| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, April 25, 1994; and in revised form, December 21, 1994) From the
Growth factors coordinately regulate a variety of different
genes to stimulate cellular proliferation. In the stomach, gastrin,
epidermal growth factor (EGF), and transforming growth factor-
Activation of the epidermal growth factor (EGF) ( The EGF response element in the human gastrin
promoter does not resemble these elements(10) . Instead, the
gastrin EGF response element (gERE) is a GC-rich DNA element
5`-GGGGCGGGGTGGGGGG that binds nuclear proteins in both footprinting
and gel shift assays(11) . The two overlapping gERE half-sites
(GGGGCGGGG and GGGGTGGGGGG) represent binding sites for the
transcription factor Sp1(12) ; however, neither element alone
is able to confer EGF induction(11) . Sp1 consensus elements
bind a 100-kDa zinc finger protein and confer basal activity to the
promoters of viral or cellular genes(13, 14) .
However, recent studies have shown that Sp1 binding sites also
contribute to the inducible expression of growth factors and
growth-regulated genes (15, 16, 17, 18) . In the stomach,
an increase in Sp1 gene expression occurs in parietal cells during
development(19) , which implies that Sp1 gene expression may
correlate with gastric epithelial cell growth, maturation, and possibly
acid secretion. Furthermore, Sp1 is overexpressed in human gastric
carcinomas compared to expression in adjacent histologically normal
mucosa(20) . Thus, these findings implicate a potential role
for Sp1 in both the developing and neoplastic stomach. Gastrin is
synthesized in the antral G cell of the stomach and is an important
growth factor for both the gastrointestinal epithelium and
pancreas(21) . Moreover, it is conceivable that Sp1 binding to
the gastrin promoter may represent one example of how Sp1 regulates
specific gastric genes. Therefore to gain further insight into the
molecular mechanisms by which nuclear proteins bind to gERE, we
determined whether Sp1 binds this element and second whether Sp1
binding is required for EGF activation of transcription from the
gastrin promoter. We show that Sp1 does indeed bind to the 5` domain of
gERE and that two other gastrin EGF response proteins (gERP 1 and 2)
bind to the 3` domain. Further, we show that the occupation of both
overlapping domains, is necessary for EGF induction.
Figure 1:
Transcription factor Sp1 binds to gERE
in the presence of Zn
The slow
migrating complex was supershifted by polyclonal Sp1 antisera
confirming the presence of Sp1 in this band (Fig. 1, lane
9, *). Preimmune (PI) and heterologous immune sera (HI) did not supershift this complex. Affinity-purified Sp1 (lanes 12-15) comigrated with the slow migrating complex
and was also supershifted with Sp1 antisera (lane 13, *). In
the absence of excess Zn
Figure 2:
Quantitative gel shift assays. Gel shift
assays were performed in the presence of Zn
Figure 3:
Schematic representation of the minimal
gastrin promoter construct. The minimal human gastrin promoter
construct was created by inserting a 43-bp oligonucleotide cassette
with flanking 5` BglII and 3` BamHI restriction sites
into the BglII site of a promoterless luciferase vector. Other
constructs were created by inserting oligonucleotide cassettes upstream
of the gastrin promoter element into a regenerated BglII site
or a BamHI site located downstream of luciferase coding
elements. Restriction analysis was used to screen for oligonucleotide
orientation. wWT and wSp1 represent the WT and Sp1
cassettes inserted in the 3` to 5` direction. Arrows designate
the multiple transcriptional start sites of the gastrin promoter
previously determined.
Figure 4:
Competition for protein binding to gERE in
gel shift assays. Single and multiple nucleotide changes within the
gERE sequence (shown in Fig. 3) were used to compete for protein
binding to labeled gERE in the absence (upper panel) or
presence (lower panel) of Zn
Figure 5:
Gel shift assay using the Split WT
element. The WT (gERE) element or 30-bp Split WT element
(GGGGCGGGGTTTTTTGGGTGGGGGG) was Klenow end-labeled and incubated with
GH
UV cross-linking confirmed that Sp1 binds to the 5` domain of
gERE; whereas gERP 1 and 2 bind to the 3` domain (Fig. 6). This
experiment was performed by substituting bromodeoxyuridine for thymine
in the gERE and M1 sense strands. Nuclear extracts and
affinity-purified Sp1 were then incubated with these radiolabeled
probes. The DNA-protein mixture was exposed to UV light prior to
resolving the mixture on an SDS-polyacrylamide gel. The M5 and Sp1
elements were used as competitors to demonstrate the specificity of
binding. Three major complexes cross-linked to the M1 probe
corresponding to Sp1 at
Figure 6:
UV cross-linking of Sp1 and gERP 1 and 2.
Bromodeoxyuridine was substituted for thymines in the sense strand of
the M1 and gERE sequences. After hybridizing to the complementary
strand, these double-stranded oligonucleotide cassettes were Klenow
end-labeled. GH
Figure 7:
Promoter activity of gERE constructs. A, the basal activity of each construct was expressed as a
percent of normalized luciferase activity determined after transfection
of the human metallothionein IIa Sp1-containing construct. B,
the relative induction of each construct by 10 nM EGF is
shown. The constructs are labeled according to the oligonucleotide
sequence inserted upstream of ALuc (see Fig. 3). The wWT-ALuc and wSp1-ALuc represent the WT gERE and Sp1
elements in the 3` to 5` orientation (see Fig. 3). The mean
± S.E. of five experiments performed in duplicate is shown. p values <0.05 were considered significant
(*).
Only
the elements that competed for all three factors conferred EGF
induction (see Fig. 7B, WT-, M1-, M2-ALuc). The mutated 3` domain that competed for Sp1 (M6-ALuc) conferred high promoter activity with or without
EGF. In contrast, the mutated 5` domain conferred low promoter activity
with or without EGF (M5-ALuc). However, the Split WT element
was an exception. Although it competed for all three factors, it did
not confer EGF induction. Thus some overlap between the two domains was
required to create a functional EGF response element. This observation
raised the possibility that the orientation of these half-sites might
affect promoter inducibility (Fig. 7B, Split
WT-ALuc).
The present study shows that a DNA element in the human
gastrin promoter is composed of two overlapping domains that cooperate
to confer EGF responsiveness; a 5` domain that binds Sp1 and a 3`
domain that binds gERP 1 and 2. Moreover, these factors bind gERE with
similar relative affinities. However, further studies will be required
to establish the precise molecular mechanisms by which the factors
become activated and confer induction. One attractive possibility is
that Sp1 and the gERP proteins switch the promoter from a basal to an
activated state by alternate binding or alternate activation of the
constitutively bound proteins. Support for this hypothesis was
strengthened by showing that constructs containing mutations of the 5`
domain (M5) resulted in low promoter activity ( Many promoters
contain GC-rich elements that are capable of binding Sp1 in addition to
other DNA binding proteins. Therefore, how the cell coordinately
regulates genes through DNA elements capable of binding multiple
proteins requires further study. Given the abundance of cellular Sp1,
to coordinately regulate genes containing Sp1 binding sites, the access
of Sp1 protein to these promoters must be regulated to ensure some
specificity. Possible mechanisms include regulating the level of Sp1
activation by phosphorylation or
glycosylation(31, 32) , regulating the affinity of Sp1
for DNA(33) , and regulating its nuclear levels (14) or
its concentration relative to other transcription factors occupying
adjacent or overlapping GC-rich sites(16) . Many of these
adjacent or overlapping elements represent binding sites for other
regulatory proteins that under appropriate conditions are able to
successfully exclude Sp1 from
binding(28, 34, 35) . Since Sp1 binds in the
major groove, it cannot bind to tandem sites that are less than 10 bp
away; therefore, other factors may bind to the adjacent repetitive
GC-rich elements(14) . In the c-myc promoter, several
zinc finger proteins including Sp1 and ZF87 bind tandem GC-rich
elements to regulate basal c-myc expression(36, 37) . In the SV40 promoter,
directly repeated GC-rich sites are recognized by both Sp1 and
LSF(38) . Although abundant in most cell lines, Sp1 expression
varies substantially in different tissues during
development(19) . Consequently when Sp1 levels are low, factors
other than Sp1 may occupy Sp1 consensus elements or successfully
out-compete Sp1 for its binding site. These other factors include the
Sp1-related factors, e.g. SPR-2, -3, and -4, that bind to the
same DNA element, but differ in their transactivation domains and
tissue specific expression(39, 40) . In summary,
transcription factors binding to the 5` and 3` domains of gERE,
including Sp1, are required to confer EGF responsiveness to the gastrin
promoter perhaps by regulating factor abundance, access to DNA or the
level of phosphorylation. Analysis of cloned gERP 1 and 2 should help
to discern whether they cooperate or compete with Sp1 in order to bind
gERE and activate transcription. Moreover, it will be important to
determine whether Sp1 and gERP function in a similar manner on other
promoters given the numerous putative Sp1 sites residing in the
promoters of a variety of genes.
Volume 270,
Number 11,
Issue of March 17, 1995 pp. 6314-6319
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
all
mediate gastric mucosal homeostasis by promoting cell renewal. We have
previously shown that EGF and phorbol esters stimulate the human
gastrin promoter through a novel GC-rich DNA element
5`-
GGGGCGGGGTGGGGGG
called gERE
(gastrin EGF response element). In this report, we show that three
factors bind to this element, the transcription factor Sp1 and two fast
migrating complexes designated gastrin EGF response proteins (gERP 1
and 2). To understand how these factors bind and confer EGF
responsiveness, mutations of gERE were tested in vitro for
protein binding and in vivo for promoter activation. Both gel
shift assays and UV cross-linking studies revealed that the factors
bind to overlapping domains, Sp1 to the 5` half-site and gERP 1 and 2
to the 3` half-site. Placing either the 5` or 3` mutations upstream of
a minimal gastrin promoter abolished EGF induction. Therefore both the
5` and 3` domains were required to confer EGF induction. Collectively,
these results demonstrate that complex interactions between Sp1 and
other factors binding to overlapping gERE half-sites confer EGF
responsiveness to the gastrin promoter.
)receptor by either EGF or transforming growth factor-
initiates a cascade of intracellular events(1, 2) .
These events include the transcriptional activation of various genes
encoding early response factors, receptors, structural proteins, and
hormones. However, despite the number of genes regulated by EGF
receptor activation, few EGF response elements and their corresponding
DNA-binding proteins have been identified. Indeed, the best
characterized EGF responsive elements are the serum response element
found in the c-fos, prolactin, and tyrosine hydroxylase
promoters (3, 4, 5, 6) and the
sis-inducible element residing further upstream of the serum response
element in the c-fos promoter(7) . Moreover, EGF
response elements have been identified in the Moloney murine leukemia
virus long terminal repeat, pS2, and transin
promoters(5, 8, 9) . However, regulatory
proteins capable of binding these elements have not been fully
characterized.
Plasmid Construction
A minimal gastrin reporter
construct (ALuc) was constructed by ligating a 43-bp oligonucleotide
cassette with overhanging BglII and BamHI restriction
sites (gatctTTTATAAGGCAGGCCTGGAGCATCAAGCAGAGCAGAGAgatcc, oligo A) into
the BglII site of a promoterless luciferase expression vector
(pGL2-basic, Promega). This oligonucleotide corresponded to sequences
from -28 to +9 of the human gastrin promoter. Authentic
start sites were verified previously by RNase protection
analysis(11) . Other gastrin reporter constructs were made by
ligating oligonucleotide cassettes with flanking BglII and BamHI ends immediately upstream of oligo A within the ALuc
construct. These oligonucleotide cassettes corresponded to the wild
type gERE (WT), gERE mutations (M1-M6), or the human
metallothionein IIa Sp1 (Sp1) element. WT or Sp1 elements placed 3` of
the coding sequence were ligated into the BamHI site of the
ALuc plasmid. All inserts were verified by restriction analysis and
sequencing. Oligonucleotides were synthesized on an automated DNA
synthesizer (Applied Biosystems, Inc.) employing 
-cyanoethyl
phosphoramide chemistry. Plasmids for transfection were prepared by a
modified alkaline lysis procedure (Qiagen plasmid kit).Cell Culture and DNA Transfection
GH
cells were cultured in Dulbecco's modified Eagle's
medium (Life Technologies, Inc.) containing 8% horse serum, 6% newborn
calf serum, penicillin at 100 µg/ml, and streptomycin at 100
µg/ml in a humidified atmosphere of 5% CO
, 95% air.
Subconfluent GH cells were transfected with 5 µg of
plasmid DNA for 15 min at 37 °C in Dulbecco's modified
Eagle's medium containing 400 µg/ml DEAE-dextran, 50 mM Tris-HCl followed by glycerol shock(11) . EGF (10
nM) was added the day after transfection for 16 h prior to
preparing cell lysates. Luciferase activity was normalized to the
activity of the cotransfected -galactosidase gene expressed from
the cytomegalovirus promoter (1 µg/plate). Normalized basal gastrin
promoter activity was expressed as a percent of the activity generated
by the Sp1-ALuc construct. Relative induction by EGF represented
normalized luciferase activity in the presence of EGF compared to
unstimulated promoter activity.Gel Shift Assays
Nuclear proteins were prepared
from GH cell lysates by detergent extraction(22) .
Oligonucleotide probes were Klenow end-labeled with
[-
P]dATP after hybridizing complementary
strands. All gel shift reactions were carried out in a final volume of
20 µl that contained 10 mM Tris-HCl (pH 7.9), 100 mM KCl, 1 mM MgCl, 3 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and 300 ng of poly(dI
dC) at 25
°C. Gel shift assays that required ZnCl also contained
5 mM MgCl and 1 mM EDTA. Gel shift buffer
and 2 µg of nuclear extract were incubated for 10 min at 25 °C
prior to the addition of labeled probe (30,000 cpm/0.1 ng) for 5 min.
The presence of Sp1 in gel shift complexes was confirmed by
preincubating 1 µl per assay of polyclonal Sp1 antisera 2892 (a
gift from S. Jackson and R. Tjian), preimmune sera, or sera raised
against synthetic gastrin peptide with buffer and extract for 5 min
prior to the addition of probe. DNA-protein complexes were resolved on
a 4% nondenaturing polyacrylamide gel containing 45 mM Tris
base, 45 mM boric acid, 1 mM EDTA. Quantitative gel
shifts were quantified by a PhosphorImager (Molecular Dynamics) and
analyzed by the method of Scatchard using Biosoft's EBDA program
(Biosoft, Milltown, NJ).UV Cross-linking Studies
Bromodeoxyuridine was
substituted for thymine in the sense strands of the gERE and M1
mutation. After hybridizing, the resulting oligonucleotide cassettes
were Klenow end-labeled with [-P]dATP.
Affinity-purified Sp1 (Promega) or nuclear extracts were incubated in
gel shift buffer containing ZnCl and the
bromodeoxyuridine-substituted probe. The DNA-protein mixture was
exposed to UV light (254 nm) for 5 min prior to resolving the complexes
on an 8% SDS-polyacrylamide gel.
Sp1 Binds to gERE
We have shown previously that
gERE binds specifically to nuclear protein from GH cells in
DNase I footprinting and gel shift assays(11) . Other known EGF
response and GC-rich elements, including a consensus binding site for
Sp1, did not compete for the fast migrating complex binding to gERE
(gERP 1). In addition, affinity-purified Sp1 did not bind gERE in the
absence of exogenous Zn
despite the presence of a
consensus binding site for Sp1(11) . However, recent reports
show that Zn facilitates Sp1
binding(23, 24) . Thus, when Zn was
added to gel shift assays, a slow migrating complex, presumed to be
Sp1, bound to gERE (Fig. 1). Apparently, sufficient
Zn was chelated by the EDTA present in the nuclear
extract isolation buffer to prevent Sp1 from binding.
. Sp1 polyclonal antisera was
added to the gel shift assay in the absence (lanes 1-5)
or presence (lanes 8-15) of Zn. A P-labeled gERE probe (30,000 cpm/0.1 ng) was used in lanes 1-11. A P-labeled human
metallothionein IIa Sp1 probe (30,000 cpm/0.1 ng) (13) was used
in gel shift assays containing affinity-purified Sp1 protein (Promega) (lanes 12-15). Lanes 2-5 and 7-11 contained nuclear protein, lanes 12-15 contained Sp1 protein. Lanes 1 and 6 contained
probe alone. Sp1 antisera 2892 (I) was added to the gel shift
assays shown in lanes 3, 9 and 13; preimmune
sera (PI) was added to assays shown in lanes 4, 10 and 14 and heterologous immune sera (HI)
was added to assays shown in lanes 5, 11, and 15. gERP 1 and 2 and Sp1 complexes are indicated with an arrow. The supershifted complexes are indicated
(*).
, gERP 1 was the predominant
protein bound to gERE (Fig. 1, lanes 2-5). gERP 1 was not supershifted by Sp1 antisera (lane 3)
nor did its binding depend upon Zn. In addition, a
third complex (gERP 2) that migrated near the probe front
appeared after the addition of exogenous Zn, but also
was not supershifted by Sp1 antisera. Taken together, these studies
demonstrated that three distinct complexes bind gERE, a slow migrating
complex formed by Sp1 and two fast migrating complexes designated gERP
1 and 2. Two of the factors required Zn for binding
which suggested that they might differ in their affinity for gERE.gERE Factors Bind with Similar Affinity
To further
evaluate the binding of these three factors, quantitative gel shift
assays were performed. Unlabeled competitors and limiting
concentrations of probe were added to gel shift assays containing
GH nuclear protein (Fig. 2). The percent of probe
bound by Sp1, gERP 1 and 2 was quantified with a PhosphorImager
(Molecular Dynamics) and analyzed by the method of Scatchard. The
dissociation constant (K
) for each factor binding
gERE was calculated from the slope (slope =
-1/K). The K for gERP 1
and 2 was 0.9 and 1.6 nM for Sp1, respectively. Therefore, the
affinity for gERE did not differ significantly among the three factors.
using 5
µg of GH nuclear protein and 
250 pM of
radiolabeled gERE probe. Self-competition was performed by adding
increasing concentrations of unlabeled oligonucleotide (1, 2.5, 5, 10,
25, 50, 100, 250, and 500 times the molar concentration of
probe).
Binding of Sp1 and gERP 1 and 2 to gERE
Half-sites
To determine where these factors bind the element,
point mutations of gERE were designed to eliminate binding to either
the 5` or 3` half-site (Fig. 3). Mutations that discriminated
between 5` and 3` binding were identified by competition in gel shift
assays (Fig. 4). Of the mutations studied, a single point
mutation within the 5` domain (M5) did not compete for Sp1
binding, but competed for gERP 1 and 2 (Fig. 4). Conversely,
mutations within the 3` domain (M6) competed for Sp1 binding,
but not for gERP 1 and 2. Central mutations (M3) and mutations
of both the 5` and 3` domains (M4) did not compete for binding
of either protein. Thus, Sp1 recognized the 5` domain of gERE and gERP
1 and 2 recognized the 3` domain. Both Sp1 and gERP complexes were also
competed by the ``Split WT,'' an element containing both the
5` and 3` domains separated by a 6-bp AT-rich insert (Fig. 4, lane 10). The complexes binding to this element comigrated
with the complexes binding the native WT probe (Fig. 5).
However, the Split WT element competed better for Sp1 than for gERP 1
or 2.
. Gel shift
assays were performed with GH nuclear proteins as described
in Fig. 1. An excess of oligonucleotide competitor (400 times
the molar concentration of the probe) was added to the assay mixture 10
min prior to the addition of radiolabeled gERE. Sp1 and gERP 1 and 2
complexes are indicated.
nuclear protein in the presence of Zn. Lanes 1-3 contain radiolabeled WT gERE. Lane 2 contains 200 times molar excess of unlabeled WT gERE; lane 3 contains 200 times the molar excess of unlabeled Split WT element. Lane 4 contains the radiolabeled Split WT element without
competitor.
100 kDa, gERP 1 at 45 kDa, and gERP 2
at 25 kDa. However, since thymines are not present in the 5`
domain of the WT element, neither affinity-purified Sp1 nor Sp1
contained in the extracts cross-linked to this probe. Furthermore, a
higher molecular mass complex indicative of an Sp1/gERP complex was not
detected.
nuclear protein (lanes 1 and 3-5) or affinity-purified Sp1 protein (lanes 2 and 6) was incubated in Zn-containing
buffer with probe alone or 100 
the molar excess of unlabeled
oligonucleotide before exposing to UV light (254 nm) for 5 min.
DNA-protein complexes were resolved by SDS-polyacrylamide gel
electrophoresis and visualized by autoradiography. Lanes 1-4 contain the M1 probe; lanes 5 and 6 contain WT
probe. Nucleotide differences between the mutations and the WT sequence
are indicated. The Sp1 consensus sequence is underlined.
EGF Induction Requires Binding to both gERE
Half-sites
The basal and EGF-inducible activities of the gERE
mutations were studied by inserting each oligonucleotide upstream of
the human gastrin promoter expressing the luciferase reporter gene (see Fig. 3, ALuc). This promoter was minimally active in
GH cells without an enhancer element (Fig. 7A, ALuc)(10, 11) . In
the presence of an Sp1 consensus element from the human metallothionein
promoter (Sp1-ALuc), basal gastrin promoter activity was at
least 5-fold higher than the activity conferred by gERE. Similarly, M6
also conferred 5-fold higher basal activity (Fig. 7A, M6-ALuc), and the Split WT-ALuc conferred 2-fold higher basal
promoter activity. Thus, elements with a higher affinity for Sp1
correlated with higher basal promoter activity. This finding was
consistent with the fact that Sp1 is a basal transactivator (24, 25, 26) . In contrast, those elements
that competed for all three factors (WT, M1, M2) or only gERP 1 and 2
were poor basal enhancers. Those mutations that did not compete for
either protein (M3, M4) also did not possess enhancer activity.
EGF Induction Is Orientation- but Not
Location-dependent
To further investigate whether orientation
and location affected EGF induction, the gERE was placed in either the
3` to 5` orientation or 5, 20, or 25 bp upstream of the TATA box (Fig. 7). Location did not affect WT-ALuc basal or inducible
activity unless the element was placed 3` to the coding elements.
However, placing gERE in the 3` to 5` orientation (wWT-ALuc)
abolished EGF responsiveness. In contrast, the orientation of the Sp1
element did not affect its activity (wSp1-ALuc). Furthermore,
location did not affect Sp1-ALuc promoter activity. This result was
consistent with prior studies showing that distal GC boxes are only
functional in the presence of high concentrations of
Sp1(14, 27) .
20%), whereas
mutations of the 3` domain resulted in high promoter activity (100%).
In either instance, these constructs did not confer EGF induction.
Thus, promoter activity in the setting of exclusive occupation of
either the 5` or 3` domains differed by a factor of five. This
corresponded to the same incremental change conferred by the WT
element. However, EGF did not stimulate an increase in factor binding, ()implying that alternate activation of constitutively bound
factors may indeed regulate promoter induction. This might occur
through protein-protein interactions or covalent modifications, e.g. phosphorylation. Furthermore, intranuclear divalent
cation concentrations might also regulate DNA-protein interactions
since two of the factors (Sp1 and gERP 2) required specific
concentrations of Zn to bind. It was difficult to
determine whether factor binding reflected cooperative interactions
because the appearance of an additional slow migrating complex was not
observed in gel shift assays or by UV cross-linking. Nevertheless, such
complexes may not be either stable or abundant enough to be detected.
Growth factor induction without significant changes in factor binding
also has been observed for the serum response factor binding to the
serum response element in the c-fos promoter(28, 29, 30) .
))
The oligonucleotides were synthesized by the
University of Michigan DNA synthesis core facility. We thank Drs.
Stephen Jackson and Robert Tjian (The Wellcome Trust, Cambridge, United
Kingdom, and University of California, Berkeley) for the gift of
polyclonal Sp1 antisera 2892. We are grateful to Drs. Linda Samuelson,
Diane Robins, Deborah Gumucio, and Timothy Wang for critically reading
the manuscript and for their helpful comments.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Malakooti, R. Sandoval, V. C. Memark, P. K. Dudeja, and K. Ramaswamy Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate Am J Physiol Gastrointest Liver Physiol, October 1, 2005; 289(4): G653 - G663. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Pages and J. Pouyssegur Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors Cardiovasc Res, February 15, 2005; 65(3): 564 - 573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. F. Sinclair, W. Ai, R. Raychowdhury, M. Bi, T. C. Wang, T. J. Koh, and J. T. McLaughlin Gastrin regulates the heparin-binding epidermal-like growth factor promoter via a PKC/EGFR-dependent mechanism Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G992 - G999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wang, A. B. Leiter, E. W. Englander, and G. H. Greeley Jr. Insulin-Like Growth Factor I Increases Rat Peptide YY Promoter Activity through Sp1 Binding Sites Endocrinology, February 1, 2004; 145(2): 659 - 666. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Xu, M. Inouye, E. R. Hines, J. F. Collins, and F. K. Ghishan Transcriptional regulation of the human NaPi-IIb cotransporter by EGF in Caco-2 cells involves c-myb Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1262 - C1271. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Perrais, P. Pigny, M.-C. Copin, J.-P. Aubert, and I. Van Seuningen Induction of MUC2 and MUC5AC Mucins by Factors of the Epidermal Growth Factor (EGF) Family Is Mediated by EGF Receptor/Ras/Raf/Extracellular Signal-regulated Kinase Cascade and Sp1* J. Biol. Chem., August 23, 2002; 277(35): 32258 - 32267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Zatyka, C Morrissey, I Kuzmin, M I Lerman, F Latif, F M Richards, and E R Maher Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter J. Med. Genet., July 1, 2002; 39(7): 463 - 472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, R. M. Lynch, and F. K. Ghishan Epidermal growth factor regulation of rat NHE2 gene expression Am J Physiol Cell Physiol, August 1, 2001; 281(2): C504 - C513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Xu, J. F. Collins, L. Bai, P. R. Kiela, and F. K. Ghishan Regulation of the human sodium-phosphate cotransporter NaPi-IIb gene promoter by epidermal growth factor Am J Physiol Cell Physiol, March 1, 2001; 280(3): C628 - C636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Tsai, L. Liu, J. Guan, and W. C. Aird The Egr-1 gene is induced by epidermal growth factor in ECV304 cells and primary endothelial cells Am J Physiol Cell Physiol, November 1, 2000; 279(5): C1414 - C1424. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bakovic, K. A. Waite, and D. E. Vance Functional significance of Sp1, Sp2, and Sp3 transcription factors in regulation of the murine CTP:phosphocholine cytidylyltransferase {alpha} promoter J. Lipid Res., April 1, 2000; 41(4): 583 - 594. [Abstract] [Full Text]
|
|
|
|
|
|
S. Chupreta, M. Du, A. Todisco, and J. L. Merchant EGF stimulates gastrin promoter through activation of Sp1 kinase activity Am J Physiol Cell Physiol, April 1, 2000; 278(4): C697 - C708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zannetti, S. Del Vecchio, M. V. Carriero, R. Fonti, P. Franco, G. Botti, G. D’Aiuto, M. P. Stoppelli, and M. Salvatore Coordinate Up-Regulation of Sp1 DNA-binding Activity and Urokinase Receptor Expression in Breast Carcinoma Cancer Res., March 1, 2000; 60(6): 1546 - 1551. [Abstract] [Full Text]
|
|
|
|
 |
|
 B.-K. Chen, H.-C. Kung, T.-Y. Tsai, and W.-C. Chang Essential Role of Mitogen-Activated Protein Kinase Pathway and c-Jun Induction in Epidermal Growth Factor-Induced Gene Expression of Human 12-Lipoxygenase Mol. Pharmacol., January 1, 2000; 57(1): 153 - 161. [Abstract] [Full Text]
|
|
|
|
|
|
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Wang, Y. Zhang, J. Lu, S. Sun, and K. Ravid Mpl Ligand Enhances the Transcription of the Cyclin D3 Gene: A Potential Role for Sp1 Transcription Factor Blood, June 15, 1999; 93(12): 4208 - 4221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Alroy, L. Soussan, R. Seger, and Y. Yarden Neu Differentiation Factor Stimulates Phosphorylation and Activation of the Sp1 Transcription Factor Mol. Cell. Biol., March 1, 1999; 19(3): 1961 - 1972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Hoppe and O. L. Francone Binding and functional effects of transcription factors Sp1 and Sp3 on the proximal human lecithin:cholesterol acyltransferase promoter J. Lipid Res., May 1, 1998; 39(5): 969 - 977. [Abstract] [Full Text]
|
|
|
|
|
|
H. Ogata, N. Inoue, and D. K. Podolsky Identification of a Goblet Cell-specific Enhancer Element in the Rat Intestinal Trefoil Factor Gene Promoter Bound by a Goblet Cell Nuclear Protein J. Biol. Chem., January 30, 1998; 273(5): 3060 - 3067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ren, T. Satoh, M. Yamada, K. Hashimoto, S. Konaka, T. Iwasaki, and M. Mori Stimulation of the Preprothyrotropin-Releasing Hormone Gene by Epidermal Growth Factor Endocrinology, January 1, 1998; 139(1): 195 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-Y. P. Wo, J. Stewart, and W. F. Greenlee Functional Analysis of the Promoter for the Human CYP1B1 Gene J. Biol. Chem., October 17, 1997; 272(42): 26702 - 26707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ihn, E. C. LeRoy, and M. Trojanowska Oncostatin M Stimulates Transcription of the Human alpha 2(I) Collagen Gene via the Sp1/Sp3-binding Site J. Biol. Chem., September 26, 1997; 272(39): 24666 - 24672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. Mortensen, P. A. Marks, A. Shiotani, and J. L. Merchant Epidermal Growth Factor and Okadaic Acid Stimulate Sp1 Proteolysis J. Biol. Chem., June 27, 1997; 272(26): 16540 - 16547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhang, M. H. Wang, R. K. Singh, A. Wells, and G. P. Siegal Epidermal Growth Factor Induces CD44 Gene Expression through a Novel Regulatory Element in Mouse Fibroblasts J. Biol. Chem., May 30, 1997; 272(22): 14139 - 14146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Armstrong, D. A. Barry, R. W. Leggett, and C. R. Mueller Casein Kinase II-mediated Phosphorylation of the C Terminus of Sp1 Decreases Its DNA Binding Activity J. Biol. Chem., May 23, 1997; 272(21): 13489 - 13495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
