|
Volume 270,
Number 11,
Issue of March 17, 1995 pp. 6108-6118
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Purification
and Characterization of an Estrogen-regulated Xenopus Liver
Polysomal Nuclease Involved in the Selective Destabilization of Albumin
mRNA (*)
(Received for publication, October 26, 1994; and in revised form, January 6, 1995)
Raquel E.
Dompenciel (§),
,
Varsha R.
Garnepudi
,
Daniel
R.
Schoenberg (¶)
From the Department of Pharmacology, Uniformed Services
University of the Health Sciences, School of Medicine, Bethesda,
Maryland 20814-4799
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
A previous report from this laboratory described an
estrogen-regulated endoribonuclease activity on Xenopus liver
polysomes which had properties one might expect for a messenger
ribonuclease involved in the regulated destabilization of albumin mRNA
(Pastori, R. L., Moskaitis, J. E., and Schoenberg, D. R.(1991) Biochemistry 30, 10490-10498). This report describes the
purification and properties of this ribonuclease. The purified nuclease
fraction contained a doublet of 62 and 64 kDa and a small amount of a
40-kDa peptide. In situ analysis on both denaturing and
nondenaturing gels using an albumin transcript as substrate showed all
three proteins possess nuclease activity. Peptide mapping and Western
blot with a polyclonal antiserum showed the 62- and 64-kDa peptides to
be isoforms, and the 40-kDa peptide to be a degradation product of the
larger species. Two-dimensional gel electrophoresis further separated
the 62- and 64-kDa species into three pairs of proteins, with
isoelectric points of 9.6, 9.8, and 9.8. The purified ribonuclease
rapidly degraded a full-length albumin transcript, yet had no effect on
either a full-length albumin antisense transcript or full-length
ferritin transcript. A number of properties of the purified nuclease
were characterized, including the effects of salt, divalent cations,
EDTA, sulfhydryl reagents, and temperature. Treatment of the polysomal
nuclease with micrococcal nuclease had no effect, indicating that this
enzyme does not require an RNA cofactor for activity. Finally, primer
extension mapped the major cleavage site to an overlapping repeated
sequence APyrUGA, with cleavage between and adjacent to the two
pyrimidine residues generating fragments with 5`-hydroxyls.
INTRODUCTION
The past several years have seen significant advances in our
understanding of gene regulation through changes in mRNA stability
(reviewed in (1) ). A number of sequence elements have been
identified that, when present in a given mRNA, can alter its stability.
The best characterized examples of this are the AU-rich element found
in the 3`-untranslated region of a number of cytokine and oncogene
mRNAs (e.g. granulocyte-macrophage colony-stimulating factor,
c-fos,
c-myc,(2, 3, 4, 5, 6) )
and the iron-responsive element present in the 3`-untranslated region
of the transferrin receptor mRNA(7, 8, 9) .
It is clear that such elements can serve as binding sites for specific
proteins, such as those specific for AU-rich elements (10, 11, 12) and the iron-responsive
element-binding
protein(8, 9, 13, 14) . It is
believed that such binding promotes the degradation (in the case of
granulocyte-macrophage colony-stimulating factor or c-myc) or
stabilization (in the case of transferrin receptor) of the target mRNA. A major advance in understanding the mechanisms of regulated mRNA
turnover has been the development of in vitro degradation
systems which mimic in vivo degradative pathways for a number
of mRNAs (reviewed in (15) ). In general these systems can be
subdivided into three components: the mRNA under study, the proteins
that interact with specific sequence elements which identify such mRNA
for selective stabilization or degradation, and a nuclease or group of
nucleases that catalyze the degradative process. A number of such
nucleases have been identified in crude extracts, each of which appears
to play a role in specific mRNA degradation. Ross and co-workers (16, 17, 18) have identified a polysomal
3`-5` exonuclease that catalyzes the degradation of histone mRNA in
vitro. That group has also identified and characterized a 3`-5`
exonuclease that degrades c-myc mRNA in
vitro(19) . Bandyopadhyay et al.(20) have reported on an endonuclease present in mRNP
complexes, and a subsequent report from that laboratory described a
5`-3` exonuclease present in cytoplasmic extracts(21) . Perhaps
the best characterized mRNA degradative enzyme in eukaryotes is the
poly(A) nuclease found in Saccharomyces
cervisiae(22) . The substrate for poly(A) nuclease is the
complex of the 3` poly(A) tail with poly(A)-binding protein, which is
degraded by poly(A) nuclease in a 3`-5` manner. Parker and
co-workers have identified what they believe will be a common pathway
for non-regulated mRNA decay, in which the first committed step is
deadenylation by the poly(A) nuclease, followed by decapping and
subsequent degradation by the 5` exonuclease encoded by the XRN1 gene(23) . In addition, that laboratory recently reported
that in yeast, nonsensemediated decay proceeds through decapping and
degradation by the XRN1 nuclease without prior
deadenylation(24) . To date there are no similar data on either
constitutive mRNA turnover or nonsense-mediated mRNA turnover in higher
eukaryotes. In contrast to the decay pathways described above, there
is a growing body of evidence that regulated mRNA instability may be
affected through the action of endonucleases. Some examples of this
include the degradation of apo-very low density lipoprotein II mRNA in
avian liver (25) , interleukin 2 mRNA in T cells(26) ,
insulin-like growth factor II mRNA(27) , maternal
homeobox-containing mRNAs in Xenopus oocytes(28, 29) , Drosophila embryos(29) , and transferrin receptor mRNA(30) .
In the latter, the major endonuclease cleavage site maps to a region
adjacent to an iron-responsive element. Binding of the iron-responsive
element-binding protein to the iron-responsive element during periods
of iron deprivation may stabilize transferrin receptor mRNA by masking
this endonuclease cleavage site. In Xenopus, liver estrogen
causes a reorganization of the translational pattern for secreted
proteins from one in which the major products are the serum proteins,
to one in which the yolk protein precursor vitellogenin predominates
(reviewed in (31) )). This is accomplished by three basic
mechanisms: 1) the transcriptional induction(31, 32) ,
2) subsequent stabilization (31) of vitellogenin mRNA, and 3)
the destabilization of the mRNAs encoding the major serum
proteins(33) . The latter results in the virtual disappearance
of mRNAs for albumin, transferrin, -fibrinogen, and trypsin
inhibitor from the cytoplasm shortly after exposure to hormone. The
mRNAs encoding ferritin, poly(A)-binding protein or actin remain
unaffected by estrogen, consistent with a model in which regulation is
restricted to those mRNAs encoding secreted proteins(33) . We recently described a novel ribonuclease activity on Xenopus liver polysomes that has characteristics consistent with those of
a messenger ribonuclease(34) . Little ribonuclease activity was
detectable in polysome preparations from control male animals. However,
polysomes from estrogen-treated male frogs showed substantial
ribonuclease activity. This activity could be extracted with salt, and
the extractable material showed differential activity against albumin versus ferritin mRNA using as substrate either total liver RNA
or the 20-80 S mRNP fraction. The crude enzyme was shown to be an
endonuclease that did not require divalent cations for activity and was
not inhibited by EDTA. Similarly it was resistant to inhibition by
placental ribonuclease inhibitor and N-ethylmaleimide. The
nuclease is not a component of either ribosomal subunit, but requires
both subunits be together in an 80 S complex for its association with
polysomes(35) . In order to decipher the molecular
mechanisms involved in the estrogen regulation of albumin mRNA
stability we chose to focus on the regulation and characterization of
this enzyme. In the present report we describe the purification of this
enzyme to homogeneity and examine a number of important properties of
the purified nuclease. The purified enzyme is a substrate-selective
endonuclease which displays many of the properties described earlier (34) for the crude activity extracted from polysomes. Primer
extension analysis demonstrates that the major site of cleavage lies in
a repeat of the sequence APyrUGA, suggesting that the messenger
ribonuclease may also be considered a sequence selective enzyme.
MATERIALS AND METHODS
Subcellular Fractionation of Xenopus LiverMale
frogs (Xenopus One, Ann Arbor, MI) were injected with 1 mg of
17 -estradiol in 0.1 ml of propylene glycol/Me SO (9:1)
48 h before liver excision. All procedures were carried out at 4
°C. Livers were perfused with sterile 1 SSC (0.15 M NaCl, 0.015 M sodium citrate, pH 7.0) before excision,
then cut into small pieces and homogenized with 1.3 volumes of 40
mM Tris-HCl, pH 7.5, 10 mM MgCl , 7%
sucrose, 2 mM DTT, ( )0.2 mM PMSF, 0.5
µg/ml leupeptin, 0.7 µg/ml pepstatin, 2 µg/ml aprotinin in
a Teflon glass homogenizer. The homogenate was filtered through a
polyamide nylon mesh (Nitex 27621, Tetko, 0.5 mm). Triton X-100 was
added to a final concentration of 1%, and the homogenate was incubated
on ice for 10 min. Nuclei were removed by centrifugation at 1000
g for 10 min in a Sorvall HS4 rotor. The supernatant
was centrifuged for 15 min at 25,000 g in a Sorvall
SA600 rotor to generate a postmitochondrial extract. The
postmitochondrial supernatant was centrifuged at 100,000 g for 1 h in a Beckman 75Ti rotor to yield a polysomal pellet, which
was solubilized overnight in 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 50 mM EDTA, 0.3% Triton X-100, 0.2 mM PMSF,
0.5 µg/ml leupeptin, 0.7 µg/ml pepstatin, 2 µg/ml aprotinin
in half the original volume. This step effectively dissociates the
nuclease from ribosomal subunits. The extract was centrifuged the
following day at 106,000 g for 40 min in a Beckman
50Ti rotor. The resultant supernatant was dialyzed against 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 20% glycerol, 0.2 mM PMSF and stored at -70 °C until use.
Nuclease IsolationAll procedures were performed
at 4 °C. The dissociated polysomal extract was dialyzed against 40
mM Tris-HCl, pH 7.5, 50 mM NaCl, 2 mM DTT,
0.2 mM PMSF and applied to a series of three connected 5-ml
Econo-Pac Q (QAE) cartridges (Bio-Rad) that had been previously
equilibrated in the same buffer. The fraction that did not bind to the
QAE resin (flow-through) was dialyzed overnight in 50 mM sodium phosphate, pH 7.2, 2 mM DTT, 0.2 mM PMSF.
This material was applied to two connected Econo-Pac S (SE) 5-ml
cartridges (Bio-Rad) and eluted with a linear gradient of 0-0.5 M NaCl in the same buffer at 2 ml/min. The eluate was
monitored at 206 nm, and 2-ml fractions were collected. The fractions
containing the enzymatic activity were pooled and dialyzed overnight
against 50 mM sodium phosphate, pH 7.2, 2 mM DTT, 0.2
mM PMSF. The dialyzate was applied to a 5-ml Econo-Pac HTP
(hydroxylapatite) cartridge (Bio-Rad) and eluted at 0.5 ml/min with a
linear gradient of 0-0.5 M NaCl in the same buffer. The
eluate was monitored at 206 nm, and 1-ml fractions were collected. The
fractions containing nuclease activity were pooled, dialyzed against 40
mM Tris-HCl, pH 7.5, 2 mM DTT, 20% glycerol, 0.2
mM PMSF, and stored at -70 °C until use. All
fractions obtained during chromatographic procedures (1-10 µl
from each fraction) were tested for activity in a standardized in
vitro reaction using a P-labeled albumin transcript
(see below). Protein concentration was determined by a modified dye
binding assay (36) using bovine serum albumin as standard.
Gel Electrophoresis and Western BlotsDenaturing
polyacrylamide gel electrophoresis of protein was performed as
described by Laemmli(37) . Mini-gels (10 8 cm, 0.75 mm)
consisted of a 4% stacking gel and 12% resolving gel. Samples
(0.5-1.0 µg) were boiled for 4 min in sample buffer. Silver
stain molecular weight standards and the silver stain kit from Bio-Rad
were used for detection on gels. For Western analysis, proteins
separated by SDS-PAGE were electroblotted onto nitrocellulose membrane
(Hybond-ECL, Amersham Corp.) at 4 °C, 30 V overnight in 25 mM Tris, pH 8.3, 192 mM glycine. Membranes were blocked with
5% non-fat milk in TBST (20 mM Tris-HCl, pH 7.5, 137 mM NaCl, 0.1% Tween 20) for 1 h, followed by incubation for 1 h with
a monospecific rabbit polyclonal antibody to the polysomal nuclease
(diluted 1:10,000) that was prepared to the 62/64-kDa protein doublet
of the final pure protein excised from a preparative SDS gel. The
washed membranes were incubated for 1 h with a donkey anti-rabbit
IgG-horseradish peroxidase conjugate (1:3000). Specific complexes were
detected by enhanced chemiluminescence (Amersham). The experiment in Fig. 3used an antibody that was immunoselected against the
40-kDa nuclease fragment. The selected antibody was obtained by
excising the portion of the nitrocellulose membrane which contained the
40-kDa peptide-antibody complex and eluting the bound antibody by a
series of 3 30-s washes in 5 mM glycine HCl, pH 2.3,
0.5 M NaCl, 0.5% Tween 20, 100 µg/ml BSA. The eluates were
pooled, neutralized with phosphate-buffered saline, and incubated
overnight with the subsequent protein blot.
Figure 3:
Relationship between the 62-, 64-, and
40-kDa proteins. A, the 62-, 64-, and 40-kDa proteins present
in a 1-µg sample of the purified nuclease were separated on a 12%
SDS-PAGE. Each protein was digested separately with alkaline protease (lanes 1-3), endoproteinase Glu-C (lanes
4-6), and endoproteinase Lys-C (lanes 7-9) in
the stacking gel of a 15% SDS-PAGE for 30 min. Following
electrophoresis the proteolytic products were visualized by silver
stain. The largest species in lanes 4, 5, 7, and 8 are the intact 62- and 64-kDa proteins, respectfully. The 40-kDa
species is present as the largest band in lanes 3, 6, and 9. B, a polyclonal antiserum prepared against the
62/64-kDa doublet was diluted 1:20,000 and used to detect a Western
blot of 1 µg of a partially purified nuclease preparation (lane
2) or 1 µg of a preparation of pure polysomal nuclease which
has no contaminating 40-kDa material (lane 3). The sample in lane 4 is another lane from the blot that contains the same
pure nuclease preparation as in lane 2. This was reacted with
an immunoselected antibody that had been eluted from the 40-kDa band of
a Western blot of a nuclease preparation like that in seen Fig. 4, lane 5. The bands were detected by enhanced
chemiluminescence followed by a 10-s exposure to
Hyperfilm-ECL.
Figure 4:
Two-dimensional gel analysis of the 62-,
64-, and 40-kDa peptides. Five µg of a preparation that contained a
substantial fraction of the 40-kDa breakdown product was separated by
isoelectric focusing in the first dimension and SDS-PAGE in the second
dimension. The separated proteins were visualized by silver
staining.
Isoelectric focusing was
performed in a 10 8-cm slab gel (1.5 mm thick) consisting of 5%
acrylamide/bisacrylamide (37.5:1), 10% glycerol, 1.5% 3/10 Bio-Lyte
ampholyte, and 0.5% 8/10 Bio-Lyte ampholyte (Bio-Rad). In the
experiment shown in Fig. 4, a 5-µg sample containing both
the 62/64-kDa nuclease and the 40-kDa fragment was mixed with an equal
volume of 60% glycerol, 1.5% 3/10 ampholyte, 0.5% 8/10 ampholyte and
loaded onto the gel. The gel was focussed at 200 V for 1.5 h (4 °C)
in 25 mM NaOH (cathode) and 20 mM acetic acid
(anode). The pI of the samples was determined by the migration of
isoelectric focusing standards (Bio-Rad) run in a parallel lane. The
gel was fixed after isoelectric focusing in 10% trichloroacetic acid
for 10 min, followed by an overnight incubation in 1% trichloroacetic
acid. The gel strip containing the separated proteins was equilibrated
for 30 min in SDS sample buffer and overlaid onto the stacking gel of a
12% SDS-PAGE (10 8 cm, 1.5 mm). The separated proteins were
visualized by silver staining.
Peptide MappingPeptide mapping was performed
essentially as described by Cleveland et al.(38) . The
64-, 62-, and 40-kDa proteins containing nuclease activity were
separated first by electrophoresis on a 12% acrylamide
SDS-polyacrylamide gel. The gel was stained for 10 min in 0.05%
Coomassie Blue, 40% methanol, 10% acetic acid, then destained. The 64-,
62-, and 40-kDa bands were excised from the gel and equilibrated for 60
min in SDS gel running buffer. The gel slices were loaded into the
wells of a 15% SDS-PAGE and overlaid with 5 µl of 20% glycerol,
0.125 M Tris, pH 6.8, 0.1% SDS, 3% -mercaptoethanol,
0.005% bromphenol blue, followed by 5 µl of a protease:protein
ratio of 1:50 for alkaline protease and 1:10 for endoproteinases Lys-C
and Glu-C in 50% glycerol, 0.625 M Tris, pH 6.8, 0.5% SDS,
0.025% bromphenol blue. The gel was electrophoresed at 100 V for 15 min
and stopped for 30 min to allow for digestion, following which
electrophoresis was resumed at 200 V until the dye front reached the
bottom of the gel. The peptide pattern was visualized by silver stain.
Reconstitution AssayDenaturing SDS-polyacrylamide
gels (12%) were prepared with 220 µg of unlabeled albumin
transcript/ml of gel mix (Fig. 2A). A 2-µg sample
of the purified nuclease shown in Fig. 1, lane 5, was
denatured by incubation for 3 min at 37 °C in 6.5 mM Tris-HCl, pH 6.8, 2 mM EDTA, 10% glycerol, 0.12 M -mercaptoethanol, 1% SDS and loaded onto the gel.
Electrophoresis was performed at 4 °C. The gel was washed twice for
15 min in 25% isopropanol, 40 mM Tris-HCl, pH 7.5, followed by
three washes in 40 mM Tris-HCl, pH 7.5, for 10 min each. The
gel was incubated at 37 °C for 1.5 h in 40 mM Tris-HCl, pH
7.5, 1 mM EDTA, washed 10 min in the same buffer and stained
with 0.2% toluidine blue for 10 min. The higher temperature wash was
necessary to obtain the best clearing of the degraded transcript from
regions of the gel containing the nuclease. The gel was destained in 40
mM Tris-HCl, pH 7.5, until clear bands of ribonuclease
activity were visible against a blue background.
Figure 2:
Reconstitution of nuclease activity on
denaturing and nondenaturing gels. A, two µg of purified
nuclease shown in Fig. 1, lane 5, was electrophoresed
at 4 °C in an SDS-PAGE containing 220 µg/ml of unlabeled
albumin transcript. Following electrophoresis the gel was processed for
protein renaturation, incubated at 37 °C to enable in situ digestion of the RNA, and stained with toluidine blue. B,
one µg (lanes 2-4) or 1.5 µg (lane 5)
of the indicated samples were electrophoresed at 4 °C on a
nondenaturing polyacrylamide gel in which 3 10 dpm
of radiolabeled transcript had been incorporated. Following
electrophoresis the gel was equilibrated in reaction buffer, incubated
at 25 °C to enable in situ digestion of the RNA, dried,
and autoradiographed. C, the portion of a paired gel to that
in B, which contained nuclease activity and had not been
dried, was electrophoresed on a 12% SDS-PAGE and
silver-stained.
Figure 1:
Summary SDS-PAGE of active fractions
throughout the isolation procedure. The samples from each fractionation
step that contained enzymatic activity were analyzed on a single 12%
SDS-PAGE and visualized by silver stain. All lanes contain 0.5 µg
of protein except for lane 5 which contains 1 µg. The
starting dissociated liver polysomal extract applied to the QAE column
(QAE load) is shown in lane 2, the eluate of this column which
was applied to the SE column (SE load) is in lane 3,
the eluate of the SE column which was applied to the HTP column (HTP load) is in lane 4, and the peak of activity
from the HTP column is in lane 5 (see ``Materials and
Methods'' for details on the column fractionation
procedure).
In Fig. 2B, a native 10% polyacrylamide gel was prepared
in 8.9 mM Tris, pH 8.4, 8.9 mM boric acid, 2 mM EDTA containing 3 10 dpm/ml of a P uniformly labeled albumin transcript. The gel was
electrophoresed at 150 V for 2 h at 4 °C. It was next washed for 1
h in 40 mM Tris-HCl, pH 7.5, 10 mM MgCl ,
2 mM EDTA, 10% glycerol at 25 °C and left overnight in the
same buffer at 4 °C. The gel was dried and autoradiographed.
Ribonuclease activity was identified as a clear area on the
autoradiogram. The portion of the gel containing the activity shown in Fig. 2B was excised from a paired sample, denatured,
and electrophoresed on a 12% SDS-PAGE. Protein was detected by silver
stain (Fig. 2C).
Preparation of Radiolabeled TranscriptsThe
albumin cDNA clones used for the preparation of transcripts was
obtained from a liver library prepared in ZAP (39) and
were described previously (34) . The transcript used for
experiments in Fig. 6Fig. 7Fig. 8Fig. 9corresponded to the
first 500 nt of the 74-kDa albumin mRNA(35) . A standard
transcription reaction contained 1 µg of linearized plasmid, 40
mM Tris-HCl, pH 7.5, 6 mM MgCl , 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 20 units of
recombinant RNasin, 500 µM each ATP, GTP, UTP, 12
µM CTP, 50 µCi of [ - P]CTP
(400 Ci/mmol), and 20 units of T3 RNA polymerase. The reaction was
incubated for 30 min at 30 °C, after which the same amount of
unlabeled nucleotides were added and incubated another 30 min. The
reaction was stopped by the addition of 1 unit of RNase-free DNase
followed by incubation for 15 min at 37 °C. RNA was extracted once
with phenol/chloroform/isoamyl alcohol (25:24:1) and once with
chloroform/isoamyl alcohol. The extracted sample was separated from
unincorporated nucleotides by size exclusion chromatography through an
RNase-free Sephadex G-25 spin column, then precipitated with 0.5 volume
of 7.5 M ammonium acetate and 2.5 volumes of ethanol. The
resultant pellet was washed with ethanol, dried, and dissolved in
pyrocarbonic acid diethyl ester-treated water. 5` end-labeled
transcript was prepared by transcription with T3 polymerase in the
presence of 50 µCi of [ - P]GTP, 6000
Ci/mmol with 10 µM unlabeled GTP in the reaction mixture.
For preparation of double-stranded RNA an antisense RNA to the 5`
500-nt albumin substrate transcript was prepared by transcription of
the pBluescript plasmid bearing this cDNA with T7 RNA polymerase. One
ng of P-labeled sense transcript was mixed with 5 ng of
the unlabeled antisense transcript in 80% formamide, 40 mM Pipes, pH 6.4, 400 mM NaCl, 1 mM EDTA. The
reaction mixture was heated for 5 min at 80 °C to denature both
RNAs followed by hybridization overnight at 52 °C. The
double-stranded RNA was analyzed as described previously(34) ,
then used in the standard in vitro degradation assay.
Figure 6:
Properties of the purified polysomal
nuclease. In each experiment the basic protocol utilized 250 ng of
purified nuclease incubated at 22 °C for 30 min with 500 pg of P-labeled transcript of the 5` 500 nt of albumin mRNA in
40 mM Tris-HCl, pH 7.5, 2 mM dithiothreitol. Lane
2 is the starting transcript, lane 3 is transcript
incubated alone under the above conditions, and lane 4 shows
the result of the 30-min incubation of transcript with the nuclease. In lanes 5 and 6 the reaction mixture was supplemented
with 10 mM MgCl or 10 mM EDTA,
respectively. Lanes 7-10 show the effect of addition of
10, 50, 100, and 400 mM NaCl to the reaction buffer. Placental
ribonuclease inhibitor (20 and 100 units) was added to the reaction
mixture in lanes 11 and 12. In lanes 13-17 the purified nuclease was first heated for 5 min at 50, 60, 70,
80, and 90 °C prior to the start of the reaction. Lane 1 (M) contains a marker of end-labeled HinfI
restriction fragments of X174 DNA. The position of the 194-nt
doublet cleavage fragment is shown with the closed arrow, and
the 306-nt fragment from the 3` portion of the transcript is shown with
the open arrow.
Figure 7:
Endonuclease activity of the purified
enzyme. A, the RNA degradation assay was performed with a 5`
end-labeled albumin substrate RNA prepared by transcription in a buffer
containing [ - P]GTP. Lanes 2 and 3 contain RNA incubated at 4 and 22 °C, respectively, with
no added nuclease. The cleavage of the end-labeled transcript by the
nuclease is shown in lane 4. B, double-stranded RNA
was prepared by hybridization of a P-labeled albumin sense
transcript with an excess of unlabeled antisense transcript. Lanes
2 and 3 are the same controls as in A.Lane
4 is a control for the standard digestion of albumin sense
transcript with 250 ng of purified nuclease. Lane 5 consists
of double-stranded RNA incubated without added nuclease, and lane 6 shows the effect of the same RNA incubated with the purified
nuclease. Lane 1 contains X174 HinfI fragments
as size markers. The arrowhead on both gels shows the position
of the 194-nt doublet cleavage product.
Figure 8:
Evidence that an RNA cofactor is not
required for nuclease activity. P-Labeled albumin
substrate transcript was incubated for 30 min at 22 °C in the
absence of added nuclease (lane 1), with purified polysomal
nuclease (lane 2), with micrococcal nuclease (MNase)
at 20 °C for 15 min (lane 3), followed by 10 mM EGTA to stop the reaction (lane 3), or with micrococcal
nuclease in buffer containing 10 mM EGTA (lane 4). In
the reaction shown in lane 5, purified nuclease was incubated
first with micrococcal nuclease for 15 min at 20 °C, followed by 10
mM EGTA to stop the reaction. This was then added to
radiolabeled albumin substrate transcript and incubated under standard
reaction conditions. The arrow shows the position of the
194-nt doublet cleavage product.
Figure 9:
Determination of the nuclease cleavage
site on the substrate transcript. The substrate transcript was digested
for 30 min at 22 °C with purified nuclease, extracted with phenol,
and ethanol-precipitated. The product of this reaction was annealed
with an endlabeled oligonucleotide complementary to a site 311 nt from
the 5` end of the RNA followed by primer extension with reverse
transcriptase. Samples from duplicate reactions were applied to the gel (lanes 5 and 6). Lane 7 is a control primer
extension performed on undigested RNA. The position of the cleavage
sites was determined relative to a dideoxy sequencing ladder generated
with the same primer, cloned albumin cDNA and modified T7 DNA
polymerase (lanes 1-4).
In Vitro Assay for Ribonuclease ActivityThe
standard reaction was performed in a 20-µl reaction mixture
containing 40 mM Tris-HCl, pH 7.5, 2 mM DTT, 10
µg of liver RNA, 500 pg of radiolabeled transcript, similar to the
assay described previously(34, 35) . All components
were assembled on ice. The desired amount of protein was added (from 10
µg of polysomal extracts to 250 ng of an HTP active fraction)
followed by a 30-min incubation at 22 °C. Reactions were terminated
by the addition of an equal volume of stop solution (95% formamide, 20
mM EDTA, pH 8.0, 0.1% xylene cyanol, 0.1% bromphenol blue).
Samples were denatured by heating at 68 °C for 10 min and
electrophoresed at 70 watts for 1.5 h in a 6% acrylamide, 8 M urea gel. The dried gel was autoradiographed on Kodak X-Omat XAR-5
film. Specific nuclease activity was identified by the degradation of
the 500-nt transcript and the generation of a characteristic 194-nt
doublet cleavage fragment as described by Pastori et
al.(34) . Micrococcal nuclease treatment of either the
purified nuclease or albumin substrate transcript (Fig. 8) was
accomplished by the addition of 5 10 units
to a 10-µl volume containing 20 mM HCl, pH 7.5, 2 mM CaCl . The reaction was terminated after 15 min at 20
°C by the addition of 10 mM EGTA, following which the
sample was assayed for nuclease activity.
Kinetic Analysis of mRNA DegradationFull-length P-labeled albumin mRNA was prepared by in vitro transcription with T3 RNA polymerase from a pBluescript
SK(-) plasmid bearing the cloned 74-kDa albumin cDNA. A
full-length P-labeled albumin antisense RNA was generated
by transcription of the same cloned cDNA with T7 RNA polymerase.
Full-length P-labeled ferritin mRNA was prepared in the
same manner by transcription of a pBluescript plasmid with T7 RNA
polymerase. Six-hundred pg of each transcript was incubated with 300 ng
of purified nuclease in a 25-µl volume containing 40 mM Tris-HCl, pH 7.5, 2 mM dithiothreitol, 2 units/µl
placental ribonuclease inhibitor, 1 µg/µl BSA, and 0.5
µg/µl yeast tRNA. Five-µl samples were removed at 0, 5, 10,
20, and 30 min of incubation at 22 °C. The reaction was stopped by
the addition of an equal volume of stop solution (95% formamide, 20
mM EDTA, pH 8.0, 0.1% xylene cyanole, 0.1% bromphenol blue).
All samples were heated at 68 °C for 10 min prior to
electrophoresis on a 6% acrylamide, 8 M urea gel. The overall
pattern of degradation was visualized by autoradiography of the dried
gel, and RNA decay was quantified using a Molecular Dynamics
PhosphorImager.
Mapping in Vitro Cleavage Sites by Primer
ExtensionOne and one-half µg of unlabeled albumin substrate
transcript was treated with or without 500 ng of purified nuclease for
30 min at 22 °C to generate the substrate for primer extension
analysis. Ten ng of a 5` end-labeled primer (5` CACTCAGGAGTTTTGTCATTAA)
complementary to a site 311 nt from the 5` end of the transcript was
added to the products of the nuclease cleavage reaction dissolved in a
20-µl volume containing 10 mM Tris-HCl, pH 7.9, 250 mM KCl, 1 mM EDTA. This mixture was heated at 65 °C for
5 min and slowly cooled to room temperature. The samples were extracted
with phenol, ethanol-precipitated, and dissolved in a 50 µl volume
containing 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3
mM MgCl , 10 mM dithiothreitol, 0.33
mM each dATP, dCTP, dGTP, and TTP and 100 units of Moloney
murine leukemia virus reverse transcriptase. Primer extension was
performed at 42 °C for 1.5 h. The extension products recovered by
ethanol precipitation were dissolved in 4 µl of formamide loading
solution plus 2 µl of 0.1 N NaOH. These were denatured in
a boiling water bath for 5 min and immediately electrophoresed on a
denaturing 6% acrylamide gel. A DNA sequencing ladder prepared from the
cloned cDNA using the same primer, and modified T7 DNA polymerase
(Sequenase) was run in adjacent lanes of the gel to provide a standard
for localization of the cleavage sites.
RESULTS
Chromatographic Separation of the Polysomal
NucleaseThe estrogen-regulated polysomal nuclease generates a
194-doublet cleavage fragment from a P-labeled transcript
of the 5` end of albumin mRNA(34, 35) . This property
was used to assay activity throughout the purification. The nuclease
was purified by sequential fast protein liquid chromatography on QAE
strong anion exchange resin, SE strong cation exchange resin, and
hydroxylapatite (HTP). Details of the purification steps are presented
under ``Materials and Methods.'' An SDS-PAGE summarizing each
step in the purification of the nuclease is shown in Fig. 1. Gel
exclusion chromatography of a crude liver extract indicated that the
enzyme of interest had a molecular mass of approximately 66 kDa (data
not shown). The final product obtained from the HTP column (fractions 9
and 10) consisted of a pair of bands at 62 and 64 kDa, corresponding to
88% of the protein by densitometry, and a band at 40 kDa corresponding
to 12% of the protein. In this gel, lanes 2-4 each
contain 0.5 µg of protein, whereas lane 5 contains 1
µg. A greater amount of the final product was loaded in this lane
to demonstrate that, within the limits of detection, only the 62/64-kDa
doublet and a small amount of a 40-kDa peptide are present in this
fraction. The 62/64-kDa doublet is undetectable in the material loaded
onto the QAE or SE columns and is barely detectable in the material
loaded onto the HTP column.We operationally define 1 unit of the
polysomal nuclease as that which causes the disappearance of 1 ng of a P-labeled 5` 500-nt albumin transcript completely in 30
min at 22 °C. The activities of each of the column fractions were
determined by PhosphorImager analysis of the surviving transcript on
acrylamide/urea gels. Linear plots of the degree of substrate
disappearance with time for each of the column fractions were then used
to calculate the purification data in Table 1. By this approach
we determined the overall purification was 235-fold for the final
fraction obtained from the HTP column compared with the starting
polysomal extract. This number is likely a significant underestimate of
the actual fold purification (see ``Discussion'').
Evidence That the Purified Products Possess Nuclease
ActivityAny one of the protein products detected in the final
HTP fraction could be the nuclease which cleaves albumin mRNA.
Alternatively, the nuclease could be a different protein present in
such small amounts that it was not detected by silver stain. A number
of different approaches were used to address this issue. The experiment
shown in Fig. 2A employed SDS-PAGE in conjunction with an in
situ gel assay to identify proteins with nuclease activity. In
this experiment, 2 µg of the purified nuclease from the HTP column
shown in Fig. 1, lane 5, was denatured and
electrophoresed on a 12% SDS-PAGE in which unlabeled albumin 5`
transcript had been polymerized (see ``Materials and
Methods''). After electrophoresis the gel was subject to
renaturation conditions, incubated at 37 °C to enable the nuclease
to digest the incorporated RNA, and stained with toluidine blue. In
this assay, bands containing nuclease activity are visualized as areas
of decreased staining by toluidine blue. The data in Fig. 2A show a pattern identical to the silver stain of the applied
sample; a doublet of 62 and 64 kDa, and a lesser amount of activity at
40 kDa.Further confirmation that the proteins identified in Fig. 1possess nuclease activity was obtained by native
(nondenaturing) gel electrophoresis (Fig. 2B). In this
experiment, radiolabeled albumin transcript was incorporated into the
gel and 1 µg (lanes 2-4) or 1.5 µg (lane
5) of the indicated samples were electrophoresed at 4 °C. The
gel was equilibrated in reaction buffer, incubated at 25 °C to
allow for in situ digestion of the radiolabeled transcript,
washed, dried, and autoradiographed. The nuclease that generates the
194-doublet cleavage product is a basic protein as evidenced by its
inability to bind to QAE and its behavior in preparative isoelectric
focusing (see below). We anticipated that it would barely enter the
gel, whereas other nucleases would likely fractionate throughout. The
data in Fig. 2B confirm this. Electrophoresis of the
crude Triton-EDTA extract (QAE load, lane 2) resulted in
clearing over one-half of the length of the gel. A similar pattern of
nuclease activity was observed in that which eluted in the unbound
fraction of the QAE column (SE load, lane 3). The presence of
nuclease activity only at the top of the gel in the sample obtained
from the SE column (HTP load, lane 4) indicated that this
column separated the enzyme under study from most other contaminating
nucleases. Similarly, clearing was only observed at the top of the lane
containing the purified nuclease (lane 5). It should be noted
that the stronger signal here resulted from the use of a larger amount
(1.5 µg) of a more purified protein fraction than was loaded onto lane 4. To identify which proteins were responsible for the
nuclease activity in lane 5, this portion of the gel was
excised and fractionated by SDS-PAGE. Silver staining reveals only the
presence of the 62/64-kDa doublet and a small amount of the 40-kDa
peptide (Fig. 2C, lane 7). We have also extracted the
62/64-kDa doublet and the 40-kDa peptide from SDS gels, renatured these
samples, and found that they both contain nuclease activity (data not
shown). Taken together, these data prove that the proteins eluted from
the HTP column correspond to the nuclease which generates the unique
cleavage of albumin mRNA in vitro.
Relationship between the 62-, 64-, and 40-kDa
PeptidesIt is clear from the preceding data that all three of
the identified proteins possess nuclease activity. The question then
becomes what is the relationship among these proteins? The presence of
a peptide doublet at 62 and 64 kDa is reminiscent of the doublet
albumin peptide(40, 41) which arose from the
duplication of the Xenopus genome(41, 42) .
To determine the relationship between the 62- and 64-kDa proteins, as
well as the nature of the 40-kDa protein, we performed the peptide
mapping experiment shown in Fig. 3A. One µg of
purified nuclease was separated by electrophoresis on a 12% SDS-PAGE
that was over-run to maximize separation of the three protein species.
The gel was stained with Coomassie Blue, and the 64-, 62-, and 40-kDa
bands were excised from the gel. In situ partial proteolysis
of the separated proteins was performed as described previously (38) with alkaline protease, endoproteinase Glu-C and
endoproteinase Lys-C. The patterns obtained for the 62- and 64-kDa
peptides following each protease digestion are very similar (lanes
1, 2, 4, 5, 7, and 8), indicating a high degree of
homology(43) . Although at present we cannot rule out the
possibility that the 62-kDa protein is a processed or proteolytically
cleaved form of the 64-kDa species, we believe it most likely that the
62- and 64-kDa proteins are products of a duplicated gene. Based on the
fact that endoproteinase Lys-C, endoproteinase Glu-C, and alkaline
protease all generate a 40-kDa peptide which itself is not cut by
endoproteinase Lys-C, and the fact that the 40 kDa peptide retains
enzymatic activity, our data suggest it may be a breakdown fragment of
the larger proteins that is generated by hydrolysis of a particularly
labile peptide bond or series of peptide bonds (see below and
``Discussion'').Further proof of the relationship between
the 40- and 62/64-kDa proteins was obtained by Western blot. A
polyclonal antiserum was prepared in one rabbit, using as antigen the
62/64-kDa material excised from an SDS-PAGE of the purified nuclease.
This antiserum reacts with both the 62/64-kDa doublet and the 40-kDa
band when used to study preparations that contain both species (like
that shown in Fig. 1, lane 5, data not shown). To
determine whether the 40- and 62/64-kDa species are related, the
antibody bound to the 40-kDa band was eluted from the membrane and used
to probe a Western blot of a preparation of pure nuclease that
contained no detectable 40-kDa species by silver stain. The data in Fig. 3B, lane 4, demonstrate that the antibody selected
against the 40-kDa peptide reacts with the 62/64-kDa species. This
result provides further proof that the 40-kDa peptide is related to the
62/64-kDa species. For the purpose of comparison, lanes 2 and 3 of Fig. 3B show blots of adjacent lanes of
the same gel containing partially purified material obtained from the
SE column (Fig. 1, HTP load, lane 4) and the pure
nuclease used in lane 4 probed with the unfractionated
antiserum. The unfractionated antiserum identifies the 62/64-kDa
species in both cases, and upon longer exposure, the 40-kDa species can
be seen in the partially purified material in lane 2 (data not
shown).
Two-dimensional Gel Analysis of the 62/64-kDa Nuclease
and the 40-kDa Degradation FragmentTo characterize further both
the nature of the parent nuclease and the relationship between the 62-,
64-, and 40-kDa proteins, a preparation containing all three was
analyzed by isoelectric focusing followed by SDS-PAGE (Fig. 4).
Isoelectric focusing separated the 62/64-kDa doublet into three pairs
of proteins of the same size but isoelectric points of 9.6, 9.7, and
9.8. These data indicate that the parent ribonuclease is a highly basic
protein that has undergone posttranslational modification, most likely
phosphorylation, to yield a group of proteins. Only a single species of
the catalytically active 40-kDa peptide with an isoelectric point of
8.7 was observed.
Selectivity of the Polysomal Nuclease for Albumin
mRNAAn earlier study showed that the stability of ferritin mRNA
was unaffected by the processes that destabilized albumin mRNA
following estrogen administration in vivo(33) . If
regulated mRNA instability involved the activation or induction of a
nuclease with selectivity for specific mRNA species, one might expect
that the enzyme responsible for the degradation of albumin mRNA should
retain some degree of the substrate selectivity observed in
vivo. The issue of substrate selectivity was addressed by the
experiment in Fig. 5. In this experiment full-length transcripts
for albumin mRNA and ferritin mRNA, and a full-length transcript of the
antisense strand of albumin mRNA, were used to examine the kinetics of
degradation by the purified nuclease. Fig. 5A (top) shows a short exposure (4 h) of that portion of the
gel bearing the full-length mRNAs. Albumin mRNA was rapidly degraded by
the purified nuclease, whereas little degradation was observed for the
antisense albumin transcript, and ferritin mRNA remained stable
throughout the time course. These data were quantified with a
PhosphorImager, and a kinetic analysis of their in vitro stabilities is shown in Fig. 5B. The results
confirm that ferritin mRNA (closed boxes) and albumin
antisense RNA (open circles) remained resistant to degradation
by the polysomal nuclease throughout the 30-min time course. In
contrast, albumin mRNA (closed circles) was rapidly degraded,
showing a half-life of 9 min. A longer exposure of the gel (20 h) shown
in Fig. 5C shows that the only discernible degradation
product is the 194-doublet cleavage product (arrow) derived
from the 5` end of albumin mRNA (see below). In this one experiment the
reaction mixture included 1 µg/µl nuclease-free BSA to
stabilize the enzyme against loss of activity over time. The dense band
present one-third of the way down the gel in all samples is an artifact
that results from its presence in the reaction mixture.
Figure 5:
Selectivity of the purified nuclease for
albumin mRNA. Uniformly labeled full-length transcripts of albumin
mRNA, the antisense strand of albumin mRNA, and ferritin mRNA were
incubated with the purified nuclease at 22 °C. Portions of the
reaction mixture were removed at the indicated times and
electrophoresed on a urea/acrylamide gel. A 4-h exposure of that
portion of the gel containing the full-length mRNAs is shown in A, and a quantitative analysis of the disappearance of these
RNAs is shown in B ( , albumin mRNA; , ferritin
mRNA; , albumin antisense transcript). A 20-h exposure of the
entire gel is shown in C, with the arrow indicating
the position of the characteristic 194-nt doublet cleavage
fragment.
Properties of the Purified Polysomal NucleaseThe
properties of the purified polysomal nuclease were characterized by the
effect of various treatments on its activity in a standardized in
vitro degradation assay. As described in our earlier
studies(34, 35) , this assay measures the degradation
of a P-labeled transcript corresponding to the 5` 500 nt
of albumin mRNA as well as the generation of a characteristic doublet
cleavage product of approximately 194 nt (shown with a closed arrow in Fig. 6) which comes from the 5` portion of the
transcript. In some experiments the corresponding fragment from the 3`
portion of the transcript can also be seen (open arrow). The
controls of substrate transcript incubated with and without added
nuclease are shown in Fig. 6, lanes 4 and 3,
respectively. The next lanes show the effects of Mg ,
EDTA, NaCl, placental ribonuclease inhibitor, and temperature on
activity of the purified nuclease. Enzymatic activity was increased by
the addition of 10 mM MgCl (lane 5);
however, 10 mM EDTA (lane 6) did not lower the basal
enzymatic activity observed with the control reaction in just Tris
buffer and 2 mM dithiothreitol (lane 4). It therefore
appears that, although the nuclease does not require
Mg , its activity is enhanced by this divalent cation.
This is a general effect of divalent cations, as similar results were
obtained with 10 mM Ca and Zn ions. There was little effect of divalent cations below 5 mM (data not shown).The data in lanes 7-10 show
the effect of 10, 50, 100, and 400 mM NaCl on the activity of
the purified enzyme. Ten mM NaCl gave the same result as the
control (lane 4). However, 50 mM NaCl resulted in
more substantial substrate degradation (lane 8) and still
greater degradation was obtained at 100 mM NaCl (lane
9). It is interesting to note that at this higher salt
concentration there was also preferential accumulation of the
194-doublet cleavage product. The significance of this is unclear,
although this higher salt concentration might stabilize the major
cleavage product. Addition of 400 mM NaCl resulted in the
inactivation of the purified nuclease (lane 10). Most
ribonucleases related to the RNase A family of enzymes can be inhibited
by placental ribonuclease inhibitor (RNasin(TM)). Addition of either
20 units (lane 11) or 100 units (lane 12) of
recombinant RNasin increased enzymatic activity. We have been able to
achieve the same effect with bovine serum albumin, suggesting that this
effect is due to stabilization of the nuclease at the low protein
concentration used in the assay (see below). Control experiments
demonstrated that neither the RNasin or BSA preparations used in these
experiments possess nuclease activity in our assay (data not shown).
The sulfhydryl reagent N-ethylmaleimide had no effect on the
activity of the purified nuclease (data not shown). Last, the relative
temperature stability of the purified nuclease was examined. Lanes
13-17 show the effect of a 5-min incubation at 50, 60, 70,
80, and 90 °C prior to the start of the reaction. The nuclease
activity was unaffected by incubation at 50 and 60 °C (compare lanes 13 and 14 with lane 4) and was
inactivated at 70 °C and above. Thus, the nuclease is relatively
temperature-stable. It should be noted that all of the experiments in
this paper were performed at the optimal pH for activity of the
nuclease (7.5).
Evidence That the Purified Enzyme Is a Single
Strandspecific EndonucleaseIn our previous study (34) we characterized the crude estrogen-induced enzyme as an
endonuclease by its ability to generate the same 194-doublet cleavage
fragment from uniformly labeled or end-labeled transcript. The
experiment in Fig. 7A shows that the purified nuclease
generates the same 194-nt doublet cleavage product with a 5`
end-labeled transcript as was observed in Fig. 6with uniformly
labeled transcript. This reaffirms that the enzyme under study is an
endonuclease. The 300-nt 3` cleavage product could be labeled directly
by a forward reaction (as opposed to an exchange reaction) with
[ - P]ATP and polynucleotide kinase with or
without prior treatment with alkaline phosphatase. The generation of
products with a free 5`-hydroxyl is a property common to many
ribonucleases (44) .The preceding experiments were all
performed with the albumin sense transcript alone. The experiment in Fig. 7B was a first step toward addressing the role of
RNA structure and/or conformation as it relates to cleavage by the
polysomal nuclease. In this experiment a double-stranded RNA was
generated by hybridizing an excess of unlabeled albumin antisense
transcript to the radiolabeled sense strand. Whereas the radiolabeled
sense strand alone was degraded by the purified nuclease (lane
4), the hybrid formed with the antisense strand was resistant to
digestion (lane 6). It is highly unlikely that the inhibition
observed resulted from competition by excess unhybridized antisense RNA
because inclusion of 10 µg of either liver RNA or tRNA have no
effect on the degradation of the substrate transcript, and the nuclease
does not degrade albumin antisense RNA (see Fig. 5). The band
that migrated slightly faster than the substrate transcript in lane
6 results from incomplete denaturation of the duplexed RNA and is
not a product of nuclease degradation. We conclude that there must be
structural features of albumin mRNA that are important in either the
mechanisms of targeting or degradation by the nuclease.
Evidence That the Polysomal Nuclease Does Not Require an
RNA CofactorA number of ribonucleases involved in RNA
processing events (e.g. RNase P and RNase MRP(45) )
possess an RNA cofactor that is essential for activity. To address
whether an RNA cofactor is required for activity by the Xenopus liver polysomal nuclease the purified enzyme was treated with
micrococcal nuclease as shown in the experiment in Fig. 8. Lane 2 shows the degradation of radiolabeled albumin
transcript by the purified nuclease under our standard reaction
conditions. Substitution of 5 10 units of
micrococcal nuclease for the polysomal nuclease (lane 3)
resulted in the nonspecific degradation of the substrate transcript.
This degradation was prevented by co-addition of 10 mM EGTA (lane 4). In lane 5, 250 ng of purified nuclease was
incubated first with micrococcal nuclease as in lane 3. Ten
mM EGTA was then added to inactivate micrococcal nuclease
followed by incubation with the substrate transcript. Pretreatment with
micrococcal nuclease had no effect on the ability of the polysomal
nuclease to degrade albumin mRNA. We conclude from these results that
the polysomal nuclease does not require an RNA cofactor and/or that a
catalytic RNA is not responsible for nucleolytic activity present in
our purified preparation.
Identification of Major Cleavage Sites within the Albumin
5` Substrate TranscriptThe availability of the nuclease in a
highly purified form allowed us to map the sites of cleavage
responsible for generating the 194-doublet cleavage products. In the
experiment in Fig. 9, 1.5 µg of unlabeled substrate RNA was
digested with 500 ng of purified nuclease for 30 min at 22 °C (lanes 5 and 6). A control of undigested RNA was also
analyzed (lane 7). The reaction products were analyzed by
primer extension using an end-labeled oligonucleotide complementary to
a site 311 nt within the body of the transcript. Two major cleavage
sites (arrows) were detected by this method in addition to a
number of polymerase pause sites present in all lanes. The position of
the major cleavage sites within the sequence of this portion of albumin
mRNA is shown by the arrows in the right-hand panel,
with the size of the arrow indicative of the relative strength
of the observed signal on the gel. The numbers above the
sequence refer to the position relative to the 5` end of the transcript
and the numbers in parentheses correspond to the actual
position in albumin mRNA, the difference coming from polylinker
sequences of the plasmid vector. The 194-nt doublet cleavage product
resulted from cleavages at positions 188 and 193 between two pyrimidine
residues in AUUGA and between the U and G residues in the adjacent
overlapping sequence ACUGA (see ``Discussion'').
DISCUSSION
This is the first report of the isolation and
characterization of a ribonuclease involved in regulated mRNA turnover
in higher eukaryotes. Several lines of evidence point to this protein
as being important in the destabilization of albumin mRNA following
estrogen administration. First, the amount of enzymatic activity is
significantly increased following estrogen administration. Second, this
activity shows differential substrate selectivity for albumin versus ferritin mRNA that mirrors the relative stabilities of
these mRNAs in vivo after hormone treatment(33) .
Third, breakdown products identified in liver RNA after estrogen
administration result from cleavage in vivo at the same sites
as cleaved in vitro by the purified nuclease. ( ) Throughout these prior studies we used the ability of
the polysomal nuclease to generate a doublet 194-nt cleavage product
from a 500-nt 5` albumin transcript as an assay for the specific
estrogen-inducible activity. This property was used here to follow the
purification of the nuclease and to characterize some properties of the
purified enzyme. Although the major site of cleavage is that which
generates the 194-nt doublet product (Fig. 9), the product
generated by this is itself subject to further cleavage by the
nuclease. Because of this we had to rely on the disappearance of the
substrate transcript for calculating the specific activity of the
polysomal nuclease throughout its purification. By this method an
overall 235-fold purification was obtained from the crude polysomal
extract to the final product from the HTP column. It is likely this is
a significant underestimate of the true magnitude of purification. The
data in Fig. 2B indicate that there are many nucleases
present in the crude polysomal extract. The 77 units/mg calculated for
this material represents the sum of the activities of all of these
nucleases, of which the enzyme of interest likely represents only a
small fraction. Further confounding these data is the presence of an
endogenous inhibitor of the polysomal nuclease that we described
previously(34) . It is unclear to what degree this inhibitor
alters the observed specific activity, at which step in the
purification it is removed, or indeed how strongly it binds to, and
inhibits the action of the nuclease. Based on the purification and in situ gel reconstitution data, we believe that the
biologically active form of the nuclease is represented in the 62- and
64-kDa species. As noted above, peptide mapping data indicate these to
be isoforms of the same enzyme, their duplication likely a result of
the duplicated Xenopus genome. We believe that the 40-kDa
peptide is most likely a breakdown fragment of the larger proteins that
is generated during purification. There are six reasons for this
supposition. First, the 40-kDa peptide possesses catalytic activity
similar to that of the larger molecules. Second, it is not found in
every preparation of nuclease, and its presence appears to correlate
inversely with the relative recovery of the 62/64-kDa material. Third,
it is found in that portion of the nondenaturing gel in Fig. 2B that contains both the 62- and 64-kDa species
and ribonuclease activity. Fourth, only the 66-kDa fraction obtained by
gel filtration of crude material demonstrates specific ribonuclease
activity on albumin RNA. Fifth, a peptide fragment generated with
endoproteinase Glu-C digestion of the 40-kDa protein coincides with a
fragment obtained from the 62- and 64-kDa species. The 40-kDa peptide
is not cleaved with endoproteinase Lys-C at the concentration employed
in this experiment, yet endoproteinase Lys-C digestion of the 62- and
64-kDa proteins yields the same size fragment. In fact, both
endoproteinase Glu-C and alkaline protease digestion of the 62- and
64-kDa proteins yield a 40-kDa fragment (Fig. 3A, lanes 1,
2, 4, and 5). Finally, an antiserum prepared against the
gel-purified 62/64-kDa species crossreacts with the 40-kDa peptide.
Immunoselection with the 40-kDa peptide yields a preparation that
reacts strongly with the 62/64-kDa species (Fig. 3B). The 62- and 64-kDa proteins present in our final preparation of the
nuclease are heterogeneous with respect to their isoelectric points (Fig. 4). There appear to be three forms of each protein, with
isoelectric points of 9.6, 9.7, and 9.8. It is likely that the
differences in pI come from posttranslational modification, such as
phosphorylation. Posttranslational modification might be related to
selectivity of the nuclease for 80 S ribosome complexes (but not 40 or
60 S ribosomal subunits(35) ) or the increase in enzyme
activity found on polysomes following estrogen
administration(34) . The destabilization of albumin mRNA can be
blocked by agents such as 4-hydroxytamoxifen (which also blocks the
transcriptional induction of vitellogenin(46) ), yet this
process is independent of new protein synthesis(47) . The
recent demonstration that adenylate cyclase can be activated by
estrogen, and this activation can be blocked by
antiestrogens(48) , provides a rational basis for a model in
which the destabilization of the major serum protein-coding mRNAs in Xenopus liver might result from posttranslational activation
of the polysomal nuclease. Experiments to address this are in progress.
Since the catalytically active 40-kDa fragment is less basic (pI
= 8.7) and appears to lack the heterogeneity in isoelectric
point seen for the 62- and 64-kDa species, we speculate that the
nuclease has at least two domains. The first is a highly basic domain
which is subject to posttranslational modification and is involved in
targeting the enzyme to polysomes, mRNPs, or mRNA itself. The second is
a more neutral catalytic domain. Resolution of this must await the
cloning of the nuclease. As noted above, the purified polysomal
nuclease is a sequence-selective enzyme, showing preference for
albumin versus ferritin mRNA or a full-length albumin
antisense RNA (Fig. 5). The same experiment done with RNase A
yields identical decay curves for all RNAs examined (data not shown).
In several experiments a curved line suggestive of a second order
reaction provided the best fit for in vitro degradation of
albumin mRNA. This result was puzzling as we expected a first order
decay process for a reaction containing only the purified enzyme and
its RNA substrate. At present we believe this results from loss of
enzyme activity over time. Future studies will examine the kinetics of
the degradation reaction in detail to determine the nature of this
phenomenon. Many of the properties of the purified nuclease,
including the ineffectiveness of EDTA or N-ethylmaleimide to
inhibit activity, the resistance to placental ribonuclease inhibitor,
temperature stability, inhibition by 400 mM NaCl, and
resistance of double-stranded RNA to degradation, are similar to those
reported earlier for the crude enzyme extracted from liver polysomes of
estrogen-treated male frogs(34) . However, a number of
differences were observed with the purified nuclease. The nuclease does
not require divalent cations for activity, but their presence results
in increased activity (Fig. 6). Mg ,
Ca , or Zn all have similar effects.
Little stimulation of activity was observed at concentrations below 5
mM, and maximal stimulation was observed at 10 mM.
Although NaCl is not required for activity, 100 mM NaCl
stimulated activity much like 10 mM MgCl . The
exact degree of stimulation was not determined by rigorous analysis of
enzyme kinetics, so at this point it is unclear whether this is an
effect on the K of the enzyme or results from
stabilization of the secondary structure of albumin mRNA, producing a
more suitable substrate for digestion. An important step toward
understanding the mechanism of substrate selectivity is to identify the
precise cleavage site(s) for the nuclease on albumin mRNA. The primer
extension experiment in Fig. 9localized the sites responsible
for generating the 194-nt doublet cleavage products to the sequence
AUUGACUGA at positions 187-195 in the transcript, with the
predominant product coming from cleavage after position 193. This
sequence can be thought of as a direct overlapping repeat of the
sequence APyrUGA. Of those unstable mRNAs we have sequenced to date,
the sequence APyrUGA is present 14 times in albumin mRNA, 9 times in
transferrin mRNA, and 7 times in -fibrinogen mRNA. It is absent
from ferritin mRNA. Of the 14 copies of this sequence present in
albumin mRNA, 4 are in the 5` fragment used to assay the enzyme.
Secondary cleavages at these sites may contribute to the disappearance
of the 194-nt doublet product and to some of the other bands observe in Fig. 8and Fig. 9. It is also possible that a change in
the structure of the RNA after cleavage renders secondary sites
available for additional cleavage. The data in Fig. 7B indicate that the substrate transcript is not cleaved when present
in double-stranded RNA. Analysis of the secondary structure of the 5`
500 nt of albumin mRNA indicates that the bases in position
187-195 are located in a single-stranded loop adjacent to a
duplex stem. Furthermore, this loop appears to be the major
site of cleavage in the 5` portion of albumin mRNA in vivo following estrogen administration (op. cit.). In
conclusion, we present here the isolation and characterization of an
estrogen-regulated ribonuclease that catalyzes the selective
degradation of albumin mRNA. The properties of this enzyme indicate
that a major facet of the process of mRNA turnover may be endonuclease
recognition of a specific sequence element in a favorable conformation.
Other factors, such as sequence-specific RNA-binding proteins,
subcellular localization, and the presence of translating ribosomes may
influence the in vivo selectivity of the polysomal nuclease
for mRNAs encoding secreted proteins.
FOOTNOTES
- *
- This work
was supported in part by Grant GM38277 from the National Institutes of
Health (to D. R. S.). The experiments reported herein were conducted
according to the principles set forth in the Guide for the Care and Use
of Laboratory Animals, Institute of Animal Resources, National Research
Council, Department of Health and Human Services Publication (National
Institutes of Health) 78-23. All recombinant organisms and molecules
were handled under conditions of the National Institutes of Health
guidelines for recombinant DNA research. The costs of publication of
this article were defrayed in part by the payment of page charges. This
article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- Supported by a Research Supplement for
Underrepresented Minorities from the National Institute of General
Medical Sciences and a recipient of a Ford Foundation Minority
Postdoctoral Fellowship.
- ¶
- To whom all
correspondences and reprint requests should be addressed: Dept. of
Pharmacology, The Ohio State University College of Medicine, 333 West
Tenth Ave., Columbus, OH 43210-1239. Tel.: 614-688-3012; Fax:
614-292-7232.
- (
) - The abbreviations used are: DTT,
dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; BSA, bovine serum
albumin; nt, nucleotide(s); Pipes, 1,4-piperazinediethanesulfonic acid;
PAGE, polyacrylamide gel electrophoresis; Pyr, a pyrimidine.
- (
) - E. Chernokalskaya, R. E. Dompenciel, and D. R.
Schoenberg, manuscript in preparation.
ACKNOWLEDGEMENTS
We thank Jeff Ross and members of the Schoenberg
laboratory for their helpful suggestions and comments on this work.
REFERENCES
- (1993) Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
- Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., and Lindsten, T. (1991) Mol. Cell. Biol. 11, 3288-3295
[Abstract/Free Full Text]
- Brewer, G. (1991) Mol. Cell. Biol. 11, 2460-2466
[Abstract/Free Full Text]
- Chen, C. Y. A., You, Y., and Shyu, A. B. (1992) Mol. Cell. Biol. 12, 5748-5757
[Abstract/Free Full Text]
- Greenberg, M. E., and Belasco, J. G. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
- Shaw, G., and Kamen, R. (1986) Cell 46, 659-667
[CrossRef][Medline]
[Order article via Infotrieve]
- Mullner, E. W., and Kuhn, L. C. (1988) Cell 53, 815-825
[CrossRef][Medline]
[Order article via Infotrieve]
- Klausner, R. D., Rouault, T. A., and Harford, J. B. (1993) Cell 72, 19-28
[CrossRef][Medline]
[Order article via Infotrieve]
- Harford, J. B. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
- Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., and Lindsten, T. (1992) J. Biol. Chem. 267, 6302-6309
[Abstract/Free Full Text]
- Müller, W. E. G., Slor, H., Pfeifer, K., Huhn, P., Bek, A., Orsulic, S., Ushijima, H., and Schroder, H. C. (1992) J. Mol. Biol. 226, 721-733
[CrossRef][Medline]
[Order article via Infotrieve]
- Zhang, W., Wagner, B. J., Ehrenman, K., Schaefer, A. W., Demaria, C. T., Crater, D., Dehaven, K., Long, L., and Brewer, G. (1993) Mol. Cell. Biol. 13, 7652-7665
[Abstract/Free Full Text]
- Jaffrey, S. R., Haile, D. J., Klausner, R. D., and Harford, J. B. (1993) Nucleic Acids Res. 21, 4627-4631
[Abstract/Free Full Text]
- Henderson, B. R., Seiser, C., and Kuhn, L. C. (1993) J. Biol. Chem. 268, 27327-27334
[Abstract/Free Full Text]
- Ross, J. (1993) in Control of Messenger RNA Stability (Belasco, J., and Brawerman, G., eds) Academic Press, San Diego, CA
- Mclaren, R. S., and Ross, J. (1993) J. Biol. Chem. 268, 14637-14644
[Abstract/Free Full Text]
- Ross, J., and Kobs, G. (1986) J. Mol. Biol. 188, 579-593
[CrossRef][Medline]
[Order article via Infotrieve]
- Ross, J., Kobs, G., Brewer, G., and Peltz, S. W. (1987) J. Biol. Chem. 262, 9374-9381
[Abstract/Free Full Text]
- Brewer, G., and Ross, J. (1988) Mol. Cell. Biol. 8, 1697-1708
[Abstract/Free Full Text]
- Bandyopadhyay, R., Coutts, M., Krowczynska, A., and Brawerman, G. (1990) Mol. Cell. Biol. 10, 2060-2069
[Abstract/Free Full Text]
- Coutts, M., and Brawerman, G. (1993) Biochim. Biophys. Acta 1173, 57-62
[Medline]
[Order article via Infotrieve]
- Lowell, J. E., Rudner, D. Z., and Sachs, A. B. (1992) Genes & Dev. 6, 2088-2099
[CrossRef]
- Muhlrad, D., Decker, C. J., and Parker, R. (1994) Genes & Dev. 8, 855-866
[CrossRef]
- Muhlrad, D., and Parker, R. (1994) Nature 370, 578-581
[CrossRef][Medline]
[Order article via Infotrieve]
- Binder, R., Hwang, S. P. L., Ratnasabapathy, R., and Williams, D. L. (1989) J. Biol. Chem. 264, 16910-16918
[Abstract/Free Full Text]
- Hua, J., Garner, R., and Paetkau, V. (1993) Nucleic Acids Res. 21, 155-162
[Abstract/Free Full Text]
- Nielsen, F. C., and Christiansen, J. (1992) J. Biol. Chem. 267, 19404-19411
[Abstract/Free Full Text]
- Brown, B. D., and Harland, R. M. (1990) Genes & Dev. 4, 1925-1935
[CrossRef]
- Brown, B. D., Zipkin, I. D., and Harland, R. M. (1993) Genes & Dev. 7, 1620-1631
[CrossRef]
- Binder, R., Horowitz, J. A., Basillon, J. P., Koeller, D. M., Klausner, R. D., and Harford, J. B. (1994) EMBO J. 13, 1969-1980
[Medline]
[Order article via Infotrieve]
- Shapiro, D. J., Barton, M. C., McKearin, D. M., Chang, T. C., Lew, D., Blume, J., Nielsen, D. A., and Gould, L. (1989) Recent Prog. Horm. Res. 45, 29-64
- Martin, M. B., Riegel, A. T., and Schoenberg, D. R. (1986) J. Biol. Chem. 261, 2355-2361
[Abstract/Free Full Text]
- Pastori, R. L., Moskaitis, J. E., Buzek, S. W., and Schoenberg, D. R. (1991) Mol. Endocrinol. 5, 461-468
[Abstract/Free Full Text]
- Pastori, R. L., Moskaitis, J. E., and Schoenberg, D. R. (1991) Biochemistry 30, 10490-10498
[CrossRef][Medline]
[Order article via Infotrieve]
- Pastori, R. L., and Schoenberg, D. R. (1993) Arch. Biochem. Biophys. 305, 313-319
[CrossRef][Medline]
[Order article via Infotrieve]
- Redinbaugh, M. G., and Campbell, W. H. (1985) Anal. Biochem. 147, 144-147
[CrossRef][Medline]
[Order article via Infotrieve]
- Laemmli, U. K. (1970) Nature 227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Cleveland, D. W., Fischer, S. G., Kirschner, M. W., and Laemmli, U. K. (1977) J. Biol. Chem. 252, 1102-1106
[Abstract/Free Full Text]
- Pastori, R. L., Moskaitis, J. E., Smith, L. H., and Schoenberg, D. R. (1990) Biochemistry 29, 2599-2605
[CrossRef][Medline]
[Order article via Infotrieve]
- Schoenberg, D. R. (1981) Nucleic Acids Res. 9, 6669-6688
[Abstract/Free Full Text]
- Haefliger, D. N., Moskaitis, J. E., Schoenberg, D. R., and Wahli, W. (1989) J. Mol. Evol. 29, 344-354
[CrossRef][Medline]
[Order article via Infotrieve]
- Bisbee, C. A., Baker, M. A., Wilson, A. C., Hadji-Azimi, I., and Fischberg, M. (1977) Science 195, 785-787
[Abstract/Free Full Text]
- Calvert, R., and Gratzer, W. B. (1978) FEBS Lett. 86, 247-249
[CrossRef][Medline]
[Order article via Infotrieve]
- Beintema, J. J., Schuller, C., Irie, M., and Carsana, A. (1989) Prog. Biophys. Mol. Biol. 51, 165-192
- Karwan, R. (1993) FEBS Lett. 319, 1-4
[CrossRef][Medline]
[Order article via Infotrieve]
- Riegel, A. T., Aitken, S. C., Martin, M. B., and Schoenberg, D. R. (1987) Mol. Endocrinol. 1, 160-167
[Abstract/Free Full Text]
- Moskaitis, J. E., Buzek, S. W., Pastori, R. L., and Schoenberg, D. R. (1991) Biochem. Biophys. Res. Commun. 174, 825-830
[CrossRef][Medline]
[Order article via Infotrieve]
- Aronica, S. M., Kraus, W. L., and Katzenellenbogen, B. S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8517-8521
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Peng, E. L. Murray, M. Sarkar, X. Liu, and D. R. Schoenberg
The cytoskeleton-associated Ena/VASP proteins are unanticipated partners of the PMR1 mRNA endonuclease
RNA,
April 1, 2009;
15(4):
576 - 587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Peng, X. Liu, and D. R. Schoenberg
The 90-kDa Heat Shock Protein Stabilizes the Polysomal Ribonuclease 1 mRNA Endonuclease to Degradation by the 26S Proteasome
Mol. Biol. Cell,
February 1, 2008;
19(2):
546 - 552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Yang, Y. Peng, and D. R. Schoenberg
Endonuclease-mediated mRNA Decay Requires Tyrosine Phosphorylation of Polysomal Ribonuclease 1 (PMR1) for the Targeting and Degradation of Polyribosome-bound Substrate mRNA
J. Biol. Chem.,
November 19, 2004;
279(47):
48993 - 49002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ehlers, S. Horke, K. Reumann, A. Rang, F. Grosse, H. Will, and T. Heise
Functional Characterization of the Interaction between Human La and Hepatitis B Virus RNA
J. Biol. Chem.,
October 15, 2004;
279(42):
43437 - 43447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Goolsby and D. J. Shapiro
RNAi-mediated depletion of the 15 KH domain protein, vigilin, induces death of dividing and non-dividing human cells but does not initially inhibit protein synthesis
Nucleic Acids Res.,
October 1, 2003;
31(19):
5644 - 5653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. BREMER, A. STEVENS, and D. R. SCHOENBERG
An endonuclease activity similar to Xenopus PMR1 catalyzes the degradation of normal and nonsense-containing human {beta}-globin mRNA in erythroid cells
RNA,
September 1, 2003;
9(9):
1157 - 1167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol.,
April 1, 2003;
17(4):
562 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Decker and R. Parker
mRNA decay enzymes: Decappers conserved between yeast and mammals
PNAS,
October 1, 2002;
99(20):
12512 - 12514.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Stevens, Y. Wang, K. Bremer, J. Zhang, R. Hoepfner, M. Antoniou, D. R. Schoenberg, and L. E. Maquat
beta -Globin mRNA decay in erythroid cells: UG site-preferred endonucleolytic cleavage that is augmented by a premature termination codon
PNAS,
October 1, 2002;
99(20):
12741 - 12746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Feng, D. N. Everly Jr., and G. S. Read
mRNA Decay during Herpesvirus Infections: Interaction between a Putative Viral Nuclease and a Cellular Translation Factor
J. Virol.,
November 1, 2001;
75(21):
10272 - 10280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. van Dijk, J. S. Sussenbach, and P. E. Holthuizen
Kinetics and regulation of site-specific endonucleolytic cleavage of human IGF-II mRNAs
Nucleic Acids Res.,
September 1, 2001;
29(17):
3477 - 3486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Heise, L. G. Guidotti, and F. V. Chisari
Characterization of Nuclear RNases That Cleave Hepatitis B Virus RNA near the La Protein Binding Site
J. Virol.,
August 1, 2001;
75(15):
6874 - 6883.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. S. Cunningham, M. N. Hanson, and D. R. Schoenberg
Polysomal ribonuclease 1 exists in a latent form on polysomes prior to estrogen activation of mRNA decay
Nucleic Acids Res.,
March 1, 2001;
29(5):
1156 - 1162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Cunningham, R. E. Dodson, M. A. Nagel, D. J. Shapiro, and D. R. Schoenberg
Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1
PNAS,
October 23, 2000;
(2000)
220425497.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Z. Zhao, F.-C. Chang, and H. M. Furneaux
The identification of an endonuclease that cleaves within an HuR binding site in mRNA
Nucleic Acids Res.,
July 15, 2000;
28(14):
2695 - 2701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Poon, B. Liu, and M. B. Taubman
Identification of a Novel Dexamethasone-Sensitive RNA-Destabilizing Region on Rat Monocyte Chemoattractant Protein 1 mRNA
Mol. Cell. Biol.,
October 1, 1999;
19(10):
6471 - 6478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Lee, P. Leeds, and J. Ross
Purification and Characterization of a Polysome-associated Endoribonuclease That Degrades c-myc mRNA in Vitro
J. Biol. Chem.,
September 25, 1998;
273(39):
25261 - 25271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Trautwein, T. Rakemann, A. Pietrangelo, J. Plumpe, G. Montosi, and M. P. Manns
C/EBP-beta /LAP Controls Down-regulation of Albumin Gene Transcription during Liver Regeneration
J. Biol. Chem.,
September 6, 1996;
271(36):
22262 - 22270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Margot and D. L. Williams
Estrogen Induces the Assembly of a Multiprotein Messenger Ribonucleoprotein Complex on the 3`-Untranslated Region of Chicken Apolipoprotein II mRNA
J. Biol. Chem.,
February 23, 1996;
271(8):
4452 - 4460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Garcia-Gras, P. Chi, and E. A. Thompson
Glucocorticoid-mediated Destabilization of Cyclin D3 mRNA Involves RNA-Protein Interactions in the 3'-Untranslated Region of the mRNA
J. Biol. Chem.,
July 14, 2000;
275(29):
22001 - 22008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kar, L. Soong, M. Colmenares, K. Goldsmith-Pestana, and D. McMahon-Pratt
The Immunologically Protective P-4 Antigen of Leishmania Amastigotes. A DEVELOPMENTALLY REGULATED SINGLE STRAND-SPECIFIC NUCLEASE ASSOCIATED WITH THE ENDOPLASMIC RETICULUM
J. Biol. Chem.,
November 22, 2000;
275(48):
37789 - 37797.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Hanson and D. R. Schoenberg
Identification of in Vivo mRNA Decay Intermediates Corresponding to Sites of in Vitro Cleavage by Polysomal Ribonuclease 1
J. Biol. Chem.,
April 6, 2001;
276(15):
12331 - 12337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Rodgers, Z. Wang, and M. Kiledjian
Characterization and Purification of a Mammalian Endoribonuclease Specific for the alpha -Globin mRNA
J. Biol. Chem.,
January 18, 2002;
277(4):
2597 - 2604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Cunningham, R. E. Dodson, M. A. Nagel, D. J. Shapiro, and D. R. Schoenberg
Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1
PNAS,
November 7, 2000;
97(23):
12498 - 12502.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|