Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dompenciel, R. E.
Right arrow Articles by Schoenberg, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dompenciel, R. E.
Right arrow Articles by Schoenberg, D. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 11, Issue of March 17, 1995 pp. 6108-6118
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Purification and Characterization of an Estrogen-regulated Xenopus Liver Polysomal Nuclease Involved in the Selective Destabilization of Albumin mRNA (*)

(Received for publication, October 26, 1994; and in revised form, January 6, 1995)

Raquel E. Dompenciel (§) Varsha R. Garnepudi Daniel R. Schoenberg (¶)

From the Department of Pharmacology, Uniformed Services University of the Health Sciences, School of Medicine, Bethesda, Maryland 20814-4799

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A previous report from this laboratory described an estrogen-regulated endoribonuclease activity on Xenopus liver polysomes which had properties one might expect for a messenger ribonuclease involved in the regulated destabilization of albumin mRNA (Pastori, R. L., Moskaitis, J. E., and Schoenberg, D. R.(1991) Biochemistry 30, 10490-10498). This report describes the purification and properties of this ribonuclease. The purified nuclease fraction contained a doublet of 62 and 64 kDa and a small amount of a 40-kDa peptide. In situ analysis on both denaturing and nondenaturing gels using an albumin transcript as substrate showed all three proteins possess nuclease activity. Peptide mapping and Western blot with a polyclonal antiserum showed the 62- and 64-kDa peptides to be isoforms, and the 40-kDa peptide to be a degradation product of the larger species. Two-dimensional gel electrophoresis further separated the 62- and 64-kDa species into three pairs of proteins, with isoelectric points of 9.6, 9.8, and 9.8. The purified ribonuclease rapidly degraded a full-length albumin transcript, yet had no effect on either a full-length albumin antisense transcript or full-length ferritin transcript. A number of properties of the purified nuclease were characterized, including the effects of salt, divalent cations, EDTA, sulfhydryl reagents, and temperature. Treatment of the polysomal nuclease with micrococcal nuclease had no effect, indicating that this enzyme does not require an RNA cofactor for activity. Finally, primer extension mapped the major cleavage site to an overlapping repeated sequence APyrUGA, with cleavage between and adjacent to the two pyrimidine residues generating fragments with 5`-hydroxyls.


INTRODUCTION

The past several years have seen significant advances in our understanding of gene regulation through changes in mRNA stability (reviewed in (1) ). A number of sequence elements have been identified that, when present in a given mRNA, can alter its stability. The best characterized examples of this are the AU-rich element found in the 3`-untranslated region of a number of cytokine and oncogene mRNAs (e.g. granulocyte-macrophage colony-stimulating factor, c-fos, c-myc,(2, 3, 4, 5, 6) ) and the iron-responsive element present in the 3`-untranslated region of the transferrin receptor mRNA(7, 8, 9) . It is clear that such elements can serve as binding sites for specific proteins, such as those specific for AU-rich elements (10, 11, 12) and the iron-responsive element-binding protein(8, 9, 13, 14) . It is believed that such binding promotes the degradation (in the case of granulocyte-macrophage colony-stimulating factor or c-myc) or stabilization (in the case of transferrin receptor) of the target mRNA.

A major advance in understanding the mechanisms of regulated mRNA turnover has been the development of in vitro degradation systems which mimic in vivo degradative pathways for a number of mRNAs (reviewed in (15) ). In general these systems can be subdivided into three components: the mRNA under study, the proteins that interact with specific sequence elements which identify such mRNA for selective stabilization or degradation, and a nuclease or group of nucleases that catalyze the degradative process. A number of such nucleases have been identified in crude extracts, each of which appears to play a role in specific mRNA degradation. Ross and co-workers (16, 17, 18) have identified a polysomal 3`-5` exonuclease that catalyzes the degradation of histone mRNA in vitro. That group has also identified and characterized a 3`-5` exonuclease that degrades c-myc mRNA in vitro(19) . Bandyopadhyay et al.(20) have reported on an endonuclease present in mRNP complexes, and a subsequent report from that laboratory described a 5`-3` exonuclease present in cytoplasmic extracts(21) . Perhaps the best characterized mRNA degradative enzyme in eukaryotes is the poly(A) nuclease found in Saccharomyces cervisiae(22) . The substrate for poly(A) nuclease is the complex of the 3` poly(A) tail with poly(A)-binding protein, which is degraded by poly(A) nuclease in a 3`-5` manner.

Parker and co-workers have identified what they believe will be a common pathway for non-regulated mRNA decay, in which the first committed step is deadenylation by the poly(A) nuclease, followed by decapping and subsequent degradation by the 5` exonuclease encoded by the XRN1 gene(23) . In addition, that laboratory recently reported that in yeast, nonsensemediated decay proceeds through decapping and degradation by the XRN1 nuclease without prior deadenylation(24) . To date there are no similar data on either constitutive mRNA turnover or nonsense-mediated mRNA turnover in higher eukaryotes.

In contrast to the decay pathways described above, there is a growing body of evidence that regulated mRNA instability may be affected through the action of endonucleases. Some examples of this include the degradation of apo-very low density lipoprotein II mRNA in avian liver (25) , interleukin 2 mRNA in T cells(26) , insulin-like growth factor II mRNA(27) , maternal homeobox-containing mRNAs in Xenopus oocytes(28, 29) , Drosophila embryos(29) , and transferrin receptor mRNA(30) . In the latter, the major endonuclease cleavage site maps to a region adjacent to an iron-responsive element. Binding of the iron-responsive element-binding protein to the iron-responsive element during periods of iron deprivation may stabilize transferrin receptor mRNA by masking this endonuclease cleavage site.

In Xenopus, liver estrogen causes a reorganization of the translational pattern for secreted proteins from one in which the major products are the serum proteins, to one in which the yolk protein precursor vitellogenin predominates (reviewed in (31) )). This is accomplished by three basic mechanisms: 1) the transcriptional induction(31, 32) , 2) subsequent stabilization (31) of vitellogenin mRNA, and 3) the destabilization of the mRNAs encoding the major serum proteins(33) . The latter results in the virtual disappearance of mRNAs for albumin, transferrin, -fibrinogen, and trypsin inhibitor from the cytoplasm shortly after exposure to hormone. The mRNAs encoding ferritin, poly(A)-binding protein or actin remain unaffected by estrogen, consistent with a model in which regulation is restricted to those mRNAs encoding secreted proteins(33) .

We recently described a novel ribonuclease activity on Xenopus liver polysomes that has characteristics consistent with those of a messenger ribonuclease(34) . Little ribonuclease activity was detectable in polysome preparations from control male animals. However, polysomes from estrogen-treated male frogs showed substantial ribonuclease activity. This activity could be extracted with salt, and the extractable material showed differential activity against albumin versus ferritin mRNA using as substrate either total liver RNA or the 20-80 S mRNP fraction. The crude enzyme was shown to be an endonuclease that did not require divalent cations for activity and was not inhibited by EDTA. Similarly it was resistant to inhibition by placental ribonuclease inhibitor and N-ethylmaleimide. The nuclease is not a component of either ribosomal subunit, but requires both subunits be together in an 80 S complex for its association with polysomes(35) .

In order to decipher the molecular mechanisms involved in the estrogen regulation of albumin mRNA stability we chose to focus on the regulation and characterization of this enzyme. In the present report we describe the purification of this enzyme to homogeneity and examine a number of important properties of the purified nuclease. The purified enzyme is a substrate-selective endonuclease which displays many of the properties described earlier (34) for the crude activity extracted from polysomes. Primer extension analysis demonstrates that the major site of cleavage lies in a repeat of the sequence APyrUGA, suggesting that the messenger ribonuclease may also be considered a sequence selective enzyme.


MATERIALS AND METHODS

Subcellular Fractionation of Xenopus Liver

Male frogs (Xenopus One, Ann Arbor, MI) were injected with 1 mg of 17beta-estradiol in 0.1 ml of propylene glycol/Me(2)SO (9:1) 48 h before liver excision. All procedures were carried out at 4 °C. Livers were perfused with sterile 1 times SSC (0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) before excision, then cut into small pieces and homogenized with 1.3 volumes of 40 mM Tris-HCl, pH 7.5, 10 mM MgCl(2), 7% sucrose, 2 mM DTT, (^1)0.2 mM PMSF, 0.5 µg/ml leupeptin, 0.7 µg/ml pepstatin, 2 µg/ml aprotinin in a Teflon glass homogenizer. The homogenate was filtered through a polyamide nylon mesh (Nitex 27621, Tetko, 0.5 mm). Triton X-100 was added to a final concentration of 1%, and the homogenate was incubated on ice for 10 min. Nuclei were removed by centrifugation at 1000 times g for 10 min in a Sorvall HS4 rotor. The supernatant was centrifuged for 15 min at 25,000 times g in a Sorvall SA600 rotor to generate a postmitochondrial extract. The postmitochondrial supernatant was centrifuged at 100,000 times g for 1 h in a Beckman 75Ti rotor to yield a polysomal pellet, which was solubilized overnight in 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 50 mM EDTA, 0.3% Triton X-100, 0.2 mM PMSF, 0.5 µg/ml leupeptin, 0.7 µg/ml pepstatin, 2 µg/ml aprotinin in half the original volume. This step effectively dissociates the nuclease from ribosomal subunits. The extract was centrifuged the following day at 106,000 times g for 40 min in a Beckman 50Ti rotor. The resultant supernatant was dialyzed against 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 20% glycerol, 0.2 mM PMSF and stored at -70 °C until use.

Nuclease Isolation

All procedures were performed at 4 °C. The dissociated polysomal extract was dialyzed against 40 mM Tris-HCl, pH 7.5, 50 mM NaCl, 2 mM DTT, 0.2 mM PMSF and applied to a series of three connected 5-ml Econo-Pac Q (QAE) cartridges (Bio-Rad) that had been previously equilibrated in the same buffer. The fraction that did not bind to the QAE resin (flow-through) was dialyzed overnight in 50 mM sodium phosphate, pH 7.2, 2 mM DTT, 0.2 mM PMSF. This material was applied to two connected Econo-Pac S (SE) 5-ml cartridges (Bio-Rad) and eluted with a linear gradient of 0-0.5 M NaCl in the same buffer at 2 ml/min. The eluate was monitored at 206 nm, and 2-ml fractions were collected. The fractions containing the enzymatic activity were pooled and dialyzed overnight against 50 mM sodium phosphate, pH 7.2, 2 mM DTT, 0.2 mM PMSF. The dialyzate was applied to a 5-ml Econo-Pac HTP (hydroxylapatite) cartridge (Bio-Rad) and eluted at 0.5 ml/min with a linear gradient of 0-0.5 M NaCl in the same buffer. The eluate was monitored at 206 nm, and 1-ml fractions were collected. The fractions containing nuclease activity were pooled, dialyzed against 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 20% glycerol, 0.2 mM PMSF, and stored at -70 °C until use. All fractions obtained during chromatographic procedures (1-10 µl from each fraction) were tested for activity in a standardized in vitro reaction using a P-labeled albumin transcript (see below). Protein concentration was determined by a modified dye binding assay (36) using bovine serum albumin as standard.

Gel Electrophoresis and Western Blots

Denaturing polyacrylamide gel electrophoresis of protein was performed as described by Laemmli(37) . Mini-gels (10 times 8 cm, 0.75 mm) consisted of a 4% stacking gel and 12% resolving gel. Samples (0.5-1.0 µg) were boiled for 4 min in sample buffer. Silver stain molecular weight standards and the silver stain kit from Bio-Rad were used for detection on gels. For Western analysis, proteins separated by SDS-PAGE were electroblotted onto nitrocellulose membrane (Hybond-ECL, Amersham Corp.) at 4 °C, 30 V overnight in 25 mM Tris, pH 8.3, 192 mM glycine. Membranes were blocked with 5% non-fat milk in TBST (20 mM Tris-HCl, pH 7.5, 137 mM NaCl, 0.1% Tween 20) for 1 h, followed by incubation for 1 h with a monospecific rabbit polyclonal antibody to the polysomal nuclease (diluted 1:10,000) that was prepared to the 62/64-kDa protein doublet of the final pure protein excised from a preparative SDS gel. The washed membranes were incubated for 1 h with a donkey anti-rabbit IgG-horseradish peroxidase conjugate (1:3000). Specific complexes were detected by enhanced chemiluminescence (Amersham). The experiment in Fig. 3used an antibody that was immunoselected against the 40-kDa nuclease fragment. The selected antibody was obtained by excising the portion of the nitrocellulose membrane which contained the 40-kDa peptide-antibody complex and eluting the bound antibody by a series of 3 times 30-s washes in 5 mM glycine HCl, pH 2.3, 0.5 M NaCl, 0.5% Tween 20, 100 µg/ml BSA. The eluates were pooled, neutralized with phosphate-buffered saline, and incubated overnight with the subsequent protein blot.


Figure 3: Relationship between the 62-, 64-, and 40-kDa proteins. A, the 62-, 64-, and 40-kDa proteins present in a 1-µg sample of the purified nuclease were separated on a 12% SDS-PAGE. Each protein was digested separately with alkaline protease (lanes 1-3), endoproteinase Glu-C (lanes 4-6), and endoproteinase Lys-C (lanes 7-9) in the stacking gel of a 15% SDS-PAGE for 30 min. Following electrophoresis the proteolytic products were visualized by silver stain. The largest species in lanes 4, 5, 7, and 8 are the intact 62- and 64-kDa proteins, respectfully. The 40-kDa species is present as the largest band in lanes 3, 6, and 9. B, a polyclonal antiserum prepared against the 62/64-kDa doublet was diluted 1:20,000 and used to detect a Western blot of 1 µg of a partially purified nuclease preparation (lane 2) or 1 µg of a preparation of pure polysomal nuclease which has no contaminating 40-kDa material (lane 3). The sample in lane 4 is another lane from the blot that contains the same pure nuclease preparation as in lane 2. This was reacted with an immunoselected antibody that had been eluted from the 40-kDa band of a Western blot of a nuclease preparation like that in seen Fig. 4, lane 5. The bands were detected by enhanced chemiluminescence followed by a 10-s exposure to Hyperfilm-ECL.




Figure 4: Two-dimensional gel analysis of the 62-, 64-, and 40-kDa peptides. Five µg of a preparation that contained a substantial fraction of the 40-kDa breakdown product was separated by isoelectric focusing in the first dimension and SDS-PAGE in the second dimension. The separated proteins were visualized by silver staining.



Isoelectric focusing was performed in a 10 times 8-cm slab gel (1.5 mm thick) consisting of 5% acrylamide/bisacrylamide (37.5:1), 10% glycerol, 1.5% 3/10 Bio-Lyte ampholyte, and 0.5% 8/10 Bio-Lyte ampholyte (Bio-Rad). In the experiment shown in Fig. 4, a 5-µg sample containing both the 62/64-kDa nuclease and the 40-kDa fragment was mixed with an equal volume of 60% glycerol, 1.5% 3/10 ampholyte, 0.5% 8/10 ampholyte and loaded onto the gel. The gel was focussed at 200 V for 1.5 h (4 °C) in 25 mM NaOH (cathode) and 20 mM acetic acid (anode). The pI of the samples was determined by the migration of isoelectric focusing standards (Bio-Rad) run in a parallel lane. The gel was fixed after isoelectric focusing in 10% trichloroacetic acid for 10 min, followed by an overnight incubation in 1% trichloroacetic acid. The gel strip containing the separated proteins was equilibrated for 30 min in SDS sample buffer and overlaid onto the stacking gel of a 12% SDS-PAGE (10 times 8 cm, 1.5 mm). The separated proteins were visualized by silver staining.

Peptide Mapping

Peptide mapping was performed essentially as described by Cleveland et al.(38) . The 64-, 62-, and 40-kDa proteins containing nuclease activity were separated first by electrophoresis on a 12% acrylamide SDS-polyacrylamide gel. The gel was stained for 10 min in 0.05% Coomassie Blue, 40% methanol, 10% acetic acid, then destained. The 64-, 62-, and 40-kDa bands were excised from the gel and equilibrated for 60 min in SDS gel running buffer. The gel slices were loaded into the wells of a 15% SDS-PAGE and overlaid with 5 µl of 20% glycerol, 0.125 M Tris, pH 6.8, 0.1% SDS, 3% beta-mercaptoethanol, 0.005% bromphenol blue, followed by 5 µl of a protease:protein ratio of 1:50 for alkaline protease and 1:10 for endoproteinases Lys-C and Glu-C in 50% glycerol, 0.625 M Tris, pH 6.8, 0.5% SDS, 0.025% bromphenol blue. The gel was electrophoresed at 100 V for 15 min and stopped for 30 min to allow for digestion, following which electrophoresis was resumed at 200 V until the dye front reached the bottom of the gel. The peptide pattern was visualized by silver stain.

Reconstitution Assay

Denaturing SDS-polyacrylamide gels (12%) were prepared with 220 µg of unlabeled albumin transcript/ml of gel mix (Fig. 2A). A 2-µg sample of the purified nuclease shown in Fig. 1, lane 5, was denatured by incubation for 3 min at 37 °C in 6.5 mM Tris-HCl, pH 6.8, 2 mM EDTA, 10% glycerol, 0.12 M beta-mercaptoethanol, 1% SDS and loaded onto the gel. Electrophoresis was performed at 4 °C. The gel was washed twice for 15 min in 25% isopropanol, 40 mM Tris-HCl, pH 7.5, followed by three washes in 40 mM Tris-HCl, pH 7.5, for 10 min each. The gel was incubated at 37 °C for 1.5 h in 40 mM Tris-HCl, pH 7.5, 1 mM EDTA, washed 10 min in the same buffer and stained with 0.2% toluidine blue for 10 min. The higher temperature wash was necessary to obtain the best clearing of the degraded transcript from regions of the gel containing the nuclease. The gel was destained in 40 mM Tris-HCl, pH 7.5, until clear bands of ribonuclease activity were visible against a blue background.


Figure 2: Reconstitution of nuclease activity on denaturing and nondenaturing gels. A, two µg of purified nuclease shown in Fig. 1, lane 5, was electrophoresed at 4 °C in an SDS-PAGE containing 220 µg/ml of unlabeled albumin transcript. Following electrophoresis the gel was processed for protein renaturation, incubated at 37 °C to enable in situ digestion of the RNA, and stained with toluidine blue. B, one µg (lanes 2-4) or 1.5 µg (lane 5) of the indicated samples were electrophoresed at 4 °C on a nondenaturing polyacrylamide gel in which 3 times 10^4 dpm of radiolabeled transcript had been incorporated. Following electrophoresis the gel was equilibrated in reaction buffer, incubated at 25 °C to enable in situ digestion of the RNA, dried, and autoradiographed. C, the portion of a paired gel to that in B, which contained nuclease activity and had not been dried, was electrophoresed on a 12% SDS-PAGE and silver-stained.




Figure 1: Summary SDS-PAGE of active fractions throughout the isolation procedure. The samples from each fractionation step that contained enzymatic activity were analyzed on a single 12% SDS-PAGE and visualized by silver stain. All lanes contain 0.5 µg of protein except for lane 5 which contains 1 µg. The starting dissociated liver polysomal extract applied to the QAE column (QAE load) is shown in lane 2, the eluate of this column which was applied to the SE column (SE load) is in lane 3, the eluate of the SE column which was applied to the HTP column (HTP load) is in lane 4, and the peak of activity from the HTP column is in lane 5 (see ``Materials and Methods'' for details on the column fractionation procedure).



In Fig. 2B, a native 10% polyacrylamide gel was prepared in 8.9 mM Tris, pH 8.4, 8.9 mM boric acid, 2 mM EDTA containing 3 times 10^4 dpm/ml of a P uniformly labeled albumin transcript. The gel was electrophoresed at 150 V for 2 h at 4 °C. It was next washed for 1 h in 40 mM Tris-HCl, pH 7.5, 10 mM MgCl(2), 2 mM EDTA, 10% glycerol at 25 °C and left overnight in the same buffer at 4 °C. The gel was dried and autoradiographed. Ribonuclease activity was identified as a clear area on the autoradiogram. The portion of the gel containing the activity shown in Fig. 2B was excised from a paired sample, denatured, and electrophoresed on a 12% SDS-PAGE. Protein was detected by silver stain (Fig. 2C).

Preparation of Radiolabeled Transcripts

The albumin cDNA clones used for the preparation of transcripts was obtained from a liver library prepared in ZAP (39) and were described previously (34) . The transcript used for experiments in Fig. 6Fig. 7Fig. 8Fig. 9corresponded to the first 500 nt of the 74-kDa albumin mRNA(35) . A standard transcription reaction contained 1 µg of linearized plasmid, 40 mM Tris-HCl, pH 7.5, 6 mM MgCl(2), 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 20 units of recombinant RNasin, 500 µM each ATP, GTP, UTP, 12 µM CTP, 50 µCi of [alpha-P]CTP (400 Ci/mmol), and 20 units of T3 RNA polymerase. The reaction was incubated for 30 min at 30 °C, after which the same amount of unlabeled nucleotides were added and incubated another 30 min. The reaction was stopped by the addition of 1 unit of RNase-free DNase followed by incubation for 15 min at 37 °C. RNA was extracted once with phenol/chloroform/isoamyl alcohol (25:24:1) and once with chloroform/isoamyl alcohol. The extracted sample was separated from unincorporated nucleotides by size exclusion chromatography through an RNase-free Sephadex G-25 spin column, then precipitated with 0.5 volume of 7.5 M ammonium acetate and 2.5 volumes of ethanol. The resultant pellet was washed with ethanol, dried, and dissolved in pyrocarbonic acid diethyl ester-treated water. 5` end-labeled transcript was prepared by transcription with T3 polymerase in the presence of 50 µCi of [-P]GTP, 6000 Ci/mmol with 10 µM unlabeled GTP in the reaction mixture. For preparation of double-stranded RNA an antisense RNA to the 5` 500-nt albumin substrate transcript was prepared by transcription of the pBluescript plasmid bearing this cDNA with T7 RNA polymerase. One ng of P-labeled sense transcript was mixed with 5 ng of the unlabeled antisense transcript in 80% formamide, 40 mM Pipes, pH 6.4, 400 mM NaCl, 1 mM EDTA. The reaction mixture was heated for 5 min at 80 °C to denature both RNAs followed by hybridization overnight at 52 °C. The double-stranded RNA was analyzed as described previously(34) , then used in the standard in vitro degradation assay.


Figure 6: Properties of the purified polysomal nuclease. In each experiment the basic protocol utilized 250 ng of purified nuclease incubated at 22 °C for 30 min with 500 pg of P-labeled transcript of the 5` 500 nt of albumin mRNA in 40 mM Tris-HCl, pH 7.5, 2 mM dithiothreitol. Lane 2 is the starting transcript, lane 3 is transcript incubated alone under the above conditions, and lane 4 shows the result of the 30-min incubation of transcript with the nuclease. In lanes 5 and 6 the reaction mixture was supplemented with 10 mM MgCl(2) or 10 mM EDTA, respectively. Lanes 7-10 show the effect of addition of 10, 50, 100, and 400 mM NaCl to the reaction buffer. Placental ribonuclease inhibitor (20 and 100 units) was added to the reaction mixture in lanes 11 and 12. In lanes 13-17 the purified nuclease was first heated for 5 min at 50, 60, 70, 80, and 90 °C prior to the start of the reaction. Lane 1 (M) contains a marker of end-labeled HinfI restriction fragments of X174 DNA. The position of the 194-nt doublet cleavage fragment is shown with the closed arrow, and the 306-nt fragment from the 3` portion of the transcript is shown with the open arrow.




Figure 7: Endonuclease activity of the purified enzyme. A, the RNA degradation assay was performed with a 5` end-labeled albumin substrate RNA prepared by transcription in a buffer containing [-P]GTP. Lanes 2 and 3 contain RNA incubated at 4 and 22 °C, respectively, with no added nuclease. The cleavage of the end-labeled transcript by the nuclease is shown in lane 4. B, double-stranded RNA was prepared by hybridization of a P-labeled albumin sense transcript with an excess of unlabeled antisense transcript. Lanes 2 and 3 are the same controls as in A.Lane 4 is a control for the standard digestion of albumin sense transcript with 250 ng of purified nuclease. Lane 5 consists of double-stranded RNA incubated without added nuclease, and lane 6 shows the effect of the same RNA incubated with the purified nuclease. Lane 1 contains X174 HinfI fragments as size markers. The arrowhead on both gels shows the position of the 194-nt doublet cleavage product.




Figure 8: Evidence that an RNA cofactor is not required for nuclease activity. P-Labeled albumin substrate transcript was incubated for 30 min at 22 °C in the absence of added nuclease (lane 1), with purified polysomal nuclease (lane 2), with micrococcal nuclease (MNase) at 20 °C for 15 min (lane 3), followed by 10 mM EGTA to stop the reaction (lane 3), or with micrococcal nuclease in buffer containing 10 mM EGTA (lane 4). In the reaction shown in lane 5, purified nuclease was incubated first with micrococcal nuclease for 15 min at 20 °C, followed by 10 mM EGTA to stop the reaction. This was then added to radiolabeled albumin substrate transcript and incubated under standard reaction conditions. The arrow shows the position of the 194-nt doublet cleavage product.




Figure 9: Determination of the nuclease cleavage site on the substrate transcript. The substrate transcript was digested for 30 min at 22 °C with purified nuclease, extracted with phenol, and ethanol-precipitated. The product of this reaction was annealed with an endlabeled oligonucleotide complementary to a site 311 nt from the 5` end of the RNA followed by primer extension with reverse transcriptase. Samples from duplicate reactions were applied to the gel (lanes 5 and 6). Lane 7 is a control primer extension performed on undigested RNA. The position of the cleavage sites was determined relative to a dideoxy sequencing ladder generated with the same primer, cloned albumin cDNA and modified T7 DNA polymerase (lanes 1-4).



In Vitro Assay for Ribonuclease Activity

The standard reaction was performed in a 20-µl reaction mixture containing 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 10 µg of liver RNA, 500 pg of radiolabeled transcript, similar to the assay described previously(34, 35) . All components were assembled on ice. The desired amount of protein was added (from 10 µg of polysomal extracts to 250 ng of an HTP active fraction) followed by a 30-min incubation at 22 °C. Reactions were terminated by the addition of an equal volume of stop solution (95% formamide, 20 mM EDTA, pH 8.0, 0.1% xylene cyanol, 0.1% bromphenol blue). Samples were denatured by heating at 68 °C for 10 min and electrophoresed at 70 watts for 1.5 h in a 6% acrylamide, 8 M urea gel. The dried gel was autoradiographed on Kodak X-Omat XAR-5 film. Specific nuclease activity was identified by the degradation of the 500-nt transcript and the generation of a characteristic 194-nt doublet cleavage fragment as described by Pastori et al.(34) . Micrococcal nuclease treatment of either the purified nuclease or albumin substrate transcript (Fig. 8) was accomplished by the addition of 5 times 10 units to a 10-µl volume containing 20 mM HCl, pH 7.5, 2 mM CaCl(2). The reaction was terminated after 15 min at 20 °C by the addition of 10 mM EGTA, following which the sample was assayed for nuclease activity.

Kinetic Analysis of mRNA Degradation

Full-length P-labeled albumin mRNA was prepared by in vitro transcription with T3 RNA polymerase from a pBluescript SK(-) plasmid bearing the cloned 74-kDa albumin cDNA. A full-length P-labeled albumin antisense RNA was generated by transcription of the same cloned cDNA with T7 RNA polymerase. Full-length P-labeled ferritin mRNA was prepared in the same manner by transcription of a pBluescript plasmid with T7 RNA polymerase. Six-hundred pg of each transcript was incubated with 300 ng of purified nuclease in a 25-µl volume containing 40 mM Tris-HCl, pH 7.5, 2 mM dithiothreitol, 2 units/µl placental ribonuclease inhibitor, 1 µg/µl BSA, and 0.5 µg/µl yeast tRNA. Five-µl samples were removed at 0, 5, 10, 20, and 30 min of incubation at 22 °C. The reaction was stopped by the addition of an equal volume of stop solution (95% formamide, 20 mM EDTA, pH 8.0, 0.1% xylene cyanole, 0.1% bromphenol blue). All samples were heated at 68 °C for 10 min prior to electrophoresis on a 6% acrylamide, 8 M urea gel. The overall pattern of degradation was visualized by autoradiography of the dried gel, and RNA decay was quantified using a Molecular Dynamics PhosphorImager.

Mapping in Vitro Cleavage Sites by Primer Extension

One and one-half µg of unlabeled albumin substrate transcript was treated with or without 500 ng of purified nuclease for 30 min at 22 °C to generate the substrate for primer extension analysis. Ten ng of a 5` end-labeled primer (5` CACTCAGGAGTTTTGTCATTAA) complementary to a site 311 nt from the 5` end of the transcript was added to the products of the nuclease cleavage reaction dissolved in a 20-µl volume containing 10 mM Tris-HCl, pH 7.9, 250 mM KCl, 1 mM EDTA. This mixture was heated at 65 °C for 5 min and slowly cooled to room temperature. The samples were extracted with phenol, ethanol-precipitated, and dissolved in a 50 µl volume containing 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl(2), 10 mM dithiothreitol, 0.33 mM each dATP, dCTP, dGTP, and TTP and 100 units of Moloney murine leukemia virus reverse transcriptase. Primer extension was performed at 42 °C for 1.5 h. The extension products recovered by ethanol precipitation were dissolved in 4 µl of formamide loading solution plus 2 µl of 0.1 N NaOH. These were denatured in a boiling water bath for 5 min and immediately electrophoresed on a denaturing 6% acrylamide gel. A DNA sequencing ladder prepared from the cloned cDNA using the same primer, and modified T7 DNA polymerase (Sequenase) was run in adjacent lanes of the gel to provide a standard for localization of the cleavage sites.


RESULTS

Chromatographic Separation of the Polysomal Nuclease

The estrogen-regulated polysomal nuclease generates a 194-doublet cleavage fragment from a P-labeled transcript of the 5` end of albumin mRNA(34, 35) . This property was used to assay activity throughout the purification. The nuclease was purified by sequential fast protein liquid chromatography on QAE strong anion exchange resin, SE strong cation exchange resin, and hydroxylapatite (HTP). Details of the purification steps are presented under ``Materials and Methods.'' An SDS-PAGE summarizing each step in the purification of the nuclease is shown in Fig. 1. Gel exclusion chromatography of a crude liver extract indicated that the enzyme of interest had a molecular mass of approximately 66 kDa (data not shown). The final product obtained from the HTP column (fractions 9 and 10) consisted of a pair of bands at 62 and 64 kDa, corresponding to 88% of the protein by densitometry, and a band at 40 kDa corresponding to 12% of the protein. In this gel, lanes 2-4 each contain 0.5 µg of protein, whereas lane 5 contains 1 µg. A greater amount of the final product was loaded in this lane to demonstrate that, within the limits of detection, only the 62/64-kDa doublet and a small amount of a 40-kDa peptide are present in this fraction. The 62/64-kDa doublet is undetectable in the material loaded onto the QAE or SE columns and is barely detectable in the material loaded onto the HTP column.

We operationally define 1 unit of the polysomal nuclease as that which causes the disappearance of 1 ng of a P-labeled 5` 500-nt albumin transcript completely in 30 min at 22 °C. The activities of each of the column fractions were determined by PhosphorImager analysis of the surviving transcript on acrylamide/urea gels. Linear plots of the degree of substrate disappearance with time for each of the column fractions were then used to calculate the purification data in Table 1. By this approach we determined the overall purification was 235-fold for the final fraction obtained from the HTP column compared with the starting polysomal extract. This number is likely a significant underestimate of the actual fold purification (see ``Discussion'').



Evidence That the Purified Products Possess Nuclease Activity

Any one of the protein products detected in the final HTP fraction could be the nuclease which cleaves albumin mRNA. Alternatively, the nuclease could be a different protein present in such small amounts that it was not detected by silver stain. A number of different approaches were used to address this issue. The experiment shown in Fig. 2A employed SDS-PAGE in conjunction with an in situ gel assay to identify proteins with nuclease activity. In this experiment, 2 µg of the purified nuclease from the HTP column shown in Fig. 1, lane 5, was denatured and electrophoresed on a 12% SDS-PAGE in which unlabeled albumin 5` transcript had been polymerized (see ``Materials and Methods''). After electrophoresis the gel was subject to renaturation conditions, incubated at 37 °C to enable the nuclease to digest the incorporated RNA, and stained with toluidine blue. In this assay, bands containing nuclease activity are visualized as areas of decreased staining by toluidine blue. The data in Fig. 2A show a pattern identical to the silver stain of the applied sample; a doublet of 62 and 64 kDa, and a lesser amount of activity at 40 kDa.

Further confirmation that the proteins identified in Fig. 1possess nuclease activity was obtained by native (nondenaturing) gel electrophoresis (Fig. 2B). In this experiment, radiolabeled albumin transcript was incorporated into the gel and 1 µg (lanes 2-4) or 1.5 µg (lane 5) of the indicated samples were electrophoresed at 4 °C. The gel was equilibrated in reaction buffer, incubated at 25 °C to allow for in situ digestion of the radiolabeled transcript, washed, dried, and autoradiographed. The nuclease that generates the 194-doublet cleavage product is a basic protein as evidenced by its inability to bind to QAE and its behavior in preparative isoelectric focusing (see below). We anticipated that it would barely enter the gel, whereas other nucleases would likely fractionate throughout. The data in Fig. 2B confirm this. Electrophoresis of the crude Triton-EDTA extract (QAE load, lane 2) resulted in clearing over one-half of the length of the gel. A similar pattern of nuclease activity was observed in that which eluted in the unbound fraction of the QAE column (SE load, lane 3). The presence of nuclease activity only at the top of the gel in the sample obtained from the SE column (HTP load, lane 4) indicated that this column separated the enzyme under study from most other contaminating nucleases. Similarly, clearing was only observed at the top of the lane containing the purified nuclease (lane 5). It should be noted that the stronger signal here resulted from the use of a larger amount (1.5 µg) of a more purified protein fraction than was loaded onto lane 4. To identify which proteins were responsible for the nuclease activity in lane 5, this portion of the gel was excised and fractionated by SDS-PAGE. Silver staining reveals only the presence of the 62/64-kDa doublet and a small amount of the 40-kDa peptide (Fig. 2C, lane 7). We have also extracted the 62/64-kDa doublet and the 40-kDa peptide from SDS gels, renatured these samples, and found that they both contain nuclease activity (data not shown). Taken together, these data prove that the proteins eluted from the HTP column correspond to the nuclease which generates the unique cleavage of albumin mRNA in vitro.

Relationship between the 62-, 64-, and 40-kDa Peptides

It is clear from the preceding data that all three of the identified proteins possess nuclease activity. The question then becomes what is the relationship among these proteins? The presence of a peptide doublet at 62 and 64 kDa is reminiscent of the doublet albumin peptide(40, 41) which arose from the duplication of the Xenopus genome(41, 42) . To determine the relationship between the 62- and 64-kDa proteins, as well as the nature of the 40-kDa protein, we performed the peptide mapping experiment shown in Fig. 3A. One µg of purified nuclease was separated by electrophoresis on a 12% SDS-PAGE that was over-run to maximize separation of the three protein species. The gel was stained with Coomassie Blue, and the 64-, 62-, and 40-kDa bands were excised from the gel. In situ partial proteolysis of the separated proteins was performed as described previously (38) with alkaline protease, endoproteinase Glu-C and endoproteinase Lys-C. The patterns obtained for the 62- and 64-kDa peptides following each protease digestion are very similar (lanes 1, 2, 4, 5, 7, and 8), indicating a high degree of homology(43) . Although at present we cannot rule out the possibility that the 62-kDa protein is a processed or proteolytically cleaved form of the 64-kDa species, we believe it most likely that the 62- and 64-kDa proteins are products of a duplicated gene. Based on the fact that endoproteinase Lys-C, endoproteinase Glu-C, and alkaline protease all generate a 40-kDa peptide which itself is not cut by endoproteinase Lys-C, and the fact that the 40 kDa peptide retains enzymatic activity, our data suggest it may be a breakdown fragment of the larger proteins that is generated by hydrolysis of a particularly labile peptide bond or series of peptide bonds (see below and ``Discussion'').

Further proof of the relationship between the 40- and 62/64-kDa proteins was obtained by Western blot. A polyclonal antiserum was prepared in one rabbit, using as antigen the 62/64-kDa material excised from an SDS-PAGE of the purified nuclease. This antiserum reacts with both the 62/64-kDa doublet and the 40-kDa band when used to study preparations that contain both species (like that shown in Fig. 1, lane 5, data not shown). To determine whether the 40- and 62/64-kDa species are related, the antibody bound to the 40-kDa band was eluted from the membrane and used to probe a Western blot of a preparation of pure nuclease that contained no detectable 40-kDa species by silver stain. The data in Fig. 3B, lane 4, demonstrate that the antibody selected against the 40-kDa peptide reacts with the 62/64-kDa species. This result provides further proof that the 40-kDa peptide is related to the 62/64-kDa species. For the purpose of comparison, lanes 2 and 3 of Fig. 3B show blots of adjacent lanes of the same gel containing partially purified material obtained from the SE column (Fig. 1, HTP load, lane 4) and the pure nuclease used in lane 4 probed with the unfractionated antiserum. The unfractionated antiserum identifies the 62/64-kDa species in both cases, and upon longer exposure, the 40-kDa species can be seen in the partially purified material in lane 2 (data not shown).

Two-dimensional Gel Analysis of the 62/64-kDa Nuclease and the 40-kDa Degradation Fragment

To characterize further both the nature of the parent nuclease and the relationship between the 62-, 64-, and 40-kDa proteins, a preparation containing all three was analyzed by isoelectric focusing followed by SDS-PAGE (Fig. 4). Isoelectric focusing separated the 62/64-kDa doublet into three pairs of proteins of the same size but isoelectric points of 9.6, 9.7, and 9.8. These data indicate that the parent ribonuclease is a highly basic protein that has undergone posttranslational modification, most likely phosphorylation, to yield a group of proteins. Only a single species of the catalytically active 40-kDa peptide with an isoelectric point of 8.7 was observed.

Selectivity of the Polysomal Nuclease for Albumin mRNA

An earlier study showed that the stability of ferritin mRNA was unaffected by the processes that destabilized albumin mRNA following estrogen administration in vivo(33) . If regulated mRNA instability involved the activation or induction of a nuclease with selectivity for specific mRNA species, one might expect that the enzyme responsible for the degradation of albumin mRNA should retain some degree of the substrate selectivity observed in vivo. The issue of substrate selectivity was addressed by the experiment in Fig. 5. In this experiment full-length transcripts for albumin mRNA and ferritin mRNA, and a full-length transcript of the antisense strand of albumin mRNA, were used to examine the kinetics of degradation by the purified nuclease. Fig. 5A (top) shows a short exposure (4 h) of that portion of the gel bearing the full-length mRNAs. Albumin mRNA was rapidly degraded by the purified nuclease, whereas little degradation was observed for the antisense albumin transcript, and ferritin mRNA remained stable throughout the time course. These data were quantified with a PhosphorImager, and a kinetic analysis of their in vitro stabilities is shown in Fig. 5B. The results confirm that ferritin mRNA (closed boxes) and albumin antisense RNA (open circles) remained resistant to degradation by the polysomal nuclease throughout the 30-min time course. In contrast, albumin mRNA (closed circles) was rapidly degraded, showing a half-life of 9 min. A longer exposure of the gel (20 h) shown in Fig. 5C shows that the only discernible degradation product is the 194-doublet cleavage product (arrow) derived from the 5` end of albumin mRNA (see below). In this one experiment the reaction mixture included 1 µg/µl nuclease-free BSA to stabilize the enzyme against loss of activity over time. The dense band present one-third of the way down the gel in all samples is an artifact that results from its presence in the reaction mixture.


Figure 5: Selectivity of the purified nuclease for albumin mRNA. Uniformly labeled full-length transcripts of albumin mRNA, the antisense strand of albumin mRNA, and ferritin mRNA were incubated with the purified nuclease at 22 °C. Portions of the reaction mixture were removed at the indicated times and electrophoresed on a urea/acrylamide gel. A 4-h exposure of that portion of the gel containing the full-length mRNAs is shown in A, and a quantitative analysis of the disappearance of these RNAs is shown in B (bullet, albumin mRNA; circle, ferritin mRNA; , albumin antisense transcript). A 20-h exposure of the entire gel is shown in C, with the arrow indicating the position of the characteristic 194-nt doublet cleavage fragment.



Properties of the Purified Polysomal Nuclease

The properties of the purified polysomal nuclease were characterized by the effect of various treatments on its activity in a standardized in vitro degradation assay. As described in our earlier studies(34, 35) , this assay measures the degradation of a P-labeled transcript corresponding to the 5` 500 nt of albumin mRNA as well as the generation of a characteristic doublet cleavage product of approximately 194 nt (shown with a closed arrow in Fig. 6) which comes from the 5` portion of the transcript. In some experiments the corresponding fragment from the 3` portion of the transcript can also be seen (open arrow). The controls of substrate transcript incubated with and without added nuclease are shown in Fig. 6, lanes 4 and 3, respectively. The next lanes show the effects of Mg, EDTA, NaCl, placental ribonuclease inhibitor, and temperature on activity of the purified nuclease. Enzymatic activity was increased by the addition of 10 mM MgCl(2) (lane 5); however, 10 mM EDTA (lane 6) did not lower the basal enzymatic activity observed with the control reaction in just Tris buffer and 2 mM dithiothreitol (lane 4). It therefore appears that, although the nuclease does not require Mg, its activity is enhanced by this divalent cation. This is a general effect of divalent cations, as similar results were obtained with 10 mM Ca and Zn ions. There was little effect of divalent cations below 5 mM (data not shown).

The data in lanes 7-10 show the effect of 10, 50, 100, and 400 mM NaCl on the activity of the purified enzyme. Ten mM NaCl gave the same result as the control (lane 4). However, 50 mM NaCl resulted in more substantial substrate degradation (lane 8) and still greater degradation was obtained at 100 mM NaCl (lane 9). It is interesting to note that at this higher salt concentration there was also preferential accumulation of the 194-doublet cleavage product. The significance of this is unclear, although this higher salt concentration might stabilize the major cleavage product. Addition of 400 mM NaCl resulted in the inactivation of the purified nuclease (lane 10). Most ribonucleases related to the RNase A family of enzymes can be inhibited by placental ribonuclease inhibitor (RNasin(TM)). Addition of either 20 units (lane 11) or 100 units (lane 12) of recombinant RNasin increased enzymatic activity. We have been able to achieve the same effect with bovine serum albumin, suggesting that this effect is due to stabilization of the nuclease at the low protein concentration used in the assay (see below). Control experiments demonstrated that neither the RNasin or BSA preparations used in these experiments possess nuclease activity in our assay (data not shown). The sulfhydryl reagent N-ethylmaleimide had no effect on the activity of the purified nuclease (data not shown). Last, the relative temperature stability of the purified nuclease was examined. Lanes 13-17 show the effect of a 5-min incubation at 50, 60, 70, 80, and 90 °C prior to the start of the reaction. The nuclease activity was unaffected by incubation at 50 and 60 °C (compare lanes 13 and 14 with lane 4) and was inactivated at 70 °C and above. Thus, the nuclease is relatively temperature-stable. It should be noted that all of the experiments in this paper were performed at the optimal pH for activity of the nuclease (7.5).

Evidence That the Purified Enzyme Is a Single Strandspecific Endonuclease

In our previous study (34) we characterized the crude estrogen-induced enzyme as an endonuclease by its ability to generate the same 194-doublet cleavage fragment from uniformly labeled or end-labeled transcript. The experiment in Fig. 7A shows that the purified nuclease generates the same 194-nt doublet cleavage product with a 5` end-labeled transcript as was observed in Fig. 6with uniformly labeled transcript. This reaffirms that the enzyme under study is an endonuclease. The 300-nt 3` cleavage product could be labeled directly by a forward reaction (as opposed to an exchange reaction) with [-P]ATP and polynucleotide kinase with or without prior treatment with alkaline phosphatase. The generation of products with a free 5`-hydroxyl is a property common to many ribonucleases (44) .

The preceding experiments were all performed with the albumin sense transcript alone. The experiment in Fig. 7B was a first step toward addressing the role of RNA structure and/or conformation as it relates to cleavage by the polysomal nuclease. In this experiment a double-stranded RNA was generated by hybridizing an excess of unlabeled albumin antisense transcript to the radiolabeled sense strand. Whereas the radiolabeled sense strand alone was degraded by the purified nuclease (lane 4), the hybrid formed with the antisense strand was resistant to digestion (lane 6). It is highly unlikely that the inhibition observed resulted from competition by excess unhybridized antisense RNA because inclusion of 10 µg of either liver RNA or tRNA have no effect on the degradation of the substrate transcript, and the nuclease does not degrade albumin antisense RNA (see Fig. 5). The band that migrated slightly faster than the substrate transcript in lane 6 results from incomplete denaturation of the duplexed RNA and is not a product of nuclease degradation. We conclude that there must be structural features of albumin mRNA that are important in either the mechanisms of targeting or degradation by the nuclease.

Evidence That the Polysomal Nuclease Does Not Require an RNA Cofactor

A number of ribonucleases involved in RNA processing events (e.g. RNase P and RNase MRP(45) ) possess an RNA cofactor that is essential for activity. To address whether an RNA cofactor is required for activity by the Xenopus liver polysomal nuclease the purified enzyme was treated with micrococcal nuclease as shown in the experiment in Fig. 8. Lane 2 shows the degradation of radiolabeled albumin transcript by the purified nuclease under our standard reaction conditions. Substitution of 5 times 10 units of micrococcal nuclease for the polysomal nuclease (lane 3) resulted in the nonspecific degradation of the substrate transcript. This degradation was prevented by co-addition of 10 mM EGTA (lane 4). In lane 5, 250 ng of purified nuclease was incubated first with micrococcal nuclease as in lane 3. Ten mM EGTA was then added to inactivate micrococcal nuclease followed by incubation with the substrate transcript. Pretreatment with micrococcal nuclease had no effect on the ability of the polysomal nuclease to degrade albumin mRNA. We conclude from these results that the polysomal nuclease does not require an RNA cofactor and/or that a catalytic RNA is not responsible for nucleolytic activity present in our purified preparation.

Identification of Major Cleavage Sites within the Albumin 5` Substrate Transcript

The availability of the nuclease in a highly purified form allowed us to map the sites of cleavage responsible for generating the 194-doublet cleavage products. In the experiment in Fig. 9, 1.5 µg of unlabeled substrate RNA was digested with 500 ng of purified nuclease for 30 min at 22 °C (lanes 5 and 6). A control of undigested RNA was also analyzed (lane 7). The reaction products were analyzed by primer extension using an end-labeled oligonucleotide complementary to a site 311 nt within the body of the transcript. Two major cleavage sites (arrows) were detected by this method in addition to a number of polymerase pause sites present in all lanes. The position of the major cleavage sites within the sequence of this portion of albumin mRNA is shown by the arrows in the right-hand panel, with the size of the arrow indicative of the relative strength of the observed signal on the gel. The numbers above the sequence refer to the position relative to the 5` end of the transcript and the numbers in parentheses correspond to the actual position in albumin mRNA, the difference coming from polylinker sequences of the plasmid vector. The 194-nt doublet cleavage product resulted from cleavages at positions 188 and 193 between two pyrimidine residues in AUUGA and between the U and G residues in the adjacent overlapping sequence ACUGA (see ``Discussion'').


DISCUSSION

This is the first report of the isolation and characterization of a ribonuclease involved in regulated mRNA turnover in higher eukaryotes. Several lines of evidence point to this protein as being important in the destabilization of albumin mRNA following estrogen administration. First, the amount of enzymatic activity is significantly increased following estrogen administration. Second, this activity shows differential substrate selectivity for albumin versus ferritin mRNA that mirrors the relative stabilities of these mRNAs in vivo after hormone treatment(33) . Third, breakdown products identified in liver RNA after estrogen administration result from cleavage in vivo at the same sites as cleaved in vitro by the purified nuclease. (^2)

Throughout these prior studies we used the ability of the polysomal nuclease to generate a doublet 194-nt cleavage product from a 500-nt 5` albumin transcript as an assay for the specific estrogen-inducible activity. This property was used here to follow the purification of the nuclease and to characterize some properties of the purified enzyme. Although the major site of cleavage is that which generates the 194-nt doublet product (Fig. 9), the product generated by this is itself subject to further cleavage by the nuclease. Because of this we had to rely on the disappearance of the substrate transcript for calculating the specific activity of the polysomal nuclease throughout its purification. By this method an overall 235-fold purification was obtained from the crude polysomal extract to the final product from the HTP column. It is likely this is a significant underestimate of the true magnitude of purification. The data in Fig. 2B indicate that there are many nucleases present in the crude polysomal extract. The 77 units/mg calculated for this material represents the sum of the activities of all of these nucleases, of which the enzyme of interest likely represents only a small fraction. Further confounding these data is the presence of an endogenous inhibitor of the polysomal nuclease that we described previously(34) . It is unclear to what degree this inhibitor alters the observed specific activity, at which step in the purification it is removed, or indeed how strongly it binds to, and inhibits the action of the nuclease.

Based on the purification and in situ gel reconstitution data, we believe that the biologically active form of the nuclease is represented in the 62- and 64-kDa species. As noted above, peptide mapping data indicate these to be isoforms of the same enzyme, their duplication likely a result of the duplicated Xenopus genome. We believe that the 40-kDa peptide is most likely a breakdown fragment of the larger proteins that is generated during purification. There are six reasons for this supposition. First, the 40-kDa peptide possesses catalytic activity similar to that of the larger molecules. Second, it is not found in every preparation of nuclease, and its presence appears to correlate inversely with the relative recovery of the 62/64-kDa material. Third, it is found in that portion of the nondenaturing gel in Fig. 2B that contains both the 62- and 64-kDa species and ribonuclease activity. Fourth, only the 66-kDa fraction obtained by gel filtration of crude material demonstrates specific ribonuclease activity on albumin RNA. Fifth, a peptide fragment generated with endoproteinase Glu-C digestion of the 40-kDa protein coincides with a fragment obtained from the 62- and 64-kDa species. The 40-kDa peptide is not cleaved with endoproteinase Lys-C at the concentration employed in this experiment, yet endoproteinase Lys-C digestion of the 62- and 64-kDa proteins yields the same size fragment. In fact, both endoproteinase Glu-C and alkaline protease digestion of the 62- and 64-kDa proteins yield a 40-kDa fragment (Fig. 3A, lanes 1, 2, 4, and 5). Finally, an antiserum prepared against the gel-purified 62/64-kDa species crossreacts with the 40-kDa peptide. Immunoselection with the 40-kDa peptide yields a preparation that reacts strongly with the 62/64-kDa species (Fig. 3B).

The 62- and 64-kDa proteins present in our final preparation of the nuclease are heterogeneous with respect to their isoelectric points (Fig. 4). There appear to be three forms of each protein, with isoelectric points of 9.6, 9.7, and 9.8. It is likely that the differences in pI come from posttranslational modification, such as phosphorylation. Posttranslational modification might be related to selectivity of the nuclease for 80 S ribosome complexes (but not 40 or 60 S ribosomal subunits(35) ) or the increase in enzyme activity found on polysomes following estrogen administration(34) . The destabilization of albumin mRNA can be blocked by agents such as 4-hydroxytamoxifen (which also blocks the transcriptional induction of vitellogenin(46) ), yet this process is independent of new protein synthesis(47) . The recent demonstration that adenylate cyclase can be activated by estrogen, and this activation can be blocked by antiestrogens(48) , provides a rational basis for a model in which the destabilization of the major serum protein-coding mRNAs in Xenopus liver might result from posttranslational activation of the polysomal nuclease. Experiments to address this are in progress. Since the catalytically active 40-kDa fragment is less basic (pI = 8.7) and appears to lack the heterogeneity in isoelectric point seen for the 62- and 64-kDa species, we speculate that the nuclease has at least two domains. The first is a highly basic domain which is subject to posttranslational modification and is involved in targeting the enzyme to polysomes, mRNPs, or mRNA itself. The second is a more neutral catalytic domain. Resolution of this must await the cloning of the nuclease.

As noted above, the purified polysomal nuclease is a sequence-selective enzyme, showing preference for albumin versus ferritin mRNA or a full-length albumin antisense RNA (Fig. 5). The same experiment done with RNase A yields identical decay curves for all RNAs examined (data not shown). In several experiments a curved line suggestive of a second order reaction provided the best fit for in vitro degradation of albumin mRNA. This result was puzzling as we expected a first order decay process for a reaction containing only the purified enzyme and its RNA substrate. At present we believe this results from loss of enzyme activity over time. Future studies will examine the kinetics of the degradation reaction in detail to determine the nature of this phenomenon.

Many of the properties of the purified nuclease, including the ineffectiveness of EDTA or N-ethylmaleimide to inhibit activity, the resistance to placental ribonuclease inhibitor, temperature stability, inhibition by 400 mM NaCl, and resistance of double-stranded RNA to degradation, are similar to those reported earlier for the crude enzyme extracted from liver polysomes of estrogen-treated male frogs(34) . However, a number of differences were observed with the purified nuclease. The nuclease does not require divalent cations for activity, but their presence results in increased activity (Fig. 6). Mg, Ca, or Zn all have similar effects. Little stimulation of activity was observed at concentrations below 5 mM, and maximal stimulation was observed at 10 mM. Although NaCl is not required for activity, 100 mM NaCl stimulated activity much like 10 mM MgCl(2). The exact degree of stimulation was not determined by rigorous analysis of enzyme kinetics, so at this point it is unclear whether this is an effect on the K(m) of the enzyme or results from stabilization of the secondary structure of albumin mRNA, producing a more suitable substrate for digestion.

An important step toward understanding the mechanism of substrate selectivity is to identify the precise cleavage site(s) for the nuclease on albumin mRNA. The primer extension experiment in Fig. 9localized the sites responsible for generating the 194-nt doublet cleavage products to the sequence AUUGACUGA at positions 187-195 in the transcript, with the predominant product coming from cleavage after position 193. This sequence can be thought of as a direct overlapping repeat of the sequence APyrUGA. Of those unstable mRNAs we have sequenced to date, the sequence APyrUGA is present 14 times in albumin mRNA, 9 times in transferrin mRNA, and 7 times in -fibrinogen mRNA. It is absent from ferritin mRNA. Of the 14 copies of this sequence present in albumin mRNA, 4 are in the 5` fragment used to assay the enzyme. Secondary cleavages at these sites may contribute to the disappearance of the 194-nt doublet product and to some of the other bands observe in Fig. 8and Fig. 9. It is also possible that a change in the structure of the RNA after cleavage renders secondary sites available for additional cleavage. The data in Fig. 7B indicate that the substrate transcript is not cleaved when present in double-stranded RNA. Analysis of the secondary structure of the 5` 500 nt of albumin mRNA indicates that the bases in position 187-195 are located in a single-stranded loop adjacent to a duplex stem.^2 Furthermore, this loop appears to be the major site of cleavage in the 5` portion of albumin mRNA in vivo following estrogen administration (op. cit.).

In conclusion, we present here the isolation and characterization of an estrogen-regulated ribonuclease that catalyzes the selective degradation of albumin mRNA. The properties of this enzyme indicate that a major facet of the process of mRNA turnover may be endonuclease recognition of a specific sequence element in a favorable conformation. Other factors, such as sequence-specific RNA-binding proteins, subcellular localization, and the presence of translating ribosomes may influence the in vivo selectivity of the polysomal nuclease for mRNAs encoding secreted proteins.


FOOTNOTES

*
This work was supported in part by Grant GM38277 from the National Institutes of Health (to D. R. S.). The experiments reported herein were conducted according to the principles set forth in the Guide for the Care and Use of Laboratory Animals, Institute of Animal Resources, National Research Council, Department of Health and Human Services Publication (National Institutes of Health) 78-23. All recombinant organisms and molecules were handled under conditions of the National Institutes of Health guidelines for recombinant DNA research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Supported by a Research Supplement for Underrepresented Minorities from the National Institute of General Medical Sciences and a recipient of a Ford Foundation Minority Postdoctoral Fellowship.

To whom all correspondences and reprint requests should be addressed: Dept. of Pharmacology, The Ohio State University College of Medicine, 333 West Tenth Ave., Columbus, OH 43210-1239. Tel.: 614-688-3012; Fax: 614-292-7232.

(^1)
The abbreviations used are: DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; BSA, bovine serum albumin; nt, nucleotide(s); Pipes, 1,4-piperazinediethanesulfonic acid; PAGE, polyacrylamide gel electrophoresis; Pyr, a pyrimidine.

(^2)
E. Chernokalskaya, R. E. Dompenciel, and D. R. Schoenberg, manuscript in preparation.


ACKNOWLEDGEMENTS

We thank Jeff Ross and members of the Schoenberg laboratory for their helpful suggestions and comments on this work.


REFERENCES

  1. (1993) Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
  2. Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., and Lindsten, T. (1991) Mol. Cell. Biol. 11, 3288-3295 [Abstract/Free Full Text]
  3. Brewer, G. (1991) Mol. Cell. Biol. 11, 2460-2466 [Abstract/Free Full Text]
  4. Chen, C. Y. A., You, Y., and Shyu, A. B. (1992) Mol. Cell. Biol. 12, 5748-5757 [Abstract/Free Full Text]
  5. Greenberg, M. E., and Belasco, J. G. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
  6. Shaw, G., and Kamen, R. (1986) Cell 46, 659-667 [CrossRef][Medline] [Order article via Infotrieve]
  7. Mullner, E. W., and Kuhn, L. C. (1988) Cell 53, 815-825 [CrossRef][Medline] [Order article via Infotrieve]
  8. Klausner, R. D., Rouault, T. A., and Harford, J. B. (1993) Cell 72, 19-28 [CrossRef][Medline] [Order article via Infotrieve]
  9. Harford, J. B. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
  10. Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., and Lindsten, T. (1992) J. Biol. Chem. 267, 6302-6309 [Abstract/Free Full Text]
  11. Müller, W. E. G., Slor, H., Pfeifer, K., Huhn, P., Bek, A., Orsulic, S., Ushijima, H., and Schroder, H. C. (1992) J. Mol. Biol. 226, 721-733 [CrossRef][Medline] [Order article via Infotrieve]
  12. Zhang, W., Wagner, B. J., Ehrenman, K., Schaefer, A. W., Demaria, C. T., Crater, D., Dehaven, K., Long, L., and Brewer, G. (1993) Mol. Cell. Biol. 13, 7652-7665 [Abstract/Free Full Text]
  13. Jaffrey, S. R., Haile, D. J., Klausner, R. D., and Harford, J. B. (1993) Nucleic Acids Res. 21, 4627-4631 [Abstract/Free Full Text]
  14. Henderson, B. R., Seiser, C., and Kuhn, L. C. (1993) J. Biol. Chem. 268, 27327-27334 [Abstract/Free Full Text]
  15. Ross, J. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
  16. Mclaren, R. S., and Ross, J. (1993) J. Biol. Chem. 268, 14637-14644 [Abstract/Free Full Text]
  17. Ross, J., and Kobs, G. (1986) J. Mol. Biol. 188, 579-593 [CrossRef][Medline] [Order article via Infotrieve]
  18. Ross, J., Kobs, G., Brewer, G., and Peltz, S. W. (1987) J. Biol. Chem. 262, 9374-9381 [Abstract/Free Full Text]
  19. Brewer, G., and Ross, J. (1988) Mol. Cell. Biol. 8, 1697-1708 [Abstract/Free Full Text]
  20. Bandyopadhyay, R., Coutts, M., Krowczynska, A., and Brawerman, G. (1990) Mol. Cell. Biol. 10, 2060-2069 [Abstract/Free Full Text]
  21. Coutts, M., and Brawerman, G. (1993) Biochim. Biophys. Acta 1173, 57-62 [Medline] [Order article via Infotrieve]
  22. Lowell, J. E., Rudner, D. Z., and Sachs, A. B. (1992) Genes & Dev. 6, 2088-2099 [CrossRef]
  23. Muhlrad, D., Decker, C. J., and Parker, R. (1994) Genes & Dev. 8, 855-866 [CrossRef]
  24. Muhlrad, D., and Parker, R. (1994) Nature 370, 578-581 [CrossRef][Medline] [Order article via Infotrieve]
  25. Binder, R., Hwang, S. P. L., Ratnasabapathy, R., and Williams, D. L. (1989) J. Biol. Chem. 264, 16910-16918 [Abstract/Free Full Text]
  26. Hua, J., Garner, R., and Paetkau, V. (1993) Nucleic Acids Res. 21, 155-162 [Abstract/Free Full Text]
  27. Nielsen, F. C., and Christiansen, J. (1992) J. Biol. Chem. 267, 19404-19411 [Abstract/Free Full Text]
  28. Brown, B. D., and Harland, R. M. (1990) Genes & Dev. 4, 1925-1935 [CrossRef]
  29. Brown, B. D., Zipkin, I. D., and Harland, R. M. (1993) Genes & Dev. 7, 1620-1631 [CrossRef]
  30. Binder, R., Horowitz, J. A., Basillon, J. P., Koeller, D. M., Klausner, R. D., and Harford, J. B. (1994) EMBO J. 13, 1969-1980 [Medline] [Order article via Infotrieve]
  31. Shapiro, D. J., Barton, M. C., McKearin, D. M., Chang, T. C., Lew, D., Blume, J., Nielsen, D. A., and Gould, L. (1989) Recent Prog. Horm. Res. 45, 29-64
  32. Martin, M. B., Riegel, A. T., and Schoenberg, D. R. (1986) J. Biol. Chem. 261, 2355-2361 [Abstract/Free Full Text]
  33. Pastori, R. L., Moskaitis, J. E., Buzek, S. W., and Schoenberg, D. R. (1991) Mol. Endocrinol. 5, 461-468 [Abstract/Free Full Text]
  34. Pastori, R. L., Moskaitis, J. E., and Schoenberg, D. R. (1991) Biochemistry 30, 10490-10498 [CrossRef][Medline] [Order article via Infotrieve]
  35. Pastori, R. L., and Schoenberg, D. R. (1993) Arch. Biochem. Biophys. 305, 313-319 [CrossRef][Medline] [Order article via Infotrieve]
  36. Redinbaugh, M. G., and Campbell, W. H. (1985) Anal. Biochem. 147, 144-147 [CrossRef][Medline] [Order article via Infotrieve]
  37. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  38. Cleveland, D. W., Fischer, S. G., Kirschner, M. W., and Laemmli, U. K. (1977) J. Biol. Chem. 252, 1102-1106 [Abstract/Free Full Text]
  39. Pastori, R. L., Moskaitis, J. E., Smith, L. H., and Schoenberg, D. R. (1990) Biochemistry 29, 2599-2605 [CrossRef][Medline] [Order article via Infotrieve]
  40. Schoenberg, D. R. (1981) Nucleic Acids Res. 9, 6669-6688 [Abstract/Free Full Text]
  41. Haefliger, D. N., Moskaitis, J. E., Schoenberg, D. R., and Wahli, W. (1989) J. Mol. Evol. 29, 344-354 [CrossRef][Medline] [Order article via Infotrieve]
  42. Bisbee, C. A., Baker, M. A., Wilson, A. C., Hadji-Azimi, I., and Fischberg, M. (1977) Science 195, 785-787 [Abstract/Free Full Text]
  43. Calvert, R., and Gratzer, W. B. (1978) FEBS Lett. 86, 247-249 [CrossRef][Medline] [Order article via Infotrieve]
  44. Beintema, J. J., Schuller, C., Irie, M., and Carsana, A. (1989) Prog. Biophys. Mol. Biol. 51, 165-192
  45. Karwan, R. (1993) FEBS Lett. 319, 1-4 [CrossRef][Medline] [Order article via Infotrieve]
  46. Riegel, A. T., Aitken, S. C., Martin, M. B., and Schoenberg, D. R. (1987) Mol. Endocrinol. 1, 160-167 [Abstract/Free Full Text]
  47. Moskaitis, J. E., Buzek, S. W., Pastori, R. L., and Schoenberg, D. R. (1991) Biochem. Biophys. Res. Commun. 174, 825-830 [CrossRef][Medline] [Order article via Infotrieve]
  48. Aronica, S. M., Kraus, W. L., and Katzenellenbogen, B. S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8517-8521 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
RNAHome page
Y. Peng, E. L. Murray, M. Sarkar, X. Liu, and D. R. Schoenberg
The cytoskeleton-associated Ena/VASP proteins are unanticipated partners of the PMR1 mRNA endonuclease
RNA, April 1, 2009; 15(4): 576 - 587.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. Peng, X. Liu, and D. R. Schoenberg
The 90-kDa Heat Shock Protein Stabilizes the Polysomal Ribonuclease 1 mRNA Endonuclease to Degradation by the 26S Proteasome
Mol. Biol. Cell, February 1, 2008; 19(2): 546 - 552.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yang, Y. Peng, and D. R. Schoenberg
Endonuclease-mediated mRNA Decay Requires Tyrosine Phosphorylation of Polysomal Ribonuclease 1 (PMR1) for the Targeting and Degradation of Polyribosome-bound Substrate mRNA
J. Biol. Chem., November 19, 2004; 279(47): 48993 - 49002.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Ehlers, S. Horke, K. Reumann, A. Rang, F. Grosse, H. Will, and T. Heise
Functional Characterization of the Interaction between Human La and Hepatitis B Virus RNA
J. Biol. Chem., October 15, 2004; 279(42): 43437 - 43447.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. M. Goolsby and D. J. Shapiro
RNAi-mediated depletion of the 15 KH domain protein, vigilin, induces death of dividing and non-dividing human cells but does not initially inhibit protein synthesis
Nucleic Acids Res., October 1, 2003; 31(19): 5644 - 5653.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
K. A. BREMER, A. STEVENS, and D. R. SCHOENBERG
An endonuclease activity similar to Xenopus PMR1 catalyzes the degradation of normal and nonsense-containing human {beta}-globin mRNA in erythroid cells
RNA, September 1, 2003; 9(9): 1157 - 1167.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol., April 1, 2003; 17(4): 562 - 574.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Decker and R. Parker
mRNA decay enzymes: Decappers conserved between yeast and mammals
PNAS, October 1, 2002; 99(20): 12512 - 12514.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Stevens, Y. Wang, K. Bremer, J. Zhang, R. Hoepfner, M. Antoniou, D. R. Schoenberg, and L. E. Maquat
beta -Globin mRNA decay in erythroid cells: UG site-preferred endonucleolytic cleavage that is augmented by a premature termination codon
PNAS, October 1, 2002; 99(20): 12741 - 12746.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Feng, D. N. Everly Jr., and G. S. Read
mRNA Decay during Herpesvirus Infections: Interaction between a Putative Viral Nuclease and a Cellular Translation Factor
J. Virol., November 1, 2001; 75(21): 10272 - 10280.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. L. van Dijk, J. S. Sussenbach, and P. E. Holthuizen
Kinetics and regulation of site-specific endonucleolytic cleavage of human IGF-II mRNAs
Nucleic Acids Res., September 1, 2001; 29(17): 3477 - 3486.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Heise, L. G. Guidotti, and F. V. Chisari
Characterization of Nuclear RNases That Cleave Hepatitis B Virus RNA near the La Protein Binding Site
J. Virol., August 1, 2001; 75(15): 6874 - 6883.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
K. S. Cunningham, M. N. Hanson, and D. R. Schoenberg
Polysomal ribonuclease 1 exists in a latent form on polysomes prior to estrogen activation of mRNA decay
Nucleic Acids Res., March 1, 2001; 29(5): 1156 - 1162.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. S. Cunningham, R. E. Dodson, M. A. Nagel, D. J. Shapiro, and D. R. Schoenberg
Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1
PNAS, October 23, 2000; (2000) 220425497.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
Z. Zhao, F.-C. Chang, and H. M. Furneaux
The identification of an endonuclease that cleaves within an HuR binding site in mRNA
Nucleic Acids Res., July 15, 2000; 28(14): 2695 - 2701.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Poon, B. Liu, and M. B. Taubman
Identification of a Novel Dexamethasone-Sensitive RNA-Destabilizing Region on Rat Monocyte Chemoattractant Protein 1 mRNA
Mol. Cell. Biol., October 1, 1999; 19(10): 6471 - 6478.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. H. Lee, P. Leeds, and J. Ross
Purification and Characterization of a Polysome-associated Endoribonuclease That Degrades c-myc mRNA in Vitro
J. Biol. Chem., September 25, 1998; 273(39): 25261 - 25271.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Trautwein, T. Rakemann, A. Pietrangelo, J. Plumpe, G. Montosi, and M. P. Manns
C/EBP-beta /LAP Controls Down-regulation of Albumin Gene Transcription during Liver Regeneration
J. Biol. Chem., September 6, 1996; 271(36): 22262 - 22270.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. B. Margot and D. L. Williams
Estrogen Induces the Assembly of a Multiprotein Messenger Ribonucleoprotein Complex on the 3`-Untranslated Region of Chicken Apolipoprotein II mRNA
J. Biol. Chem., February 23, 1996; 271(8): 4452 - 4460.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Garcia-Gras, P. Chi, and E. A. Thompson
Glucocorticoid-mediated Destabilization of Cyclin D3 mRNA Involves RNA-Protein Interactions in the 3'-Untranslated Region of the mRNA
J. Biol. Chem., July 14, 2000; 275(29): 22001 - 22008.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kar, L. Soong, M. Colmenares, K. Goldsmith-Pestana, and D. McMahon-Pratt
The Immunologically Protective P-4 Antigen of Leishmania Amastigotes. A DEVELOPMENTALLY REGULATED SINGLE STRAND-SPECIFIC NUCLEASE ASSOCIATED WITH THE ENDOPLASMIC RETICULUM
J. Biol. Chem., November 22, 2000; 275(48): 37789 - 37797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. N. Hanson and D. R. Schoenberg
Identification of in Vivo mRNA Decay Intermediates Corresponding to Sites of in Vitro Cleavage by Polysomal Ribonuclease 1
J. Biol. Chem., April 6, 2001; 276(15): 12331 - 12337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. D. Rodgers, Z. Wang, and M. Kiledjian
Characterization and Purification of a Mammalian Endoribonuclease Specific for the alpha -Globin mRNA
J. Biol. Chem., January 18, 2002; 277(4): 2597 - 2604.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. S. Cunningham, R. E. Dodson, M. A. Nagel, D. J. Shapiro, and D. R. Schoenberg
Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1
PNAS, November 7, 2000; 97(23): 12498 - 12502.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dompenciel, R. E.
Right arrow Articles by Schoenberg, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dompenciel, R. E.
Right arrow Articles by Schoenberg, D. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement