Amsterdam
  41. Wen, P. Z., Warden, C., Fletcher, B. S., Kujubu, D. A., Herschman, H. R., and Lusis, A. J. (1993) Genomics 15, 458-460 [CrossRef][Medline] [Order article via Infotrieve]
  42. Whitney, P. (1988) J. Cell Biol. 107, 639a (Abstr. 3625)
  43. Wiser, M. F., Leible, M. B., and Plitt, B. (1988) Mol. Biochem. Parasitol. 27, 11-22 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J BiochemHome page
H. Yamamoto, N. Nishi, H. Shoji, A. Itoh, L.-H. Lu, M. Hirashima, and T. Nakamura
Induction of Cell Adhesion by Galectin-8 and its Target Molecules in Jurkat T-Cells
J. Biochem., March 1, 2008; 143(3): 311 - 324.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Nagae, N. Nishi, T. Murata, T. Usui, T. Nakamura, S. Wakatsuki, and R. Kato
Crystal Structure of the Galectin-9 N-terminal Carbohydrate Recognition Domain from Mus musculus Reveals the Basic Mechanism of Carbohydrate Recognition
J. Biol. Chem., November 24, 2006; 281(47): 35884 - 35893.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. M. Wu, T. Singh, J. H. Wu, M. Lensch, S. Andre, and H.-J. Gabius
Interaction profile of galectin-5 with free saccharides and mammalian glycoproteins: probing its fine specificity and the effect of naturally clustered ligand presentation
Glycobiology, June 1, 2006; 16(6): 524 - 537.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
J. Nio, Y. Kon, and T. Iwanaga
Differential Cellular Expression of Galectin Family mRNAs in the Epithelial Cells of the Mouse Digestive Tract
J. Histochem. Cytochem., November 1, 2005; 53(11): 1323 - 1334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Maeda, N. Kawada, S. Seki, T. Arakawa, K. Ikeda, H. Iwao, H. Okuyama, J. Hirabayashi, K.-i. Kasai, and K. Yoshizato
Stimulation of Proliferation of Rat Hepatic Stellate Cells by Galectin-1 and Galectin-3 through Different Intracellular Signaling Pathways
J. Biol. Chem., May 23, 2003; 278(21): 18938 - 18944.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
H. Ahmed, M. A. Bianchet, L. M. Amzel, J. Hirabayashi, K.-i. Kasai, Y. Giga-Hama, H. Tohda, and G. R. Vasta
Novel carbohydrate specificity of the 16-kDa galectin from Caenorhabditis elegans: binding to blood group precursor oligosaccharides (type 1, type 2, T{alpha}, and T{beta}) and gangliosides
Glycobiology, August 1, 2002; 12(8): 451 - 461.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. Leal-Pinto, B. E. Cohen, M. S. Lipkowitz, and R. G. Abramson
Functional analysis and molecular model of the human urate transporter/channel, hUAT
Am J Physiol Renal Physiol, July 1, 2002; 283(1): F150 - F163.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Pace, T. Lebestky, T. Hummel, P. Arnoux, K. Kwan, and L. G. Baum
Characterization of a Novel Drosophila melanogaster Galectin. EXPRESSION IN DEVELOPING IMMUNE, NEURAL, AND MUSCLE TISSUES
J. Biol. Chem., April 5, 2002; 277(15): 13091 - 13098.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
H. Shoji, N. Nishi, M. Hirashima, and T. Nakamura
Purification and cDNA cloning of Xenopus liver galectins and their expression
Glycobiology, March 1, 2002; 12(3): 163 - 172.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M. Sato, N. Nishi, H. Shoji, M. Seki, T. Hashidate, J. Hirabayashi, K.-i. Kasai, Y. Hata, S. Suzuki, M. Hirashima, et al.
Functional analysis of the carbohydrate recognition domains and a linker peptide of galectin-9 as to eosinophil chemoattractant activity
Glycobiology, March 1, 2002; 12(3): 191 - 197.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Z. Rappoport, M. S. Lipkowitz, and R. G. Abramson
Localization and topology of a urate transporter/channel, a galectin, in epithelium-derived cells
Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1926 - C1939.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. DAHAN, A. FUCHSHUBER, S. ADAMIS, M. SMAERS, S. KROISS, G. LOUTE, J.-P. COSYNS, F. HILDEBRANDT, C. VERELLEN-DUMOULIN, and Y. PIRSON
Familial Juvenile Hyperuricemic Nephropathy and Autosomal Dominant Medullary Cystic Kidney Disease Type 2: Two Facets of the Same Disease?
J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2348 - 2357.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
D. Solis, M. I.F. Lopez-Lucendo, S. Leon, J. Varela, and T. Diaz-Maurino
Description of a monomeric prototype galectin from the lizard Podarcis hispanica
Glycobiology, December 1, 2000; 10(12): 1325 - 1331.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Matsushita, N. Nishi, M. Seki, R. Matsumoto, I. Kuwabara, F.-T. Liu, Y. Hata, T. Nakamura, and M. Hirashima
Requirement of Divalent Galactoside-binding Activity of Ecalectin/Galectin-9 for Eosinophil Chemoattraction
J. Biol. Chem., March 17, 2000; 275(12): 8355 - 8360.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
K. Wasano and Y. Hirakawa
Two Domains of Rat Galectin-4 Bind to Distinct Structures of the Intercellular Borders of Colorectal Epithelia
J. Histochem. Cytochem., January 1, 1999; 47(1): 75 - 82.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. T. Ogden, I. Nunes, K. Ko, S. Wu, C. S. Hines, A.-F. Wang, R. S. Hegde, and R. A. Lang
GRIFIN, a Novel Lens-specific Protein Related to the Galectin Family
J. Biol. Chem., October 30, 1998; 273(44): 28889 - 28896.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Matsumoto, H. Matsumoto, M. Seki, M. Hata, Y. Asano, S. Kanegasaki, R. L. Stevens, and M. Hirashima
Human Ecalectin, a Variant of Human Galectin-9, Is a Novel Eosinophil Chemoattractant Produced by T Lymphocytes
J. Biol. Chem., July 3, 1998; 273(27): 16976 - 16984.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. A. Rabinovich, M. M. Iglesias, N. M. Modesti, L. F. Castagna, C. Wolfenstein-Todel, C. M. Riera, and C. E. Sotomayor
Activated Rat Macrophages Produce a Galectin-1-Like Protein That Induces Apoptosis of T Cells: Biochemical and Functional Characterization
J. Immunol., May 15, 1998; 160(10): 4831 - 4840.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Gitt, C. Colnot, F. Poirier, K. J. Nani, S. H. Barondes, and H. Leffler
Galectin-4 and Galectin-6 Are Two Closely Related Lectins Expressed in Mouse Gastrointestinal Tract
J. Biol. Chem., January 30, 1998; 273(5): 2954 - 2960.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Gitt, Y.-R. Xia, R. E. Atchison, A. J. Lusis, S. H. Barondes, and H. Leffler
Sequence, Structure, and Chromosomal Mapping of the Mouse Lgals6 Gene, Encoding Galectin-6
J. Biol. Chem., January 30, 1998; 273(5): 2961 - 2970.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Arata, J. Hirabayashi, and K.-i. Kasai
Structure of the 32-kDa Galectin Gene of the Nematode Caenorhabditis elegans
J. Biol. Chem., October 17, 1997; 272(42): 26669 - 26677.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Huflejt, E. T. Jordan, M. A. Gitt, S. H. Barondes, and H. Leffler
Strikingly Different Localization of Galectin-3 and Galectin-4 in Human Colon Adenocarcinoma T84 Cells. GALECTIN-4 IS LOCALIZED AT SITES OF CELL ADHESION
J. Biol. Chem., May 30, 1997; 272(22): 14294 - 14303.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Tureci, H. Schmitt, N. Fadle, M. Pfreundschuh, and U. Sahin
Molecular Definition of a Novel Human Galectin Which Is Immunogenic in Patients with Hodgkin's Disease
J. Biol. Chem., March 7, 1997; 272(10): 6416 - 6422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wada and Y. S. Kanwar
Identification and Characterization of Galectin-9, a Novel beta -Galactoside-binding Mammalian Lectin
J. Biol. Chem., February 28, 1997; 272(9): 6078 - 6086.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
K. Wasano and Y. Hirakawa
Recombinant Galectin-1 Recognizes Mucin and Epithelial Cell Surface Glycocalyces of Gastrointestinal Tract
J. Histochem. Cytochem., February 1, 1997; 45(2): 275 - 284.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. N.W. Cooper, R. P. Boulianne, S. Charlton, E. M. Farrell, A. Sucher, and B. C. Lu
Fungal Galectins, Sequence and Specificity of Two Isolectins from Coprinus cinereus
J. Biol. Chem., January 17, 1997; 272(3): 1514 - 1521.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Leal-Pinto, W. Tao, J. Rappaport, M. Richardson, B. A. Knorr, and R. G. Abramson
Molecular Cloning and Functional Reconstitution of a Urate Transporter/Channel
J. Biol. Chem., January 3, 1997; 272(1): 617 - 625.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Ahmed, J. Pohl, N. E. Fink, F. Strobel, and G. R. Vasta
The Primary Structure and Carbohydrate Specificity of a beta -Galactosyl-binding Lectin from Toad (Bufo arenarum Hensel) Ovary Reveal Closer Similarities to the Mammalian Galectin-1 than to the Galectin from the Clawed Frog Xenopus laevis
J. Biol. Chem., December 20, 1996; 271(51): 33083 - 33094.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Hirabayashi, T. Ubukata, and K.-i. Kasai
Purification and Molecular Characterization of a Novel 16-kDa Galectin from the Nematode Caenorhabditis elegans
J. Biol. Chem., February 2, 1996; 271(5): 2497 - 2505.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Mazurek, J. Conklin, J. C. Byrd, A. Raz, and R. S. Bresalier
Phosphorylation of the beta -Galactoside-binding Protein Galectin-3 Modulates Binding to Its Ligands
J. Biol. Chem., November 10, 2000; 275(46): 36311 - 36315.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R.-Y. Yang, D. K. Hsu, L. Yu, J. Ni, and F.-T. Liu
Cell Cycle Regulation by Galectin-12, a New Member of the Galectin Superfamily
J. Biol. Chem., June 1, 2001; 276(23): 20252 - 20260.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Hotta, T. Funahashi, Y. Matsukawa, M. Takahashi, H. Nishizawa, K. Kishida, M. Matsuda, H. Kuriyama, S. Kihara, T. Nakamura, et al.
Galectin-12, an Adipose-expressed Galectin-like Molecule Possessing Apoptosis-inducing Activity
J. Biol. Chem., August 31, 2001; 276(36): 34089 - 34097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gitt, M. A.
Right arrow Articles by Barondes, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gitt, M. A.
Right arrow Articles by Barondes, S. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement