JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhandari, B.
Right arrow Articles by Abboud, H. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhandari, B.
Right arrow Articles by Abboud, H. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 10, Issue of March 10, 1995 pp. 5541-5548
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Nuclear Protein in Mesangial Cells That Binds to the Promoter Region of the Platelet-derived Growth Factor-A Chain Gene
INDUCTION BY PHORBOL ESTER (*)

(Received for publication, November 30, 1994)

Basant Bhandari (§) Ulrich O. Wenzel (¶) Fabio Marra Hanna E. Abboud

From the Department of Medicine, The University of Texas Health Science Center at San Antonio and Audie Murphy VA Hospital, San Antonio, Texas 78284-7882

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Mesangial cells predominantly express platelet-derived growth factor (PDGF)-A chain mRNA and release PDGF. Mesangial cell PDGF-A chain mRNA abundance is regulated by several agents including phorbol esters. We have recently demonstrated that induction of PDGF-A chain mRNA abundance in response to phorbol 12-myristate 13-acetate is primarily due to gene transcription. We have now analyzed the 5`-flanking region of the PDGF-A chain promoter to identify DNA binding protein(s) which have the potential to regulate PDGF-A chain gene transcription in human mesangial cells. DNase I footprint analysis of the 5`-flanking region of the PDGF-A chain promoter identifies a DNase I protected region at the location -82 to -102 corresponding to the sequence 5`-GGCCCGGAATCCGGGGGAGGC-3`. Therefore, nuclear extracts from human mesangial cells contain a protein, PDGF-A-BP-1, that binds to a DNA sequence (-82 to -102) in the promoter region of the PDGF-A chain gene. Gel mobility shift analysis using labeled oligomer corresponding to the binding site for PDGF-A-BP-1 indicates that PDGF-A-BP-1 is induced by phorbol ester in mesangial cells as well as fat-storing cells (>20 fold). Egr-1 protein does not bind to labeled PDGF-A-BP-1 oligomer and does not compete with the binding of PDGF-A-BP-1. In addition, SP-1 binding sequence does not compete with the binding sequence of the mesangial cell protein. PDGF-A-BP-1 appears to represent a novel protein which is induced by phorbol ester and thus has the potential for an important role in the transcriptional regulation of the PDGF-A chain gene in mesangial cells and other vascular pericytes.


INTRODUCTION

Platelet-derived growth factor (PDGF) (^1)is a glycoprotein composed of two subunits referred to as A and B chains that are encoded by two separate genes (reviewed in (1) ). The dimeric forms of PDGF, PDGF-AA, -AB, and -BB, have been shown to be biologically active and are involved in a receptor-mediated induction of several of the biological effects of PDGF including cellular proliferation, chemotaxis, and cell ruffling (reviewed in (1) ). PDGF has been implicated in the pathogenesis of diverse processes including glomerulonephritis, atherosclerosis, carcinogenesis, hypertension, wound healing, and tissue development (reviewed in Ref 1). PDGF-A chain is a growth regulator in several cell types(2, 3, 4) . PDGF-A chain mRNA is more abundantly expressed than PDGF-B chain mRNA in human mesangial cells(5) , vascular smooth muscle cells(6) , and undifferentiated F9 embryonal carcinoma stem cells(7) . Considerable interest has developed in recent years concerning the regulation of PDGF-A chain gene expression due to its potential role in growth and development as well as tissue morphogenesis and differentiation(4, 7, 8) .

Glomerular mesangial cells, vascular pericytes in the renal microvasculature, are useful model to study PDGF-A chain gene regulation. A number of agents including growth factors have been shown to regulate steady state levels of PDGF-A chain mRNA abundance and gene transcription in these and other cells(5, 9, 10, 11, 12, 13) . Phorbol 12-myristate 13-acetate (PMA) is a potent inducer (10-15-fold) of PDGF-A chain mRNA (5, 9) . The increase in PDGF-A chain mRNA levels in cells treated with PMA ranges from 5- to 15-fold compared to control untreated cells (5, 9, 14) . We have also reported that PMA induces PDGF-A chain gene transcription in human mesangial cells(14) . We have now utilized DNase I footprint analysis to identify region(s) in the 5`-flanking sequence of PDGF-A chain promoter that binds to nuclear proteins from human mesangial cells. We found a unique protein binding domain in the PDGF-A chain promoter region that is regulated by phorbol esters. We also show by gel mobility shift and competition analyses that the binding of the identified nuclear protein PDGF-A-BP-1 is specific and is induced by PMA. This nuclear protein is likely to regulate PDGF-A chain function in mesangial cells.


EXPERIMENTAL PROCEDURES

Materials

T(4) polynucleotide kinase, DNase I, calf intestine alkaline phosphatase, and DNA sequencing kit were from U. S. Biochemicals Corp. PMA was from Sigma. PDGF-BB homodimer was from Amgen. [gamma-P]ATP was from Amersham Corp. Egr-1 peptide and Egr-1 polyclonal antibodies from Santa Cruz Biotechnology, Inc. Consensus oligonucleotide SP-1 was from Promega.

PDGF-A Chain Promoter

The expression vector pACCAT-1 containing the PDGF-A chain promoter (kindly provided by Dr. T. Collins, Brigham and Women's Hospital, Boston, MA) was constructed as follows: HindIII linkers were ligated to a 1.16-kilobase MluI/MstII fragment of the PDGF-A chain gene promoter and inserted into the HindIII site of vector SP-65. A diagram for the PDGF-A chain promoter is shown in Fig. 1.


Figure 1: PDGF-A chain gene promoter.



Cell Cultures and Nuclear Extracts

Human mesangial cells were grown and maintained in Waymouth's medium supplemented with 15 mM HEPES, 0.6 unit/ml insulin, 2 mM glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, antibiotic/antifungal solution, and 17% fetal calf serum (complete medium) as described previously(5, 13) . Mesangial cells were made quiescent by incubation in serum-free insulin-free medium for 48 h before treatment with PMA (10M) for 3 h. Human fat-storing cells were isolated from sections of unused livers unsuitable for transplantation and cultured in 17% fetal calf serum as described(15) . Fat-storing cells were preincubated in serum-free, insulin-free medium for 48 h and stimulated with 10M PMA for 4 h. Nuclear extracts from human mesangial cells and liver fat-storing cells were prepared as described previously(16) . Rat vascular smooth muscle cells were established as described(17) . Cells are plated in minimum essential medium with 10% fetal bovine serum.

DNase I Footprinting Analysis

The 1.16-kilobase MluI/MstII fragment of the PDGF-A chain promoter with HindIII linkers inserted into vector SP-65 was digested with XhoI (Fig. 1) and 5`-end labeled with T4 polynucleotide kinase and [gamma-P]ATP as described previously(16) . The radiolabeled fragment was digested with HindIII and the resulting 380-bp XhoI/HindIII fragment (labeled probe) was isolated by 1% agarose gel electrophoresis. DNA binding reactions were performed in a 10-µl volume containing labeled probe (3 times 10^4) in a final concentration of 20 mM HEPES (pH 7.6), 0.1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 50 mM NaCl, 1 µg of poly(dI-dC), and 40 µg of nuclear extracts. Binding was performed by incubating reactions on ice for 30 min and then for 1 min at 25 °C. MgCl(2) and CaCl(2) (3 mM each) were added followed by the addition of DNase I and incubation for 1 min at 37 °C. Reactions were stopped by adding 30 µl of solution containing 150 mM NaCl, 0.7% SDS, 15 mM EDTA, and 30 µg of tRNA. Samples were extracted with phenol/chloroform followed by ethanol precipitation and dissolved in 10 µl of loading dye containing 95% formamide, 10 mM EDTA, and 0.2% each of bromphenol blue and xylene cyanol. Samples were loaded onto 8% polyacrylamide gel containing 8.3 M urea. Nucleotide sequences protected from DNase I digestion were deduced from Maxam-Gilbert ``G/A'' sequencing reactions(18) . In addition, we used sequencing reactions using M13 mp18 vector as a marker to locate precisely the boundaries of the nucleotide sequences protected from DNase I digestion(19) .

Preparation of Oligonucleotides

From the DNase I footprinting analysis, we deduced the location for binding of the mesangial cell nuclear protein which binds to -82 to -102 in the 5`-flanking region of the PDGF-A chain promoter. Complementary pairs of single-stranded deoxyoligonucleotides were synthesized and annealed (18) to form double-stranded 21-bp oligomers (specific oligomer): 5`-GGCCCGGAATCCGGGGGAGGC-3`; 3`-CCGGGCCTTAGGCCCCCTCCG-5`. In addition, complementary pairs of nonspecific single-stranded deoxyoligonucleotides were synthesized and annealed (18) to form double-stranded 15-bp oligomer (nonspecific oligomer): 5`-TAACCTCACCTGGCA-3`; 3`-ATTGGAGTGGACCGT-5`. In addition, we used a 22-bp oligomer which corresponds to one of the binding sites for SP-1 (Promega) with the following nucleotide sequence: 5`-ATTCGATCGGGGCGGGGCGAGC-3`; 3`-TAAGCTAGCCCCGCCCCGCTCG-5`. Double-stranded oligomers in which specific bases were mutated were also synthesized (Fig. 9A) and used in gel retardation assays.


Figure 9: Gel mobility shift analysis using deleted sequences from wild type PDGF-A-BP-1 binding site. A, wild type (wt) or deletion mutant (mut) sequences are boxed in the diagram. Complementary pairs of single-stranded deoxynucleotides were synthesized and annealed (18) to form double-stranded oligomers. B, gel mobility shift analysis using wild type -82/-102 (lanes 1 and 2), mut -82/-96 (lanes 3 and 4), mut -88/-102 (lanes 5 and 6), and mut -82/-88, -95/-102 (lanes 7 and 8) as a labeled probe. Experimental details are as for Fig. 3. Nuclear extracts were prepared from human mesangial cells which were not treated (lanes 1, 3, 5, and 7) or treated with PMA (lanes 2, 4, 6, and 8) for 3 h. C, competition experiments show that unlabeled wild type -82/-102 or mut -82/-96 oligomer compete for the PDGF-A-BP-1 binding site in gel mobility shift analysis. Experimental details are as in B. With labeled wild type -82/-102 oligomer (lanes 1-5) and with labeled mut -82/-96 oligomer (lanes 6-10). Lanes (except 1 and 6) contained nuclear extracts treated with PMA (lanes 3-5 and 8-10) or without PMA treatment (lanes 2 and 7). For competition: 100-fold unlabeled wild type -82/-102 oligomer (lane 4) or mut -82/-96 oligomer (lane 9), and 100-fold nonspecific oligomer (lanes 5 or 10) was used for competition analysis.




Figure 3: Induction of PDGF-A-BP-1 by phorbol ester in gel mobility shift analysis in human mesangial cells. Nuclear extracts were prepared from human mesangial cells made quiescent in serum-free medium for 2 days and the same cells treated with 10M PMA for 3 h. Nuclear extracts were incubated with 5`-end labeled specific oligomer probe (GGCCCGGAATCCGGGGGAGGC) for 30 min on ice and then analyzed on 6.7% polyacrylamide gel as described under ``Experimental Procedures.'' The protein-DNA complexes are labeled as A(1), A(2), and A(3). 5 µg of nuclear proteins were used in the gel mobility shift assays as follows: lane 1, labeled probe alone without nuclear extract; lane 2, nuclear extract from quiescent cells treated with PMA; lane 3, nuclear extract from cells maintained in serum-free medium.



Gel Mobility Shift Analysis

Double-stranded deoxyoligonucleotides (specific oligo -82 to -102) or SP-1 were labeled using T4 polynucleotide kinase and [gamma-P]ATP (18) . The binding reactions were performed in 10 µl containing labeled probe (10,000 cpm) in a final concentration of 20 mM HEPES (pH 7.6), 0.1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 50 mM NaCl, 0.2 µg of poly(dI-dC), and nuclear extracts. Binding reactions were initiated by adding labeled probe and incubation was performed for 30 min on ice. DNA-protein complexes were separated by electrophoresis on a 6% polyacrylamide gel in 40 mM Tris glycine buffer (pH 8.6). Gel was dried at 80 °C before autoradiography. For competition assays, unlabeled competitor DNA oligomers were preincubated with nuclear extracts for 20 min on ice before addition of labeled probe.

Reporter Plasmids

PDGF-A chain/CAT constructs containing PDGF-A chain promoter sequences from -120 to +8 (pACCATe36) and -82 to +8 (pACCATf11) in promoterless chloramphenicol acetyltransferase (CAT) plasmid pSPCAT3 (kindly provided by Dr. T. Collins, Birgham and Women's Hospital, Boston, MA) were constructed as described(20) .

Transient Transfection of Rat Vascular Smooth Muscle Cells

This procedure was performed by electroporation with a Bio-Rad Gene pulsar electroporator. Nearly confluent cells were treated with 0.05% trypsin and sedimented. Cells (10 times 10^6) were resuspended in 1 ml of minimal essential medium/fetal bovine serum. Electroporation was performed with 20 µg of pACCATe36 and pACCATf11 plasmids at 340 volts and a capacitance of 960 microfarad. Cells were then incubated on ice for 5 min and plated at approximately 80% confluence. Cells were cotransfected with 2 µg of SV40-beta-galactosidase fusion gene (pSV2-beta-gal) as an internal control for transfection efficiency(21, 22) . After 24 h of transfection, cells were made quiescent by incubation in serum-free medium for 24 h before treatment with PMA (10M) for 24 h. Cells were washed twice with phosphate-buffered saline. CAT activity was measured at 37 °C from the rate of conversion of [^14C]chloramphenicol to acetylated products as described previously(16) . beta-Galactosidase activity was measured spectrophotometrically at 410 nm at 37 °C as a production of o-nitrophenol from o-nitrophenyl-beta-D-galactopyranoside as described previously(16) .


RESULTS

Identification of a Region in the PDGF-A Chain Promoter as a Binding Site for Nuclear Protein

We have performed DNase I footprinting analysis to identify protein binding sequences in the promoter region of the PDGF-A chain gene. A diagram for PDGF-A chain promoter is shown in Fig. 1. A 1.16-kilobase MluI/MstII fragment of the 5`-flanking region of PDGF-A chain promoter was inserted into SP-65. This includes TATA box and sites for binding early growth response elements (Egr-1) and SP-1 in the GC-rich region of the PDGF-A chain promoter(23) . We have used a 380-bp DNA fragment (XhoI/HindIII, labeled at XhoI) of the PDGF-A chain promoter for the DNase I footprint analysis (Fig. 1). Nuclear extracts from human mesangial cells maintained in complete cultured medium protected from DNase I digestion a region in the 5`-flanking sequence of PDGF-A chain promoter (Fig. 2). These data suggest that human mesangial cells contain a nuclear protein that binds to a DNA sequence at the location -82 to -102 in the PDGF-A chain promoter region (Fig. 1). The protein will be referred to as PDGF-A-BP-1. The sequence that binds this protein is shown in Fig. 1.


Figure 2: Identification of a region in PDGF promoter as a binding site for nuclear protein. Nuclear extracts were prepared from human mesangial cells maintained in complete medium. DNase I footprint analysis was performed as described under ``Experimental Procedures.'' Boundaries of the protected region from the DNase I digestion are marked. Lanes with (+) or without(-) nuclear extracts are designated.



Identification of DNA-Protein Complexes and Induction of PDGF-A-BP-1 by Phorbol Ester

We performed gel mobility shift analysis to obtain further evidence for the presence of the putative PDGF-A-BP-1. Quiescent human mesangial cells were incubated with PMA for 3 h. Cells were harvested and nuclear extracts were prepared. Oligomer containing the nucleotide sequence for the binding site for PDGF-A-BP-1 was synthesized (Fig. 1), 5`-end labeled, and used for gel mobility shift analysis. Data in Fig. 3clearly demonstrate formation of DNA-protein complexes. Three DNA-protein complexes A(1), A(2), and A(3) are observed. Gel mobility shift analysis (Fig. 3, lane 2) demonstrates that incubation with phorbol ester induces PDGF-A-BP-1 by >20-fold (complex A(1)) compared to control untreated cells (Fig. 3, lane 3). The DNA-protein complex A(1) is more abundant than A(2) or A(3). The induction of the PDGF-A chain mRNA expression by phorbol ester has been demonstrated in other cell lines. We used nuclear extracts from human liver fat-storing cells that were kept quiescent in serum-free medium (Fig. 4, lane 2) or treated with 10M PMA for 4 h (Fig. 4, lane 3). Similar to human mesangial cells, gel mobility shift analysis demonstrates the formation of a PMA-inducible protein-DNA complex using nuclear extracts from human fat-storing liver cells.


Figure 4: Induction of PDGF-A-BP-1 by phorbol ester in gel mobility shift analysis in liver fat-storing cells. Nuclear extracts were prepared from liver fat-storing cells made quiescent in serum-free medium for 2 days and same cells treated with 10M PMA for 4 h. Nuclear extracts were incubated with 5`-end labeled specific oligomer probe for 30 min on ice and then analyzed on 6.7% polyacrylamide gel as described under ``Experimental Procedures.'' The protein-DNA complexes are labeled as A(1), A(2), and A(3). 5 µg of nuclear proteins were used in the gel mobility shift assays as follows: lane 1, labeled probe alone without nuclear extract; lane 2, nuclear extract from quiescent cells; lane 3, nuclear extract from cells maintained in serum-free medium and treated with PMA.



Competition Analysis

In order to ascertain the specificity of the observed DNA-protein complex A(1), we performed competition assays using gel mobility shift analysis. We used a nonspecific oligomer which has no sequence homology with the binding site for PDGF-A-BP-1. Nuclear extracts were prepared from cells made quiescent in serum-free media for 2 days and the same cells incubated with phorbol ester for 3 h. Data indicate that DNA-protein complex A(1) was specifically competed for when 100-fold molar excess of unlabeled probe was used (Fig. 5, lane 4). In addition, preincubation with a 100-fold molar excess of nonspecific oligomer did not compete for the binding site of PDGF-A-BP-1 (Fig. 5, lane 5).


Figure 5: Effect of specific and nonspecific competition on the PDGF-A-BP-1 in gel mobility shift analysis using nuclear extracts prepared from PMA-stimulated human mesangial cells. Experimental details are as for Fig. 3. Nuclear extracts were prepared from human mesangial cells which were treated with PMA for 3 h. Lane 1, labeled probe without nuclear extract; lanes 2-5 contained nuclear extracts with labeled probe as follows: lane 2, no poly(dI-dC); lane 3, no competitor; lane 4, 100-fold unlabeled specific oligomer; lane 5, 100-fold nonspecific oligomer.



PDGF-A-BP-1 Is Not a SP-1-or Egr-1-like Factor

We compared the consensus sequence for the binding site of PDGF-A-BP-1 with known transcription factors which contain abundant G and C nucleotides. There are several known transcription factors which have some sequence homology for the binding site for PDGF-A-BP-1 (Table 1) but none of them have perfect homology. SP-1 has a consensus binding sequence that has abundant GC nucleotides (Table 1) and has sequence homology with the 3`-end of the binding sequence for PDGF-A-BP-1. We used SP-1 oligomer to test whether the observed protein-DNA complex (A(1)) is due to SP-1. Our data for human mesangial cells (Fig. 6, lane 5), as well as for liver fat-storing cells (Fig. 4, lane 6) demonstrate that SP-1 did not compete specifically with PDGF-A-BP-1. To further confirm these findings, we labeled SP-1 oligomer and performed competition assays using unlabeled oligomer (-82 to -102) corresponding to the binding site for PDGF-A-BP-1 in gel mobility shift analysis. Our results show that unlabeled oligomer did not compete with SP-1 (Fig. 7, lane 5). In addition, DNA-protein complexes formed have different gel mobility when labeled SP-1 oligomer was used (Fig. 7). The consensus nucleotide sequence for the binding site of Egr-1 shares homology to the 5`-end of the sequence for the binding site for PDGF-A-BP-1 (Table 1). When Egr-1 peptide was incubated with labeled oligomer (-82 to -102), no DNA-protein complex formation was observed in the absence of nuclear extracts from PMA-stimulated cells (Fig. 8, lanes 3 and 4). In addition, preincubation of nuclear extracts with Egr-1 polyclonal antibody did not compete with PDGF-A-BP-1 (Fig. 8, lanes 5 and 6). These data demonstrate specificity of protein-DNA complex A(1) and shows that PDGF-A-BP-1 is neither a SP-1- nor Egr-1-like transcription factor.




Figure 6: Competition experiments demonstrating that unlabeled SP-1 oligomer does not compete for PDGF-A-BP-1 binding site in gel mobility shift analysis. Experimental details are as for Fig. 3. Lane 1, labeled probe without nuclear extract; lanes 2-5, contained nuclear extracts with labeled probe as follows: lane 2, no competitors; lane 3, 100-fold excess unlabeled specific oligomer; lane 4, 100-fold excess nonspecific oligomer; and lane 5, 100-fold excess SP-1 oligomer.




Figure 7: Competition studies using labeled SP-1 oligomer in gel mobility shift assays. Experimental details are as for Fig. 3except that labeled oligomer used in binding assays was SP-1 instead of oligomer corresponding to binding site for PDGF-A-BP-1. Lane 1, labeled SP-1 oligomer without nuclear extract; lanes 2-5 contained nuclear extracts and labeled SP-1 as follows: lane 2, no competitor; lane 3, 100-fold excess unlabeled SP-1 oligomer; lane 4, 100-fold excess nonspecific oligomer; lane 5; 100-fold excess unlabeled specific oligomer corresponding to binding site for PDGF-A-BP-1.




Figure 8: Effect of Egr-1 peptide and Egr-1 IgG on binding of labeled specific oligomer corresponding to the binding site for PDGF-A-BP-1 and nuclear extracts from human mesangial cells in gel mobility shift analysis. Experimental details are as for Fig. 3. Lanes 1, 3, and 4 are without nuclear extracts; lanes 2, 5, and 6, with nuclear extracts (5 µg). Egr-1 peptide, 1 µg (lanes 3, 4 and 7) was added without nuclear extracts. Egr-1 IgG was added to nuclear extracts and incubated for 90 min prior to addition of 5`-end labeled probe. Egr-1 IgG, 3 µg (lane 5) or 5 µg mg (lane 6).



Specificity of the PDGF-A-BP-1 Binding Sequences Using Deletion Analysis

In order to identify more specifically the bases within -82 to -102 required for the binding of the PDGF-A-BP-1, we synthesized double-stranded oligomers (Fig. 9A). Blocks of 6 bases were deleted from wild type 21-base pair oligomer at three different regions. Gel mobility shift analysis data (Fig. 9B) demonstrate the formation of DNA-protein complex when either labeled wild type -82/-102 (lanes 1 and 2) or mut -82/-96 oligomer was used for binding assays. When labeled mut -88/-102 (lanes 5 and 6) or mut -82/-88, -95/-102 oligomers were used in gel mobility shift assay, the formation of DNA-protein complexes were abolished (compared to lanes 1-4). Using competition analysis, the results (Fig. 9C) demonstrate that DNA-protein complex A(1) was specifically competed for when 100-fold molar excess of unlabeled probe (mut -82/-96) was used. On the other hand, preincubation with 100-fold molar excess of nonspecific oligomer did not compete for the binding site of PDGF-A-BP-1 (Fig. 9C). These data clearly indicate that the sequences -82 to -96 of the PDGF-A chain promoter are required for the binding of PDGF-A-BP-1.

Functional Analysis of PDGF-A-BP-1 Sequences in Response to PMA

In order to assess the potential function of PDGF-A-BP-1 sequences, we used pACCATe36 and pACCATf11 fusion genes. These constructs include nucleotides -120 to +8 and -82 to +8 of the PDGF-A chain promoter inserted upstream of the promoterless CAT gene(20) . The PDGF-A-BP-1 binding site present in pACCATe36 is deleted in the pACCATf11 construct. The promoter activity in response to PMA was measured in rat vascular smooth muscle cells, which were co-transfected with pSV2-beta-galactosidase to normalize for any variation in the transfection efficiency(21, 22) . Since human mesangial cells were difficult to transfect, we choose rat vascular smooth muscle cells to demonstrate the functional importance of PDGF-A-BP-1 sequences. The data from two separate experiments are shown in Fig. 10. The data clearly demonstrate a 2.4-fold increase in CAT activity in response to PMA when pACCATe36 containing PDGF-A-BP-1 sequences were used in the experiments. There was no difference in PMA-inducible CAT activity when the pACCATf11 construct was used in transfection studies.


Figure 10: Functional analysis of PDGF-A-BP-1 sequences in response to PMA. A, PDGF-A promoter/CAT constructs used in transient transfection assays. Location of the PDGF-A-BP-1 binding site is also shown. B, CAT activity in transiently transfected rat vascular smooth muscle cells. The figure depicts an autoradiograph of a thin layer chromatogram used to separate acetylated products from chloramphenicol. Cells were cotransfected with 2 µg of pSV2-beta-galactosidase and 20 µg of either pACCATe36 or pACCATf11 constructs. After 24 h of transfection, cells were incubated in serum-free media for 24 h followed by treatment with or without PMA (10M) for 24 h as indicated. CAT activity was measured as described under ``Experimental Procedures.'' C, relative CAT activity was estimated as follows. Areas on the thin layer chromatogram corresponding to acetylated products were cut from the thin layer chromatogram and radioactivity was measured. The CAT activity was normalized with beta-galactosidase activity for variation in transfection efficiency. Relative CAT activity was calculated by normalizing to pACCATe36 (without PMA treatment). The data shown are the average of two experiments.




DISCUSSION

The structure of the PDGF-A chain gene has been described in detail by several investigators(23, 24) . The expression of PDGF-A in mesangial and other cells has recently been demonstrated to be regulated by a number of agents including phorbol ester, epidermal growth factor, transforming growth factor alpha and beta, and thrombin(5, 9, 10, 11, 12, 13) . We have recently shown that PDGF-A chain gene transcription in human mesangial cells is induced by phorbol ester(14) . To understand the molecular mechanism(s) which regulate PDGF-A chain gene transcription, we analyzed the 5`-flanking sequence of the human PDGF-A chain promoter.

We have used DNase I footprinting and gel mobility shift analyses to identify protein(s) that bind to the 5`-flanking region of the PDGF-A chain promoter. Identification of potential regulatory elements will help understand PDGF-A chain gene regulation in mesangial and other cells that express abundant levels of PDGF-A chain mRNA. By DNase I footprint analysis, we deduced the boundaries of the nucleotide sequences protected from DNase I digestion which revealed a location at approximately -82 to -102 from transcription initiation site of the PDGF-A chain promoter. This suggests that nuclear extracts from human mesangial cells contain a nuclear protein (PDGF-A-BP-1) that binds to a DNA sequence (GGCCCGGAATCCGGGGGAGGC) in the 5`-flanking region of the PDGF-A chain promoter. It is noteworthy that by S1 nuclease analysis, S1 hypersensitive sites SHSI and SHSII have recently been identified in the 5`-flanking region of the PDGF-A chain promoter(25, 26) . The SHSI site is within the PDGF-A-BP-1 binding site, whereas the SHSII site is in the GC-rich region of the PDGF-A chain promoter(25, 26) . In addition, DNase I protection assays showed a protected region between -98 and -49 from the transcription start site and this region is implicated in the regulation of Wilms' tumor suppresser gene WTI(20) .

We have used gel mobility shift analyses to further confirm the results obtained by DNase I protection analysis (Fig. 2). Data reported in this article demonstrate that the binding site for PDGF-A-BP-1 in the 5`-flanking region of PDGF-A chain promoter is specific. A comparison of identified sequences for binding of PDGF-A-BP-1 to several known transcription factors shows no perfect homology (Table 1). The binding site (-82 to -102) for PDGF-A-BP-1 contains abundant G and C nucleotides similar to transcription factors that are rich in GC nucleotides. The transcription factors: Egr-1 (also called NGF-I-A, Krox, Tis 8, Zif 268) and Egr-2 and Egr-3 (27, 28, 29, 30, 31) have some homology at the 5`-end of the binding sequence for PDGF-A-BP-1 (Table 1). Egr-1 is encoded by an immediate early growth response gene and has been implicated in cell growth and differentiation(32) . Several other transcription factors HIV-EP-1 (33) , MBP-1(34) , and PRDII-BF-1 (35) exhibit some homology with binding sequences for PDGF-A-BP-1. MBP-1 has been implicated in cell proliferation events(34) . The other transcription factors which exhibit some homology to PDGF-A-BP-1 are: AGIE-BP-1(36) , H(1)TF(2)(37) , H(2)TF(1)(38, 39, 40) , KBF-1(41) , EBP-1(42) , and NF(K)B(39, 43) . In addition, SP-1 has homology at the 3`-end of the PDGF-A-BP-1 binding site sequence(44) . It is interesting to note that while several transcription factors (Table 1) appear to show remarkable sequence homology, they differ in their properties.

There are several binding sites for Egr-1 that are located in the GC-rich region of the 5`-flanking region of the PDGF-A chain promoter. However, Egr peptide does not form protein-DNA complexes when incubated with the labeled oligomer and preincubation of nuclear extracts with Egr-1 antibody does not interfere with binding of PDGF-A-BP-1 (Fig. 8). These data indicate that the putative factor is not Egr-1. In addition, there are a number of SP-1 binding sites located in the GC-rich region of PDGF-A chain promoter. Comparison of sequence homology for SP-1 binding site and that for PDGF-A-BP-1 reveal some homology at the 3`-end of the binding sequence for PDGF-A-BP-1. We therefore used SP-1 for competition analysis in gel mobility shift assays. By using labeled oligomer (-82 to -102) or SP-1 oligomer, we have shown that PDGF-A-BP-1 is not SP-1 (Fig. 6Fig. 7Fig. 8). This is due to the fact that the consensus sequence for SP-1 did not compete with the PDGF-A-BP-1 binding sequence ( Fig. 6and Fig. 7) and the PDGF-A-BP-1 binding sequence did not compete with SP-1 for binding (Fig. 7). Deletion of specific bases within the PDGF-A-BP-1 binding sequence demonstrates that sequences -82 to -96 of PDGF-A chain promoter are required for binding of the PDGF-A-BP-1 (Fig. 9). These data, together with functional analysis of PDGF-A-BP-1 sequences (Fig. 10), strongly suggest that PDGF-A-BP-1 is a novel nuclear protein.

In conclusion, we have identified by DNase I footprint analysis, a sequence (-82 to -102) in the 5`-flanking region of the PDGF-A chain promoter which is a site for binding of nuclear protein (PDGF-A-BP-1) in human mesangial cells. PMA caused severalfold induction of PDGF-A-BP-1 as demonstrated by gel mobility shift analysis. Based on gel mobility shift analysis with specific and nonspecific competitors, it appears that PDGF-A-BP-1 is a new nuclear protein and thus has the potential to play an important role in the regulation of PDGF-A chain gene transcription in mesangial cells and other vascular pericytes.


FOOTNOTES

*
This work was supported in part by the Veterans Administration Medical Research Service and National Institutes of Health Grant DK 43988. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Medicine/Division of Nephrology, The University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Dr., San Antonio, TX 78284-7882. Tel.: 210-567-4700; Fax: 210-567-4712.

Supported by the German Research Foundation.

(^1)
The abbreviations used are: PDGF, platelet-derived growth factor; PMA, phorbol 12-myristate 13-acetate; bp, base pair(s); CAT, chloramphenicol acetyltransferase; mut, mutant.


ACKNOWLEDGEMENTS

We thank Kathy Woodruff for her expert technical assistance and Sergio Garcia for assistance with cell culture.


REFERENCES

  1. Heldin, C. H. (1992) EMBO J. 11, 4251-4259 [Medline] [Order article via Infotrieve]
  2. Daynes, R. A., Dowell, T., and Ayaneo, R. Y. (1991) J. Exp. Med. 174, 1323-1333 [Abstract/Free Full Text]
  3. Yeb, H. J., Ruit, K. G., Wang, Y. X., Parks, W. C., Snider, W. D., and Deuel, T. F. (1991) Cell 64, 209-216 [CrossRef][Medline] [Order article via Infotrieve]
  4. Hutchins, J. B., and Jefferson, V. E. (1992) Dev. Brain Res. 67, 121-135 [Medline] [Order article via Infotrieve]
  5. Knauss, T. C., Jaffer, F. E., and Abboud, H. E. (1990) J. Biol. Chem. 265, 14457-14463 [Abstract/Free Full Text]
  6. Zwijsen, R. M. L., Japenga, S. C., Heijen, A. M. P., Van den Bos, R. C., and Koeman, J. H. (1992) Biochem. Biophys. Res. Commun. 186, 1410-1416 [CrossRef][Medline] [Order article via Infotrieve]
  7. Mercola, M., Wang, C., Kelly, J., Brownlee, C., Jackson-Grusby, L., Stiles, C., and Bowen-Pope, D. (1990) Dev. Biol. 138, 114-122 [CrossRef][Medline] [Order article via Infotrieve]
  8. Orr-Urtreger, A., Bedford, M. T., Do, M. S., Eisenbach, L., and Lonai, P. (1992) Development 115, 289-303 [Abstract]
  9. Silver, B. J., Jaffer, F. E., and Abboud, H. E. (1989) Proc. Natl. Acad. Sci. U. S. A. 85, 1056-1060
  10. Daniel, T. O., Gibbs, V. C., Milfay, D. F., Garovoy, M. R., and Williams, L. T. (1986) J. Biol. Chem. 261, 9579-9582 [Abstract/Free Full Text]
  11. Kavanaugh, W. M., Harsh, G. R., IV, Starksen, N. F., and Rocco, C. M., Williams, L. T. (1988) J. Biol. Chem. 263, 8470-8472 [Abstract/Free Full Text]
  12. Starksen, N. F., Harsh, G. R., IV, Gibbs, V. C., and Williams, L. T. (1987) J. Biol. Chem. 262, 14381-14384 [Abstract/Free Full Text]
  13. Shultz, P. J., Dicorleto, P. E., Silver, B. J., and Abboud, H. E. (1988) Am. J. Physiol. 255, F674-F684
  14. Bhandari, B., and Abboud, H. E. (1993) Mol. Cell. Endocrinol. 91, 185-191 [CrossRef][Medline] [Order article via Infotrieve]
  15. Marra, F., Valente, A. J., Pinzani, M., and Abboud, H. E. (1993) J. Clin. Invest. 92, 1674-1680
  16. Bhandari, B., Roesler, W. J., Delisio, K. D., Klemm, D. J., Ross, N. S., and Miller, R. E. (1991) J. Biol. Chem. 266, 7784-7792 [Abstract/Free Full Text]
  17. Hahn, A. W. A., Regenass, S., Resnik, T. J., Kern, R., and Buehler, F. R. (1993) J. Vasc. Res. 30, 192-201 [Medline] [Order article via Infotrieve]
  18. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  19. Bhandari, B., Beckwith, K. D., and Miller, R. E. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5789-5793 [Abstract/Free Full Text]
  20. Gashler, A. L., Bonthron, D. T., Madden, S. L., Rauscher, F. J., III, Collins, T., and Sukhatme, V. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10984-10988 [Abstract/Free Full Text]
  21. Edlund, T., Walker, M. D., Barr, P. J., and Rutter, W. J. (1985) Science 230, 912-916 [Abstract/Free Full Text]
  22. Hall, C. V., Jacob, P. E., Ringold, G. M., and Lee, F. (1983) J. Mol. Appl. Genet. 2, 101-109 [Medline] [Order article via Infotrieve]
  23. Bonthron, D. T., Morton, C. C., Orkin, S. H., and Collins, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1492-1496 [Abstract/Free Full Text]
  24. Takimoto, Y., Wang, Z. Y., Kobler, K., and Deuel, T. F. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1686-1690 [Abstract/Free Full Text]
  25. Wang, Z. Y., Lin, X. H., Nobyuoshi, M., Qui, Q. Q., and Deuel, T. F. (1992) J. Biol. Chem. 267, 13669-13674 [Abstract/Free Full Text]
  26. Wang, Z. Y., Lin, X. H., Qui, Q. Q., and Deuel, T. F. (1992) J. Biol. Chem. 267, 17022-17031 [Abstract/Free Full Text]
  27. Christy, B., and Nathans, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8737-8741 [Abstract/Free Full Text]
  28. Lemaire, P., Vesque, C., Schmitt, J., Stunnemberg, H., Frank, R., and Charnay, P. (1990) Mol. Cell. Biol. 10, 3456-3467 [Abstract/Free Full Text]
  29. Cao, X., Koshki, P. A., Gashler, A., McKieman, M., Morris, C. F., Gaffney, R., Hay, R. V., and Sukhatme, V. P. (1990) Mol. Cell. Biol. 10, 1931-1939 [Abstract/Free Full Text]
  30. Suva, L. J., Ernst, M., and Rodan, G. A. (1991) Mol. Cell. Biol. 11, 2503-2510 [Abstract/Free Full Text]
  31. Chavrier, P., Vesque, C., Galliot, B., Vigneron, M., Dolle, P., Duboule, D., and Charnay, P. (1990) EMBO J. 9, 1209-1218 [Medline] [Order article via Infotrieve]
  32. Sukhatme, V. P. (1990) J. Am. Soc. Nephrol. 1, 859-866 [Abstract]
  33. Maekawa, T., Sakura, H., Sudo, T., and Ishii, S. (1989) J. Biol. Chem. 264, 14591-14593 [Abstract/Free Full Text]
  34. Baldwin, A. S., LeClair, K. P., Singh, H., and Sharp, P. A. (1990) Mol. Cell. Biol. 10, 1406-1414 [Abstract/Free Full Text]
  35. Fan, C. M., and Maniatis, T. (1990) Genes & Dev. 4, 29-42
  36. Ron, D., Brasier, M. R., and Habener, J. F. (1991) Mol. Cell. Biol. 11, 2887-2895 [Abstract/Free Full Text]
  37. Gallinari, P., La Bella, F., and Heintz, N. (1989) Mol. Cell. Biol. 9, 1566-1575 [Abstract/Free Full Text]
  38. Rustgi, A. K., Van'T Veer, L. J., and Bernards, R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8707-8710 [Abstract/Free Full Text]
  39. Henseling, U., Schmidt, W., Scholer, H. R., Gruss, P., and Hatzopoulos, A. K. (1990) Mol. Cell. Biol. 10, 4100-4109 [Abstract/Free Full Text]
  40. Lenardo, M., Rustgi, A. K., Schievella, A. R., and Bernards, R. (1989) EMBO J. 8, 3351-3355 [Medline] [Order article via Infotrieve]
  41. Kieran, M., Blank, V., Logeat, F., Vandekerckhove, J., Lottspeich, F., LeBail, O., Urban, M. B., Kourilsky, P., Baeuerle, P. A., and Israel, A. (1990) Cell 62, 1007-1018 [CrossRef][Medline] [Order article via Infotrieve]
  42. Wu, F. K., Garcia, J. A., Harrich, D., and Graynor, R. B. (1988) EMBO J. 7, 2117-2129 [Medline] [Order article via Infotrieve]
  43. Shirakawa, F., Chedid, M., Suttles, J., Pollock, B. A., and Mizel, S.B. (1989) Mol. Cell. Biol. 9, 959-964 [Abstract/Free Full Text]
  44. Descheemaeker, K. A., Wyns, S., Nelles, L., Auwerx, J., Ny, T., and Collen, D. (1992) J. Biol. Chem. 267, 15086-15091 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Dent. Res.Home page
Y. Wittrant, B. S. Bhandari, H. Abboud, N. Benson, K. Woodruff, M. MacDougall, and S. Abboud-Werner
PDGF Up-regulates CSF-1 Gene Transcription in Ameloblast-like Cells
J. Dent. Res., January 1, 2008; 87(1): 33 - 38.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Worden, X. P. Yang, T. L. Lee, L. Bagain, N. T. Yeh, J. G. Cohen, C. Van Waes, and Z. Chen
Hepatocyte Growth Factor/Scatter Factor Differentially Regulates Expression of Proangiogenic Factors through Egr-1 in Head and Neck Squamous Cell Carcinoma
Cancer Res., August 15, 2005; 65(16): 7071 - 7080.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Gorin, J. M. Ricono, N.-H. Kim, B. Bhandari, G. G. Choudhury, and H. E. Abboud
Nox4 mediates angiotensin II-induced activation of Akt/protein kinase B in mesangial cells
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F219 - F229.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Y. GORIN, N.-H. KIM, D. FELIERS, B. BHANDARI, G. G. CHOUDHURY, and H. E. ABBOUD
Angiotensin II activates Akt/protein kinase B by an arachidonic acid/redox-dependent pathway and independent of phosphoinositide 3-kinase
FASEB J, September 1, 2001; 15(11): 1909 - 1920.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Tallquist, K. Weismann, M Hellstrom, and P Soriano
Early myotome specification regulates PDGFA expression and axial skeleton development
Development, January 12, 2000; 127(23): 5059 - 5070.
[Abstract] [PDF]


Home page
Physiol. Rev.Home page
C.-H. Heldin and B. Westermark
Mechanism of Action and In Vivo Role of Platelet-Derived Growth Factor
Physiol Rev, October 1, 1999; 79(4): 1283 - 1316.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Maul, H. Zhang, J. D. Reid IV, N. G. Pedigo, and D. M. Kaetzel
Identification of a Cell Type-specific Enhancer in the Distal 5'-Region of the Platelet-derived Growth Factor A-chain Gene
J. Biol. Chem., December 11, 1998; 273(50): 33239 - 33246.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. J. Delbridge and L. M. Khachigian
FGF-1–Induced Platelet-Derived Growth Factor-A Chain Gene Expression in Endothelial Cells Involves Transcriptional Activation by Early Growth Response Factor-1
Circ. Res., August 19, 1997; 81(2): 282 - 288.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Suzuki, B. C. O'Neill, Y. Suzuki, O. N. Denisenko, and K. Bomsztyk
Activation of a Nuclear DNA-binding Protein Recognized by a Transcriptional Element, bcn-1, from the Laminin B2 Chain Gene Promoter
J. Biol. Chem., August 2, 1996; 271(31): 18981 - 18988.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Khachigian, A. J. Williams, and T. Collins
Interplay of Sp1 and Egr-1 in the Proximal Platelet-derived Growth Factor A-Chain Promoter in Cultured Vascular Endothelial Cells
J. Biol. Chem., November 17, 1995; 270(46): 27679 - 27686.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhandari, B.
Right arrow Articles by Abboud, H. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhandari, B.
Right arrow Articles by Abboud, H. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.