JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Merchant, J. L.
Right arrow Articles by Abraczinskas, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Merchant, J. L.
Right arrow Articles by Abraczinskas, D. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 11, Issue of March 17, 1995 pp. 6314-6319
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Epidermal Growth Factor Stimulation of the Human Gastrin Promoter Requires Sp1 (*)

(Received for publication, April 25, 1994; and in revised form, December 21, 1994)

Juanita L. Merchant (§) Akiko Shiotani Eric R. Mortensen (¶) Dale K. Shumaker Diane R. Abraczinskas (**)

From the Departments of Internal Medicine and Physiology, University of Michigan and the Howard Hughes Medical Institute, Ann Arbor, Michigan 48109

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Growth factors coordinately regulate a variety of different genes to stimulate cellular proliferation. In the stomach, gastrin, epidermal growth factor (EGF), and transforming growth factor-alpha all mediate gastric mucosal homeostasis by promoting cell renewal. We have previously shown that EGF and phorbol esters stimulate the human gastrin promoter through a novel GC-rich DNA element 5`-GGGGCGGGGTGGGGGG called gERE (gastrin EGF response element). In this report, we show that three factors bind to this element, the transcription factor Sp1 and two fast migrating complexes designated gastrin EGF response proteins (gERP 1 and 2). To understand how these factors bind and confer EGF responsiveness, mutations of gERE were tested in vitro for protein binding and in vivo for promoter activation. Both gel shift assays and UV cross-linking studies revealed that the factors bind to overlapping domains, Sp1 to the 5` half-site and gERP 1 and 2 to the 3` half-site. Placing either the 5` or 3` mutations upstream of a minimal gastrin promoter abolished EGF induction. Therefore both the 5` and 3` domains were required to confer EGF induction. Collectively, these results demonstrate that complex interactions between Sp1 and other factors binding to overlapping gERE half-sites confer EGF responsiveness to the gastrin promoter.


INTRODUCTION

Activation of the epidermal growth factor (EGF) (^1)receptor by either EGF or transforming growth factor-alpha initiates a cascade of intracellular events(1, 2) . These events include the transcriptional activation of various genes encoding early response factors, receptors, structural proteins, and hormones. However, despite the number of genes regulated by EGF receptor activation, few EGF response elements and their corresponding DNA-binding proteins have been identified. Indeed, the best characterized EGF responsive elements are the serum response element found in the c-fos, prolactin, and tyrosine hydroxylase promoters (3, 4, 5, 6) and the sis-inducible element residing further upstream of the serum response element in the c-fos promoter(7) . Moreover, EGF response elements have been identified in the Moloney murine leukemia virus long terminal repeat, pS2, and transin promoters(5, 8, 9) . However, regulatory proteins capable of binding these elements have not been fully characterized.

The EGF response element in the human gastrin promoter does not resemble these elements(10) . Instead, the gastrin EGF response element (gERE) is a GC-rich DNA element 5`-GGGGCGGGGTGGGGGG that binds nuclear proteins in both footprinting and gel shift assays(11) . The two overlapping gERE half-sites (GGGGCGGGG and GGGGTGGGGGG) represent binding sites for the transcription factor Sp1(12) ; however, neither element alone is able to confer EGF induction(11) . Sp1 consensus elements bind a 100-kDa zinc finger protein and confer basal activity to the promoters of viral or cellular genes(13, 14) . However, recent studies have shown that Sp1 binding sites also contribute to the inducible expression of growth factors and growth-regulated genes (15, 16, 17, 18) . In the stomach, an increase in Sp1 gene expression occurs in parietal cells during development(19) , which implies that Sp1 gene expression may correlate with gastric epithelial cell growth, maturation, and possibly acid secretion. Furthermore, Sp1 is overexpressed in human gastric carcinomas compared to expression in adjacent histologically normal mucosa(20) . Thus, these findings implicate a potential role for Sp1 in both the developing and neoplastic stomach.

Gastrin is synthesized in the antral G cell of the stomach and is an important growth factor for both the gastrointestinal epithelium and pancreas(21) . Moreover, it is conceivable that Sp1 binding to the gastrin promoter may represent one example of how Sp1 regulates specific gastric genes. Therefore to gain further insight into the molecular mechanisms by which nuclear proteins bind to gERE, we determined whether Sp1 binds this element and second whether Sp1 binding is required for EGF activation of transcription from the gastrin promoter. We show that Sp1 does indeed bind to the 5` domain of gERE and that two other gastrin EGF response proteins (gERP 1 and 2) bind to the 3` domain. Further, we show that the occupation of both overlapping domains, is necessary for EGF induction.


EXPERIMENTAL PROCEDURES

Plasmid Construction

A minimal gastrin reporter construct (ALuc) was constructed by ligating a 43-bp oligonucleotide cassette with overhanging BglII and BamHI restriction sites (gatctTTTATAAGGCAGGCCTGGAGCATCAAGCAGAGCAGAGAgatcc, oligo A) into the BglII site of a promoterless luciferase expression vector (pGL2-basic, Promega). This oligonucleotide corresponded to sequences from -28 to +9 of the human gastrin promoter. Authentic start sites were verified previously by RNase protection analysis(11) . Other gastrin reporter constructs were made by ligating oligonucleotide cassettes with flanking BglII and BamHI ends immediately upstream of oligo A within the ALuc construct. These oligonucleotide cassettes corresponded to the wild type gERE (WT), gERE mutations (M1-M6), or the human metallothionein IIa Sp1 (Sp1) element. WT or Sp1 elements placed 3` of the coding sequence were ligated into the BamHI site of the ALuc plasmid. All inserts were verified by restriction analysis and sequencing. Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems, Inc.) employing beta-cyanoethyl phosphoramide chemistry. Plasmids for transfection were prepared by a modified alkaline lysis procedure (Qiagen plasmid kit).

Cell Culture and DNA Transfection

GH(4) cells were cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 8% horse serum, 6% newborn calf serum, penicillin at 100 µg/ml, and streptomycin at 100 µg/ml in a humidified atmosphere of 5% CO(2), 95% air. Subconfluent GH(4) cells were transfected with 5 µg of plasmid DNA for 15 min at 37 °C in Dulbecco's modified Eagle's medium containing 400 µg/ml DEAE-dextran, 50 mM Tris-HCl followed by glycerol shock(11) . EGF (10 nM) was added the day after transfection for 16 h prior to preparing cell lysates. Luciferase activity was normalized to the activity of the cotransfected beta-galactosidase gene expressed from the cytomegalovirus promoter (1 µg/plate). Normalized basal gastrin promoter activity was expressed as a percent of the activity generated by the Sp1-ALuc construct. Relative induction by EGF represented normalized luciferase activity in the presence of EGF compared to unstimulated promoter activity.

Gel Shift Assays

Nuclear proteins were prepared from GH(4) cell lysates by detergent extraction(22) . Oligonucleotide probes were Klenow end-labeled with [alpha-P]dATP after hybridizing complementary strands. All gel shift reactions were carried out in a final volume of 20 µl that contained 10 mM Tris-HCl (pH 7.9), 100 mM KCl, 1 mM MgCl(2), 3 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and 300 ng of poly(dIbulletdC) at 25 °C. Gel shift assays that required ZnCl(2) also contained 5 mM MgCl(2) and 1 mM EDTA. Gel shift buffer and 2 µg of nuclear extract were incubated for 10 min at 25 °C prior to the addition of labeled probe (30,000 cpm/0.1 ng) for 5 min. The presence of Sp1 in gel shift complexes was confirmed by preincubating 1 µl per assay of polyclonal Sp1 antisera 2892 (a gift from S. Jackson and R. Tjian), preimmune sera, or sera raised against synthetic gastrin peptide with buffer and extract for 5 min prior to the addition of probe. DNA-protein complexes were resolved on a 4% nondenaturing polyacrylamide gel containing 45 mM Tris base, 45 mM boric acid, 1 mM EDTA. Quantitative gel shifts were quantified by a PhosphorImager (Molecular Dynamics) and analyzed by the method of Scatchard using Biosoft's EBDA program (Biosoft, Milltown, NJ).

UV Cross-linking Studies

Bromodeoxyuridine was substituted for thymine in the sense strands of the gERE and M1 mutation. After hybridizing, the resulting oligonucleotide cassettes were Klenow end-labeled with [alpha-P]dATP. Affinity-purified Sp1 (Promega) or nuclear extracts were incubated in gel shift buffer containing ZnCl(2) and the bromodeoxyuridine-substituted probe. The DNA-protein mixture was exposed to UV light (254 nm) for 5 min prior to resolving the complexes on an 8% SDS-polyacrylamide gel.


RESULTS

Sp1 Binds to gERE

We have shown previously that gERE binds specifically to nuclear protein from GH(4) cells in DNase I footprinting and gel shift assays(11) . Other known EGF response and GC-rich elements, including a consensus binding site for Sp1, did not compete for the fast migrating complex binding to gERE (gERP 1). In addition, affinity-purified Sp1 did not bind gERE in the absence of exogenous Zn despite the presence of a consensus binding site for Sp1(11) . However, recent reports show that Zn facilitates Sp1 binding(23, 24) . Thus, when Zn was added to gel shift assays, a slow migrating complex, presumed to be Sp1, bound to gERE (Fig. 1). Apparently, sufficient Zn was chelated by the EDTA present in the nuclear extract isolation buffer to prevent Sp1 from binding.


Figure 1: Transcription factor Sp1 binds to gERE in the presence of Zn. Sp1 polyclonal antisera was added to the gel shift assay in the absence (lanes 1-5) or presence (lanes 8-15) of Zn. A P-labeled gERE probe (30,000 cpm/0.1 ng) was used in lanes 1-11. A P-labeled human metallothionein IIa Sp1 probe (30,000 cpm/0.1 ng) (13) was used in gel shift assays containing affinity-purified Sp1 protein (Promega) (lanes 12-15). Lanes 2-5 and 7-11 contained nuclear protein, lanes 12-15 contained Sp1 protein. Lanes 1 and 6 contained probe alone. Sp1 antisera 2892 (I) was added to the gel shift assays shown in lanes 3, 9 and 13; preimmune sera (PI) was added to assays shown in lanes 4, 10 and 14 and heterologous immune sera (HI) was added to assays shown in lanes 5, 11, and 15. gERP 1 and 2 and Sp1 complexes are indicated with an arrow. The supershifted complexes are indicated (*).



The slow migrating complex was supershifted by polyclonal Sp1 antisera confirming the presence of Sp1 in this band (Fig. 1, lane 9, *). Preimmune (PI) and heterologous immune sera (HI) did not supershift this complex. Affinity-purified Sp1 (lanes 12-15) comigrated with the slow migrating complex and was also supershifted with Sp1 antisera (lane 13, *). In the absence of excess Zn, gERP 1 was the predominant protein bound to gERE (Fig. 1, lanes 2-5). gERP 1 was not supershifted by Sp1 antisera (lane 3) nor did its binding depend upon Zn. In addition, a third complex (gERP 2) that migrated near the probe front appeared after the addition of exogenous Zn, but also was not supershifted by Sp1 antisera. Taken together, these studies demonstrated that three distinct complexes bind gERE, a slow migrating complex formed by Sp1 and two fast migrating complexes designated gERP 1 and 2. Two of the factors required Zn for binding which suggested that they might differ in their affinity for gERE.

gERE Factors Bind with Similar Affinity

To further evaluate the binding of these three factors, quantitative gel shift assays were performed. Unlabeled competitors and limiting concentrations of probe were added to gel shift assays containing GH(4) nuclear protein (Fig. 2). The percent of probe bound by Sp1, gERP 1 and 2 was quantified with a PhosphorImager (Molecular Dynamics) and analyzed by the method of Scatchard. The dissociation constant (K(d)) for each factor binding gERE was calculated from the slope (slope = -1/K(d)). The K(d) for gERP 1 and 2 was 0.9 and 1.6 nM for Sp1, respectively. Therefore, the affinity for gERE did not differ significantly among the three factors.


Figure 2: Quantitative gel shift assays. Gel shift assays were performed in the presence of Zn using 5 µg of GH(4) nuclear protein and 250 pM of radiolabeled gERE probe. Self-competition was performed by adding increasing concentrations of unlabeled oligonucleotide (1, 2.5, 5, 10, 25, 50, 100, 250, and 500 times the molar concentration of probe).



Binding of Sp1 and gERP 1 and 2 to gERE Half-sites

To determine where these factors bind the element, point mutations of gERE were designed to eliminate binding to either the 5` or 3` half-site (Fig. 3). Mutations that discriminated between 5` and 3` binding were identified by competition in gel shift assays (Fig. 4). Of the mutations studied, a single point mutation within the 5` domain (M5) did not compete for Sp1 binding, but competed for gERP 1 and 2 (Fig. 4). Conversely, mutations within the 3` domain (M6) competed for Sp1 binding, but not for gERP 1 and 2. Central mutations (M3) and mutations of both the 5` and 3` domains (M4) did not compete for binding of either protein. Thus, Sp1 recognized the 5` domain of gERE and gERP 1 and 2 recognized the 3` domain. Both Sp1 and gERP complexes were also competed by the ``Split WT,'' an element containing both the 5` and 3` domains separated by a 6-bp AT-rich insert (Fig. 4, lane 10). The complexes binding to this element comigrated with the complexes binding the native WT probe (Fig. 5). However, the Split WT element competed better for Sp1 than for gERP 1 or 2.


Figure 3: Schematic representation of the minimal gastrin promoter construct. The minimal human gastrin promoter construct was created by inserting a 43-bp oligonucleotide cassette with flanking 5` BglII and 3` BamHI restriction sites into the BglII site of a promoterless luciferase vector. Other constructs were created by inserting oligonucleotide cassettes upstream of the gastrin promoter element into a regenerated BglII site or a BamHI site located downstream of luciferase coding elements. Restriction analysis was used to screen for oligonucleotide orientation. wWT and wSp1 represent the WT and Sp1 cassettes inserted in the 3` to 5` direction. Arrows designate the multiple transcriptional start sites of the gastrin promoter previously determined.




Figure 4: Competition for protein binding to gERE in gel shift assays. Single and multiple nucleotide changes within the gERE sequence (shown in Fig. 3) were used to compete for protein binding to labeled gERE in the absence (upper panel) or presence (lower panel) of Zn. Gel shift assays were performed with GH(4) nuclear proteins as described in Fig. 1. An excess of oligonucleotide competitor (400 times the molar concentration of the probe) was added to the assay mixture 10 min prior to the addition of radiolabeled gERE. Sp1 and gERP 1 and 2 complexes are indicated.




Figure 5: Gel shift assay using the Split WT element. The WT (gERE) element or 30-bp Split WT element (GGGGCGGGGTTTTTTGGGTGGGGGG) was Klenow end-labeled and incubated with GH(4) nuclear protein in the presence of Zn. Lanes 1-3 contain radiolabeled WT gERE. Lane 2 contains 200 times molar excess of unlabeled WT gERE; lane 3 contains 200 times the molar excess of unlabeled Split WT element. Lane 4 contains the radiolabeled Split WT element without competitor.



UV cross-linking confirmed that Sp1 binds to the 5` domain of gERE; whereas gERP 1 and 2 bind to the 3` domain (Fig. 6). This experiment was performed by substituting bromodeoxyuridine for thymine in the gERE and M1 sense strands. Nuclear extracts and affinity-purified Sp1 were then incubated with these radiolabeled probes. The DNA-protein mixture was exposed to UV light prior to resolving the mixture on an SDS-polyacrylamide gel. The M5 and Sp1 elements were used as competitors to demonstrate the specificity of binding. Three major complexes cross-linked to the M1 probe corresponding to Sp1 at 100 kDa, gERP 1 at 45 kDa, and gERP 2 at 25 kDa. However, since thymines are not present in the 5` domain of the WT element, neither affinity-purified Sp1 nor Sp1 contained in the extracts cross-linked to this probe. Furthermore, a higher molecular mass complex indicative of an Sp1/gERP complex was not detected.


Figure 6: UV cross-linking of Sp1 and gERP 1 and 2. Bromodeoxyuridine was substituted for thymines in the sense strand of the M1 and gERE sequences. After hybridizing to the complementary strand, these double-stranded oligonucleotide cassettes were Klenow end-labeled. GH(4) nuclear protein (lanes 1 and 3-5) or affinity-purified Sp1 protein (lanes 2 and 6) was incubated in Zn-containing buffer with probe alone or 100 times the molar excess of unlabeled oligonucleotide before exposing to UV light (254 nm) for 5 min. DNA-protein complexes were resolved by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography. Lanes 1-4 contain the M1 probe; lanes 5 and 6 contain WT probe. Nucleotide differences between the mutations and the WT sequence are indicated. The Sp1 consensus sequence is underlined.



EGF Induction Requires Binding to both gERE Half-sites

The basal and EGF-inducible activities of the gERE mutations were studied by inserting each oligonucleotide upstream of the human gastrin promoter expressing the luciferase reporter gene (see Fig. 3, ALuc). This promoter was minimally active in GH(4) cells without an enhancer element (Fig. 7A, ALuc)(10, 11) . In the presence of an Sp1 consensus element from the human metallothionein promoter (Sp1-ALuc), basal gastrin promoter activity was at least 5-fold higher than the activity conferred by gERE. Similarly, M6 also conferred 5-fold higher basal activity (Fig. 7A, M6-ALuc), and the Split WT-ALuc conferred 2-fold higher basal promoter activity. Thus, elements with a higher affinity for Sp1 correlated with higher basal promoter activity. This finding was consistent with the fact that Sp1 is a basal transactivator (24, 25, 26) . In contrast, those elements that competed for all three factors (WT, M1, M2) or only gERP 1 and 2 were poor basal enhancers. Those mutations that did not compete for either protein (M3, M4) also did not possess enhancer activity.


Figure 7: Promoter activity of gERE constructs. A, the basal activity of each construct was expressed as a percent of normalized luciferase activity determined after transfection of the human metallothionein IIa Sp1-containing construct. B, the relative induction of each construct by 10 nM EGF is shown. The constructs are labeled according to the oligonucleotide sequence inserted upstream of ALuc (see Fig. 3). The wWT-ALuc and wSp1-ALuc represent the WT gERE and Sp1 elements in the 3` to 5` orientation (see Fig. 3). The mean ± S.E. of five experiments performed in duplicate is shown. p values <0.05 were considered significant (*).



Only the elements that competed for all three factors conferred EGF induction (see Fig. 7B, WT-, M1-, M2-ALuc). The mutated 3` domain that competed for Sp1 (M6-ALuc) conferred high promoter activity with or without EGF. In contrast, the mutated 5` domain conferred low promoter activity with or without EGF (M5-ALuc). However, the Split WT element was an exception. Although it competed for all three factors, it did not confer EGF induction. Thus some overlap between the two domains was required to create a functional EGF response element. This observation raised the possibility that the orientation of these half-sites might affect promoter inducibility (Fig. 7B, Split WT-ALuc).

EGF Induction Is Orientation- but Not Location-dependent

To further investigate whether orientation and location affected EGF induction, the gERE was placed in either the 3` to 5` orientation or 5, 20, or 25 bp upstream of the TATA box (Fig. 7). Location did not affect WT-ALuc basal or inducible activity unless the element was placed 3` to the coding elements. However, placing gERE in the 3` to 5` orientation (wWT-ALuc) abolished EGF responsiveness. In contrast, the orientation of the Sp1 element did not affect its activity (wSp1-ALuc). Furthermore, location did not affect Sp1-ALuc promoter activity. This result was consistent with prior studies showing that distal GC boxes are only functional in the presence of high concentrations of Sp1(14, 27) .


DISCUSSION

The present study shows that a DNA element in the human gastrin promoter is composed of two overlapping domains that cooperate to confer EGF responsiveness; a 5` domain that binds Sp1 and a 3` domain that binds gERP 1 and 2. Moreover, these factors bind gERE with similar relative affinities. However, further studies will be required to establish the precise molecular mechanisms by which the factors become activated and confer induction.

One attractive possibility is that Sp1 and the gERP proteins switch the promoter from a basal to an activated state by alternate binding or alternate activation of the constitutively bound proteins. Support for this hypothesis was strengthened by showing that constructs containing mutations of the 5` domain (M5) resulted in low promoter activity (20%), whereas mutations of the 3` domain resulted in high promoter activity (100%). In either instance, these constructs did not confer EGF induction. Thus, promoter activity in the setting of exclusive occupation of either the 5` or 3` domains differed by a factor of five. This corresponded to the same incremental change conferred by the WT element. However, EGF did not stimulate an increase in factor binding, (^2)implying that alternate activation of constitutively bound factors may indeed regulate promoter induction. This might occur through protein-protein interactions or covalent modifications, e.g. phosphorylation. Furthermore, intranuclear divalent cation concentrations might also regulate DNA-protein interactions since two of the factors (Sp1 and gERP 2) required specific concentrations of Zn to bind. It was difficult to determine whether factor binding reflected cooperative interactions because the appearance of an additional slow migrating complex was not observed in gel shift assays or by UV cross-linking. Nevertheless, such complexes may not be either stable or abundant enough to be detected. Growth factor induction without significant changes in factor binding also has been observed for the serum response factor binding to the serum response element in the c-fos promoter(28, 29, 30) .

Many promoters contain GC-rich elements that are capable of binding Sp1 in addition to other DNA binding proteins. Therefore, how the cell coordinately regulates genes through DNA elements capable of binding multiple proteins requires further study. Given the abundance of cellular Sp1, to coordinately regulate genes containing Sp1 binding sites, the access of Sp1 protein to these promoters must be regulated to ensure some specificity. Possible mechanisms include regulating the level of Sp1 activation by phosphorylation or glycosylation(31, 32) , regulating the affinity of Sp1 for DNA(33) , and regulating its nuclear levels (14) or its concentration relative to other transcription factors occupying adjacent or overlapping GC-rich sites(16) . Many of these adjacent or overlapping elements represent binding sites for other regulatory proteins that under appropriate conditions are able to successfully exclude Sp1 from binding(28, 34, 35) . Since Sp1 binds in the major groove, it cannot bind to tandem sites that are less than 10 bp away; therefore, other factors may bind to the adjacent repetitive GC-rich elements(14) . In the c-myc promoter, several zinc finger proteins including Sp1 and ZF87 bind tandem GC-rich elements to regulate basal c-myc expression(36, 37) . In the SV40 promoter, directly repeated GC-rich sites are recognized by both Sp1 and LSF(38) . Although abundant in most cell lines, Sp1 expression varies substantially in different tissues during development(19) . Consequently when Sp1 levels are low, factors other than Sp1 may occupy Sp1 consensus elements or successfully out-compete Sp1 for its binding site. These other factors include the Sp1-related factors, e.g. SPR-2, -3, and -4, that bind to the same DNA element, but differ in their transactivation domains and tissue specific expression(39, 40) .

In summary, transcription factors binding to the 5` and 3` domains of gERE, including Sp1, are required to confer EGF responsiveness to the gastrin promoter perhaps by regulating factor abundance, access to DNA or the level of phosphorylation. Analysis of cloned gERP 1 and 2 should help to discern whether they cooperate or compete with Sp1 in order to bind gERE and activate transcription. Moreover, it will be important to determine whether Sp1 and gERP function in a similar manner on other promoters given the numerous putative Sp1 sites residing in the promoters of a variety of genes.


FOOTNOTES

*
This work was supported in part by United States Public Health Service Grant DK-45729 from NIDDK (to J. L. M.), by a National Institutes of Health Grant to the General Clinical Research Center, and by funds from the University of Michigan Gastrointestinal Peptide Research Center (DK-34533). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of a Robert Wood Johnson Minority Faculty Development Award and investigator of the Howard Hughes Medical Institute. To whom correspondence should be addressed: Dept. of Internal Medicine, Howard Hughes Medical Institute, University of Michigan, 1150 West Medical Drive, MSRB I, 3510D, Ann Arbor, MI 48109-0682. Tel.: 313-747-2944; Fax: 313-936-1400.

Recipient of a Robert Wood Johnson Minority Faculty Development Award.

**
Recipient of an American Gastroenterology Association Foundation Student Fellowship.

(^1)
The abbreviations used are: EGF, epidermal growth factor; gERE, gastrin EGF response element; gERP, gastrin EGF response protein; WT, wild type; bp, base pair(s).

(^2)
J. L. Merchant, A. Shiotani, E. R. Mortensen, D. K. Shumaker, and D. R. Abraczinskas, unpublished observations.


ACKNOWLEDGEMENTS

The oligonucleotides were synthesized by the University of Michigan DNA synthesis core facility. We thank Drs. Stephen Jackson and Robert Tjian (The Wellcome Trust, Cambridge, United Kingdom, and University of California, Berkeley) for the gift of polyclonal Sp1 antisera 2892. We are grateful to Drs. Linda Samuelson, Diane Robins, Deborah Gumucio, and Timothy Wang for critically reading the manuscript and for their helpful comments.


REFERENCES

  1. Carpenter, G. (1987) Annu. Rev. Biochem. 56, 881-914 [CrossRef][Medline] [Order article via Infotrieve]
  2. Burgess, A. W. (1989) Br. Med. Bull. 45, 401-424 [Abstract/Free Full Text]
  3. Treisman, R. (1986) Cell 46, 567-574 [CrossRef][Medline] [Order article via Infotrieve]
  4. Fisch, T. M., Prywes, R., and Roeder, R. G. (1987) Mol. Cell. Biol. 7, 3490-3502 [Abstract/Free Full Text]
  5. Elsholtz, H. P., Mangalam, H. J., Potter, E., Albert, V. R., Supowit, S., Evans, R. M., and Rosenfeld, M. G. (1986) Science 234, 1552-1557 [Abstract/Free Full Text]
  6. Lewis, E. J., and Chikaraishi, D. M. (1987) Mol. Cell. Biol. 7, 3332-3336 [Abstract/Free Full Text]
  7. Sadowski, H. B., Shuai, K., Darnell, J. E., Jr., and Gilman, M. Z. (1993) Science 261, 1739-1744 [Abstract/Free Full Text]
  8. Nunez, A.-M., Berry, M., Imler, J.-L., and Chambon, P. (1989) EMBO J. 8, 823-829 [Medline] [Order article via Infotrieve]
  9. Kerr, L. D., Holt, J. T., and Matrisian, L. M. (1988) Science 242, 1424-1426 [Abstract/Free Full Text]
  10. Godley-Merchant, J., and Brand, S. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3036-3040 [Abstract/Free Full Text]
  11. Merchant, J. L., Demediuk, B., and Brand, S. J. (1991) Mol. Cell. Biol. 11, 2686-2696 [Abstract/Free Full Text]
  12. Letovsky, J., and Dynan, W. S. (1989) Nucleic Acids Res. 17, 2639-2653 [Abstract/Free Full Text]
  13. Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends Biochem. Sci. 11, 20-23
  14. Courey, A. J., and Tjian, R. (1992) in Transcriptional Regulation (McKnight, S. L. and Yamamoto, K. R., eds) pp. 743-789, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  15. Shin, T. H., Paterson, A. J., Grant, J. H., III, Meluch, A. A., and Kudlow, J. E. (1992) Mol. Cell. Biol. 12, 3998-4006 [Abstract/Free Full Text]
  16. Nehls, M. C., Grapilon, M. L., and Brenner, D. A. (1992) DNA Cell Biol. 11, 443-452 [Medline] [Order article via Infotrieve]
  17. Chen, X., Azizkhan, J. C., and Lee, D. C. (1992) Oncogene 7, 1805-1815 [Medline] [Order article via Infotrieve]
  18. Kutoh, E., and Schwander, J. (1993) Biochem. Biophys. Res. Commun. 194, 1475-1482 [CrossRef][Medline] [Order article via Infotrieve]
  19. Saffer, J. D., Jackson, S. P., and Annarella, M. B. (1991) Mol. Cell. Biol. 11, 2189-2199 [Abstract/Free Full Text]
  20. Kitadai, Y., Yasui, W., Yokozaki, H., Kuniyasu, H., Haruma, K., Kajiyama, G., and Tahara, E. (1992) Biochem. Biophys. Res. Commun. 189, 1342-1348 [CrossRef][Medline] [Order article via Infotrieve]
  21. Walsh, J. H., and Grossman, M. I. (1975) N. Engl. J. Med. 292, 1324-1334 [Medline] [Order article via Infotrieve]
  22. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419 [Free Full Text]
  23. Westin, G., and Schaffner, W. (1988) Nucleic Acids Res. 16, 5771-5780 [Abstract/Free Full Text]
  24. Nehls, M. C., Rippe, R. A., Veloz, L., and Brenner, D. A. (1991) Mol. Cell. Biol. 11, 4065-4073 [Abstract/Free Full Text]
  25. Schmidt, M. C., Zhou, Q., and Berk, A. J. (1989) Mol. Cell. Biol. 9, 3299-3307 [Abstract/Free Full Text]
  26. Borellini, F., He, Y. F., Aquino, A., Yu, G., Josephs, S. F., and Glazer, R. I. (1991) J. Biol. Chem. 266, 15850-15854 [Abstract/Free Full Text]
  27. Courey, A. J., Holtzman, D. A., Jackson, S. P., and Tjian, R. (1989) Cell 59, 827-836 [CrossRef][Medline] [Order article via Infotrieve]
  28. Ackerman, S. L., Minden, A. G., Williams, G. T., Bobonis, C., and Yeung, C.-Y. (1993) Proc. Natl. Acad. Sci. U. S. A. 88, 7523-7527 [Abstract/Free Full Text]
  29. Fu, X.-Y., and Zhang, J.-J. (1993) Cell 74, 1135-1145 [CrossRef][Medline] [Order article via Infotrieve]
  30. Grueneberg, D. A., Natesan, S., Alexandre, C., and Gilman, M. Z. (1992) Science 257, 1089-1095 [Abstract/Free Full Text]
  31. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 63, 155-165 [CrossRef][Medline] [Order article via Infotrieve]
  32. Jackson, S. P., and Tjian, R. (1988) Cell 55, 125-133 [CrossRef][Medline] [Order article via Infotrieve]
  33. Thiesen, H. J., and Bach, C. (1991) Biochem. Biophys. Res. Commun. 176, 551-557 [CrossRef][Medline] [Order article via Infotrieve]
  34. Lehmann, J. M., Zhang, X.-K., and Pfahl, M. (1992) Mol. Cell. Biol. 12, 2976-2985 [Abstract/Free Full Text]
  35. LeMaigre, F. P., LaFontaine, D. A., Courtois, S. J., Durviaux, S. M., and Rousseau, G. G. (1990) Mol. Cell. Biol. 10, 1811-1814 [Abstract/Free Full Text]
  36. Pyrc, J. J., Moberg, K. H., and Hall, D. J. (1992) Biochemistry 31, 4102-4110 [CrossRef][Medline] [Order article via Infotrieve]
  37. Bossone, S. A., Asselin, C., Patel, A. M., and Marcu, K. B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7452-7456 [Abstract/Free Full Text]
  38. Huang, H.-C., Sundseth, R., and Hansen, U. (1990) Genes & Dev. 4, 287-298
  39. Hagen, G., Muller, S., Beato, M., and Suske, G. (1992) Nucleic Acids Res. 20, 5519-5525 [Abstract/Free Full Text]
  40. Kingsley, C., and Winoto, A. (1992) Mol. Cell. Biol. 12, 4251-4261 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Malakooti, R. Sandoval, V. C. Memark, P. K. Dudeja, and K. Ramaswamy
Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate
Am J Physiol Gastrointest Liver Physiol, October 1, 2005; 289(4): G653 - G663.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Pages and J. Pouyssegur
Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors
Cardiovasc Res, February 15, 2005; 65(3): 564 - 573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
N. F. Sinclair, W. Ai, R. Raychowdhury, M. Bi, T. C. Wang, T. J. Koh, and J. T. McLaughlin
Gastrin regulates the heparin-binding epidermal-like growth factor promoter via a PKC/EGFR-dependent mechanism
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G992 - G999.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Wang, A. B. Leiter, E. W. Englander, and G. H. Greeley Jr.
Insulin-Like Growth Factor I Increases Rat Peptide YY Promoter Activity through Sp1 Binding Sites
Endocrinology, February 1, 2004; 145(2): 659 - 666.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Xu, M. Inouye, E. R. Hines, J. F. Collins, and F. K. Ghishan
Transcriptional regulation of the human NaPi-IIb cotransporter by EGF in Caco-2 cells involves c-myb
Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1262 - C1271.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Perrais, P. Pigny, M.-C. Copin, J.-P. Aubert, and I. Van Seuningen
Induction of MUC2 and MUC5AC Mucins by Factors of the Epidermal Growth Factor (EGF) Family Is Mediated by EGF Receptor/Ras/Raf/Extracellular Signal-regulated Kinase Cascade and Sp1*
J. Biol. Chem., August 23, 2002; 277(35): 32258 - 32267.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M Zatyka, C Morrissey, I Kuzmin, M I Lerman, F Latif, F M Richards, and E R Maher
Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter
J. Med. Genet., July 1, 2002; 39(7): 463 - 472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, R. M. Lynch, and F. K. Ghishan
Epidermal growth factor regulation of rat NHE2 gene expression
Am J Physiol Cell Physiol, August 1, 2001; 281(2): C504 - C513.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, and F. K. Ghishan
Regulation of the human sodium-phosphate cotransporter NaPi-IIb gene promoter by epidermal growth factor
Am J Physiol Cell Physiol, March 1, 2001; 280(3): C628 - C636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. C. Tsai, L. Liu, J. Guan, and W. C. Aird
The Egr-1 gene is induced by epidermal growth factor in ECV304 cells and primary endothelial cells
Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1414 - C1424.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. Bakovic, K. A. Waite, and D. E. Vance
Functional significance of Sp1, Sp2, and Sp3 transcription factors in regulation of the murine CTP:phosphocholine cytidylyltransferase {alpha} promoter
J. Lipid Res., April 1, 2000; 41(4): 583 - 594.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Chupreta, M. Du, A. Todisco, and J. L. Merchant
EGF stimulates gastrin promoter through activation of Sp1 kinase activity
Am J Physiol Cell Physiol, April 1, 2000; 278(4): C697 - C708.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Zannetti, S. Del Vecchio, M. V. Carriero, R. Fonti, P. Franco, G. Botti, G. D’Aiuto, M. P. Stoppelli, and M. Salvatore
Coordinate Up-Regulation of Sp1 DNA-binding Activity and Urokinase Receptor Expression in Breast Carcinoma
Cancer Res., March 1, 2000; 60(6): 1546 - 1551.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
B.-K. Chen, H.-C. Kung, T.-Y. Tsai, and W.-C. Chang
Essential Role of Mitogen-Activated Protein Kinase Pathway and c-Jun Induction in Epidermal Growth Factor-Induced Gene Expression of Human 12-Lipoxygenase
Mol. Pharmacol., January 1, 2000; 57(1): 153 - 161.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund
Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene
J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z. Wang, Y. Zhang, J. Lu, S. Sun, and K. Ravid
Mpl Ligand Enhances the Transcription of the Cyclin D3 Gene: A Potential Role for Sp1 Transcription Factor
Blood, June 15, 1999; 93(12): 4208 - 4221.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Alroy, L. Soussan, R. Seger, and Y. Yarden
Neu Differentiation Factor Stimulates Phosphorylation and Activation of the Sp1 Transcription Factor
Mol. Cell. Biol., March 1, 1999; 19(3): 1961 - 1972.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. L. Hoppe and O. L. Francone
Binding and functional effects of transcription factors Sp1 and Sp3 on the proximal human lecithin:cholesterol acyltransferase promoter
J. Lipid Res., May 1, 1998; 39(5): 969 - 977.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Ogata, N. Inoue, and D. K. Podolsky
Identification of a Goblet Cell-specific Enhancer Element in the Rat Intestinal Trefoil Factor Gene Promoter Bound by a Goblet Cell Nuclear Protein
J. Biol. Chem., January 30, 1998; 273(5): 3060 - 3067.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Ren, T. Satoh, M. Yamada, K. Hashimoto, S. Konaka, T. Iwasaki, and M. Mori
Stimulation of the Preprothyrotropin-Releasing Hormone Gene by Epidermal Growth Factor
Endocrinology, January 1, 1998; 139(1): 195 - 203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-Y. P. Wo, J. Stewart, and W. F. Greenlee
Functional Analysis of the Promoter for the Human CYP1B1 Gene
J. Biol. Chem., October 17, 1997; 272(42): 26702 - 26707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Ihn, E. C. LeRoy, and M. Trojanowska
Oncostatin M Stimulates Transcription of the Human alpha 2(I) Collagen Gene via the Sp1/Sp3-binding Site
J. Biol. Chem., September 26, 1997; 272(39): 24666 - 24672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. R. Mortensen, P. A. Marks, A. Shiotani, and J. L. Merchant
Epidermal Growth Factor and Okadaic Acid Stimulate Sp1 Proteolysis
J. Biol. Chem., June 27, 1997; 272(26): 16540 - 16547.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, M. H. Wang, R. K. Singh, A. Wells, and G. P. Siegal
Epidermal Growth Factor Induces CD44 Gene Expression through a Novel Regulatory Element in Mouse Fibroblasts
J. Biol. Chem., May 30, 1997; 272(22): 14139 - 14146.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Armstrong, D. A. Barry, R. W. Leggett, and C. R. Mueller
Casein Kinase II-mediated Phosphorylation of the C Terminus of Sp1 Decreases Its DNA Binding Activity
J. Biol. Chem., May 23, 1997; 272(21): 13489 - 13495.
[Abstract] [Full Text] [PDF]


Home page