| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, November 29, 1994; and in revised form, January 12, 1995) From the
Munc-18, also known as n-Sec1 or rbSec1, is a syntaxin-binding
protein thought to play a role in regulating synaptic vesicle
exocytosis. Although a gene family of syntaxins has been identified,
only a limited subset bind to Munc-18. This implicates the existence of
other mammalian Munc-18 homologues that may be involved in a range of
vesicle transport reactions. The purpose of the present study was to
identify other members of the Munc-18 family by cDNA cloning. Three
distinct Munc-18 isoforms, Munc-18a, previously identified in neuronal
tissue, and two novel isoforms, Munc-18b and Munc-18c, were isolated
from a 3T3-L1 adipocyte cDNA library by screening with a rat brain
Munc-18 DNA probe. Munc-18a is identical to Munc-18 and by Northern
analysis is expressed predominantly in brain and to a lesser extent in
testis and 3T3-L1 cells. Munc-18b is 62% identical to Munc-18 at the
amino acid level and is expressed in testis, intestine, kidney, rat
adipose tissue, and 3T3-L1 cells. Munc-18c is 51% identical to Munc-18
and is ubiquitously expressed. It is likely, based on these findings,
that unique Munc-18/syntaxin interactions may play an important role in
generating a combinatorial mechanism for the regulation of vesicle
transport in mammalian cells.
Identifying the molecular factors that regulate vesicle
transport and fusion in eukaryotic cells has been the subject of
intense investigation(1, 2) , particularly in the
mammalian synapse. Here it has been demonstrated that many of the
proteins that regulate synaptic vesicle exocytosis are similar to those
observed in other cell types, including yeast, thus enabling the
formulation of unifying models to explain all vesicle transport
reactions(3) . Recent biochemical studies have identified a
number of multiprotein intermediates (SNARES) ( Another family of proteins
believed to participate in this complex show homology to Sec1p. The
Sec1p family of proteins includes Sly1(15) ,
Slp1/Vps33(16) , and Sec1(17, 18) , which act
at many different stages along the secretory pathway in yeast. Studies
in mammalian cells, however, have so far only identified one Sec1p
family member,
Munc-18/n-Sec1/rbSec1(19, 20, 21) , giving
rise to the question as to whether other Sec1p-like proteins exist in
mammalian cells. Munc-18 itself was identified as a mammalian
syntaxin-binding protein. Although there is no functional data
concerning the role of Munc-18 in vesicle transport, a highly related
protein from Caenorhabditis elegans unc-18, has been
identified and mutations in this gene product result in accumulation of
acetylcholine containing secretory vesicles as well as abnormalities in
the development of the C. elegans nervous
system(22, 23) . Thus, given the likelihood of
additional mammalian Sec1p-like proteins and their potentially
important role in membrane trafficking events, we have identified and
characterized further members of this gene family to more closely
understand the regulation of vesicle transport.
To examine the hypothesis that there is a large gene family
of mammalian Munc-18 isoforms, a 3T3-L1 adipocyte cDNA library was
screened with a 1.8-kb rat brain Munc-18 DNA fragment. Thirty-five
positive clones were isolated, and 30 were characterized by DNA
sequencing. Three distinct cDNA classes were identified, referred to
here as Munc-18a, Munc-18b, and Munc-18c. Munc-18a was identical to
Munc-18/n-Sec1/rbSec1 (19, 20, 21) as
determined by sequencing the 5` 340 nucleotides of a full-length clone
(M5A) and by restriction mapping. Three of the 30 characterized clones
were assigned to this group. Munc-18b was the most abundant isoform
isolated from the library (22 out of 30 clones), whereas the remaining
five clones fell into the third class, Munc-18c. Both Munc-18b and
Munc-18c represent novel Munc-18 isoforms. The inserts from two
separate Munc-18b clones (M1B and M3A) were completely sequenced on
both strands and were both found to be missing 5` ends, as was the case
for all the remaining clones in this class. The 5`-coding region was
obtained using a 5` rapid amplification of cDNA ends procedure (see
``Experimental Procedures''). A 270-bp DNA fragment was
amplified by this technique and then subcloned into Bluescript,
sequenced, and found to contain a start codon with a consensus Kozak
sequence (27) followed by 18 bp of novel sequence and 200 bp
that were identical to that of the 5` end of M1B. The entire open
reading frame of Munc-18b is 1,779 bp encoding a protein of 593 amino
acids with a predicted M
Figure 1:
Complete nucleotide
sequence of 3T3-L1 Munc-18b cDNA and deduced amino acid sequence of the
protein. Capital letters indicate the coding sequence, whereas lowercase letters signify the 5`- and 3`-noncoding sequences.
Amino acid residues are denoted by the standard three-letter code below
the nucleotide sequence, and the sequences are numbered on the right.
Figure 2:
Complete nucleotide sequence of 3T3-L1
Munc-18c cDNA and deduced amino acid sequence of the protein. Capital letters indicate the coding sequence, whereas lowercase letters signify the 5`- and 3`-noncoding sequences.
Amino acid residues are denoted by the standard three-letter code below
the nucleotide sequence, and the sequences are numbered on the right.
The amino acid
sequences of the three Munc-18 3T3-L1 isoforms exhibit substantial
similarity along their entire length to the C. elegans gene
product, unc-18 (Fig. 3). Munc-18b and Munc-18c showed 62 and
51% amino acid identity, respectively, compared with
Munc-18/n-Sec1/rbSec1, referred to here as Munc-18a (Fig. 3, Table 1). We have adopted a similar nomenclature to Hata et
al. (19) to refer to these different isoforms rather than
that used by others(20, 21) , since all of the clones
isolated from mammalian cells showed a higher degree of amino acid
identity to the C. elegans gene product, unc-18, than to the
yeast homologue, Sec1p (Table 1). As shown in Table 1,
Munc-18a is most similar to the Drosophila homologue, Ropp
(65%) and C. elegans unc-18 (59%), whereas Munc-18b is
increasingly less similar to Ropp (54%) and unc-18 (53%) with Munc-18c
being the least identical to Ropp (44%) and unc-18 (43%). All three
adipocyte Munc-18 homologues displayed much lower identities
(17-27%) to Sec1p, Sly1p, and Slp1p (Table 1). The
predicted secondary structures of Munc-18a, Munc-18b, and Munc-18c were
all very similar (results not shown).
Figure 3:
Comparison of the deduced amino acid
sequences of Munc isoforms. Three different Munc-18 clones were
isolated from a 3T3-L1 adipocyte cDNA expression library. Munc-18a was
partially sequenced (see underlined region) and was found to
be identical to a rat brain isoform previously referred to as
Munc-18/nSec1/rbSec1(19, 20, 21) . Munc-18b
and Munc-18c are novel cDNAs. Also included in the alignment is a C. elegans gene product, unc-18 (GenBank accession number
S66176). Amino acids are shown in the single-letter code and numbered
on the right. Amino acids that are identical between all four
homologues are denoted by an asterisk, whereas conserved
substitutions are indicated with a dot. Gaps introduced to generate this alignment are represented by dashes. Sequences were aligned using the computer program
Clustal V.
The tissue distribution of
Munc-18a, Munc-18b, and Munc-18c was studied by Northern blot analysis
and was found to be unique for each isoform (Fig. 4A).
In agreement with previous studies (19, 20, 21) , Munc-18a had a transcript size
of 3.8 kb and was expressed predominantly in rat brain, but lower
levels were also detected in testis. Munc-18b was expressed at highest
levels in rat testis, and lower levels of expression were detected in
intestine, kidney, and epididymal fat pad. A major Munc-18b transcript
of 2.3 kb and a minor transcript of 3.2 kb were detected in each of
these tissues (Fig. 4A). The molecular basis and
significance of the two transcripts remains to be determined. Munc-18c
(transcript size: 3.0 kb) was expressed ubiquitously in liver, kidney,
intestine, testis, heart, skeletal muscle, brain, and epididymal fat. A
second Munc-18c transcript of 1.7 kb was also detected in rat testis.
Each of the Munc-18 isoforms was expressed in 3T3-L1 fibroblasts and
adipocytes, consistent with the fact that these clones were isolated
from a 3T3-L1 adipocyte cDNA library. The expression of Munc-18a
decreased following differentiation into adipocytes, whereas increased
mRNA levels of both Munc-18b and Munc-18c were observed in 3T3-L1
adipocytes compared with the undifferentiated fibroblasts (Fig. 4B).
Figure 4:
RNA blot analysis of 3T3-L1 Munc-18
isoform mRNAs in various rat tissues and 3T3-L1 fibroblasts and
adipocytes. Total RNA from eight different rat tissues and
poly(A)
In this study we have identified two novel Munc-18 isoforms
which exhibit broad and distinct tissue distributions and which are
highly homologous to the previously described neural isoform,
Munc-18/n-Sec1/rbSec1(19, 20, 21) . We have
referred to these gene products as: Munc-18a, which is the
neural-specific protein; Munc-18b, found in testis, kidney, intestine,
and adipose tissue; and the ubiquitously expressed Munc-18c. Previous
studies in a variety of organisms have ascribed an important role to
the Munc-18/Sec1p gene product in the regulation of vesicle transport.
In the mammalian synapse Munc-18a has been shown to bind to the
presynaptic membrane protein syntaxin (19, 20, 21) . Furthermore, a genetic
interaction between Sec1p and two syntaxin homologues, Sso1 and Sso2,
has been found in yeast(9) . In view of the putative role of
syntaxin in the formation of a vesicle docking complex, it has been
suggested that members of the Munc-18/Sec1p family may play a
proofreading function in vesicle docking/fusion reactions(20) . The SNARE hypothesis (3) proposes that the specificity of
different vesicle fusion reactions is determined by specific proteins
in both the donor and acceptor membrane compartments. In the case of
the mammalian synapse, these include syntaxin, synaptobrevin,
synaptosomal-associated protein-25 (SNAP-25), and small molecular
weight GTP-binding proteins of the Rab family (reviewed in (4) ). Each of these proteins belongs to a large gene family,
the individual members of which display differences in tissue
expression and intracellular location. Another difference is that both
genetic studies in yeast and biochemical studies in the mammalian
synapse have revealed a particular specificity in the interaction
between different members of these gene families. For instance,
synaptobrevin or vesicle-associated membrane protein 1 and 2 bind to
syntaxin 1A and 4 but not to syntaxin 2 and 3(28) . On the
basis of such studies it has been suggested that the specificity of
vesicle transport may be regulated by a combinatorial mechanism. We
propose on the basis of the findings in the present study that
different Munc-18 isoforms are also involved in regulating distinct
vesicular transport steps, thus elaborating the fidelity of a
combinatorial mechanism of sorting. Two lines of evidence predicted
the existence of multiple homologues of Munc-18 in mammalian cells.
First, three distinct yeast genes have been identified that are
involved in discrete vesicle transport events. These include
Sec1(17) , which is involved in post-Golgi secretion,
Sly1(15) , in endoplasmic reticulum to Golgi transport, and
Slp1(16) , that has a function in vacuolar trafficking. Second,
the neural homologue of Sec1, referred to here as Munc-18a, binds to
syntaxin 1A, 2, and 3 but not to syntaxin 4(20) . Furthermore,
the expression of Munc-18a is primarily confined to neural tissue
(19-21; Fig. 4A), whereas members of the syntaxin
family display a broad tissue distribution(5) . Based on the
amino acid homology between Munc-18a, Munc-18b, and Munc-18c as well as
their tissue distributions, it is likely that they may be involved in a
wide array of vesicle transport steps. Munc-18b showed the highest
amino acid sequence identity to Munc-18a (62%, Table 1). The
relatively limited tissue distribution of Munc-18b implies that it may
be involved in more specialized vesicle trafficking events common to
testis, intestine, and kidney. The tissue distribution of Munc-18b does
not correlate with that of any of the known mammalian syntaxin
isoforms(5) . This raises the possibility that a
Munc-18b-specific syntaxin remains to be identified. However, the
neural-specific isoform, Munc-18a, interacts with multiple
syntaxin's (20) , both neural and non-neural, and so it
is conceivable that different Munc-18/syntaxin combinations may occur in vivo, depending upon the native expression of these
proteins in a particular cell type. Munc-18c exhibited a broad tissue
distribution implicating its involvement in a more constitutive vesicle
transport event that is common to all cells. Consistent with this,
Munc-18c showed the least identity to Munc-18a, Ropp, and unc-18
(43-51%, Table 1), which have all been implicated in
regulated exocytosis in more specialized secretory cells. In order to
define the role of these new Munc-18 isoforms in vesicle transport, it
will be necessary to determine the intracellular location of Munc-18b
and Munc-18c using isoform-specific antibodies and to study the
specificity of the interaction between different members of the
syntaxin and Munc-18 gene families. The identification of a
mammalian Munc-18 gene family provides further insight into our
understanding of vesicle transport regulation. These proteins are
likely to play an important role in vesicle docking and/or fusion and
should be considered as an integral component of the SNARE complex.
Future studies will be required to map the specific interactions
between different syntaxin's and Munc-18 isoforms in order to
define their role in vesicle transport. It is also possible that other
members of this gene family exist, which are either not expressed at a
significant level in 3T3-L1 cells or are less homologous than the three
Munc-18 proteins described here.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s) U19520 [GenBank](munc-18b gene) and U19521 [GenBank](munc-18c gene).
Volume 270,
Number 11,
Issue of March 17, 1995 pp. 5857-5863
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)that
regulate the specificity of synaptic vesicle exocytosis (reviewed in (4) ). A fusion protein complex, consisting of N-ethylmaleimide-sensitive factor and soluble N-ethylmaleimide-sensitive factor attachment proteins,
interact with three proteins isolated from brain: synaptobrevin or
vesicle-associated membrane protein, a synaptic vesicle membrane
protein; and syntaxin and the synaptosomal-associated protein-25
(SNAP-25), both found on the presynaptic plasma membrane. The
identification of this protein complex supports the recent SNARE
hypothesis(3) , which implies that the specificity of membrane
fusion is regulated by the specific binding of the donor vesicle (via
the V-SNARE or synaptobrevin protein) with the acceptor membrane (via a
T-SNARE or syntaxin). This basic template for molecular recognition and
regulation of membrane fusion appears to be a general mechanism, since
both T-SNARE and V-SNARE components belong to large gene families. In
mammalian cells six syntaxin homologues have been cloned which exhibit
a broad tissue distribution as well as variations in subcellular
location(5) . Two distinct synaptobrevins, 1 and 2(6) ,
have been identified in synaptic vesicles, whereas cellubrevin, a
synaptobrevin homologue, is targeted to recycling
endosomes(7) . Other members of these two gene families have
also been described in yeast. The yeast syntaxin homologues,
Sed5p(8) , Sso1p, Sso2p(9) , and Pep12p(10) ,
together with a variety of synaptobrevin homologues, including Bet1p (11, 12) , Bos1p(13) , SNC1, and SNC2 (14) are thought to coordinate specific membrane trafficking
events throughout the secretory pathway.
Materials
Restriction enzymes were obtained from
New England Biolabs, Inc. (Beverly, MA). Radioactive nucleotides and
nylon membranes (Hybond-N
) were from Amersham
(Aylesbury, United Kingdom). Oligonucleotides were synthesized on an
Applied Biosystems 394 DNA synthesizer. All chemicals were high purity
commercial grades. 3T3-L1 fibroblasts, obtained from the American Type
Tissue Culture Center, were cultured and differentiated into adipocytes
as described previously(24) .cDNA Cloning and Sequence Analysis of Munc-18
Isoforms
Two oligonucleotide primers corresponding to the 5`
(TGCTCTAGAAGAACGCCATGGCCCCCATTGG; sense primer) and 3`
(TGCTCTAGATTAACTGCTTATTTCTTCGTCTGTTTTATTCAG; antisense primer) ends of
the rat brain Munc-18 cDNA (19) were synthesized and used to
obtain a full length Munc-18 DNA fragment by reverse
transcriptase-polymerase chain reaction from rat brain RNA. Rat brain
RNA was isolated by the guanidine isothiocyanate
procedure(25) . The polymerase chain reaction cycling profile
was 94 °C for 20 s, 55 °C for 20 s, 72 °C for 2 min,
repeated for 35 cycles. The authenticity of the amplified DNA fragment
was verified by restriction mapping. The polymerase chain reaction
product was isolated from a 1% agarose gel, radiolabeled with random
hexamer primers (Promega Corp., Madison, WI) and used to screen a
random-primed 3T3-L1 adipocyte cDNA library constructed in 
ZAP
II, kindly provided by Dr. F. Fiedorek, University of North Carolina. A
total of 250,000 plaques were screened. From 35 positives, isolated
after sequential purifications, three distinct cDNA classes were
identified. Clones were subcloned into pBluescript II SK-
(Stratagene, La Jolla, CA) and sequenced manually using Sequenase
version 2.0 (U. S. Biochemical Corp.) or by automated DNA sequencing
(Applied Biosystems Inc., model 373A). Both strands of DNA for the
entire Munc-18c cDNA and 97% of the Munc-18b cDNA were sequenced
utilizing T3, T7, and gene-specific oligonucleotide primers as well as
the Erase-a-base nested deletion kit (Promega). The remaining 5`
sequence of Munc-18b was obtained using the 5`-Amplifinder rapid
amplification of cDNA ends kit (Clontech, Palo Alto, CA), as per
manufacturer's instructions. 3T3-L1 adipocyte poly(A) RNA (2 µg) was reverse-transcribed and then primed with
oligonucleotide P1 (GCTGCTTTGTAGGTGAAGGTTGGTGTTCCC). A nested
gene-specific primer P2 (CGCGGATCCCGTGGGACTCAGCAAATAAATTGCCTCC) was
used in conjunction with this procedure. The deduced amino acid
sequences of Munc-18b and Munc-18c were aligned with rat brain Munc-18a (19, 20, 21) and the C. elegans gene
product unc-18 (23) using the computer program Clustal
V(26) .RNA Blot Analysis
Total RNA was isolated from rat
tissues, 3T3-L1 fibroblasts, and adipocytes by the guanidine
isothiocyanate procedure(25) . 3T3-L1 fibroblast and adipocyte
poly(A) was obtained using the Pharmacia mRNA
purification kit (Pharmacia, Uppsala, Sweden). RNA was electrophoresed
using a 1% formaldehyde-agarose resolving gel and transferred to a
nylon membrane. The blot was sequentially probed with Munc-18a,
Munc-18b, and Munc-18c DNA fragments labeled with
[
-
P]dCTP by random priming. The
hybridization conditions were: 50% formamide, 5 
SSPE (1
SSPE = 0.15 M NaCl, 10 mM NaH
PO
, 1 mM EDTA, pH 7.4), 5
Denhardt's solution, 1% SDS, and 100 µg/ml denatured
herring sperm DNA at 42 °C for 16 h. The blot was washed with 1
SSC and 0.1% SDS at 50 °C. The RNA blots were also probed
with DNA coding for glyceraldehyde-3-phosphate dehydrogenase for
normalization of results. The conditions for hybridization of the RNA
blot for each of the three Munc-18 DNA probes was individually
determined such that they did not cross-hybridize.
of 66,357 and pI of 6.72 (Fig. 1). A 2.5-kb Munc-18c full-length clone (M2I) was
sequenced in both directions and found to contain a 1,776-bp open
reading frame encoding a protein of 592 amino acids with a calculated M of 67,942 and a pI of 7.96 (Fig. 2). None
of these deduced amino acid sequences showed any evidence of a
transmembrane region. The percentage identity between the three Munc-18
isoforms at the nucleotide level is 54-64%.
RNA from 3T3-L1 fibroblasts and adipocytes
were hybridized with -P-labeled probes derived from
the three different Munc-18 isoforms (Munc-18a, Munc-18b, and Munc-18c)
as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH),
as described under ``Experimental Procedures.'' A,
expression of Munc-18a, Munc-18b, Munc-18c, and
glyceraldehyde-3-phosphate dehydrogenase mRNAs in rat tissues. B, expression of Munc-18a, Munc-18b, and Munc-18c mRNAs in
3T3-L1 fibroblasts (F) and adipocytes (A). The size
(in kilobases) of the major transcripts are indicated at the left.
)
We thank Professor John Shine, Dr. Richard Alm, and
Dr. Robert Piper for providing invaluable advice and support during
these studies. We also thank Shane Rea and Kirsten Blake for technical
help. We are indebted to Dr. Amanda Carozzi for providing 3T3-L1
fibroblasts and adipocytes enabling the production of RNA.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  G. Procino, C. Barbieri, G. Tamma, L. De Benedictis, J. E. Pessin, M. Svelto, and G. Valenti AQP2 exocytosis in the renal collecting duct - involvement of SNARE isoforms and the regulatory role of Munc18b J. Cell Sci., June 15, 2008; 121(12): 2097 - 2106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Arunachalam, L. Han, N. G. Tassew, Y. He, L. Wang, L. Xie, Y. Fujita, E. Kwan, B. Davletov, P. P. Monnier, et al. Munc18-1 Is Critical for Plasma Membrane Localization of Syntaxin1 but Not of SNAP-25 in PC12 Cells Mol. Biol. Cell, February 1, 2008; 19(2): 722 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Umahara, S. Okada, E. Yamada, T. Saito, K. Ohshima, K. Hashimoto, M. Yamada, H. Shimizu, J. E. Pessin, and M. Mori Tyrosine Phosphorylation of Munc18c Regulates Platelet-Derived Growth Factor-Stimulated Glucose Transporter 4 Translocation in 3T3L1 Adipocytes Endocrinology, January 1, 2008; 149(1): 40 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Oh, C. J. Heise, J. M. English, M. H. Cobb, and D. C. Thurmond WNK1 Is a Novel Regulator of Munc18c-Syntaxin 4 Complex Formation in Soluble NSF Attachment Protein Receptor (SNARE)-mediated Vesicle Exocytosis J. Biol. Chem., November 9, 2007; 282(45): 32613 - 32622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ke, E. Oh, and D. C. Thurmond Doc2beta Is a Novel Munc18c-interacting Partner and Positive Effector of Syntaxin 4-mediated Exocytosis J. Biol. Chem., July 27, 2007; 282(30): 21786 - 21797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Oh and D. C. Thurmond The Stimulus-induced Tyrosine Phosphorylation of Munc18c Facilitates Vesicle Exocytosis J. Biol. Chem., June 30, 2006; 281(26): 17624 - 17634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Spurlin and D. C. Thurmond Syntaxin 4 Facilitates Biphasic Glucose-Stimulated Insulin Secretion from Pancreatic {beta}-Cells Mol. Endocrinol., January 1, 2006; 20(1): 183 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B.A. t. Beest, S. J. Chapin, D. Avrahami, and K. E. Mostov The Role of Syntaxins in the Specificity of Vesicle Targeting in Polarized Epithelial Cells Mol. Biol. Cell, December 1, 2005; 16(12): 5784 - 5792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Seino and T. Shibasaki PKA-Dependent and PKA-Independent Pathways for cAMP-Regulated Exocytosis Physiol Rev, October 1, 2005; 85(4): 1303 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Oh, B. A. Spurlin, J. E. Pessin, and D. C. Thurmond Munc18c Heterozygous Knockout Mice Display Increased Susceptibility for Severe Glucose Intolerance Diabetes, March 1, 2005; 54(3): 638 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Fu, A. P. Naren, X. Gao, G. U. Ahmmed, and A. B. Malik Protease-activated Receptor-1 Activation of Endothelial Cells Induces Protein Kinase C{alpha}-dependent Phosphorylation of Syntaxin 4 and Munc18c: ROLE IN SIGNALING P-SELECTIN EXPRESSION J. Biol. Chem., February 4, 2005; 280(5): 3178 - 3184. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Spurlin, S.-Y. Park, A. K. Nevins, J. K. Kim, and D. C. Thurmond Syntaxin 4 Transgenic Mice Exhibit Enhanced Insulin-Mediated Glucose Uptake in Skeletal Muscle Diabetes, September 1, 2004; 53(9): 2223 - 2231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Y. Lee, J. B. Park, I. H. Jang, Y. C. Chae, J. H. Kim, I. S. Kim, P.-G. Suh, and S. H. Ryu Munc-18-1 Inhibits Phospholipase D Activity by Direct Interaction in an Epidermal Growth Factor-reversible Manner J. Biol. Chem., April 16, 2004; 279(16): 16339 - 16348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. H. Widberg, N. J. Bryant, M. Girotti, S. Rea, and D. E. James Tomosyn Interacts with the t-SNAREs Syntaxin4 and SNAP23 and Plays a Role in Insulin-stimulated GLUT4 Translocation J. Biol. Chem., September 12, 2003; 278(37): 35093 - 35101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Spurlin, R. M. Thomas, A. K. Nevins, H.-J. Kim, Y.-J. Kim, H.-L. Noh, G. I. Shulman, J. K. Kim, and D. C. Thurmond Insulin Resistance in Tetracycline-Repressible Munc18c Transgenic Mice Diabetes, August 1, 2003; 52(8): 1910 - 1917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. R. Schlaepfer, L. K. Pulawa, L. D. M. C-B. Ferreira, D. E. James, W. H. Capell, and R. H. Eckel Increased expression of the SNARE accessory protein Munc18c in lipid-mediated insulin resistance J. Lipid Res., June 1, 2003; 44(6): 1174 - 1181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Houng, J. Polgar, and G. L. Reed Munc18-Syntaxin Complexes and Exocytosis in Human Platelets J. Biol. Chem., May 23, 2003; 278(22): 19627 - 19633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Martin-Verdeaux, I. Pombo, B. Iannascoli, M. Roa, N. Varin-Blank, J. Rivera, and U. Blank Evidence of a role for Munc18-2 and microtubules in mast cell granule exocytosis J. Cell Sci., January 15, 2003; 116(2): 325 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kauppi, G. Wohlfahrt, and V. M. Olkkonen Analysis of the Munc18b-Syntaxin Binding Interface. USE OF A MUTANT Munc18b TO DISSECT THE FUNCTIONS OF SYNTAXINS 2 AND 3 J. Biol. Chem., November 8, 2002; 277(46): 43973 - 43979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Nelson, K. A. Robinson, and M. G. Buse Insulin Acutely Regulates Munc18-c Subcellular Trafficking. ALTERED RESPONSE IN INSULIN-RESISTANT 3T3-L1 ADIPOCYTES J. Biol. Chem., February 1, 2002; 277(6): 3809 - 3812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Gerber and T. C. Sudhof Molecular Determinants of Regulated Exocytosis Diabetes, February 1, 2002; 51(90001): S3 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Foster and A. Klip Mechanism and regulation of GLUT-4 vesicle fusion in muscle and fat cells Am J Physiol Cell Physiol, October 1, 2000; 279(4): C877 - C890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Riento, M. Kauppi, S. Keranen, and V. M. Olkkonen Munc18-2, a Functional Partner of Syntaxin 3, Controls Apical Membrane Trafficking in Epithelial Cells J. Biol. Chem., April 28, 2000; 275(18): 13476 - 13483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Verhage, A. S. Maia, J. J. Plomp, A. B. Brussaard, J. H. Heeroma, H. Vermeer, R. F. Toonen, R. E. Hammer, T. K. van den Berg, M. Missler, et al. Synaptic Assembly of the Brain in the Absence of Neurotransmitter Secretion Science, February 4, 2000; 287(5454): 864 - 869. [Abstract] [Full Text]
|
|
|
|
|
|
C. C. Brooks, P. E. Scherer, K. Cleveland, J. L. Whittemore, H. F. Lodish, and B. Cheatham Pantophysin Is a Phosphoprotein Component of Adipocyte Transport Vesicles and Associates with GLUT4-containing Vesicles J. Biol. Chem., January 21, 2000; 275(3): 2029 - 2036. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. L. Reed, A. K. Houng, and M. L. Fitzgerald Human Platelets Contain SNARE Proteins and a Sec1p Homologue That Interacts With Syntaxin 4 and Is Phosphorylated After Thrombin Activation: Implications for Platelet Secretion Blood, April 15, 1999; 93(8): 2617 - 2626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Fletcher, R. Shuang, D. R. Giovannucci, L. Zhang, M. A. Bittner, and E. L. Stuenkel Regulation of Exocytosis by Cyclin-dependent Kinase 5 via Phosphorylation of Munc18 J. Biol. Chem., February 12, 1999; 274(7): 4027 - 4035. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Pessin, D. C. Thurmond, J. S. Elmendorf, K. J. Coker, and S. Okada Molecular Basis of Insulin-stimulated GLUT4 Vesicle Trafficking. LOCATION! LOCATION! LOCATION! J. Biol. Chem., January 29, 1999; 274(5): 2593 - 2596. [Full Text] [PDF]
|
|
|
|
|
|
J Rowe, N Corradi, M. Malosio, E Taverna, P Halban, J Meldolesi, and P Rosa Blockade of membrane transport and disassembly of the Golgi complex by expression of syntaxin 1A in neurosecretion-incompetent cells: prevention by rbSEC1 J. Cell Sci., January 6, 1999; 112(12): 1865 - 1877. [Abstract] [PDF]
|
|
|
|
|
|
C. YEAMAN, K. K. GRINDSTAFF, and W. J. NELSON New Perspectives on Mechanisms Involved in Generating Epithelial Cell Polarity Physiol Rev, January 1, 1999; 79(1): 73 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Thurmond, B. P. Ceresa, S. Okada, J. S. Elmendorf, K. Coker, and J. E. Pessin Regulation of Insulin-stimulated GLUT4 Translocation by Munc18c in 3T3L1 Adipocytes J. Biol. Chem., December 11, 1998; 273(50): 33876 - 33883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tamori, M. Kawanishi, T. Niki, H. Shinoda, S. Araki, H. Okazawa, and M. Kasuga Inhibition of Insulin-induced GLUT4 Translocation by Munc18c through Interaction with Syntaxin4 in 3T3-L1 Adipocytes J. Biol. Chem., July 31, 1998; 273(31): 19740 - 19746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Shuang, L. Zhang, A. Fletcher, G. E. Groblewski, J. Pevsner, and E. L. Stuenkel Regulation of Munc-18/Syntaxin 1A Interaction by Cyclin-dependent Kinase 5 in Nerve Endings J. Biol. Chem., February 27, 1998; 273(9): 4957 - 4966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
