The fibroblast growth factor (FGF) ()family is composed of at least nine members based on amino acid sequence similarity (1, 2) (reviewed in (3) and (4) ). In cell culture, some FGFs are mitogenic for a broad spectrum of cell types including epithelial, mesodermal, and neuronal. Other activities associated with the FGFs include the stimulation of cell migration, neurotrophic properties, and the induction or inhibition of cell differentiation, depending on the cell type. They have been implicated in a number of normal physiological responses, such as neovascularization, wound repair, as well as inductive and patterning processes that occur during embryonic and fetal development(5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16) (reviewed in (4) ). There is also compelling evidence to suggest that mesoderm induction in vertebrate embryos requires the obligatory function of an FGF(17) .

The FGFs bind to high and low affinity cell surface receptors (for review, see (18, 19, 20) ). The heparan sulfate proteoglycans constitute the low affinity receptors and facilitate the interaction of FGFs with the high affinity signaling receptors. To date, four high affinity receptor genes have been identified in mammals (FGFR1, FGFR2, FGFR3, and FGFR4). However, identifying the receptor for the different FGF ligands is complicated by the generation of different receptor isoforms from the same gene by alternative splicing(21, 22, 23, 24, 25, 26) . The basic structure of FGF receptors consists of an extracellular portion composed of three immunoglobulin-like domains (Ig-loops), a transmembrane segment, a juxtamembrane region, and a split tyrosine kinase domain. Some FGF receptor variants lack the first Ig-loop and may or may not contain a region rich in acidic residues (acid box) which resides between Ig-loops I and II. The consequences of lacking the first Ig-loop or acid box are not clear as the truncated receptors appear to function normally(23, 27) . The three and two Ig-loop receptors have been termed and , respectively. FGF receptor genes 1, 2, and 3, but not 4, encode a choice of exon for the second half of the third Ig loop which changes ligand binding specificity(26, 27, 28, 29) . The receptor isoforms generated by the alternate splice are termed IIIb and IIIc, respectively. Other vertebrates also appear to encode the analogous receptor genes with isolates described from chicken, amphibians, and fish(22, 30, 31, 32, 33, 34) . FGF binding causes the activation of an intrinsic receptor tyrosine kinase activity and autophosphorylation. The receptor phosphotyrosine residues have been shown in some instances to form src homology 2 (SH2) binding sites that interact with second messenger generators to propagate an intracellular signal (reviewed in (18) and (19) ).

FGF3 was first identified as the product of a cellular oncogene (formerly int-2) associated with virally induced mouse breast cancers (reviewed in (35) ). The gene is not detectably transcribed in normal mouse mammary tissue, suggesting that inappropriate expression contributes to tumorigenesis. This idea was strengthened by the induction of proliferative abnormalities and tumors in the mammary glands of transgenic mice ectopically expressing FGF3 (36, 37, 38) . Apart from its potential oncogenic properties, considerable interest in FGF3 arises from its suspected role in embryonic and fetal development(6, 12, 14, 39, 40) . The generation of mice with a Fgf-3 null genotype (11) has confirmed the importance of this gene for proper development, since these mice exhibit structural abnormalities of the tail and many have inner ear defects resulting in differing degrees of deafness. However, abnormalities were not found at all sites of Fgf-3 expression, suggesting a degree of signaling redundancy or lack of FGF3 function at some of these sites.

The inefficient secretion of mouse FGF3 in cell cultures (41, 42) and its insolubility as a recombinant protein expressed in prokaryotes ()have severely hampered the isolation of active protein. These problems have now been circumvented by the isolation of the FGF3 homolog from Xenopus laevis (XFGF3) which shows a high level of amino acid identity to the mouse protein, but is efficiently secreted. Furthermore, conditioned medium containing this protein is mitogenic and induces phenotypic transformation in a number of mammalian cell lines. Here we use purified XFGF3 to identify its high affinity receptors by specific binding, Scatchard analysis, and covalent cross-linking. We show that, in quiescent cells expressing the appropriate receptors, XFGF3 activates the MAP kinase pathway, and reinitiates DNA synthesis.

MATERIALS AND METHODS

Cell Culture

Cloning of FGF Receptors

The extracellular, transmembrane, and juxtamembrane domain sequence of Xenopus FGFR2 (IIIb) and (IIIc) variants were cloned by reverse transcription of RNA from stage 22/23 Xenopus embryos followed by cDNA amplification using the RT-PCR. For the PCR the 5` primer was CGGAATTCACCATGGGGATGTCCTTAGTGTGGCGT and the 3` primer CTCCCACATGGGATCCTGTGGTAGCTC. A unique BamHI site (underlined) was introduced at the same position as the naturally occurring BamHI site in the mouse FGFR1, which results in the change of a histidine to glutamine. The PCR products were inserted as EcoRI-BamHI fragments in pGEM4 (Promega).

The extracellular, transmembrane, and juxtamembrane domain sequences encoding the mouse FGFR2 (IIIb) and (IIIc) variants were cloned by RT-PCR using total RNA from hindbrain and tail of 9.5- and 12.5-day embryos, respectively. The 5` primer was CGGAATTCCATGGTCAGCTGGGGTCGTTTCATC and the 3` primer was TGCTCTAGATTTGCCCAGCGTCAGCTTATCTCT. The PCR products were digested by EcoRI/BamHI and ligated into pGEM4.

To construct full-length receptors, the extracellular, transmembrane, and juxtamembrane domain sequences of the different receptors were linked to the region encoding the tyrosine-kinase and cytoplasmic tail of mouse FGFR1, via a unique BamHI site. These hybrid cDNAs were subcloned into the EcoRI and XbaI sites of the SV40-based expression vector, pKC3.

All PCRs were performed using the Pyrococcus furiosus DNA polymerase (Stratagene) which has proofreading activity. The plasmid constructs were then sequenced using Sequenase version 2.0 (U. S. Biochemical Corp.).

Purification of XFGF3

FGF Iodination

FGF Cell Binding Assay

Cross-linking of Receptors and FGFs

Detection of Raf and MAP Kinases

Mitogenicity Assay

RESULTS

XFGF3 Induces DNA Synthesis and Activates the MAPK Pathway

Figure 1: Induction of DNA synthesis by XFGF3, FGF1, and FGF7. Quiescent BALB/MK (Panel a) or NIH3T3 cells (Panel b) were treated with increasing concentrations of XFGF3 (closed circles), FGF1 (open squares), or FGF7 (filled squares), and the stimulation of DNA synthesis was measured by the incorporation of [H]thymidine as described under ``Materials and Methods.'' The mean value of duplicate determinations is shown. Results are representative of at least two experiments.

An emerging paradigm of ligand-mediated activation for several classes of tyrosine-kinase receptor is the stimulation of the MAP kinase pathway (for review, see (50) ). Two isoforms of these kinases (Erk-1 and Erk-2) are present in most mammalian cells, and, within minutes of ligand/receptor binding, these proteins are activated by phosphorylation on both threonine and tyrosine residues(51, 52) . Since the hyperphosphorylated Erks have a reduced mobility on SDS-PAGE, the activation can be monitored by immunoblot analysis of cell extracts (53) . Treatment of serum-deprived NIH3T3 cells with 50 ng/ml XFGF3 or FGF1 resulted in a rapid and transient phosphorylation of Erk-1 and -2 (p44 and p42, respectively) which was detected within 1 min of ligand addition. The hyperphosphorylated state was maintained for at least 15 min but was no longer detected at 30 min (Fig. 2). The activation of MAP kinases is part of a phosphorylation cascade involving a MAP kinase kinase and a MAP kinase kinase kinase (MAPKKK). The serine/threonine kinase Raf-1 has been shown to function as a MAPKKK (reviewed in (50) ). To determine whether, Raf-1 (p74) was involved in the stimulation of the MAP kinase pathway by XFGF3, an additional blot, prepared using the same extracts, was probed with a specific Raf-1 antiserum. The results show that the reduced mobility, reflecting hyperphosphorylation of Raf-1(54) , became apparent 15 and 30 min after treatment with either FGF1 or XFGF3. Although activation of Raf-1 would be expected to precede that of MAP kinase, the hyperphosphorylation response was delayed compared to that of p44 and p42. However, it is not clear whether the detected phosphorylation of Raf-1 correlates with its activation (see ``Discussion''). Similar results were obtained when BALB/MK cells were used instead of NIH3T3 (data not shown).

Figure 2: FGF1 and XFGF3 induces hyperphosphorylation of Raf-1, Erk-1, and Erk-2. Quiescent NIH3T3 cells were treated with 50 ng/ml FGF1 or XFGF3 for 1-30 min as indicated. Equal amounts of cell extracts were analyzed by immunoblotting using polyclonal antibodies that recognize Raf-1 (Panel a) or Erk-1 and -2 (Panel b).

Binding of XFGF3 to Mammalian FGF Receptors

Figure 3: Cross-linking of I-XFGF3 to BALB/MK and NIH3T3 cells. Cell cultures were incubated with 10 ng/ml I-XFGF3 in the absence or presence of a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.'' The size of the labeled proteins indicated on the left were estimated relative to rainbow size markers (Amersham Corp.).

Figure 4: Competition of FGF1 and XFGF3 for I-FGF1 binding to different FGF receptors. COS-1 cells expressing different receptors as indicated were incubated with 0.3 nMI-FGF1 in the presence of increasing concentrations of XFGF3 (open circles) or FGF1 (filled circles). Cells were then washed and lysed, and specific binding was determined as described under ``Materials and Methods.'' The calculated ID values are presented in Table 1.

Figure 5: Cross-linking of I-XFGF3 to COS-1 cells expressing FGFR2 variants. COS-1 cells were transfected with the indicated receptor cDNA and 48 h later were incubated with 10 ng/ml I-XFGF3 in the absence or presence a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.''

Isolation of FGF Receptors from Xenopus

Figure 6: Alignment of the predicted amino acid sequences for XFGFR2 (IIIc), XFGFR2 (IIIb), and XFGFR2 (IIIb+ab). a, the arrowhead marks the predicted site for signal peptide cleavage, and the circles indicate the cysteine residues which define the disulfide links of the extracellular Ig domains. Underlined is the position of the acid box, and the dashed gap in XFGFR2 (IIIb+ab) marks the missing sequences of Ig-loop-I absent in all -forms. The transmembrane region is under and overlined, while the region of divergence between the IIIc and IIIb isoforms is boxed. b, an amino acid sequence comparison of the divergent domains of Ig-loop III for XFGFR2 IIIb and IIIc isoforms. c and d show a comparison of the IIIb and IIIc isoforms, respectively, of FGFR2 from frog (Xenopus), salamander, newt, chicken, mouse, and human(30, 33, 49, 56, 57, 58, 59, 60) . The numbers to the right refer to the percentage amino acid identity in comparison with the Xenopus sequence. A dash indicates a gap, and a dot indicates a conserved residue.

Binding of XFGF3 to Xenopus FGF Receptors

Figure 7: Cross-linking of I-XFGF3 and I-FGF1 to COS-1 cells expressing Xenopus FGF receptors. a, COS-1 cells were transfected with the indicated receptor cDNA and 48 h later incubated with 10 ng/ml I-XFGF3 in the absence or presence a 20-fold excess of unlabeled XFGF3 (- or +, respectively). The receptor/ligand complexes were cross-linked and analyzed by SDS-PAGE as described under ``Materials and Methods.'' b, COS-1 cells expressing the Xenopus receptors, as indicated, were incubated with 10 ng/ml I-FGF1 in the absence or presence (- or +, respectively) of a 15-fold excess of unlabeled XFGF3 and processed as in a. The size of the labeled proteins indicated on the left were estimated relative to rainbow size markers (Amersham Corp.).

The affinity of XFGF3 for the IIIb and IIIc variants of XFGFR2 was determined using I-XFGF3 in direct binding assays (data not shown). From the Scatchard plots, K values in the range of 0.4-0.6 nM were calculated similar to those determined for the mouse FGFR2 homologs (see Table 1). In similar experiments, no binding to XFGFR1 (IIIc) was detected, and therefore the ability of unlabeled XFGF3 to compete with I-FGF1 for binding was used as an alternative means to assess affinity (Fig. 8). Increasing amounts of XFGF3 or FGF1 in the presence of 0.3 nMI-FGF1 were added to COS-1 cells expressing XFGFR1 (IIIc), and the retained radioactivity was measured by counting. As a positive control, COS-1 cells expressing XFGFR2 (IIIc) were used in a parallel experiment. An ID of 23 nM was determined for the binding of XFGF3 to XFGFR1 (IIIc) compared to 0.8 nM for XFGFR2 (IIIc), implying an approximately 29-fold lower affinity (see Table 1). The ID value for XFGFR2 (IIIc) is consistent with the K of 0.5 nM determined using the direct binding procedure (Table 1). As expected, efficient competition by FGF1 occurred on both receptors (Fig. 8).

Figure 8: Competition of FGF1 and XFGF3 for I-FGF1 binding to Xenopus FGF receptors. COS-1 cells expressing XFGFR1 (IIIc) (Panel a) or XFGFR2 (IIIc) (Panel b) were incubated with 0.3 nMI-FGF1 in the presence of increasing concentrations of unlabeled XFGF3 (open circles) or FGF1 (filled circles). Cells were then washed and lysed, and specific binding was determined as described under ``Materials and Methods.'' The calculated ID values are presented in Table 1.

DISCUSSION

Comparison of the predicted amino acid sequences for each of the different FGF receptors shows a high level of conservation across several species, which is much more marked than that seen for the different FGF receptors within a single species(18) . Therefore, it could be predicted that ligand binding specificity is similar for the same receptor from different species. Indeed, direct binding and competition analyses have shown that XFGF3 binds with the same high affinity to both mouse and Xenopus FGFR2, and it also interacts with the same low affinity with either mouse or Xenopus FGFR1 (IIIc) (Table 1). In addition, a weak interaction was also observed with human FGFR3 (IIIc), while no binding to mouse FGFR4 could be detected ( Fig. 4and Table 1). Considering the strong sequence conservation between mammalian and Xenopus receptors (Fig. 6, c and d) (22, 55) , we would predict the same is true for the Xenopus homologs of FGFR3 (IIIc) and FGFR4. The high affinity binding to FGFR2 suggests it is the most likely partner for XFGF3 at physiological ligand concentrations. In addition, the affinities of XFGF3 for the a- and b-variants of FGFR2 were found to be very similar (Table 1). This finding is in contrast to a report that shows FGF1 affinity for the -form of FGFR1 being 8-fold higher than its affinity for the -form(61) . This discrepancy may be due to the different cell types that were used to overexpress the receptors, as factors such as the structure of cell-derived heparan sulfates may modulate ligand binding affinity, and potentially specificity(62, 63, 64) . Alternatively, it may be an inherent property of the ligand/receptor combination and could result from nonidentical ligand binding domains (see below).

Whereas XFGF3 binds to the IIIb and IIIc variants of FGFR2 with similar affinities, FGF7 interacts exclusively with the IIIb isoform, and FGF2 shows a strong preference for the IIIc isoform (Table 1)(24, 65) . Like XFGF3, FGF1 binds both variants with high affinity, but then it also associates strongly with all the other FGF receptors and their known variants. Recent studies indicate that Ig-loops II and III contribute to the ligand binding site, albeit to different degrees depending on which FGF is involved in the interaction. For example, when individual Ig-loop domains of FGFR2 (IIIb) are fused to an immunoglobulin heavy chain Fc domain, Ig-loop II confers binding to FGF1 but not to FGF7, while Ig-loop III confers the converse specificity. However, in both cases the affinity is lower than that of a construct containing both Ig-loops(66) . The importance of Ig-loop II for FGF binding is further illustrated by analyses of chimeric receptors made between FGFR2 and either FGFR1 or FGFR3; whereas both Ig-loop II and the IIIb domain from FGFR2 are necessary to confer FGF7 binding when transferred to FGFR1, the single IIIb domain from FGFR2 is sufficient to confer this property when transferred to FGFR3(28, 67) . Additional experiments using such constructs should permit precise localization of the sites that interact with the ligand. However, to establish a complete model of ligand/receptor interaction, the regions on the FGF molecules themselves that determine receptor binding specificity need to be defined. Chimeric ligands made between the various FGFs could help to provide such information.

XFGF3 was shown to be mitogenic for BALB/MK and NIH3T3 cells which naturally express the IIIb and IIIc isoforms of FGFR2, respectively (Fig. 1). Furthermore, at XFGF3 concentrations that induce maximal DNA synthesis, hyperphosphorylation of Erk-1 and Erk-2 was detected 1 min after ligand addition (Fig. 2), suggesting efficient activation of the MAP kinase pathway. Phosphorylation of Raf-1 was observed after 15 min, which was surprising since Raf-1 activation is thought to precede that of Erk-1 and Erk-2(50) . However, the functional significance of Raf-1 phosphorylation is not clear, and similar results from other groups have led to the suggestion that Raf-1 phosphorylation serves to inactivate this kinase, thereby facilitating a transient response (68) . Whatever the functional consequences of Raf-1 phosphorylation, these studies provide evidence for the activation of the Raf-1/MAP kinase pathway by FGFs in cells expressing endogenous FGF receptors, confirming previous results obtained with receptor-transfected L6 myoblasts(69, 70) , and Xenopus embryos(71, 72) .

As might be expected for a ligand and its cognate receptor, there is a striking similarity between the expression patterns of XFGF3 and XFGFR2 (55) . Furthermore, in amphibians, the levels of both FGF3 and FGFR2 have been shown to increase upon neural induction(40, 58) . Some insights into the functions of FGFs and their receptors in vivo derive from transgenic animal studies. For example, mice null for Fgf-3 or Fgf-5 were found to have specific but restricted phenotypic alterations(11, 73) . The limited phenotypic consequences of these gene knockouts despite extensive gene expression patterns, suggests there may be some functional complementation. Similar experiments designed to generate mice null for the FGF receptor genes may have more serious consequences since signaling by several FGF-ligands could be affected. An alternative strategy is to target the expression of a dominant negative form of a given receptor exclusively to one tissue/organ at a stage when endogenous expression of this receptor is known to occur. This was recently achieved by Peters et al.(74) who showed that expressing a dominant negative FGFR2 (IIIb) in the lung bud epithelium of transgenic mice results in a complete inhibition of branching morphogenesis, clearly implicating this receptor in lung organogenesis. Since FGF3 disrupts mammary gland development(36, 37, 38) , we are using a similar stategy to determine whether signaling via FGFR2 (IIIb) is necessary for normal breast morphogenesis. Thus, knowledge of FGF and FGFR specificities combined with data on the times and sites of their expression will facilitate the design of experiments to determine the functions of these signaling molecules in animal development.

FOOTNOTES

*

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence should be addressed: Viral Carcinogenesis Laboratory, P.O. Box 123, 44 Lincoln's Inn Fields, London WC2A 3PX, UK. Tel: 44-71-269-3336; Fax: 44-71-269-3094.

()

The abbreviations used are: FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; XFGF, fibroblast growth factor from Xenopus laevis; MAP, mitogen-activated protein; DMEM, Dulbecco's modified Eagle's medium; RT, reverse transcription; PCR, polymerase chain reaction; PMSF, polymethylsulfonyl fluoride; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis.

()

M. Mathieu, P. Kiefer, I. Marics, and C. Dickson, unpublished observations.

ACKNOWLEDGEMENTS

REFERENCES

1. Miyamoto, M., Naruo, K., Seko, C., Matsumoto, S., Kondo, T., and Kurokawa, T. (1993) Mol. Cell. Biol. 13, 4251-4259 [Abstract/Free Full Text]
2. Tanaka, A., Miyamoto, K., Minamino, N., Takeda, M., Sato, B., Matsuo, H., and Matsumoto, K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8928-8932 [Abstract/Free Full Text]
3. Goldfarb, M. (1990) Cell Growth & Differ. 1, 439-445
4. Burgess, W. H., and Maciag, T. (1989) Annu. Rev. Biochem. 58, 575-606 [CrossRef][Medline] [Order article via Infotrieve]
5. Mason, I., Fuller-Pace, F., Smith, R., and Dickson, C. (1994) Mech. Dev. 45, 15-30 [CrossRef][Medline] [Order article via Infotrieve]
6. Represa, J., Leon, Y., Miner, C., and Giraldez, F. (1991) Nature 353, 561-563 [CrossRef][Medline] [Order article via Infotrieve]
7. Haub, O., and Goldfarb, M. (1991) Development 112, 397-406 [Abstract]
8. DeLapeyriere, O., Ollendorff, V., Planche, J., Ott, M., Pizette, S., Coulier, F., and Birnbaum, D. (1993) Development 118, 601-611 [Abstract]
9. Drucker, B. J., and Goldfarb, M. (1993) Mech. Dev. 40, 155-163 [CrossRef][Medline] [Order article via Infotrieve]
10. Hebert, J. M., Basilico, C., Goldfarb, M., Haub, O., and Martin, G. R. (1990) Dev. Biol. 138, 453-463
11. Mansour, S. L., Goddard, J. M., and Capecchi, M. R. (1993) Development 117, 13-28 [Abstract]
12. Niswander, L., and Martin, G. R. (1992) Development 114, 755-768 [Abstract]
13. Niswander, L., Tickle, C., Vogel, A., Booth, I., and Martin, G. (1993) Cell 75, 579-587 [CrossRef][Medline] [Order article via Infotrieve]
14. Wilkinson, D. G., Bhatt, S., and McMahon, A. P. (1989) Development 105, 131-136 [Abstract]
15. Wilkinson, D. G., and Krumlauf, R. (1990) Trends Neurosci. 13, 335-339 [CrossRef][Medline] [Order article via Infotrieve]
16. Werner, S., Peters, K., Longaker, M., Fuller-Pace, F., Banda, M., and William, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6896-6900 [Abstract/Free Full Text]
17. Amaya, E., Musci, T. J., and Kirschner, M. W. (1991) Cell 66, 257-270 [CrossRef][Medline] [Order article via Infotrieve]
18. Johnson, D., and Williams, L. (1993) Adv. Cancer Res. 60, 1-41 [Medline] [Order article via Infotrieve]
19. Jaye, M., Schlessinger, J., and Dionne, C. (1992) Biochim. Biophys. Acta 1135, 185-199 [Medline] [Order article via Infotrieve]
20. Klagsbrun, M., and Baird, A. (1991) Cell 67, 229-231 [CrossRef][Medline] [Order article via Infotrieve]
21. Hou, J., Kan, M., McKeehan, K., McBride, G., Adams, P., and McKeehan, W. (1991) Science 251, 665-668 [Abstract/Free Full Text]
22. Friesel, R., and Dawid, I. B. (1991) Mol. Cell. Biol. 11, 2481-2488 [Abstract/Free Full Text]
23. Johnson, D. E., Lee, P. L., Lu, J., and Williams, L. T. (1990) Mol. Cell. Biol. 10, 4728-4736 [Abstract/Free Full Text]
24. Miki, T., Bottaro, D., Fleming, T., Smith, C., Burgess, W., Chan, A.-L., and Aaronson, S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 246-250 [Abstract/Free Full Text]
25. Reid, H., Wilks, A., and Bernard, O. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1596-1600 [Abstract/Free Full Text]
26. Werner, S., Duan, D.-S. R., DeVries, C., Peters, K. C., Johnson, D. E., and Williams, L. T. (1992) Mol. Cell. Biol. 12, 82-88 [Abstract/Free Full Text]
27. Dell, K. R., and Williams, L. T. (1992) J. Biol. Chem. 267, 21225-21229 [Abstract/Free Full Text]
28. Chellaiah, A., McEwen, D., Werner, S., Xu, J., and Ornitz, D. (1994) J. Biol. Chem. 269, 11620-11627 [Abstract/Free Full Text]
29. Vainikka, S., Partanen, J., Bellosta, P., Coulier, F., Basilico, C., Jaye, M., and Alitalo, K. (1992) EMBO J. 11, 4273-4280 [Medline] [Order article via Infotrieve]
30. Pasquale, E. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5812-5816 [Abstract/Free Full Text]
31. Lee, P. L., Johnson, D. E., Cousens, L. S., Fried, V. A., and Williams, L. T. (1989) Science 245, 57-60 [Abstract/Free Full Text]
32. Emori, Y., Yasuoka, A., and Saigo, K. (1992) FEBS Lett. 314, 176-178 [CrossRef][Medline] [Order article via Infotrieve]
33. Poulin, M. L., and Chiu, I. M. (1994) Biochim. Biophys. Acta 1220, 209-211 [Medline] [Order article via Infotrieve]
34. Shi, D. L., Feige, J. J., Riou, J. F., Desimone, D. W., and Boucaut, J. (1992) Development 116, 261-273 [Abstract]
35. Dickson, C., Deed, R., Dixon, M., and Peters, G. (1989) Prog. Growth Factor Res. 1, 123-132 [CrossRef][Medline] [Order article via Infotrieve]
36. Stamp, G., Fantl, V., Poulsom, R., Jamieson, S., Smith, R., Peters, G., and Dickson, C. (1992) Cell Growth & Differ. 3, 929-938
37. Ornitz, D. M., Cardiff, R. D., Kuo, A., and Leder, P. (1992) J. Natl. Cancer Inst. 84, 887-892 [Abstract/Free Full Text]
38. Muller, W. J., Lee, F. S., Dickson, C., Peters, G., Pattengale, P., and Leder, P. (1990) EMBO J. 9, 907-913 [Medline] [Order article via Infotrieve]
39. Wilkinson, D. G., Peters, G., Dickson, C., and McMahon, A. P. (1988) EMBO J. 7, 691-695 [Medline] [Order article via Infotrieve]
40. Tannahill, D., Isaacs, H. V., Close, M. J., Peters, G., and Slack, J. M. W. (1992) Development 115, 695-702 [Abstract]
41. Kiefer, P., Peters, G., and Dickson, C. (1993) Mol. Cell. Biol. 13, 5781-5793 [Abstract/Free Full Text]
42. Dixon, M., Deed, R., Acland, P., Moore, R., Whyte, A., Peters, G., and Dickson, C. (1989) Mol. Cell. Biol. 9, 4896-4902 [Abstract/Free Full Text]
43. Rubin, J. S., Osada, H., Finch, P. W., Taylor, W. G., Rudikoff, S., and Aaronson, S. A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 802-806 [Abstract/Free Full Text]
44. Keegan, K., Johnson, D. E., Williams, L. T., and Hayman, M. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1095-1099 [Abstract/Free Full Text]
45. Stark, K., McMahon, J., and McMahon, A. (1991) Development 113, 641-651 [Abstract]
46. Kiefer, P., Mathieu, M., Close, M., Peters, G., and Dickson, C. (1993) EMBO J. 12, 4159-4168 [Medline] [Order article via Infotrieve]
47. Kan, M., Shi, E., and McKeehan, W. (1991) in Barnes, D., Mather, J., and Sato, G. (eds) Peptide Growth Factors , Part C, Academic Press, New York, pp. 158-171
48. Adams, P., and Parker, P. (1991) FEBS Lett. 290, 77-82 [CrossRef][Medline] [Order article via Infotrieve]
49. Miki, T., Fleming, T. P., Bottaro, D. P., Rubin, J. S., Ron, D., and Aaronson, S. A. (1991) Science 251, 72-75 [Abstract/Free Full Text]
50. Ruderman, J. (1993) Curr. Opin. Cell Biol. 5, 207-213 [CrossRef][Medline] [Order article via Infotrieve]
51. Boulton, T., Nye, S., Robbins, D., Ip, N., Radziejewska, E., Morgenbesser, S., DePinho, R., Panayotatos, N., Cobb, M., and Yancopoulos, G. (1991) Cell 65, 663-675 [CrossRef][Medline] [Order article via Infotrieve]
52. Cobb, M., Boulton, T., and Robbins, D. (1991) Cell Regul. 2, 965-978 [Medline] [Order article via Infotrieve]
53. Leevers, S., and Marshall, C. (1992) EMBO J. 11, 569-574 [Medline] [Order article via Infotrieve]
54. Morrison, D. K., Kaplan, D. R., Rapp, U., and Roberts, T. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8855-8859 [Abstract/Free Full Text]
55. Friesel, R., and Brown, S. A. N. (1992) Development 116, 1051-1058 [Abstract]
56. Sato, M., Kitazawa, T., Iwai, T., Seki, J., Sakato, N., Kato, J., and Takeya, T. (1991) Oncogene 6, 1279-1283 [Medline] [Order article via Infotrieve]
57. Mansukhani, A., Dellera, P., Moscatelli, D., Kornbluth, S., Hanafusa, H., and Basilico, C. (1992) Proc Natl Acad Sci U. S. A. 89, 3305-3309 [Abstract/Free Full Text]
58. Shi, D.-L., Launay, C., Fromentoux, V., Feige, J.-J., and Boucaut, J.-C. (1994) Dev. Biol. 164, 173-182 [CrossRef][Medline] [Order article via Infotrieve]
59. Hattori, Y., Odagiri, H., Nakatani, H., Miyagawa, K., Naito, K., Sakamoto, H., Katoh, O., Yoshida, T., Sugimura, T., and Terada, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5983-5987 [Abstract/Free Full Text]
60. Dionne, C., Crumley, G., Bellot, F., Kaplow, J., Searfoss, G., Ruta, M., Burgess, W., Jaye, M., and Schlessinger, J. (1990) EMBO J. 9, 2685-2692 [Medline] [Order article via Infotrieve]
61. Shi, E., Kan, M., Xu, J., Wang, F., Hou, J., and McKeehan, W. (1993) Mol. Cell. Biol. 13, 3907-3918 [Abstract/Free Full Text]
62. Roghani, M., Mansukhani, A., Dell'Era, P., Bellosta, P., Basilico, C., Rifkin, D. B., and Moscatelli, D. (1994) J. Biol. Chem. 269, 3976-3984 [Abstract/Free Full Text]
63. Guimond, S., MacCarana, M., Olwin, B., Lindahl, U., and Rapraeger, A. (1993) J. Biol. Chem. 268, 23906-23914 [Abstract/Free Full Text]
64. Aviezer, D., Levy, E., Safran, M., Svahn, C., Buddecke, E., Schmidt, A., David, G., Vlodavsky, I., and Yayon, A. (1994) J. Biol. Chem. 269, 114-121 [Abstract/Free Full Text]
65. Yayon, A., Zimmer, Y., Shen, G. H., Avivi, A., Yarden, Y., and Givol, D. (1992) EMBO J. 11, 1885-1890 [Medline] [Order article via Infotrieve]
66. Cheon, H. G., Larochelle, W. J., Bottaro, D. P., Burgess, W. H., and Aaronson, S. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 989-993 [Abstract/Free Full Text]
67. Zimmer, Y., Givol, D., and Yayon, A. (1993) J. Biol. Chem. 268, 7899-7903 [Abstract/Free Full Text]
68. Ueki, K., Matsuda, S., Tobe, K., Gotoh, Y., Tamemoto, H., Yachi, M., Akanuma, Y., Yazaki, Y., Nishida, E., and Kadowaki, T. (1994) J. Biol. Chem. 269, 15756-15761 [Abstract/Free Full Text]
69. Vainikka, S., Joukov, V., Wennstrom, S., Bergman, M., Pelicci, P., and Alitalo, K. (1994) J. Biol. Chem 269, 18320-18326 [Abstract/Free Full Text]
70. Wang, J. K., Gao, G. X., and Goldfarb, M. (1994) Mol. Cell. Biol. 14, 181-188 [Abstract/Free Full Text]
71. Graves, L., Northrop, J., Potts, B., Krebs, E., and Kimelman, D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1662-1666 [Abstract/Free Full Text]
72. MacNicol, A., Muslin, A., and Williams, L. (1993) Cell 73, 571-583 [CrossRef][Medline] [Order article via Infotrieve]
73. Hébert, J. M., Rosenquist, T., Götz, J., and Martin, G. R. (1994) Cell 78, 1017-1025 [CrossRef][Medline] [Order article via Infotrieve]
74. Peters, K., Werner, S., Liao, X., Wert, S., Whitsett, J., and Williams, L. (1994) EMBO J. 13, 3296-3301 [Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Nechiporuk, T. Linbo, and D. W. Raible Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish Development, August 15, 2005; 132(16): 3717 - 3730. [Abstract] [Full Text] [PDF]

				M. Antoine, M. Daum, R. Köhl, V. Blecken, M. J. Close, G. Peters, and P. Kiefer NH2-Terminal Cleavage of Xenopus Fibroblast Growth Factor 3 Is Necessary for Optimal Biological Activity and Receptor Binding Cell Growth Differ., November 1, 2000; 11(11): 593 - 605. [Abstract] [Full Text]

				V. Vendrell, E. Carnicero, F. Giraldez, M. T. Alonso, and T. Schimmang Induction of inner ear fate by FGF3 Development, May 15, 2000; 127(10): 2011 - 2019. [Abstract] [PDF]

				M. Antoine, K. Reimers, C. Dickson, and P. Kiefer Fibroblast Growth Factor 3, a Protein with Dual Subcellular Localization, Is Targeted to the Nucleus and Nucleolus by the Concerted Action of Two Nuclear Localization Signals and a Nucleolar Retention Signal J. Biol. Chem., November 21, 1997; 272(47): 29475 - 29481. [Abstract] [Full Text] [PDF]

				D Jackson, J Bresnick, I Rosewell, T Crafton, R Poulsom, G Stamp, and C Dickson Fibroblast growth factor receptor signalling has a role in lobuloalveolar development of the mammary gland J. Cell Sci., January 6, 1997; 110(11): 1261 - 1268. [Abstract] [PDF]

				M. Mathieu, E. Chatelain, D. Ornitz, J. Bresnick, I. Mason, P. Kiefer, and C. Dickson Receptor Binding and Mitogenic Properties of Mouse Fibroblast Growth Factor 3 J. Biol. Chem., October 13, 1995; 270(41): 24197 - 24203. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited