|
Volume 270,
Number 12,
Issue of March 24, 1995 pp. 7004-7010
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Involvement
of Early Growth Response Factor Egr-1 in Apolipoprotein AI Gene
Transcription (*)
(Received for publication, November 14, 1994; and in revised form, January 23, 1995)
Edward J.
Kilbourne
(1),
Russell
Widom
(2), (§),
Douglas C.
Harnish
(1),
Sohail
Malik
(1),
Sotirios
K.
Karathanasis
(1) (2)(¶)From the
(1)Department of Cardiovascular Molecular
Biology, Lederle Laboratories, Pearl River, New York 10965 and the
(2)Laboratory of Molecular and Cellular Cardiology,
Department of Cardiology, Children's Hospital and Department of
Pediatrics, Harvard Medical School, Boston, Massachusetts 02115
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Liver-specific expression of the apolipoprotein AI (apoAI) gene
is mediated by transcription factors bound to three sites (A, B, and C)
in the apoAI enhancer. Sites A and C bind various members of the
nuclear receptor superfamily, including the orphan nuclear receptor
apolipoprotein regulatory protein-1 (ARP-1); site B binds the
liver-enriched factor hepatic nuclear factor-3. The immediate early
growth response factor (Egr-1), which is transiently expressed in
various pathophysiologic states of the liver, activates the apoAI
enhancer and overcomes ARP-1-mediated repression of the enhancer in
hepatoblastoma HepG2 cells. Deletion mapping analysis revealed two
Egr-1 binding sites, E1 and E2, flanking site A. Egr-1 bound
efficiently to both E1 and E2. Sp1 in HepG2 nuclear extracts bound to
E2 but not E1. In HepG2 cells, E1 functioned as an Egr-1 response
element, whereas E2 had high basal activity and was not further induced
by Egr-1. Mutations that prevent Egr-1 binding to the apoAI enhancer
abolished its responsiveness to Egr-1, while they had only minor
effects on its constitutive activity. These mutations also diminished
the ability of Egr-1 to overcome ARP-1-mediated repression. Elimination
of transcription factor binding to sites A, B, or C reduced enhancer
activity without affecting Egr-1-dependent activation. We argue that
Egr-1 is recruited to the apoAI enhancer complex under unusual
circumstances, such as those prevailing during liver regeneration, to
maintain apoAI transcription levels by overriding prior transcriptional
controls.
INTRODUCTION
Tissue-specific and developmental expression of eukaryotic genes
is regulated by multiprotein complexes assembled on enhancer and
promoter sequences (reviewed in (1) ). Modular organization of
target sites for transcriptional factors within the enhancers is
believed to be a device for integrating signals transduced by the
factors during the course of establishment and maintenance of the
tissue-specific phenotype(2) . Apolipoprotein AI (apoAI) ( )is the major protein constituent of high density
lipoproteins, which transport cholesterol from extrahepatic tissues to
the liver for excretion (reviewed in (3) ). Liver-specific
expression of the gene encoding apoAI is the outcome of multiple
protein-DNA and protein-protein interactions involving ubiquitous and
liver-enriched transcription
factors(4, 5, 6, 7, 8, 9, 10) .
The architectural requirements for these interactions are fulfilled by
a tissue-specific enhancer located in the -222 to -110
region of the apoAI gene promoter(4, 5) . Within the
enhancer, three sites (sites A, -214 to -192; B, -169
to -146; and C, -134 to -119) (5) are
predominantly occupied by transcription factors present in liver
nuclear extracts. Sites A and C are cognate sites for members of the
nuclear hormone receptor superfamily (11) including RXR (6, 8) and
HNF-4(9, 10, 12) , which activate apoAI gene
transcription, and ARP-1(7, 9) , Erb
EAR-2( ), and Erb EAR-3/chicken ovalbumin upstream promoter
transcription factor(9) , which repress it. Site B is an
efficient response element for the liver-enriched factor HNF-3 (10) . Since the apoAI regulatory apparatus responds to
diverse stimuli (14, 15, 16, 17, 18, 19, 20) ,
we predicted that the precise composition of the multiprotein enhancer
complex would be continually changing (9, 10) and
suggested that repression mediated by ARP-1 may facilitate switching
between alternative transcriptionally active states induced by
different stimuli(8, 9) . Accordingly, the early
growth response factor, Egr-1, was identified as a transcription factor
that could overcome ARP-1-mediated repression of the apoAI gene and
restore elevated activity of the enhancer(9) . This paper
demonstrates that Egr-1 activates apoAI gene transcription through two
sites in the enhancer, which bind Egr-1 and display significant
homology to the consensus Egr-1 binding site. It is further shown that
Egr-1 contributes to the transcriptional activation of the apoAI
enhancer in the absence of functional sites A, B, or C. These findings
raise the possibility that control of apoAI gene transcription by Egr-1
may be a mechanism for overriding pre-existing regulatory constraints.
MATERIALS AND METHODS
Synthetic OligonucleotidesThe
double-stranded oligonucleotides spanning the apoAI promoter between
the nucleotides -214 to -192 (oligo A), -178 to
-148 (oligo B), -136 to -114 (oligo C), and
-196 to -174 (oligo E1) were previously
described(5) . Oligonucleotide E1m,
GATCCGCCCTGCAGCACCCGCAGCTTGCT, differs from oligonucleotide E1 by one
nucleotide (underlined). E2 spans the -226 to -209
region of the apoAI promoter. The double-stranded oligonucleotide E2m,
GATCTCCTCCCGCACCCACTGAA, differs from oligonucleotide E2 by one
nucleotide (underlined). A double-stranded oligonucleotide
(oligo Egr) containing two Egr consensus sequences (CGCCCCCGC)
separated by one nucleotide, an oligonucleotide (oligo Egrmut)
containing two mutated Egr consensus sequences (CGCCCTAGC), and an
oligonucleotide containing the AP-2 cognate site were from Santa Cruz
Biotechnology. Oligonucleotides containing consensus sequences for
transcription factors AP-1, Oct-1, and Sp1 were from Promega.
PlasmidsThe following plasmids have been
previously described: chloramphenicol acetyltransferase (CAT) reporters
-256AI.CAT, -192AI.CAT, -133AI.CAT, -41AI.CAT,
-256/-80AI.CAT, -256/-133AI.CAT, and
-256/-192AI.CAT(4) ; -222/-110AI.CAT
and various mutated versions of -222/-110AI.CAT (XBC, AXC, and ABX)(10) ; and
pMT2-ARP-1 expression plasmid(7) . The pBS.ApaI plasmid
containing the Egr-1 cDNA in pBluescript used for the in vitro transcription of Egr-1 and the Egr-1 expression vector pCMV5-Egr-1
were kindly provided by Dr. V. P. Sukhatme(21) . The CAT
reporters containing C to A substitutions in the apoAI promoter at
nucleotides -186 in site E1 (-256(E1m)AI.CAT), at
nucleotide -218 in site E2 (-256(E2m) AI.CAT), or both
(-256(E1m.E2m)AI.CAT) were generated by polymerase chain reaction
mutagenesis and cloning of the polymerase chain reaction products into
the HindIII site of pUC9CAT(4) . The
E1-41AI.CAT, E1m-41AI.CAT, E2-41AI.CAT, and E2m-41AI.CAT
reporters were produced by subcloning the double-stranded
oligonucleotides E1, E1m, E2, and E2m into the BamHI site of
-41AI.CAT(4) . Standard recombinant DNA methods were
employed(22) .
Transient Transfection AssaysHuman
hepatoblastoma HepG2 cells were transfected with various CAT and
pRSV -galactosidase reporters with or without the Egr-1 expression
vector (pCMV5-Egr-1) using the calcium phosphate coprecipitation method (23) and assayed as described(5, 10) .
EMSABinding assays utilizing in
vitro translated Egr-1 (Promega TNT reticulocyte lysate system)
and oligonucleotides E1 and E2 as probes were performed as described (10) . Binding assays using HepG2 nuclear proteins (10) were similarly performed except that reactions were
incubated on ice since retardation complex formation with the E2 probe
was temperature sensitive. Antibodies (Egr-1, C/EBP, and Sp1) were from
Santa Cruz Biotechnology.
RESULTS
Identification of Two Egr-1-responsive Elements
within the apoAI EnhancerWe previously observed that Egr-1
stimulates expression of an apoAI promoter/enhancer CAT reporter in
hepatoblastoma HepG2 cells(9) . To map the Egr-1-responsive
element(s), several CAT reporters containing 5`- or 3`-truncations of
the apoAI promoter/enhancer were transiently transfected into HepG2
cells in the presence or absence of the Egr-1 expression vector
pCMV5-Egr-1, and the -fold activation of each reporter by Egr-1 was
determined. As shown in Fig. 1, the reporter -256AI.CAT,
which contains the apoAI enhancer and promoter in their natural
arrangement, was activated by Egr-1 nearly 6-fold, consistent with our
previous results(9) . The reporter -192AI.CAT also
responded to Egr-1 showing a more than 4-fold activation, while the
reporter -133AI.CAT was completely unresponsive. Reporters
analogous to -256AI.CAT but lacking the -80 to -42,
-133 to -42, or -192 to -42 promoter/enhancer
regions were activated by Egr-1 3.5-, 5.3-, and 1.9-fold, respectively.
A reporter containing the -203 to -140 region upstream of
the apoAI basal promoter (at nucleotide position -41) was
activated by Egr-1 1.8-fold while a similar reporter containing the
-187 to -140 region was completely unresponsive.
Figure 1:
Deletion mapping analysis of the apoAI
promoter responsiveness to Egr-1. CAT reporter constructs (8 µg)
under the control of the apoAI promoter (-256.AI.CAT) or the
indicated deletion derivatives were cotransfected into HepG2 cells with
pRSV- -galactosidase plasmid (2 µg) in the absence or presence
of the Egr-1 expression plasmid (pCMV5-Egr-1, 0.5 µg). For each
construct, -fold activation by Egr-1 was expressed as the ratio of the
CAT activity (normalized to -galactosidase activity) in the
presence of pCMV5-Egr-1 to that in its absence. Filledbars, relative CAT activity of construct in the absence
of Egr-1 expression plasmid; cross-hatched bars, relative CAT
activity of construct in the presence of Egr-1 expression
plasmid.
Collectively, these data indicate that the -256 to -133
apoAI promoter/enhancer region contains all the necessary elements for
maximal responsiveness of the apoAI gene to Egr-1. In addition, the
data suggest that this region is composed of more than one subregion,
each contributing to the full responsiveness to Egr-1. Specifically,
the -203 to -140 subregion responded to Egr-1, but the
-187 to -140 did not. This suggests that sequences in the
-203 to -187 region may be a part of an Egr-1-responsive
element. This is consistent with the observation that deletion of the
-256 to -192 region in the reporter -192AI.CAT
reduces Egr-1 responsiveness. However, it does not explain why the
responsiveness of the -203 to -140 region is less than half
that of the -256 to -133 region. These findings argue for
the presence of additional Egr-1-responsive elements either at
-256 to -203, -140 to -133, or both. Comparison
of sequences in and around -256 to -203, -203 to
-187, and -140 to -133 with the established consensus
sequence for Egr-1 binding CGCCCCCGC (24) revealed two sites,
site E2 CGCCCCCAC (at positions -221 to -213) and site El AGCCCCCGC (at
positions -189 to -181) each deviating by a single
nucleotide (underlined) from the Egr-1 consensus
sequence(24) . The region around -140 to -133 did
not contain sequences with recognizable homology to the Egr-1 consensus
(see Fig. 2A).
Figure 2:
EMSA analysis of proteins binding to sites
E1 and E2. A, the nucleotide sequence of the apoAI promoter
region is shown. Numbers indicate location of nucleotides
upstream from the transcriptional start site. The location of the
enhancer elements A, B, C, E1, and E2 and the overlapping Sp1 site (see
text) within this sequence are indicated. Regions spanned by
double-stranded oligonucleotides used in EMSA including mutant
oligonucleotides E1m and E2m containing C to A substitutions in the
putative Egr-1 binding sequence are also shown. These mutations (at
positions -186 and -218) are also indicated on the
sequence. B and C, in vitro translated Egr-1 (lanes2-12) was tested for binding to site E1 (panelB) and site E2 (panelC)
probes by EMSA. The following competitor oligonucleotides were
included: lanes3-6, indicated molar excess of
unlabeled oligonucleotide E1 (panelB) and E2 (panelC); lane7, Egr (Egr-1
consensus); lane8, Egrmut (Egr-1 consensus
binding site mutant); lane9, apoAI site A (A); lane10, E1m (mutant site E1, panelB) or E2m (mutant site E2, panelC).
Antibody specific for C/EBP (lane11) or Egr-1 (lane12) was included as indicated. D, EMSA
binding reactions contain HepG2 cell nuclear extract and end-labeled
site E1 (lane1) and site E2 (lanes2-13) probes. 200-fold molar excess of the
following unlabeled competitor oligonucleotides was included as
indicated: lane3, E2; lane4, E2m; lane5, apoAI site A (A); lane6, E1; lane7, Egr-1; lane8, Sp1; lane9, AP-2; lane10, AP-1; lane11, Oct-1. Antibody
specific for Sp1 (lane12) or Egr-1 (lane13) was included as
indicated.
Site E2 Binds Both Sp1 and Egr-1 but Site E1 Binds
Only Egr-1EMSA was employed to examine if Egr-1 binds to
sites E1 and E2. As shown in Fig. 2, B and C,
Egr-1 expressed in vitro bound efficiently to oligonucleotide
probes containing either site E1 or E2 (lanes2).
This binding was specific because excess unlabeled homologous
oligonucleotides in the binding reaction mixture inhibited retardation
complex formation (lanes3-6), whereas a large
excess of unrelated oligonucleotides corresponding to the apoAI gene
sites A, B, or C (see Fig. 2A) did not (Fig. 2, B and C, lanes9; data not shown).
In contrast, excess amounts of an oligonucleotide containing two copies
of the Egr-1 binding site consensus sequence inhibited retardation
complex formation (lanes7), while excess amounts of
a similar oligonucleotide containing a mutated version of the Egr-1
consensus (CGCCTAGC) did not (lanes8). Addition of
Egr-1 antiserum, but not of a control serum, to the binding reactions
supershifted these retardation complexes (lanes11 and 12). Thus, it appears that Egr-1 can bind to sites E1
and E2. This was further confirmed as follows. Based on the DNA
recognition properties of Egr-1(24) , we predicted that C to A
substitutions at nucleotide positions -186 and -218 in E1
and E2, respectively (see Fig. 2A) would prevent Egr-1
binding to the corresponding oligonucleotide probes. Indeed, excess
amounts of oligonucleotides E1m (AGCACCCGC) or E2m (CGCACCCAC) that
incorporate these nucleotide substitutions (underlined) in
sites E1 and E2, respectively, did not inhibit retardation complex
formation with the corresponding wild-type probes (lanes10).To determine whether E1 and E2 are bound by Egr-1
or other related factors in HepG2 cells, nuclear extracts prepared from
these cells were subjected to EMSA analysis with the E1 and E2
oligonucleotide probes. The results in Fig. 2D,
representative of binding reactions performed under various conditions
using different preparations of HepG2 nuclear extracts, showed little,
if any, nuclear factor binding to the E1 probe (lane1). In contrast, incubation of the nuclear extracts with
the E2 probe resulted in multiple retardation complexes (lane2). To identify the factor(s) in HepG2 cells that
bind(s) preferentially to E2 despite the similar affinities of sites E1
and E2 for Egr-1 (data not shown), we undertook a systematic
competition EMSA analysis using as competitors various double-stranded
oligonucleotides containing binding sites for previously characterized
transcription factors. As can be seen in Fig. 2D, the
retardation complex formed with probe E2 was inhibited by excess
unlabeled E2 oligonucleotide (lane3) but not by
excess E2m oligonucleotide (lane4). Retardation
complex formation was not inhibited by excess apoAI site A (lane5) or site E1 (lane6) oligonucleotides
nor by excess Egr-1 consensus oligonucleotide (lane7). Together with the observation that the factors
capable of binding to site E1 are absent in HepG2 nuclear extracts,
these data provided strong support for the notion that the factor(s)
that bind(s) to site E2 are different than Egr-1. This was further
confirmed by supershift analysis of probe E2 retardation complexes
using Egr-1-specific antiserum (lane13). The
possible identity of this factor with the transcription factor Sp1 was
indicated by the substantial inhibition of retardation complex
formation by excess amounts of an oligonucleotide containing the Sp1
binding consensus sequence (lane8). Excess amounts
of oligonucleotides corresponding to the binding sites for the
transcription factors AP-2, AP-1, and Oct-1, on the other hand, did not
interfere with retardation complex formation (lanes9-11). Supershift analysis using Sp1-specific
antiserum (lane12) confirmed the presence of Sp1 in
probe E2 retardation complexes. Indeed, upon re-inspection of the site
E2 sequence, it was apparent that it contains two extensively
overlapping transcription factor binding motifs, one for Egr-1 and
another for Sp1 (see Fig. 2A). Note also that the C to
A substitution in the mutated version of E2, i.e. E2m, affects
both Egr-1 and Sp1 binding motifs, explaining the inability of the
mutated site to bind either Egr-1 or Sp1.
Functional Analysis of Sites E1 and E2To
assess the functional significance of E1 and E2, we cloned
oligonucleotides containing these sites immediately upstream of the
apoAI core promoter (at nucleotide location -41) and tested the
activity of the resulting reporter constructs in HepG2 cells in the
presence or absence of cotransfected Egr-1 expression vector. The
results in Fig. 3A show that in the absence of Egr-1,
the activity of the construct containing site E1 is comparable with
that of the apoAI basal promoter (-41AI.CAT). In the presence of
Egr-1, however, the activity of this construct was induced
3-4-fold. An analogous construct containing two copies of site E1
was induced more than 8-fold (data not shown). The construct containing
site E2, on the other hand, was constitutively active irrespective of
the presence or absence of cotransfected Egr-1. This is presumably due
to Sp1, which is present in HepG2 cells and could activate this
construct by binding to site E2. Thus, Egr-1 responsiveness of site E2
could not be assessed in cells expressing high levels of endogenous Sp1
(or Egr-1). The mutated versions of E1 and E2, E1m and E2m,
respectively, were also cloned upstream of the apoAI basal promoter and
tested for their ability to respond to Egr-1 as described above. The
results in Fig. 3A show that neither of these mutants
exhibited higher activity in the presence of cotransfected Egr-1
compared with that in the absence of Egr-1. Thus, as expected, in the
absence of Egr-1 binding to these sites, Egr-1-dependent activation of
the nearby basal promoter is prevented. The reason for the substantial
basal activity of the E1m containing construct relative to that of its
wild-type counterpart is currently unknown.
Figure 3:
Egr-1 responsiveness of sites E1 and E2. A, CAT reporter constructs containing sites E1, E2, and their
mutant derivatives E1m and E2m (Fig. 2A) upstream of
the apoAI core promoter (-41AI.CAT) were analyzed for Egr-1
responsiveness by transfection in HepG2 cells as described in the
legend to Fig. 1. Relative CAT activity in HepG2 cells
transfected with each reporter in the absence (filledbars) or presence of Egr-1 expression plasmid (cross-hatched bars) was determined as in Fig. 1. B, CAT reporter constructs containing nucleotide substitutions
within the putative E1 and E2 enhancer elements of the apoAI promoter
are shown on the left. Egr-1 responsiveness was determined as
in A.
To evaluate the
functional significance of sites E1 and E2 in the context of the
activation of the apoAI enhancer by Egr-1, the E1 and E2 sites in
-256AI.CAT were replaced by the mutant sites E1m and E2m,
respectively, either each one alone or both in combination (see
``Materials and Methods''). The resulting reporters
-256(E1m)AI.CAT, -256(E2m)AI.CAT, and
-256(E1m.E2m)AI.CAT were then tested for their ability to respond
to Egr-1 in transient cotransfection assays in HepG2 cells. As shown in Fig. 3B, the basal activity of each of these reporters
did not differ significantly from that of -256AI.CAT, suggesting
that sites E1 and E2 are not involved in maintenance of the basal
activity of the apoAI enhancer in HepG2 cells. In contrast, the
Egr-1-induced activation of -256AI.CAT (5.8-fold) was
significantly compromised in -256(E1m)AI.CAT (1.9-fold) and
-256(E2m)AI.CAT (4-fold), while -256(E1m.E2m)AI.CAT was
totally unresponsive to Egr-1. These data indicate that both E1 and E2
sites are required for maximal responsiveness of the apoAI gene
enhancer to Egr-1.
Both E1 and E2 Are Required for Egr-1 to Fully
Overcome ARP-1-mediated Repression of the apoAI
EnhancerTranscriptional repression of the apoAI enhancer
by the orphan nuclear receptor ARP-1 can be overcome by transcriptional
activators including Egr-1(9) . To distinguish between a direct
role of Egr-1 in reversing ARP-1 repression from a secondary effect
such as through induction of another factor, the -256AI.CAT
reporter and its derivatives containing the mutant sites E1 and E2 were
examined for Egr-1 responsiveness in the presence of inhibitory amounts
of the ARP-1 expression vector pMT2-ARP-1. Consistent with our earlier
observations (Fig. 4), the constitutive activity of the
-256AI.CAT reporter declined in the presence of ARP-1 but was
fully reversed in the presence of
Egr-1(7, 8, 9) . However, the extent of this
reversal was attenuated when either the E1 or E2 was replaced by E1m or
E2m in -256(E1m)AI.CAT and -256(E2m)AI.CAT, respectively.
Thus, in the presence of ARP-1, Egr-1 restored the activity of these
reporters to only 20 and 50%, respectively, of that expressed
by -256AI.CAT. When both E1 and E2 were replaced by E1m and E2m
simultaneously in -256(E1m.E2m)AI.CAT, the ability of Egr-1 to
overcome ARP-1-mediated repression was completely abolished. We
conclude that Egr-1 overcomes ARP-1 repression via direct interactions
with both sites E1 and E2.
Figure 4:
Requirement of sites E1 and E2 in
Egr-1-mediated reversal of ARP-1 repression. CAT reporter constructs
containing inactivating nucleotide substitutions within the E1 and E2
enhancer elements of the apoAI promoter were transfected into HepG2
cells alone (filledbars), in the presence of ARP-1
expression vector (1 µg, cross-hatched bars), and with the
ARP-1 and Egr-1 expression vectors together (stippledbars). CAT activity of cell lysates was determined as in Fig. 1.
Egr-1 Responsiveness of the apoAI Enhancer Is
Independent of Sites A, B, and CGiven the previously
documented requirement of apoAI enhancer sites A, B, and C for high
level hepatocyte-specific expression of the apoAI
gene(5, 10) , we examined a series of enhancer
reporter constructs containing nucleotide substitutions that prevent
protein binding to these sites for their ability to support Egr-1
inducibility. Consistent with earlier results (5, 10) , mutations in sites A, B, or C within the
apoAI enhancer resulted in a significant decrease of constitutive CAT
reporter activity to 9.5, 23, and 52%, respectively, of the wild-type
enhancer reporter (Fig. 5). By contrast, Egr-1 activated these
constructs by 11.7-, 7.3-, and 3.6-fold, respectively, thereby
restoring their expression to levels comparable with that of the
non-mutagenized enhancer. These data indicate that transcriptional
activation by Egr-1 is not dependent upon transcription factors
functioning through sites A, B, or C and suggest that Egr-1 activation
of the apoAI gene occurs by overriding all previously imposed
transcriptional controls.
Figure 5:
Egr-1 activation of the apoAI enhancer in
the absence of functional sites A, B, or C. CAT reporter constructs
under the control of the apoAI core promoter (-41 to +397)
with promoter sequences from the -222 to -110 containing
nucleotide substitutions that eliminate protein binding to the sites
(indicated as X). Egr-1 responsiveness was determined as in Fig. 1. Filledbars, relative CAT activity of
construct in the absence of Egr-1 expression plasmid; cross-hatched
bars, relative CAT activity of construct in the presence of Egr-1
expression plasmid.
DISCUSSION
The growing list of transcription factors that function
through the 110-nucleotide span of the apoAI enhancer includes nuclear
hormone
receptors(6, 7, 8, 9, 10) ,
the hepatocyte-enriched factors HNF-3 (10) and
C/EBP(9, 25) , and, as shown in the current study, the
early growth response factor Egr-1 (26) (also called
Zif/268(24) , NGF1-A(27) , Krox
24(28, 29) , TIS(30) , and CEF5 ((31) ; for Egr-1 review see (32) ) and the
transcription factor Sp1(33) . Because many of these
transcription factors belong to families consisting of multiple
members, we suggested that there are several, possibly overlapping,
multiprotein configurations of the fully assembled
enhancer(10) . According to this scheme, a dynamic state of the
functional enhancer complex and its capacity to assimilate signals
transduced by individual family members are also implicit. Factor
exchange is predicted to involve disruption of pre-existing protein-DNA
and protein-protein contacts. Therefore, we further suggested that this
process may entail binding of ARP-1 to site A, which results in
formation of transient, transcriptionally inert complexes susceptible
to modulation by the incoming factor(8, 9) . Egr-1
activation of the apoAI gene displays no dependence upon enhancer
modules other than sites E1 and E2. Furthermore, Egr-1 can efficiently
overcome ARP-1-mediated repression, and activation by Egr-1 is not
dependent upon prior repression by ARP-1. It therefore appears that
Egr-1 is essentially insensitive to the transcription factor
configuration of the apoAI enhancer and is consequently optimally
suited to function as a device for overriding apoAI transcriptional
controls in special situations (see below). The apparent
dispensability of Egr-1-responsive sites E1 and E2 for constitutive
enhancer function further reinforces the notion that they are
contingent enhancer modules that can be mobilized only in selected
situations such as during development or in periods of unusual stress
(see below). This is reminiscent of LFA1 (HNF-4) binding to its cognate
site in the -1-antitrypsin promoter where the factor is essential
for the activity of this promoter in HepG2 cells, fetal liver, and the
yolk sac but not for expression in adult liver(34) . Similarly,
HNF-4 binds to sites in the transthyretin gene promoter in
vitro, although in vivo footprinting revealed that the
same sites were vacant(35) . This implied that HNF-4
recruitment to its cognate site may also occur only under specialized
circumstances. Experiments designed to determine whether E1 and E2
are occupied by Egr-1 or other related factors in HepG2 cells revealed
that site E1 is vacant while E2 is occupied by the transcription factor
Sp1 (Fig. 2D). The E2 sequence is composed of
extensively overlapping Egr-1 and Sp1 motifs, which suggests that Egr-1
and Sp-1 bind E2 in a mutually exclusive fashion. While this has not
been formally proven for E2, a similar situation has been documented
for a regulatory site nearly identical to E2 in the murine adenosine
deaminase promoter(36) . However, in contrast to the E2 site
where replacement of Sp1 by Egr-1 stimulates the activity of the apoAI
promoter, replacement of Sp1 by Egr-1 in the context of the adenosine
deaminase promoter results in transcriptional repression(36) ,
exemplifying that the capacity of Egr-1 to function as an activator or
repressor is dependent upon the gene promoter and cell-type
contexts(37) . A single nucleotide substitution in E2 that
abolishes its ability to bind either Egr-1 or Sp1 has little impact on
the basal activity of the apoAI enhancer in HepG2 cells, although it
reduces its responsiveness to Egr-1. Thus, although Sp1 binding to E2
contributes very little to the overall transcriptional activity of the
apoAI promoter in HepG2 cells, it is tempting to speculate that it may
also represent a contingency mechanism required for some hitherto
unidentified mode of expression of the apoAI gene. What
physiological conditions would lead to recruitment of Egr-1 to the
apoAI enhancer? Egr-1 control of the apoAI enhancer obviously reflects
some specialized program that is not called upon during routine
circumstances. Egr-1 was originally defined as a gene whose expression
is induced in response to mitogenic signals in all mammalian cells
tested(26, 30, 38, 39, 40, 41, 42, 43) as
well as regenerating hepatocytes in partially hepatectomized
animals(39, 44, 45, 46) . Recent
evidence suggests that Egr-1 is an important effector for the start of
cell differentiation(47, 48) . It is also involved in
restricting the development of monocyte precursors along the macrophage
lineage(49) . Furthermore, since Egr-1 is expressed in murine
peritoneal macrophages (50) and mature human myeloid leukemic (51) and cardiac cells(52) , it may play additional
roles in more terminally differentiated cells(49) . However,
with the exception of its early induction during hepatocyte
proliferation following partial hepatectomy, Egr-1 has not been
implicated in any signaling cascades regulating the behavior of mature
hepatocytes. Our data predict that induction of Egr-1 in mature
hepatocytes could reprogram the transcriptional apparatus of the apoAI
gene (or other genes) leading to appropriate alterations in gene
expression that result in sustained production of apoAI. It is
therefore interesting that during liver regeneration, apoAI gene
transcription remains nearly unchanged (53) despite major
alterations in the levels of transcription factors involved in apoAI
gene regulation(13, 54) . Together with our current
results, this suggests that under these conditions, Egr-1 takes over
apoAI gene regulation by overriding previously imposed transcriptional
constraints. This implies that apoAI may play an as-yet unknown role in
liver regeneration.
FOOTNOTES
- *
- The costs of publication of
this article were defrayed in part by the payment of page charges. This
article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- Present address: Arthritis Center, Boston
University School of Medicine, Boston, MA 02118.
- ¶
- To whom correspondence should be addressed.
Tel.: 914-732-4778; Fax: 914-732-5665.
- (
) - The
abbreviations used are: apoAI, apolipoprotein AI; HNF, hepatic nuclear
factor; ARP-1, apolipoprotein regulatory protein-1; Egr, early growth
response; CMV, cytomegalovirus; C/EBP, CAAT/enhancer binding protein;
EMSA, electrophoretic mobility shift assay; CAT, chloramphenicol
acetyltransferase.
- (
) - E. Kilbourne, R. Widom, D.
C. Harnish, S. Malik, and S. K. Karathanasis, unpublished results.
ACKNOWLEDGEMENTS
We thank V. Sukhatme for the Egr-1 vectors, N.
Papanicolaou and E. Ferris for expert technical assistance, and N.
Stapleton for help with the preparation of the manuscript.
REFERENCES
- Tjian, R., and Maniatis, T. (1994) Cell 77, 5-8
[CrossRef][Medline]
[Order article via Infotrieve]
- Xanthopoulos, K. G., and Mirkovitch, J. (1993) Eur. J. Biochem. 216, 353-360
[Medline]
[Order article via Infotrieve]
- Karathanasis, S. K. (1992) Monogr. Hum. Genet. 14, 140-171
- Sastry, K. N., Seedorf, U., and Karathanasis, S. K. (1988) Mol. Cell. Biol. 8, 605-614
[Abstract/Free Full Text]
- Widom, R. L., Ladias, J. A., Kouidou, S., and Karathanasis, S. K. (1991) Mol. Cell. Biol. 11, 677-686
[Abstract/Free Full Text]
- Rottman, J. N., Widom, R. L., Nadal-Ginard, B., Mahdavi, V., and Karathanasis, S. K. (1991) Mol. Cell. Biol. 11, 3814-3820
[Abstract/Free Full Text]
- Ladias, J. A., and Karathanasis, S. K. (1991) Science 251, 561-565
[Abstract/Free Full Text]
- Widom, R. L., Rhee, M., and Karathanasis, S. K. (1992) Mol. Cell. Biol. 12, 3380-3389
[Abstract/Free Full Text]
- Ge, R., Rhee, M., Malik, S., and Karathanasis, S. K. (1994) J. Biol. Chem. 269, 13185-13192
[Abstract/Free Full Text]
- Harnish, D. C., Malik, S., and Karathanasis, S. K. (1994) J. Biol. Chem. 269, 28220-28226
[Abstract/Free Full Text]
- Evans, R. (1988) Science 240, 889-895
[Abstract/Free Full Text]
- Chan, J., Nakabayashi, H., and Wong, N. C. W. (1993) Nucleic Acids Res. 21, 1205-1211
[Abstract/Free Full Text]
- Mischoulon, D., Rana, B., Bucher, N., and Farmer, S. R. (1992) Mol. Cell. Biol. 12, 2553-2560
[Abstract/Free Full Text]
- Elshourbagy, N. A., Boguski, M. S., Liao, W. S. L., Jefferson, L. S., Gordon, J. I., and Taylor, J. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8242-8246
[Abstract/Free Full Text]
- Haddad, I. A., Ordovas, J. M., Fitzpatrick, T., and Karathanasis, S. K. (1986) J. Biol. Chem. 261, 13268-13277
[Abstract/Free Full Text]
- Tam, S. P., Archer, T. K., and Deeley, R. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 3111-3115
[Abstract/Free Full Text]
- Sorci-Thomas, M., Prack, M. M., Dashti, N., Johnson, F., Rudel, L. L., and Williams, D. L. (1989) J. Lipid Res. 30, 1397-1403
[Abstract]
- Ettinger, W. H., Varma, V. K., Sorci-Thomas, M., Parks, J. S., Sigmon, R. C, Smith, T. K., and Verdery, R. B. (1994) Arterioscler. Thromb. 14, 8-13
[Abstract/Free Full Text]
- Apostopoulos, J. J., La Scala, M. J., and Howlett, G. J. (1988) Biochem. Biophys. Res. Commun. 154, 997-1002
[CrossRef][Medline]
[Order article via Infotrieve]
- Staels, B., van Tol, A., Andreu, T., and Auwerx, J. (1992) Arterioscler. Thromb. 12, 286-294
[Abstract/Free Full Text]
- Cao, X., Koski, R. A., Gashler, A., McKiernan, M., Morris, C. F., Gaffney, R., Hay, R. V., and Sukhatme, V. P. (1990) Mol. Cell. Biol. 10, 1931-1939
[Abstract/Free Full Text]
- Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456-467
[CrossRef][Medline]
[Order article via Infotrieve]
- Christy, B., and Nathans, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8737-8741
[Abstract/Free Full Text]
- Papazafiri, P., Ogami, D., Ramji, D. P., Nicosia, A., Monaci, P., Cladaras, C., and Zannis, V. I. (1991) J. Biol. Chem. 266, 5790-5797
[Abstract/Free Full Text]
- Sukhatme, V. P., Cao, X., Chang, L. C., Tsai-Morris, C.-H., Stamenkovitch, D., Ferreira, P. C. P., Cohen, D. R., Edwards, S. A., Curran, T., Le Beau, M. M., and Adamson, E. D. (1988) Cell 53, 37-43
[CrossRef][Medline]
[Order article via Infotrieve]
- Milbrandt, J. (1987) Science 238, 797-799
[Abstract/Free Full Text]
- Almendral, J. M., Sommer, D., Macdonald-Bravo, H., Burchhardt, J., Perera, J., and Bravo, R. (1988) Mol. Cell. Biol. 8, 2140-2148
[Abstract/Free Full Text]
- Lemaire, P., Revelant, O., Bravo, R., and Charnay, P. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 4691-4695
[Abstract/Free Full Text]
- Lim, R. W., Varnum, B. C., and Herschman, H. R. (1987) Oncogene 1, 263-270
[Medline]
[Order article via Infotrieve]
- Simmons, D. L., Levy, D. B., and Erikson, R. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1178-1182
[Abstract/Free Full Text]
- Madden, S. L., and Rauscher, F. J., III (1993) Ann. N. Y. Acad. Sci. 684, 75-84
[Medline]
[Order article via Infotrieve]
- Mermod, N., O'Neill, E. A., Kelly, T. J., and Tjian, R. (1989) Cell 58, 741-753
[CrossRef][Medline]
[Order article via Infotrieve]
- Tripodi, M., Abbott, C., Vivian, N., Cortese, R., and Lovell-Badge, R. (1991) EMBO J. 10, 3177-3182
[Medline]
[Order article via Infotrieve]
- Mirkovitch, J., and Darnell, J. E. (1991) Genes and Dev. 1, 256-267
[Abstract/Free Full Text]
- Ackerman, S. L., Minden, A. G., Williams, G. T., Bobonis, C., and Yeung, C.-Y. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7523-7527
[Abstract/Free Full Text]
- Wang, Z. Y., Madden, S. L., Deuel, T. F., Rauscher F. J., III (1992) J. Biol. Chem. 267, 21999-22002
[Abstract/Free Full Text]
- Sukhatme, V. P., Kartha, S., Toback, F. G., Taub, R., Hoover, R. G., and Tsai-Morris, C. (1987) Oncogene Res. 1, 343-355
[Medline]
[Order article via Infotrieve]
- Lau, L. F., and Nathans, D. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1182-1186
[Abstract/Free Full Text]
- Bartel, D. P., Sheng, M., Lau, L. F., and Greenberg, M. E. (1989) Genes & Dev. 3, 304-313
- Seyfert, V. L., Sukhatme, V. P., and Monroe, J. G. (1989) Mol. Cell. Biol. 9, 2081-2088
- Zerial, M., Toschi, L., Ryseck, R.-P., Schuermann, M., Muller, R., and Bravo, R. (1989) EMBO J. 8, 805-813
[Medline]
[Order article via Infotrieve]
- Sukhatme, V. P. (1990) J. Am. Soc. Nephrol. 1, 859-866
[Abstract]
- Nathans, D., Lau, L. F., Christy, B., Hartzell, S., Nakabeppu, Y., and Ryder, K. (1988) Cold Spring Harbor Symp. Quant. Biol. 53, 893-900
- Fausto, N. (1990) Curr. Op. Cell Biol. 2, 1036-1042
[CrossRef][Medline]
[Order article via Infotrieve]
- Michalopoulos, G. K. (1990) FASEB J. 4, 176-187
[Abstract]
- Suva, L. J., Ernst, M., and Rodan, G. (1991) Mol. Cell. Biol. 11, 2503-2510
[Abstract/Free Full Text]
- Edwards, S. A., Darland, T., Sosnowski, R., Samuels, M., and Adamson, E. (1991) Dev. Biol. 148, 165-173
[CrossRef][Medline]
[Order article via Infotrieve]
- Nguyen, H. Q., Hoffman-Lieberman, B., and Lieberman, D. A. (1993) Cell 72, 197-209
[CrossRef][Medline]
[Order article via Infotrieve]
- Henderson, S. A., Lee, P. H., Aeberhard, E. E., Adams, J. W., Ignarro, L. J., Murphy, W. J., and Sherman, M. P. (1994) J. Biol. Chem. 269, 25239-25242
[Abstract/Free Full Text]
- Merryman, P. F., Clancy, R. M., He, X. Y., and Abramson, S. B. (1993) Arthritis Rheum. 36, 1414-1422
[Medline]
[Order article via Infotrieve]
- Cao, X., Mahendran, R., Guy, G. R., and Tan, Y. H. (1993) J. Biol. Chem. 268, 16949-16957
[Abstract/Free Full Text]
- Panduro, A., Lin-Lee, Y., Chan, L., and Shafritz, D. A. (1990) Biochemistry 29, 8430-8435
[CrossRef][Medline]
[Order article via Infotrieve]
- Flodby, P., Antonson, P., Barlow, C., Blanck, A., Porsch-Hallstrom, I., and Xanthopoulos, K. (1993) Exp. Cell Res. 208, 248-256
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Qin, T. Liu, V. S. Kamanna, and M. L. Kashyap
Pioglitazone Stimulates Apolipoprotein A-I Production Without Affecting HDL Removal in HepG2 Cells: Involvement of PPAR-{alpha}
Arterioscler. Thromb. Vasc. Biol.,
November 1, 2007;
27(11):
2428 - 2434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bertrand, C. Fritsch, S. Diether, G. Lambrou, D. Muller, F. Schaeffel, P. Schindler, K. L. Schmid, J. van Oostrum, and H. Voshol
Identification of Apolipoprotein A-I as a "STOP" Signal for Myopia
Mol. Cell. Proteomics,
November 1, 2006;
5(11):
2158 - 2166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Morello, T. W.A. de Bruin, J. I. Rotter, R. E. Pratt, C. J.H. van der Kallen, G. A. Hladik, V. J. Dzau, C.-C. Liew, and Y.-D. I. Chen
Differential Gene Expression of Blood-Derived Cell Lines in Familial Combined Hyperlipidemia
Arterioscler. Thromb. Vasc. Biol.,
November 1, 2004;
24(11):
2149 - 2154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lamon-Fava and D. Micherone
Regulation of apoA-I gene expression: mechanism of action of estrogen and genistein
J. Lipid Res.,
January 1, 2004;
45(1):
106 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Keeton, K. D. Bortoff, W. L. Bennett, J. L. Franklin, D. Y. Venable, and J. L. Messina
Insulin-Regulated Expression of Egr-1 and Krox20: Dependence on ERK1/2 and Interaction with p38 and PI3-Kinase Pathways
Endocrinology,
December 1, 2003;
144(12):
5402 - 5410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Cui, N. W. Schoene, L. Zhu, J. C. Fanzo, A. Alshatwi, and K. Y. Lei
Zinc depletion reduced Egr-1 and HNF-3beta expression and apolipoprotein A-I promoter activity in Hep G2 cells
Am J Physiol Cell Physiol,
August 1, 2002;
283(2):
C623 - C630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Tsai, L. Liu, J. Zhang, K. C. Spokes, J. N. Topper, and W. C. Aird
Epidermal growth factor induces Egr-1 promoter activity in hepatocytes in vitro and in vivo
Am J Physiol Gastrointest Liver Physiol,
November 1, 2001;
281(5):
G1271 - G1278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Rich, M. R. Fontanilla, M. Nugent, and J. A. Foster
Basic Fibroblast Growth Factor Decreases Elastin Gene Transcription through an AP1/cAMP-response Element Hybrid Site in the Distal Promoter
J. Biol. Chem.,
November 19, 1999;
274(47):
33433 - 33439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Silverman, L. M. Khachigian, F. S. Santiago, A. J. Williams, V. Lindner, and T. Collins
Vascular Smooth Muscle Cells Express the Transcriptional Corepressor NAB2 in Response to Injury
Am. J. Pathol.,
October 1, 1999;
155(4):
1311 - 1317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Silverman and T. Collins
Pathways of Egr-1-Mediated Gene Transcription in Vascular Biology
Am. J. Pathol.,
March 1, 1999;
154(3):
665 - 670.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zhang and D. M. Cohen
Hypotonicity increases transcription, expression, and action of Egr-1 in murine renal medullary mIMCD3 cells
Am J Physiol Renal Physiol,
November 1, 1997;
273(5):
F837 - F842.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Khachigian and T. Collins
Inducible Expression of Egr-1–Dependent Genes : A Paradigm of Transcriptional Activation in Vascular Endothelium
Circ. Res.,
October 19, 1997;
81(4):
457 - 461.
[Full Text]
|
 |
|

|
 |

|
 |
 
S. R. Trejo, W. E. Fahl, and L. Ratner
c-sis/PDGF-B Promoter Transactivation by the Tax Protein of Human T-cell Leukemia Virus Type 1
J. Biol. Chem.,
June 14, 1996;
271(24):
14584 - 14590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Kardassis, M. Laccotripe, I. Talianidis, and V. Zannis
Transcriptional Regulation of the Genes Involved in Lipoprotein Transport : The Role of Proximal Promoters and Long-range Regulatory Elements and Factors in Apolipoprotein Gene Regulation
Hypertension,
April 1, 1996;
27(4):
980 - 1008.
[Full Text]
|
 |
|

|
 |

|
 |
 
X.-L. Zheng, S. Matsubara, C. Diao, M. D. Hollenberg, and N. C. W. Wong
Activation of Apolipoprotein AI Gene Expression by Protein Kinase A and Kinase C through Transcription Factor, Sp1
J. Biol. Chem.,
October 6, 2000;
275(41):
31747 - 31754.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|