JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mathieu, M.
Right arrow Articles by Dickson, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mathieu, M.
Right arrow Articles by Dickson, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 12, Issue of March 24, 1995 pp. 6779-6787
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Fibroblast Growth Factor (FGF) 3 from Xenopus laevis (XFGF3) Binds with High Affinity to FGF Receptor 2 (*)

(Received for publication, October 20, 1994; and in revised form, December 20, 1994)

Marc Mathieu Paul Kiefer Ivor Mason (1) Clive Dickson (§)

From the Imperial Cancer Research Fund, 44 Lincoln's Inn Fields, London WC2A 3PX, United Kingdom and Division of Anatomy and Cell Biology, United Medical and Dental Schools of Guy's and St. Thomas' Hospitals, Guy's Campus, London SE1 9RT, United Kingdom

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We demonstrate that purified fibroblast growth factor (FGF) 3 from Xenopus laevis (XFGF3) activates the mitogen-activated protein kinase pathway and induces DNA synthesis in quiescent cells. To characterize the high affinity cell surface receptors that mediate these responses, the ligand binding domains of different FGF receptors (FGFR) were expressed on COS-1 cells, and their affinity for XFGF3 was determined. Unlabeled XFGF3 efficiently competed with I-FGF1 for binding to the IIIb and IIIc isoforms of FGFR2, giving 50% displacement (ID) at 0.3-0.8 nM. Higher XFGF3 concentrations were needed to displace I-FGF1 from FGFR3 and FGFR1 (ID 4 and 21 nM, respectively), indicating that XFGF3 has a lower affinity for these receptors. No association of XFGF3 with FGFR4 was found using this assay. FGFR2 isoforms isolated from both mouse and Xenopus showed similar high affinity binding of XFGF3 as determined by direct binding assays (K values in the range of 0.2-0.6 nM). These results indicate that the binding specificity of XFGF3 is different from that of other FGFs, and identifies FGFR2 as its high affinity receptor.


INTRODUCTION

The fibroblast growth factor (FGF) (^1)family is composed of at least nine members based on amino acid sequence similarity (1, 2) (reviewed in (3) and (4) ). In cell culture, some FGFs are mitogenic for a broad spectrum of cell types including epithelial, mesodermal, and neuronal. Other activities associated with the FGFs include the stimulation of cell migration, neurotrophic properties, and the induction or inhibition of cell differentiation, depending on the cell type. They have been implicated in a number of normal physiological responses, such as neovascularization, wound repair, as well as inductive and patterning processes that occur during embryonic and fetal development(5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16) (reviewed in (4) ). There is also compelling evidence to suggest that mesoderm induction in vertebrate embryos requires the obligatory function of an FGF(17) .

The FGFs bind to high and low affinity cell surface receptors (for review, see (18, 19, 20) ). The heparan sulfate proteoglycans constitute the low affinity receptors and facilitate the interaction of FGFs with the high affinity signaling receptors. To date, four high affinity receptor genes have been identified in mammals (FGFR1, FGFR2, FGFR3, and FGFR4). However, identifying the receptor for the different FGF ligands is complicated by the generation of different receptor isoforms from the same gene by alternative splicing(21, 22, 23, 24, 25, 26) . The basic structure of FGF receptors consists of an extracellular portion composed of three immunoglobulin-like domains (Ig-loops), a transmembrane segment, a juxtamembrane region, and a split tyrosine kinase domain. Some FGF receptor variants lack the first Ig-loop and may or may not contain a region rich in acidic residues (acid box) which resides between Ig-loops I and II. The consequences of lacking the first Ig-loop or acid box are not clear as the truncated receptors appear to function normally(23, 27) . The three and two Ig-loop receptors have been termed alpha and beta, respectively. FGF receptor genes 1, 2, and 3, but not 4, encode a choice of exon for the second half of the third Ig loop which changes ligand binding specificity(26, 27, 28, 29) . The receptor isoforms generated by the alternate splice are termed IIIb and IIIc, respectively. Other vertebrates also appear to encode the analogous receptor genes with isolates described from chicken, amphibians, and fish(22, 30, 31, 32, 33, 34) . FGF binding causes the activation of an intrinsic receptor tyrosine kinase activity and autophosphorylation. The receptor phosphotyrosine residues have been shown in some instances to form src homology 2 (SH2) binding sites that interact with second messenger generators to propagate an intracellular signal (reviewed in (18) and (19) ).

FGF3 was first identified as the product of a cellular oncogene (formerly int-2) associated with virally induced mouse breast cancers (reviewed in (35) ). The gene is not detectably transcribed in normal mouse mammary tissue, suggesting that inappropriate expression contributes to tumorigenesis. This idea was strengthened by the induction of proliferative abnormalities and tumors in the mammary glands of transgenic mice ectopically expressing FGF3 (36, 37, 38) . Apart from its potential oncogenic properties, considerable interest in FGF3 arises from its suspected role in embryonic and fetal development(6, 12, 14, 39, 40) . The generation of mice with a Fgf-3 null genotype (11) has confirmed the importance of this gene for proper development, since these mice exhibit structural abnormalities of the tail and many have inner ear defects resulting in differing degrees of deafness. However, abnormalities were not found at all sites of Fgf-3 expression, suggesting a degree of signaling redundancy or lack of FGF3 function at some of these sites.

The inefficient secretion of mouse FGF3 in cell cultures (41, 42) and its insolubility as a recombinant protein expressed in prokaryotes (^2)have severely hampered the isolation of active protein. These problems have now been circumvented by the isolation of the FGF3 homolog from Xenopus laevis (XFGF3) which shows a high level of amino acid identity to the mouse protein, but is efficiently secreted. Furthermore, conditioned medium containing this protein is mitogenic and induces phenotypic transformation in a number of mammalian cell lines. Here we use purified XFGF3 to identify its high affinity receptors by specific binding, Scatchard analysis, and covalent cross-linking. We show that, in quiescent cells expressing the appropriate receptors, XFGF3 activates the MAP kinase pathway, and reinitiates DNA synthesis.


MATERIALS AND METHODS

Cell Culture

COS-1 and NIH3T3 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum. BALB/MK cells were grown in a 1:1 mixture of DMEM (without calcium) and Ham's F-12 medium containing 8% dialyzed fetal calf serum (Sigma) and 10 ng/ml epidermal growth factor(43) . For DNA transfections, 10 µg of purified plasmid DNA were introduced into 5 times 10^6 COS-1 cells by electroporation (450 V/250 mF) using a Bio-Rad Gene-Pulser.

Cloning of FGF Receptors

Xenopus FGFR1 (IIIcalpha), human FGFR3 (IIIcalpha), and mouse FGFR4 cDNA clones were generously provided by M. Kirshner, M. Hayman, and A. McMahon, respectively(17, 44, 45) . A mouse FGFR1 (IIIcalpha) cDNA was cloned by PCR from an adult brain library using two pairs of primers (the start and stop codons are indicated in boldface type). The first primer pair (5` primer ATGTGGGGCTGGAAGTGCCTCCTCTTC, and 3` primer GACCAGTCTGTCTCGTGGCAGCTCCCA) was designed to amplify the extracellular, transmembrane, and juxtamembrane regions, and the resulting PCR product was ligated into the EcoRV site of pBluescript KS plasmid (Stratagene). The sequences encoding the remaining cytoplasmic portion of the receptor, encompassing the tyrosine-kinase domain, were amplified using the 5` primer CCTGAGGATCCCCGCTGGGAG and the 3` primer TGCTCTAGATCAGCGCCGTTTGAGTCCACTGTT. The naturally occurring BamHI site and an added XbaI site (underlined) were used to clone the PCR product obtained into pGEM7Zf. The unique receptor BamHI site, present in both PCR products, was used to join the subclone fragments to generate a full-length coding sequence as an EcoRI/XbaI fragment in the SV40-based expression vector pKC3(42) .

The extracellular, transmembrane, and juxtamembrane domain sequence of Xenopus FGFR2 (IIIb) and (IIIc) variants were cloned by reverse transcription of RNA from stage 22/23 Xenopus embryos followed by cDNA amplification using the RT-PCR. For the PCR the 5` primer was CGGAATTCACCATGGGGATGTCCTTAGTGTGGCGT and the 3` primer CTCCCACATGGGATCCTGTGGTAGCTC. A unique BamHI site (underlined) was introduced at the same position as the naturally occurring BamHI site in the mouse FGFR1, which results in the change of a histidine to glutamine. The PCR products were inserted as EcoRI-BamHI fragments in pGEM4 (Promega).

The extracellular, transmembrane, and juxtamembrane domain sequences encoding the mouse FGFR2 (IIIb) and (IIIc) variants were cloned by RT-PCR using total RNA from hindbrain and tail of 9.5- and 12.5-day embryos, respectively. The 5` primer was CGGAATTCCATGGTCAGCTGGGGTCGTTTCATC and the 3` primer was TGCTCTAGATTTGCCCAGCGTCAGCTTATCTCT. The PCR products were digested by EcoRI/BamHI and ligated into pGEM4.

To construct full-length receptors, the extracellular, transmembrane, and juxtamembrane domain sequences of the different receptors were linked to the region encoding the tyrosine-kinase and cytoplasmic tail of mouse FGFR1, via a unique BamHI site. These hybrid cDNAs were subcloned into the EcoRI and XbaI sites of the SV40-based expression vector, pKC3.

All PCRs were performed using the Pyrococcus furiosus DNA polymerase (Stratagene) which has proofreading activity. The plasmid constructs were then sequenced using Sequenase version 2.0 (U. S. Biochemical Corp.).

Purification of XFGF3

30 µg of purified XFGF3.1 plasmid DNA were introduced into 2 times 10^7 COS-1 cells by electroporation. The cells were seeded into a 15-cm Petri dish, incubated overnight in normal growth medium, and then changed to DMEM containing 0.1% fetal calf serum and 10 µg/ml heparin. After a further 48 h, the culture medium from 10 plates was harvested and clarified by centrifugation at 800 times g for 5 min. To the supernatant, the following was added at the final concentration indicated: 1 µg/ml aprotinin, 1 µg/ml leupeptin, 100 µg/ml PMSF, 1 mM dithiothreitol, and 1 mM EDTA. The supernatant was gently mixed overnight at 4 °C with 80 mg of heparin-Sepharose beads (Pharmacia Biotech Inc.). The heparin-Sepharose was loaded into a column, washed sequentially with 100 ml of isotonic phosphate-buffered saline (PBS) and 40 ml of 0.6 M NaCl in PBS. XFGF3 was eluted in 1-ml fractions of 1.5 M NaCl in PBS and detected after electrophoresis on 15% SDS-PAGE. The amount of XFGF3 protein in each fraction was estimated by silver staining relative to protein standards. Up to 90% pure XFGF3 was obtained in these fractions. Further purification on a Bio-Gel P-60 (Bio-Rad) 0.9 times 36-cm column equilibrated with 0.4 M NaCl in PBS resulted in the isolation of a peak of mitogenic activity containing a single band of the correct size (27 kDa) as judged by silver staining. Identity to XFGF3 was checked by Western blot using the MSD1 monoclonal antibody(46) . This procedure yielded on average 15 µg of XFGF3 from 2 times 10^8 transfected cells. For most experiments, XFGF3 was considered pure enough after the first purification step.

FGF Iodination

Recombinant human FGF1 (BioTech Trade and Service) and XFGF3 were iodinated by the chloramine-T method as described by Kan et al.(47) . The labeled product was separated from free I by heparin-Sepharose chromatography and eluted with 20 mM phosphate buffer, pH 7.2, 2 M NaCl, 0.1% bovine serum albumin, and 1 mM dithiothreitol. Specific activities were determined by estimating the amount of labeled ligand on a silver-stained gel and counting the associated radioactivity. Specific activity of I-XFGF3 was also calculated by comparing its mitogenic activity with that of native XFGF3 at known concentrations. Specific activities ranged from 10,000 to 28,000 cpm/ng.

FGF Cell Binding Assay

COS-1 cells were transfected with the appropriate FGF receptor, and seeded at 5 times 10^4 cells/well into 48-well tissue culture dishes pretreated with poly-L-lysine (Sigma) as described by the manufacturer. After 48 h, the cell monolayers were washed twice with ice-cold binding medium (DMEM containing 50 mM Hepes, pH 7.4, 1 mg/ml bovine serum albumin, and 1 µg/ml heparin) and incubated for 2 h at 4 °C with the indicated amounts of I-FGF1 or I-XFGF3 in binding medium. For competition experiments, binding was performed in the presence of up to 200-fold excess of unlabeled ligand. The cell monolayers were then rinsed twice with cold binding medium, the cells were solubilized in 0.1% SDS, 0.3 M NaOH for 30 min at 37 °C, and the radiation was counted. To determine specific binding, the radioactivity bound to cells transfected with empty vector was subtracted from that of cells receiving FGF receptors.

Cross-linking of Receptors and FGFs

COS-1 cells (2 times 10^6) transfected with different receptor cDNAs were grown for 48 h in 60-mm tissue culture dishes. Cells were washed twice with ice-cold binding medium and incubated for 2 h at 4 °C with binding medium containing iodinated FGF (approximately 10 ng/ml) in the presence or absence of a 15-20-fold excess of unlabeled ligand. After washing once with cold binding medium and once with PBS, the cells were treated for 20 min at 4 °C with 0.3 mM disuccinimidyl suberate (Pierce) in PBS (disuccinimidyl suberate was diluted from a fresh stock solution of 30 mM dissolved in Me(2)SO). After cross-linking, the cells were scraped from the wells, microcentrifuged for 30 s, and washed with cold 25 mM Tris buffer, pH 7.4. They were then lysed in 60 µl of buffer containing 20 mM Hepes, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1.5 mM MgCl(2), 1 mM EDTA, 1 µg/ml aprotinin, 1 µg/ml leupeptin, and 100 µg/ml PMSF by vortexing and leaving on ice for 10 min. The lysates were centrifuged at 12,000 times g for 10 min, and 20 µl of 4 times Laemmli dissociation buffer were added to the supernatant. Approximately 40 µl of extract were subjected to SDS-PAGE on 7.5% gels, and the ligand-receptor complexes were detected by autoradiography.

Detection of Raf and MAP Kinases

NIH3T3 cells, maintained overnight in DMEM containing 0.5% donor calf serum, were treated for 1-30 min with FGF1 or XFGF3 at 50 ng/ml in the same medium containing 1 µg/ml heparin. The cultures were then washed with cold PBS, and the cells were immediately lysed in a buffer containing 10 mM Tris/HCl, pH 7.6, 50 mM NaCl, 50 mM NaF, 5 mM EDTA, 1% Nonidet P-40, 20 mM beta-glycerophosphate, 0.1 mM Na(3)VO(4), 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM PMSF. Cell extracts were transferred to 1.5-ml microcentrifuge tubes, mixed, and left on ice for 5 min before microcentrifugation at 4 °C for 10 min. A sample of the supernatant was taken for protein estimation and the remainder added to an equal volume of 2 times Laemmli dissociation buffer. To analyze Raf-1 and MAP kinase proteins, 50-100 µg of protein were subjected to SDS-PAGE on 7.5 and 11% gels, respectively. After blotting on to Immobilon-P (Millipore), the membranes were probed with a 1 in 1000 dilution of a rabbit antiserum directed against a COOH-terminal peptide of Raf-1 (p74), or with a 1 in 7500 dilution of a rabbit antiserum that recognizes Erk-1 (p44) and Erk-2 (p42) (48) (antisera kindly provided by Peter Parker, ICRF). Revelation was performed by using a peroxidase-conjugated anti-rabbit IgG (Dakopatt) and an enhanced chemiluminescence system (Amersham Corp.).

Mitogenicity Assay

BALB/MK cells were transferred to 48-well tissue culture plates (2 times 10^4 cells/well) in 0.5 ml of growth medium for 9 days. The culture medium was withdrawn from the confluent and quiescent cells and replaced with serum-free medium containing the test samples and processed as described previously(46) . NIH3T3 cells were seeded in 48-well tissue culture plates at 2 times 10^4 cells/well in growth medium. The cells were left without medium change for 7 days to become quiescent. The test samples were then added for 22 h. For the last 5 h, 1 mCi of [^3H]thymidine per well was added, and the radioactivity incorporated into DNA was measured as described previously.


RESULTS

XFGF3 Induces DNA Synthesis and Activates the MAPK Pathway

In previous studies, we have shown that conditioned medium from COS-1 cells expressing a XFGF3 cDNA contains proteins that can induce DNA synthesis in quiescent cell cultures(46) . To characterize this activity, we have purified XFGF3 from the conditioned medium and compared its potency to recombinant human FGF1 and FGF7. Quiescent cultures of NIH3T3 and BALB/MK cells were treated with increasing concentrations of ligand and new DNA synthesis measured using a [^3H]thymidine incorporation assay (Fig. 1). The results show that XFGF3 and FGF1 are potent mitogens for both cell lines, with half-maximal activity occurring at a concentration of less than 0.1 nM on BALB/MK and 0.5 nM on NIH3T3. As expected, FGF7 was active on BALB/MK cells which express the keratinocyte growth factor receptor (the IIIb isoform of FGFR2), but not on NIH3T3 cells which express FGFR 1 and the IIIc isoform of FGFR2(49) .^2 This result suggests that FGFR2 (IIIb) and at least one other receptor isotype can mediate the XFGF3 signal.


Figure 1: Induction of DNA synthesis by XFGF3, FGF1, and FGF7. Quiescent BALB/MK (Panel a) or NIH3T3 cells (Panel b) were treated with increasing concentrations of XFGF3 (closed circles), FGF1 (open squares), or FGF7 (filled squares), and the stimulation of DNA synthesis was measured by the incorporation of [^3H]thymidine as described under ``Materials and Methods.'' The mean value of duplicate determinations is shown. Results are representative of at least two experiments.



An emerging paradigm of ligand-mediated activation for several classes of tyrosine-kinase receptor is the stimulation of the MAP kinase pathway (for review, see (50) ). Two isoforms of these kinases (Erk-1 and Erk-2) are present in most mammalian cells, and, within minutes of ligand/receptor binding, these proteins are activated by phosphorylation on both threonine and tyrosine residues(51, 52) . Since the hyperphosphorylated Erks have a reduced mobility on SDS-PAGE, the activation can be monitored by immunoblot analysis of cell extracts (53) . Treatment of serum-deprived NIH3T3 cells with 50 ng/ml XFGF3 or FGF1 resulted in a rapid and transient phosphorylation of Erk-1 and -2 (p44 and p42, respectively) which was detected within 1 min of ligand addition. The hyperphosphorylated state was maintained for at least 15 min but was no longer detected at 30 min (Fig. 2). The activation of MAP kinases is part of a phosphorylation cascade involving a MAP kinase kinase and a MAP kinase kinase kinase (MAPKKK). The serine/threonine kinase Raf-1 has been shown to function as a MAPKKK (reviewed in (50) ). To determine whether, Raf-1 (p74) was involved in the stimulation of the MAP kinase pathway by XFGF3, an additional blot, prepared using the same extracts, was probed with a specific Raf-1 antiserum. The results show that the reduced mobility, reflecting hyperphosphorylation of Raf-1(54) , became apparent 15 and 30 min after treatment with either FGF1 or XFGF3. Although activation of Raf-1 would be expected to precede that of MAP kinase, the hyperphosphorylation response was delayed compared to that of p44 and p42. However, it is not clear whether the detected phosphorylation of Raf-1 correlates with its activation (see ``Discussion''). Similar results were obtained when BALB/MK cells were used instead of NIH3T3 (data not shown).


Figure 2: FGF1 and XFGF3 induces hyperphosphorylation of Raf-1, Erk-1, and Erk-2. Quiescent NIH3T3 cells were treated with 50 ng/ml FGF1 or XFGF3 for 1-30 min as indicated. Equal amounts of cell extracts were analyzed by immunoblotting using polyclonal antibodies that recognize Raf-1 (Panel a) or Erk-1 and -2 (Panel b).



Binding of XFGF3 to Mammalian FGF Receptors

To formally demonstrate that XFGF3 can bind receptors on the surface of NIH3T3 and BALB/MK cells, I-labeled XFGF3 was cross-linked to cells as described under ``Materials and Methods'' (Fig. 3). Labeled proteins, resolved by SDS-PAGE, were approximately 150 and 170 kDa, which are the expected sizes for the different FGF receptor isoforms complexed with ligand. The specificity of the binding was shown by the inability to detect these complexes in the presence of a 20-fold excess of unlabeled XFGF3. To identify the FGF receptors that bind XFGF3, a competition binding assay with I-FGF1 was used. As FGF1 binds to all known FGF receptors with high affinity, this method provides a test for functional receptor expression on the assay cells and allows native XFGF3 to be used as a competitor. Different FGF receptors were expressed on COS-1 cells as chimeras containing their extracellular, transmembrane, and juxtamembrane regions joined through a conserved region of sequence to a mouse FGFR1 kinase and cytoplasmic tail domain (see ``Materials and Methods''). As ligand binding is determined by the ecto-domain of the receptor, the specificity and affinity of binding should not be affected by changing the intracellular region. This strategy also enabled us to use an antiserum against the carboxyl terminus of FGFR1 to immunoprecipitate [S]methionine-labeled receptors expressed in COS-1 cells, providing a direct comparison of their expression levels (data not shown). COS-1 cells expressing similar amounts of the different FGF receptors were incubated with I-FGF1 in the absence or presence of increasing amounts of XFGF3 (Fig. 4). Efficient competition occurred for binding to both the IIIb and IIIc isoforms of FGFR2, with calculated IDs in the range of 0.3 to 0.7 nM ( Fig. 4and Table 1). A 50% displacement of I-FGF1 from FGFR3 and FGFR1 occurred at higher XFGF3 concentrations (4 and 19 nM, respectively), indicating a weaker affinity for these receptors. No displacement of I-FGF1 from FGFR4 was detected in the presence of XFGF3 up to a concentration of 40 nM. High affinity binding of XFGF3 to the FGFR2 variants was confirmed using a direct binding assay. The amount of I-XFGF3 bound was measured as a function of ligand concentration. Dissociation constants (K(d)) in the order of 0.2 to 0.6 nM were calculated from the Scatchard plots, demonstrating that the binding affinities were similar for the four variants: either the alpha compared to the beta isoform, or the IIIb compared to the IIIc isoform (see Table 1). The direct association of I-XFGF3 with the different FGFR2 variants was demonstrated by covalent cross-linking (Fig. 5). Complexes of approximately 170 or 150 kDa were readily resolved as expected for the association of I-XFGF3 with the alpha or the beta forms of FGFR2, respectively. Receptors containing two Ig-loops and an acid box fractionated on SDS-PAGE into the expected 150 kDa complex as well as a 200-kDa form, which reflects a higher order complex of unknown composition. Specificity of binding was indicated by the apparent loss of complex formation in the presence of a 20-fold excess of unlabeled XFGF3. I-XFGF3 did not bind detectably to COS-1 cells transfected with empty vector, suggesting a lack of endogenous FGFR2 expression.


Figure 3: Cross-linking of I-XFGF3 to BALB/MK and NIH3T3 cells. Cell cultures were incubated with 10 ng/ml I-XFGF3 in the absence or presence of a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.'' The size of the labeled proteins indicated on the left were estimated relative to rainbow size markers (Amersham Corp.).




Figure 4: Competition of FGF1 and XFGF3 for I-FGF1 binding to different FGF receptors. COS-1 cells expressing different receptors as indicated were incubated with 0.3 nMI-FGF1 in the presence of increasing concentrations of XFGF3 (open circles) or FGF1 (filled circles). Cells were then washed and lysed, and specific binding was determined as described under ``Materials and Methods.'' The calculated ID values are presented in Table 1.






Figure 5: Cross-linking of I-XFGF3 to COS-1 cells expressing FGFR2 variants. COS-1 cells were transfected with the indicated receptor cDNA and 48 h later were incubated with 10 ng/ml I-XFGF3 in the absence or presence a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.''



Isolation of FGF Receptors from Xenopus

In the experiments described above, XFGF3 was shown to bind with high affinity to multiple isoforms of mouse FGFR2. Although there is a high degree of sequence conservation in the receptor genes from vertebrate phyla, it was important to determine the binding affinity for the Xenopus homologs of FGFR2 (XFGFR2). Based on the published DNA sequence for the IIIc isoform of XFGFR2(55) , we designed primers to generate cDNAs encoding the IIIb and IIIc isoforms by RT-PCR. An alignment of the predicted amino acid sequences of these cDNAs is depicted in Fig. 6a. Variants analogous to the IIIbalpha (KSAM or KGFR) and IIIcalpha (BEK) isoforms of mammalian FGFR2 were obtained, in addition to a beta form of IIIb containing an acid box (IIIbbeta+ab). The amino acids encoded by the alternative exons that define IIIb and IIIc isoforms of FGFR2 in Xenopus show only 44% identity (Fig. 6b). This contrasts with the higher degree of homology between corresponding domains isolated from different vertebrate species (Fig. 6, c and d) (30, 33, 49, 56, 57, 58, 59, 60) . For example, the IIIb- and IIIc-specific sequences from Xenopus and human show 76 and 85% amino acid sequence identity, respectively.


Figure 6: Alignment of the predicted amino acid sequences for XFGFR2 (IIIcalpha), XFGFR2 (IIIbalpha), and XFGFR2 (IIIbbeta+ab). a, the arrowhead marks the predicted site for signal peptide cleavage, and the circles indicate the cysteine residues which define the disulfide links of the extracellular Ig domains. Underlined is the position of the acid box, and the dashed gap in XFGFR2 (IIIbbeta+ab) marks the missing sequences of Ig-loop-I absent in all beta-forms. The transmembrane region is under and overlined, while the region of divergence between the IIIc and IIIb isoforms is boxed. b, an amino acid sequence comparison of the divergent domains of Ig-loop III for XFGFR2 IIIb and IIIc isoforms. c and d show a comparison of the IIIb and IIIc isoforms, respectively, of FGFR2 from frog (Xenopus), salamander, newt, chicken, mouse, and human(30, 33, 49, 56, 57, 58, 59, 60) . The numbers to the right refer to the percentage amino acid identity in comparison with the Xenopus sequence. A dash indicates a gap, and a dot indicates a conserved residue.



Binding of XFGF3 to Xenopus FGF Receptors

The binding of I-XFGF3 to the Xenopus FGF receptors was investigated on COS-1 cells transiently transfected with the corresponding cDNAs. After covalent cross-linking, the labeled complexes were fractionated by SDS-PAGE and visualized by autoradiography (Fig. 7a). COS-1 cells expressing the IIIb and IIIc isoforms of XFGFR2 showed labeled complexes of the expected size. Prolonged exposure of the autoradiograph revealed weak binding to XFGFR1 (IIIcalpha) (not shown). Specificity of binding was confirmed by the apparent loss of complex formation in the presence of an excess of unlabeled XFGF3. In a further experiment, I-FGF1 binding to these receptors was efficiently competed by an excess of unlabeled XFGF3 (Fig. 7b). The results indicate that XFGF3 binds to the IIIb and IIIc isoforms of XFGFR2 and interacts with XFGFR1 (IIIcalpha) at higher ligand concentrations.


Figure 7: Cross-linking of I-XFGF3 and I-FGF1 to COS-1 cells expressing Xenopus FGF receptors. a, COS-1 cells were transfected with the indicated receptor cDNA and 48 h later incubated with 10 ng/ml I-XFGF3 in the absence or presence a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.'' b, COS-1 cells expressing the Xenopus receptors, as indicated, were incubated with 10 ng/ml I-FGF1 in the absence or presence (- or +, respectively) of a 15-fold excess of unlabeled XFGF3 and processed as in a. The size of the labeled proteins indicated on the left were estimated relative to rainbow size markers (Amersham Corp.).



The affinity of XFGF3 for the IIIb and IIIc variants of XFGFR2 was determined using I-XFGF3 in direct binding assays (data not shown). From the Scatchard plots, K(d) values in the range of 0.4-0.6 nM were calculated similar to those determined for the mouse FGFR2 homologs (see Table 1). In similar experiments, no binding to XFGFR1 (IIIcalpha) was detected, and therefore the ability of unlabeled XFGF3 to compete with I-FGF1 for binding was used as an alternative means to assess affinity (Fig. 8). Increasing amounts of XFGF3 or FGF1 in the presence of 0.3 nMI-FGF1 were added to COS-1 cells expressing XFGFR1 (IIIcalpha), and the retained radioactivity was measured by counting. As a positive control, COS-1 cells expressing XFGFR2 (IIIcalpha) were used in a parallel experiment. An ID of 23 nM was determined for the binding of XFGF3 to XFGFR1 (IIIcalpha) compared to 0.8 nM for XFGFR2 (IIIcalpha), implying an approximately 29-fold lower affinity (see Table 1). The ID value for XFGFR2 (IIIcalpha) is consistent with the K(d) of 0.5 nM determined using the direct binding procedure (Table 1). As expected, efficient competition by FGF1 occurred on both receptors (Fig. 8).


Figure 8: Competition of FGF1 and XFGF3 for I-FGF1 binding to Xenopus FGF receptors. COS-1 cells expressing XFGFR1 (IIIcalpha) (Panel a) or XFGFR2 (IIIcalpha) (Panel b) were incubated with 0.3 nMI-FGF1 in the presence of increasing concentrations of unlabeled XFGF3 (open circles) or FGF1 (filled circles). Cells were then washed and lysed, and specific binding was determined as described under ``Materials and Methods.'' The calculated ID values are presented in Table 1.




DISCUSSION

Comparison of the predicted amino acid sequences for each of the different FGF receptors shows a high level of conservation across several species, which is much more marked than that seen for the different FGF receptors within a single species(18) . Therefore, it could be predicted that ligand binding specificity is similar for the same receptor from different species. Indeed, direct binding and competition analyses have shown that XFGF3 binds with the same high affinity to both mouse and Xenopus FGFR2, and it also interacts with the same low affinity with either mouse or Xenopus FGFR1 (IIIcalpha) (Table 1). In addition, a weak interaction was also observed with human FGFR3 (IIIcalpha), while no binding to mouse FGFR4 could be detected ( Fig. 4and Table 1). Considering the strong sequence conservation between mammalian and Xenopus receptors (Fig. 6, c and d) (22, 55) , we would predict the same is true for the Xenopus homologs of FGFR3 (IIIcalpha) and FGFR4. The high affinity binding to FGFR2 suggests it is the most likely partner for XFGF3 at physiological ligand concentrations. In addition, the affinities of XFGF3 for the a- and b-variants of FGFR2 were found to be very similar (Table 1). This finding is in contrast to a report that shows FGF1 affinity for the beta-form of FGFR1 being 8-fold higher than its affinity for the alpha-form(61) . This discrepancy may be due to the different cell types that were used to overexpress the receptors, as factors such as the structure of cell-derived heparan sulfates may modulate ligand binding affinity, and potentially specificity(62, 63, 64) . Alternatively, it may be an inherent property of the ligand/receptor combination and could result from nonidentical ligand binding domains (see below).

Whereas XFGF3 binds to the IIIb and IIIc variants of FGFR2 with similar affinities, FGF7 interacts exclusively with the IIIb isoform, and FGF2 shows a strong preference for the IIIc isoform (Table 1)(24, 65) . Like XFGF3, FGF1 binds both variants with high affinity, but then it also associates strongly with all the other FGF receptors and their known variants. Recent studies indicate that Ig-loops II and III contribute to the ligand binding site, albeit to different degrees depending on which FGF is involved in the interaction. For example, when individual Ig-loop domains of FGFR2 (IIIb) are fused to an immunoglobulin heavy chain Fc domain, Ig-loop II confers binding to FGF1 but not to FGF7, while Ig-loop III confers the converse specificity. However, in both cases the affinity is lower than that of a construct containing both Ig-loops(66) . The importance of Ig-loop II for FGF binding is further illustrated by analyses of chimeric receptors made between FGFR2 and either FGFR1 or FGFR3; whereas both Ig-loop II and the IIIb domain from FGFR2 are necessary to confer FGF7 binding when transferred to FGFR1, the single IIIb domain from FGFR2 is sufficient to confer this property when transferred to FGFR3(28, 67) . Additional experiments using such constructs should permit precise localization of the sites that interact with the ligand. However, to establish a complete model of ligand/receptor interaction, the regions on the FGF molecules themselves that determine receptor binding specificity need to be defined. Chimeric ligands made between the various FGFs could help to provide such information.

XFGF3 was shown to be mitogenic for BALB/MK and NIH3T3 cells which naturally express the IIIb and IIIc isoforms of FGFR2, respectively (Fig. 1). Furthermore, at XFGF3 concentrations that induce maximal DNA synthesis, hyperphosphorylation of Erk-1 and Erk-2 was detected 1 min after ligand addition (Fig. 2), suggesting efficient activation of the MAP kinase pathway. Phosphorylation of Raf-1 was observed after 15 min, which was surprising since Raf-1 activation is thought to precede that of Erk-1 and Erk-2(50) . However, the functional significance of Raf-1 phosphorylation is not clear, and similar results from other groups have led to the suggestion that Raf-1 phosphorylation serves to inactivate this kinase, thereby facilitating a transient response (68) . Whatever the functional consequences of Raf-1 phosphorylation, these studies provide evidence for the activation of the Raf-1/MAP kinase pathway by FGFs in cells expressing endogenous FGF receptors, confirming previous results obtained with receptor-transfected L6 myoblasts(69, 70) , and Xenopus embryos(71, 72) .

As might be expected for a ligand and its cognate receptor, there is a striking similarity between the expression patterns of XFGF3 and XFGFR2 (55) . Furthermore, in amphibians, the levels of both FGF3 and FGFR2 have been shown to increase upon neural induction(40, 58) . Some insights into the functions of FGFs and their receptors in vivo derive from transgenic animal studies. For example, mice null for Fgf-3 or Fgf-5 were found to have specific but restricted phenotypic alterations(11, 73) . The limited phenotypic consequences of these gene knockouts despite extensive gene expression patterns, suggests there may be some functional complementation. Similar experiments designed to generate mice null for the FGF receptor genes may have more serious consequences since signaling by several FGF-ligands could be affected. An alternative strategy is to target the expression of a dominant negative form of a given receptor exclusively to one tissue/organ at a stage when endogenous expression of this receptor is known to occur. This was recently achieved by Peters et al.(74) who showed that expressing a dominant negative FGFR2 (IIIb) in the lung bud epithelium of transgenic mice results in a complete inhibition of branching morphogenesis, clearly implicating this receptor in lung organogenesis. Since FGF3 disrupts mammary gland development(36, 37, 38) , we are using a similar stategy to determine whether signaling via FGFR2 (IIIb) is necessary for normal breast morphogenesis. Thus, knowledge of FGF and FGFR specificities combined with data on the times and sites of their expression will facilitate the design of experiments to determine the functions of these signaling molecules in animal development.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Viral Carcinogenesis Laboratory, P.O. Box 123, 44 Lincoln's Inn Fields, London WC2A 3PX, UK. Tel: 44-71-269-3336; Fax: 44-71-269-3094.

(^1)
The abbreviations used are: FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; XFGF, fibroblast growth factor from Xenopus laevis; MAP, mitogen-activated protein; DMEM, Dulbecco's modified Eagle's medium; RT, reverse transcription; PCR, polymerase chain reaction; PMSF, polymethylsulfonyl fluoride; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis.

(^2)
M. Mathieu, P. Kiefer, I. Marics, and C. Dickson, unpublished observations.


ACKNOWLEDGEMENTS

We thank Drs. M. Kirshner, M. Hayman, and A. McMahon for providing receptor clones; Dr. D. Tannahill for supplying Xenopus RNA; P. Parker for antibodies to MAP kinase and Raf-1; and W. Gullick for FGFR1 antiserum. We also thank Anne-Marie Florence for technical help and Drs. G. Peters, P. Parker, and V. Fantl for critical comments on the manuscript.


REFERENCES

  1. Miyamoto, M., Naruo, K., Seko, C., Matsumoto, S., Kondo, T., and Kurokawa, T. (1993) Mol. Cell. Biol. 13, 4251-4259 [Abstract/Free Full Text]
  2. Tanaka, A., Miyamoto, K., Minamino, N., Takeda, M., Sato, B., Matsuo, H., and Matsumoto, K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8928-8932 [Abstract/Free Full Text]
  3. Goldfarb, M. (1990) Cell Growth & Differ. 1, 439-445
  4. Burgess, W. H., and Maciag, T. (1989) Annu. Rev. Biochem. 58, 575-606 [CrossRef][Medline] [Order article via Infotrieve]
  5. Mason, I., Fuller-Pace, F., Smith, R., and Dickson, C. (1994) Mech. Dev. 45, 15-30 [CrossRef][Medline] [Order article via Infotrieve]
  6. Represa, J., Leon, Y., Miner, C., and Giraldez, F. (1991) Nature 353, 561-563 [CrossRef][Medline] [Order article via Infotrieve]
  7. Haub, O., and Goldfarb, M. (1991) Development 112, 397-406 [Abstract]
  8. DeLapeyriere, O., Ollendorff, V., Planche, J., Ott, M., Pizette, S., Coulier, F., and Birnbaum, D. (1993) Development 118, 601-611 [Abstract]
  9. Drucker, B. J., and Goldfarb, M. (1993) Mech. Dev. 40, 155-163 [CrossRef][Medline] [Order article via Infotrieve]
  10. Hebert, J. M., Basilico, C., Goldfarb, M., Haub, O., and Martin, G. R. (1990) Dev. Biol. 138, 453-463
  11. Mansour, S. L., Goddard, J. M., and Capecchi, M. R. (1993) Development 117, 13-28 [Abstract]
  12. Niswander, L., and Martin, G. R. (1992) Development 114, 755-768 [Abstract]
  13. Niswander, L., Tickle, C., Vogel, A., Booth, I., and Martin, G. (1993) Cell 75, 579-587 [CrossRef][Medline] [Order article via Infotrieve]
  14. Wilkinson, D. G., Bhatt, S., and McMahon, A. P. (1989) Development 105, 131-136 [Abstract]
  15. Wilkinson, D. G., and Krumlauf, R. (1990) Trends Neurosci. 13, 335-339 [CrossRef][Medline] [Order article via Infotrieve]
  16. Werner, S., Peters, K., Longaker, M., Fuller-Pace, F., Banda, M., and William, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6896-6900 [Abstract/Free Full Text]
  17. Amaya, E., Musci, T. J., and Kirschner, M. W. (1991) Cell 66, 257-270 [CrossRef][Medline] [Order article via Infotrieve]
  18. Johnson, D., and Williams, L. (1993) Adv. Cancer Res. 60, 1-41 [Medline] [Order article via Infotrieve]
  19. Jaye, M., Schlessinger, J., and Dionne, C. (1992) Biochim. Biophys. Acta 1135, 185-199 [Medline] [Order article via Infotrieve]
  20. Klagsbrun, M., and Baird, A. (1991) Cell 67, 229-231 [CrossRef][Medline] [Order article via Infotrieve]
  21. Hou, J., Kan, M., McKeehan, K., McBride, G., Adams, P., and McKeehan, W. (1991) Science 251, 665-668 [Abstract/Free Full Text]
  22. Friesel, R., and Dawid, I. B. (1991) Mol. Cell. Biol. 11, 2481-2488 [Abstract/Free Full Text]
  23. Johnson, D. E., Lee, P. L., Lu, J., and Williams, L. T. (1990) Mol. Cell. Biol. 10, 4728-4736 [Abstract/Free Full Text]
  24. Miki, T., Bottaro, D., Fleming, T., Smith, C., Burgess, W., Chan, A.-L., and Aaronson, S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 246-250 [Abstract/Free Full Text]
  25. Reid, H., Wilks, A., and Bernard, O. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1596-1600 [Abstract/Free Full Text]
  26. Werner, S., Duan, D.-S. R., DeVries, C., Peters, K. C., Johnson, D. E., and Williams, L. T. (1992) Mol. Cell. Biol. 12, 82-88 [Abstract/Free Full Text]
  27. Dell, K. R., and Williams, L. T. (1992) J. Biol. Chem. 267, 21225-21229 [Abstract/Free Full Text]
  28. Chellaiah, A., McEwen, D., Werner, S., Xu, J., and Ornitz, D. (1994) J. Biol. Chem. 269, 11620-11627 [Abstract/Free Full Text]
  29. Vainikka, S., Partanen, J., Bellosta, P., Coulier, F., Basilico, C., Jaye, M., and Alitalo, K. (1992) EMBO J. 11, 4273-4280 [Medline] [Order article via Infotrieve]
  30. Pasquale, E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5812-5816 [Abstract/Free Full Text]
  31. Lee, P. L., Johnson, D. E., Cousens, L. S., Fried, V. A., and Williams, L. T. (1989) Science 245, 57-60 [Abstract/Free Full Text]
  32. Emori, Y., Yasuoka, A., and Saigo, K. (1992) FEBS Lett. 314, 176-178 [CrossRef][Medline] [Order article via Infotrieve]
  33. Poulin, M. L., and Chiu, I. M. (1994) Biochim. Biophys. Acta 1220, 209-211 [Medline] [Order article via Infotrieve]
  34. Shi, D. L., Feige, J. J., Riou, J. F., Desimone, D. W., and Boucaut, J. (1992) Development 116, 261-273 [Abstract]
  35. Dickson, C., Deed, R., Dixon, M., and Peters, G. (1989) Prog. Growth Factor Res. 1, 123-132 [CrossRef][Medline] [Order article via Infotrieve]
  36. Stamp, G., Fantl, V., Poulsom, R., Jamieson, S., Smith, R., Peters, G., and Dickson, C. (1992) Cell Growth & Differ. 3, 929-938
  37. Ornitz, D. M., Cardiff, R. D., Kuo, A., and Leder, P. (1992) J. Natl. Cancer Inst. 84, 887-892 [Abstract/Free Full Text]
  38. Muller, W. J., Lee, F. S., Dickson, C., Peters, G., Pattengale, P., and Leder, P. (1990) EMBO J. 9, 907-913 [Medline] [Order article via Infotrieve]
  39. Wilkinson, D. G., Peters, G., Dickson, C., and McMahon, A. P. (1988) EMBO J. 7, 691-695 [Medline] [Order article via Infotrieve]
  40. Tannahill, D., Isaacs, H. V., Close, M. J., Peters, G., and Slack, J. M. W. (1992) Development 115, 695-702 [Abstract]
  41. Kiefer, P., Peters, G., and Dickson, C. (1993) Mol. Cell. Biol. 13, 5781-5793 [Abstract/Free Full Text]
  42. Dixon, M., Deed, R., Acland, P., Moore, R., Whyte, A., Peters, G., and Dickson, C. (1989) Mol. Cell. Biol. 9, 4896-4902 [Abstract/Free Full Text]
  43. Rubin, J. S., Osada, H., Finch, P. W., Taylor, W. G., Rudikoff, S., and Aaronson, S. A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 802-806 [Abstract/Free Full Text]
  44. Keegan, K., Johnson, D. E., Williams, L. T., and Hayman, M. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1095-1099 [Abstract/Free Full Text]
  45. Stark, K., McMahon, J., and McMahon, A. (1991) Development 113, 641-651 [Abstract]
  46. Kiefer, P., Mathieu, M., Close, M., Peters, G., and Dickson, C. (1993) EMBO J. 12, 4159-4168 [Medline] [Order article via Infotrieve]
  47. Kan, M., Shi, E., and McKeehan, W. (1991) in Barnes, D., Mather, J., and Sato, G. (eds) Peptide Growth Factors , Part C, Academic Press, New York, pp. 158-171
  48. Adams, P., and Parker, P. (1991) FEBS Lett. 290, 77-82 [CrossRef][Medline] [Order article via Infotrieve]
  49. Miki, T., Fleming, T. P., Bottaro, D. P., Rubin, J. S., Ron, D., and Aaronson, S. A. (1991) Science 251, 72-75 [Abstract/Free Full Text]
  50. Ruderman, J. (1993) Curr. Opin. Cell Biol. 5, 207-213 [CrossRef][Medline] [Order article via Infotrieve]
  51. Boulton, T., Nye, S., Robbins, D., Ip, N., Radziejewska, E., Morgenbesser, S., DePinho, R., Panayotatos, N., Cobb, M., and Yancopoulos, G. (1991) Cell 65, 663-675 [CrossRef][Medline] [Order article via Infotrieve]
  52. Cobb, M., Boulton, T., and Robbins, D. (1991) Cell Regul. 2, 965-978 [Medline] [Order article via Infotrieve]
  53. Leevers, S., and Marshall, C. (1992) EMBO J. 11, 569-574 [Medline] [Order article via Infotrieve]
  54. Morrison, D. K., Kaplan, D. R., Rapp, U., and Roberts, T. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8855-8859 [Abstract/Free Full Text]
  55. Friesel, R., and Brown, S. A. N. (1992) Development 116, 1051-1058 [Abstract]
  56. Sato, M., Kitazawa, T., Iwai, T., Seki, J., Sakato, N., Kato, J., and Takeya, T. (1991) Oncogene 6, 1279-1283 [Medline] [Order article via Infotrieve]
  57. Mansukhani, A., Dellera, P., Moscatelli, D., Kornbluth, S., Hanafusa, H., and Basilico, C. (1992) Proc Natl Acad Sci U. S. A. 89, 3305-3309 [Abstract/Free Full Text]
  58. Shi, D.-L., Launay, C., Fromentoux, V., Feige, J.-J., and Boucaut, J.-C. (1994) Dev. Biol. 164, 173-182 [CrossRef][Medline] [Order article via Infotrieve]
  59. Hattori, Y., Odagiri, H., Nakatani, H., Miyagawa, K., Naito, K., Sakamoto, H., Katoh, O., Yoshida, T., Sugimura, T., and Terada, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5983-5987 [Abstract/Free Full Text]
  60. Dionne, C., Crumley, G., Bellot, F., Kaplow, J., Searfoss, G., Ruta, M., Burgess, W., Jaye, M., and Schlessinger, J. (1990) EMBO J. 9, 2685-2692 [Medline] [Order article via Infotrieve]
  61. Shi, E., Kan, M., Xu, J., Wang, F., Hou, J., and McKeehan, W. (1993) Mol. Cell. Biol. 13, 3907-3918 [Abstract/Free Full Text]
  62. Roghani, M., Mansukhani, A., Dell'Era, P., Bellosta, P., Basilico, C., Rifkin, D. B., and Moscatelli, D. (1994) J. Biol. Chem. 269, 3976-3984 [Abstract/Free Full Text]
  63. Guimond, S., MacCarana, M., Olwin, B., Lindahl, U., and Rapraeger, A. (1993) J. Biol. Chem. 268, 23906-23914 [Abstract/Free Full Text]
  64. Aviezer, D., Levy, E., Safran, M., Svahn, C., Buddecke, E., Schmidt, A., David, G., Vlodavsky, I., and Yayon, A. (1994) J. Biol. Chem. 269, 114-121 [Abstract/Free Full Text]
  65. Yayon, A., Zimmer, Y., Shen, G. H., Avivi, A., Yarden, Y., and Givol, D. (1992) EMBO J. 11, 1885-1890 [Medline] [Order article via Infotrieve]
  66. Cheon, H. G., Larochelle, W. J., Bottaro, D. P., Burgess, W. H., and Aaronson, S. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 989-993 [Abstract/Free Full Text]
  67. Zimmer, Y., Givol, D., and Yayon, A. (1993) J. Biol. Chem. 268, 7899-7903 [Abstract/Free Full Text]
  68. Ueki, K., Matsuda, S., Tobe, K., Gotoh, Y., Tamemoto, H., Yachi, M., Akanuma, Y., Yazaki, Y., Nishida, E., and Kadowaki, T. (1994) J. Biol. Chem. 269, 15756-15761 [Abstract/Free Full Text]
  69. Vainikka, S., Joukov, V., Wennstrom, S., Bergman, M., Pelicci, P., and Alitalo, K. (1994) J. Biol. Chem 269, 18320-18326 [Abstract/Free Full Text]
  70. Wang, J. K., Gao, G. X., and Goldfarb, M. (1994) Mol. Cell. Biol. 14, 181-188 [Abstract/Free Full Text]
  71. Graves, L., Northrop, J., Potts, B., Krebs, E., and Kimelman, D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1662-1666 [Abstract/Free Full Text]
  72. MacNicol, A., Muslin, A., and Williams, L. (1993) Cell 73, 571-583 [CrossRef][Medline] [Order article via Infotrieve]
  73. Hébert, J. M., Rosenquist, T., Götz, J., and Martin, G. R. (1994) Cell 78, 1017-1025 [CrossRef][Medline] [Order article via Infotrieve]
  74. Peters, K., Werner, S., Liao, X., Wert, S., Whitsett, J., and Williams, L. (1994) EMBO J. 13, 3296-3301 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
A. Nechiporuk, T. Linbo, and D. W. Raible
Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish
Development, August 15, 2005; 132(16): 3717 - 3730.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
M. Antoine, M. Daum, R. Köhl, V. Blecken, M. J. Close, G. Peters, and P. Kiefer
NH2-Terminal Cleavage of Xenopus Fibroblast Growth Factor 3 Is Necessary for Optimal Biological Activity and Receptor Binding
Cell Growth Differ., November 1, 2000; 11(11): 593 - 605.
[Abstract] [Full Text]


Home page
DevelopmentHome page
V. Vendrell, E. Carnicero, F. Giraldez, M. T. Alonso, and T. Schimmang
Induction of inner ear fate by FGF3
Development, May 15, 2000; 127(10): 2011 - 2019.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M. Antoine, K. Reimers, C. Dickson, and P. Kiefer
Fibroblast Growth Factor 3, a Protein with Dual Subcellular Localization, Is Targeted to the Nucleus and Nucleolus by the Concerted Action of Two Nuclear Localization Signals and a Nucleolar Retention Signal
J. Biol. Chem., November 21, 1997; 272(47): 29475 - 29481.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D Jackson, J Bresnick, I Rosewell, T Crafton, R Poulsom, G Stamp, and C Dickson
Fibroblast growth factor receptor signalling has a role in lobuloalveolar development of the mammary gland
J. Cell Sci., January 6, 1997; 110(11): 1261 - 1268.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M. Mathieu, E. Chatelain, D. Ornitz, J. Bresnick, I. Mason, P. Kiefer, and C. Dickson
Receptor Binding and Mitogenic Properties of Mouse Fibroblast Growth Factor 3
J. Biol. Chem., October 13, 1995; 270(41): 24197 - 24203.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited