Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kilbourne, E. J.
Right arrow Articles by Karathanasis, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kilbourne, E. J.
Right arrow Articles by Karathanasis, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 12, Issue of March 24, 1995 pp. 7004-7010
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Involvement of Early Growth Response Factor Egr-1 in Apolipoprotein AI Gene Transcription (*)

(Received for publication, November 14, 1994; and in revised form, January 23, 1995)

Edward J. Kilbourne (1) Russell Widom (2)(§) Douglas C. Harnish (1) Sohail Malik (1) Sotirios K. Karathanasis (1) (2)(¶)

From the  (1)Department of Cardiovascular Molecular Biology, Lederle Laboratories, Pearl River, New York 10965 and the (2)Laboratory of Molecular and Cellular Cardiology, Department of Cardiology, Children's Hospital and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02115

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Liver-specific expression of the apolipoprotein AI (apoAI) gene is mediated by transcription factors bound to three sites (A, B, and C) in the apoAI enhancer. Sites A and C bind various members of the nuclear receptor superfamily, including the orphan nuclear receptor apolipoprotein regulatory protein-1 (ARP-1); site B binds the liver-enriched factor hepatic nuclear factor-3. The immediate early growth response factor (Egr-1), which is transiently expressed in various pathophysiologic states of the liver, activates the apoAI enhancer and overcomes ARP-1-mediated repression of the enhancer in hepatoblastoma HepG2 cells. Deletion mapping analysis revealed two Egr-1 binding sites, E1 and E2, flanking site A. Egr-1 bound efficiently to both E1 and E2. Sp1 in HepG2 nuclear extracts bound to E2 but not E1. In HepG2 cells, E1 functioned as an Egr-1 response element, whereas E2 had high basal activity and was not further induced by Egr-1. Mutations that prevent Egr-1 binding to the apoAI enhancer abolished its responsiveness to Egr-1, while they had only minor effects on its constitutive activity. These mutations also diminished the ability of Egr-1 to overcome ARP-1-mediated repression. Elimination of transcription factor binding to sites A, B, or C reduced enhancer activity without affecting Egr-1-dependent activation. We argue that Egr-1 is recruited to the apoAI enhancer complex under unusual circumstances, such as those prevailing during liver regeneration, to maintain apoAI transcription levels by overriding prior transcriptional controls.


INTRODUCTION

Tissue-specific and developmental expression of eukaryotic genes is regulated by multiprotein complexes assembled on enhancer and promoter sequences (reviewed in (1) ). Modular organization of target sites for transcriptional factors within the enhancers is believed to be a device for integrating signals transduced by the factors during the course of establishment and maintenance of the tissue-specific phenotype(2) .

Apolipoprotein AI (apoAI) (^1)is the major protein constituent of high density lipoproteins, which transport cholesterol from extrahepatic tissues to the liver for excretion (reviewed in (3) ). Liver-specific expression of the gene encoding apoAI is the outcome of multiple protein-DNA and protein-protein interactions involving ubiquitous and liver-enriched transcription factors(4, 5, 6, 7, 8, 9, 10) . The architectural requirements for these interactions are fulfilled by a tissue-specific enhancer located in the -222 to -110 region of the apoAI gene promoter(4, 5) . Within the enhancer, three sites (sites A, -214 to -192; B, -169 to -146; and C, -134 to -119) (5) are predominantly occupied by transcription factors present in liver nuclear extracts. Sites A and C are cognate sites for members of the nuclear hormone receptor superfamily (11) including RXRalpha (6, 8) and HNF-4(9, 10, 12) , which activate apoAI gene transcription, and ARP-1(7, 9) , Erb EAR-2(^2), and Erb EAR-3/chicken ovalbumin upstream promoter transcription factor(9) , which repress it. Site B is an efficient response element for the liver-enriched factor HNF-3beta (10) .

Since the apoAI regulatory apparatus responds to diverse stimuli (14, 15, 16, 17, 18, 19, 20) , we predicted that the precise composition of the multiprotein enhancer complex would be continually changing (9, 10) and suggested that repression mediated by ARP-1 may facilitate switching between alternative transcriptionally active states induced by different stimuli(8, 9) . Accordingly, the early growth response factor, Egr-1, was identified as a transcription factor that could overcome ARP-1-mediated repression of the apoAI gene and restore elevated activity of the enhancer(9) .

This paper demonstrates that Egr-1 activates apoAI gene transcription through two sites in the enhancer, which bind Egr-1 and display significant homology to the consensus Egr-1 binding site. It is further shown that Egr-1 contributes to the transcriptional activation of the apoAI enhancer in the absence of functional sites A, B, or C. These findings raise the possibility that control of apoAI gene transcription by Egr-1 may be a mechanism for overriding pre-existing regulatory constraints.


MATERIALS AND METHODS

Synthetic Oligonucleotides

The double-stranded oligonucleotides spanning the apoAI promoter between the nucleotides -214 to -192 (oligo A), -178 to -148 (oligo B), -136 to -114 (oligo C), and -196 to -174 (oligo E1) were previously described(5) . Oligonucleotide E1m, GATCCGCCCTGCAGCACCCGCAGCTTGCT, differs from oligonucleotide E1 by one nucleotide (underlined). E2 spans the -226 to -209 region of the apoAI promoter. The double-stranded oligonucleotide E2m, GATCTCCTCCCGCACCCACTGAA, differs from oligonucleotide E2 by one nucleotide (underlined). A double-stranded oligonucleotide (oligo Egr) containing two Egr consensus sequences (CGCCCCCGC) separated by one nucleotide, an oligonucleotide (oligo Egrmut) containing two mutated Egr consensus sequences (CGCCCTAGC), and an oligonucleotide containing the AP-2 cognate site were from Santa Cruz Biotechnology. Oligonucleotides containing consensus sequences for transcription factors AP-1, Oct-1, and Sp1 were from Promega.

Plasmids

The following plasmids have been previously described: chloramphenicol acetyltransferase (CAT) reporters -256AI.CAT, -192AI.CAT, -133AI.CAT, -41AI.CAT, -256/-80AI.CAT, -256/-133AI.CAT, and -256/-192AI.CAT(4) ; -222/-110AI.CAT and various mutated versions of -222/-110AI.CAT (XBC, AXC, and ABX)(10) ; and pMT2-ARP-1 expression plasmid(7) . The pBS.ApaI plasmid containing the Egr-1 cDNA in pBluescript used for the in vitro transcription of Egr-1 and the Egr-1 expression vector pCMV5-Egr-1 were kindly provided by Dr. V. P. Sukhatme(21) . The CAT reporters containing C to A substitutions in the apoAI promoter at nucleotides -186 in site E1 (-256(E1m)AI.CAT), at nucleotide -218 in site E2 (-256(E2m) AI.CAT), or both (-256(E1m.E2m)AI.CAT) were generated by polymerase chain reaction mutagenesis and cloning of the polymerase chain reaction products into the HindIII site of pUC9CAT(4) . The E1-41AI.CAT, E1m-41AI.CAT, E2-41AI.CAT, and E2m-41AI.CAT reporters were produced by subcloning the double-stranded oligonucleotides E1, E1m, E2, and E2m into the BamHI site of -41AI.CAT(4) . Standard recombinant DNA methods were employed(22) .

Transient Transfection Assays

Human hepatoblastoma HepG2 cells were transfected with various CAT and pRSVbeta-galactosidase reporters with or without the Egr-1 expression vector (pCMV5-Egr-1) using the calcium phosphate coprecipitation method (23) and assayed as described(5, 10) .

EMSA

Binding assays utilizing in vitro translated Egr-1 (Promega TNT reticulocyte lysate system) and oligonucleotides E1 and E2 as probes were performed as described (10) . Binding assays using HepG2 nuclear proteins (10) were similarly performed except that reactions were incubated on ice since retardation complex formation with the E2 probe was temperature sensitive. Antibodies (Egr-1, C/EBP, and Sp1) were from Santa Cruz Biotechnology.


RESULTS

Identification of Two Egr-1-responsive Elements within the apoAI Enhancer

We previously observed that Egr-1 stimulates expression of an apoAI promoter/enhancer CAT reporter in hepatoblastoma HepG2 cells(9) . To map the Egr-1-responsive element(s), several CAT reporters containing 5`- or 3`-truncations of the apoAI promoter/enhancer were transiently transfected into HepG2 cells in the presence or absence of the Egr-1 expression vector pCMV5-Egr-1, and the -fold activation of each reporter by Egr-1 was determined. As shown in Fig. 1, the reporter -256AI.CAT, which contains the apoAI enhancer and promoter in their natural arrangement, was activated by Egr-1 nearly 6-fold, consistent with our previous results(9) . The reporter -192AI.CAT also responded to Egr-1 showing a more than 4-fold activation, while the reporter -133AI.CAT was completely unresponsive. Reporters analogous to -256AI.CAT but lacking the -80 to -42, -133 to -42, or -192 to -42 promoter/enhancer regions were activated by Egr-1 3.5-, 5.3-, and 1.9-fold, respectively. A reporter containing the -203 to -140 region upstream of the apoAI basal promoter (at nucleotide position -41) was activated by Egr-1 1.8-fold while a similar reporter containing the -187 to -140 region was completely unresponsive.


Figure 1: Deletion mapping analysis of the apoAI promoter responsiveness to Egr-1. CAT reporter constructs (8 µg) under the control of the apoAI promoter (-256.AI.CAT) or the indicated deletion derivatives were cotransfected into HepG2 cells with pRSV-beta-galactosidase plasmid (2 µg) in the absence or presence of the Egr-1 expression plasmid (pCMV5-Egr-1, 0.5 µg). For each construct, -fold activation by Egr-1 was expressed as the ratio of the CAT activity (normalized to beta-galactosidase activity) in the presence of pCMV5-Egr-1 to that in its absence. Filledbars, relative CAT activity of construct in the absence of Egr-1 expression plasmid; cross-hatched bars, relative CAT activity of construct in the presence of Egr-1 expression plasmid.



Collectively, these data indicate that the -256 to -133 apoAI promoter/enhancer region contains all the necessary elements for maximal responsiveness of the apoAI gene to Egr-1. In addition, the data suggest that this region is composed of more than one subregion, each contributing to the full responsiveness to Egr-1. Specifically, the -203 to -140 subregion responded to Egr-1, but the -187 to -140 did not. This suggests that sequences in the -203 to -187 region may be a part of an Egr-1-responsive element. This is consistent with the observation that deletion of the -256 to -192 region in the reporter -192AI.CAT reduces Egr-1 responsiveness. However, it does not explain why the responsiveness of the -203 to -140 region is less than half that of the -256 to -133 region. These findings argue for the presence of additional Egr-1-responsive elements either at -256 to -203, -140 to -133, or both. Comparison of sequences in and around -256 to -203, -203 to -187, and -140 to -133 with the established consensus sequence for Egr-1 binding CGCCCCCGC (24) revealed two sites, site E2 CGCCCCCAC (at positions -221 to -213) and site El AGCCCCCGC (at positions -189 to -181) each deviating by a single nucleotide (underlined) from the Egr-1 consensus sequence(24) . The region around -140 to -133 did not contain sequences with recognizable homology to the Egr-1 consensus (see Fig. 2A).


Figure 2: EMSA analysis of proteins binding to sites E1 and E2. A, the nucleotide sequence of the apoAI promoter region is shown. Numbers indicate location of nucleotides upstream from the transcriptional start site. The location of the enhancer elements A, B, C, E1, and E2 and the overlapping Sp1 site (see text) within this sequence are indicated. Regions spanned by double-stranded oligonucleotides used in EMSA including mutant oligonucleotides E1m and E2m containing C to A substitutions in the putative Egr-1 binding sequence are also shown. These mutations (at positions -186 and -218) are also indicated on the sequence. B and C, in vitro translated Egr-1 (lanes2-12) was tested for binding to site E1 (panelB) and site E2 (panelC) probes by EMSA. The following competitor oligonucleotides were included: lanes3-6, indicated molar excess of unlabeled oligonucleotide E1 (panelB) and E2 (panelC); lane7, Egr (Egr-1 consensus); lane8, Egrmut (Egr-1 consensus binding site mutant); lane9, apoAI site A (A); lane10, E1m (mutant site E1, panelB) or E2m (mutant site E2, panelC). Antibody specific for C/EBP (lane11) or Egr-1 (lane12) was included as indicated. D, EMSA binding reactions contain HepG2 cell nuclear extract and end-labeled site E1 (lane1) and site E2 (lanes2-13) probes. 200-fold molar excess of the following unlabeled competitor oligonucleotides was included as indicated: lane3, E2; lane4, E2m; lane5, apoAI site A (A); lane6, E1; lane7, Egr-1; lane8, Sp1; lane9, AP-2; lane10, AP-1; lane11, Oct-1. Antibody specific for Sp1 (lane12) or Egr-1 (lane13) was included as indicated.



Site E2 Binds Both Sp1 and Egr-1 but Site E1 Binds Only Egr-1

EMSA was employed to examine if Egr-1 binds to sites E1 and E2. As shown in Fig. 2, B and C, Egr-1 expressed in vitro bound efficiently to oligonucleotide probes containing either site E1 or E2 (lanes2). This binding was specific because excess unlabeled homologous oligonucleotides in the binding reaction mixture inhibited retardation complex formation (lanes3-6), whereas a large excess of unrelated oligonucleotides corresponding to the apoAI gene sites A, B, or C (see Fig. 2A) did not (Fig. 2, B and C, lanes9; data not shown). In contrast, excess amounts of an oligonucleotide containing two copies of the Egr-1 binding site consensus sequence inhibited retardation complex formation (lanes7), while excess amounts of a similar oligonucleotide containing a mutated version of the Egr-1 consensus (CGCCTAGC) did not (lanes8). Addition of Egr-1 antiserum, but not of a control serum, to the binding reactions supershifted these retardation complexes (lanes11 and 12). Thus, it appears that Egr-1 can bind to sites E1 and E2. This was further confirmed as follows. Based on the DNA recognition properties of Egr-1(24) , we predicted that C to A substitutions at nucleotide positions -186 and -218 in E1 and E2, respectively (see Fig. 2A) would prevent Egr-1 binding to the corresponding oligonucleotide probes. Indeed, excess amounts of oligonucleotides E1m (AGCACCCGC) or E2m (CGCACCCAC) that incorporate these nucleotide substitutions (underlined) in sites E1 and E2, respectively, did not inhibit retardation complex formation with the corresponding wild-type probes (lanes10).

To determine whether E1 and E2 are bound by Egr-1 or other related factors in HepG2 cells, nuclear extracts prepared from these cells were subjected to EMSA analysis with the E1 and E2 oligonucleotide probes. The results in Fig. 2D, representative of binding reactions performed under various conditions using different preparations of HepG2 nuclear extracts, showed little, if any, nuclear factor binding to the E1 probe (lane1). In contrast, incubation of the nuclear extracts with the E2 probe resulted in multiple retardation complexes (lane2).

To identify the factor(s) in HepG2 cells that bind(s) preferentially to E2 despite the similar affinities of sites E1 and E2 for Egr-1 (data not shown), we undertook a systematic competition EMSA analysis using as competitors various double-stranded oligonucleotides containing binding sites for previously characterized transcription factors. As can be seen in Fig. 2D, the retardation complex formed with probe E2 was inhibited by excess unlabeled E2 oligonucleotide (lane3) but not by excess E2m oligonucleotide (lane4). Retardation complex formation was not inhibited by excess apoAI site A (lane5) or site E1 (lane6) oligonucleotides nor by excess Egr-1 consensus oligonucleotide (lane7). Together with the observation that the factors capable of binding to site E1 are absent in HepG2 nuclear extracts, these data provided strong support for the notion that the factor(s) that bind(s) to site E2 are different than Egr-1. This was further confirmed by supershift analysis of probe E2 retardation complexes using Egr-1-specific antiserum (lane13). The possible identity of this factor with the transcription factor Sp1 was indicated by the substantial inhibition of retardation complex formation by excess amounts of an oligonucleotide containing the Sp1 binding consensus sequence (lane8). Excess amounts of oligonucleotides corresponding to the binding sites for the transcription factors AP-2, AP-1, and Oct-1, on the other hand, did not interfere with retardation complex formation (lanes9-11). Supershift analysis using Sp1-specific antiserum (lane12) confirmed the presence of Sp1 in probe E2 retardation complexes. Indeed, upon re-inspection of the site E2 sequence, it was apparent that it contains two extensively overlapping transcription factor binding motifs, one for Egr-1 and another for Sp1 (see Fig. 2A). Note also that the C to A substitution in the mutated version of E2, i.e. E2m, affects both Egr-1 and Sp1 binding motifs, explaining the inability of the mutated site to bind either Egr-1 or Sp1.

Functional Analysis of Sites E1 and E2

To assess the functional significance of E1 and E2, we cloned oligonucleotides containing these sites immediately upstream of the apoAI core promoter (at nucleotide location -41) and tested the activity of the resulting reporter constructs in HepG2 cells in the presence or absence of cotransfected Egr-1 expression vector. The results in Fig. 3A show that in the absence of Egr-1, the activity of the construct containing site E1 is comparable with that of the apoAI basal promoter (-41AI.CAT). In the presence of Egr-1, however, the activity of this construct was induced 3-4-fold. An analogous construct containing two copies of site E1 was induced more than 8-fold (data not shown). The construct containing site E2, on the other hand, was constitutively active irrespective of the presence or absence of cotransfected Egr-1. This is presumably due to Sp1, which is present in HepG2 cells and could activate this construct by binding to site E2. Thus, Egr-1 responsiveness of site E2 could not be assessed in cells expressing high levels of endogenous Sp1 (or Egr-1). The mutated versions of E1 and E2, E1m and E2m, respectively, were also cloned upstream of the apoAI basal promoter and tested for their ability to respond to Egr-1 as described above. The results in Fig. 3A show that neither of these mutants exhibited higher activity in the presence of cotransfected Egr-1 compared with that in the absence of Egr-1. Thus, as expected, in the absence of Egr-1 binding to these sites, Egr-1-dependent activation of the nearby basal promoter is prevented. The reason for the substantial basal activity of the E1m containing construct relative to that of its wild-type counterpart is currently unknown.


Figure 3: Egr-1 responsiveness of sites E1 and E2. A, CAT reporter constructs containing sites E1, E2, and their mutant derivatives E1m and E2m (Fig. 2A) upstream of the apoAI core promoter (-41AI.CAT) were analyzed for Egr-1 responsiveness by transfection in HepG2 cells as described in the legend to Fig. 1. Relative CAT activity in HepG2 cells transfected with each reporter in the absence (filledbars) or presence of Egr-1 expression plasmid (cross-hatched bars) was determined as in Fig. 1. B, CAT reporter constructs containing nucleotide substitutions within the putative E1 and E2 enhancer elements of the apoAI promoter are shown on the left. Egr-1 responsiveness was determined as in A.



To evaluate the functional significance of sites E1 and E2 in the context of the activation of the apoAI enhancer by Egr-1, the E1 and E2 sites in -256AI.CAT were replaced by the mutant sites E1m and E2m, respectively, either each one alone or both in combination (see ``Materials and Methods''). The resulting reporters -256(E1m)AI.CAT, -256(E2m)AI.CAT, and -256(E1m.E2m)AI.CAT were then tested for their ability to respond to Egr-1 in transient cotransfection assays in HepG2 cells. As shown in Fig. 3B, the basal activity of each of these reporters did not differ significantly from that of -256AI.CAT, suggesting that sites E1 and E2 are not involved in maintenance of the basal activity of the apoAI enhancer in HepG2 cells. In contrast, the Egr-1-induced activation of -256AI.CAT (5.8-fold) was significantly compromised in -256(E1m)AI.CAT (1.9-fold) and -256(E2m)AI.CAT (4-fold), while -256(E1m.E2m)AI.CAT was totally unresponsive to Egr-1. These data indicate that both E1 and E2 sites are required for maximal responsiveness of the apoAI gene enhancer to Egr-1.

Both E1 and E2 Are Required for Egr-1 to Fully Overcome ARP-1-mediated Repression of the apoAI Enhancer

Transcriptional repression of the apoAI enhancer by the orphan nuclear receptor ARP-1 can be overcome by transcriptional activators including Egr-1(9) . To distinguish between a direct role of Egr-1 in reversing ARP-1 repression from a secondary effect such as through induction of another factor, the -256AI.CAT reporter and its derivatives containing the mutant sites E1 and E2 were examined for Egr-1 responsiveness in the presence of inhibitory amounts of the ARP-1 expression vector pMT2-ARP-1. Consistent with our earlier observations (Fig. 4), the constitutive activity of the -256AI.CAT reporter declined in the presence of ARP-1 but was fully reversed in the presence of Egr-1(7, 8, 9) . However, the extent of this reversal was attenuated when either the E1 or E2 was replaced by E1m or E2m in -256(E1m)AI.CAT and -256(E2m)AI.CAT, respectively. Thus, in the presence of ARP-1, Egr-1 restored the activity of these reporters to only 20 and 50%, respectively, of that expressed by -256AI.CAT. When both E1 and E2 were replaced by E1m and E2m simultaneously in -256(E1m.E2m)AI.CAT, the ability of Egr-1 to overcome ARP-1-mediated repression was completely abolished. We conclude that Egr-1 overcomes ARP-1 repression via direct interactions with both sites E1 and E2.


Figure 4: Requirement of sites E1 and E2 in Egr-1-mediated reversal of ARP-1 repression. CAT reporter constructs containing inactivating nucleotide substitutions within the E1 and E2 enhancer elements of the apoAI promoter were transfected into HepG2 cells alone (filledbars), in the presence of ARP-1 expression vector (1 µg, cross-hatched bars), and with the ARP-1 and Egr-1 expression vectors together (stippledbars). CAT activity of cell lysates was determined as in Fig. 1.



Egr-1 Responsiveness of the apoAI Enhancer Is Independent of Sites A, B, and C

Given the previously documented requirement of apoAI enhancer sites A, B, and C for high level hepatocyte-specific expression of the apoAI gene(5, 10) , we examined a series of enhancer reporter constructs containing nucleotide substitutions that prevent protein binding to these sites for their ability to support Egr-1 inducibility. Consistent with earlier results (5, 10) , mutations in sites A, B, or C within the apoAI enhancer resulted in a significant decrease of constitutive CAT reporter activity to 9.5, 23, and 52%, respectively, of the wild-type enhancer reporter (Fig. 5). By contrast, Egr-1 activated these constructs by 11.7-, 7.3-, and 3.6-fold, respectively, thereby restoring their expression to levels comparable with that of the non-mutagenized enhancer. These data indicate that transcriptional activation by Egr-1 is not dependent upon transcription factors functioning through sites A, B, or C and suggest that Egr-1 activation of the apoAI gene occurs by overriding all previously imposed transcriptional controls.


Figure 5: Egr-1 activation of the apoAI enhancer in the absence of functional sites A, B, or C. CAT reporter constructs under the control of the apoAI core promoter (-41 to +397) with promoter sequences from the -222 to -110 containing nucleotide substitutions that eliminate protein binding to the sites (indicated as X). Egr-1 responsiveness was determined as in Fig. 1. Filledbars, relative CAT activity of construct in the absence of Egr-1 expression plasmid; cross-hatched bars, relative CAT activity of construct in the presence of Egr-1 expression plasmid.




DISCUSSION

The growing list of transcription factors that function through the 110-nucleotide span of the apoAI enhancer includes nuclear hormone receptors(6, 7, 8, 9, 10) , the hepatocyte-enriched factors HNF-3beta (10) and C/EBP(9, 25) , and, as shown in the current study, the early growth response factor Egr-1 (26) (also called Zif/268(24) , NGF1-A(27) , Krox 24(28, 29) , TIS(30) , and CEF5 ((31) ; for Egr-1 review see (32) ) and the transcription factor Sp1(33) . Because many of these transcription factors belong to families consisting of multiple members, we suggested that there are several, possibly overlapping, multiprotein configurations of the fully assembled enhancer(10) . According to this scheme, a dynamic state of the functional enhancer complex and its capacity to assimilate signals transduced by individual family members are also implicit. Factor exchange is predicted to involve disruption of pre-existing protein-DNA and protein-protein contacts. Therefore, we further suggested that this process may entail binding of ARP-1 to site A, which results in formation of transient, transcriptionally inert complexes susceptible to modulation by the incoming factor(8, 9) .

Egr-1 activation of the apoAI gene displays no dependence upon enhancer modules other than sites E1 and E2. Furthermore, Egr-1 can efficiently overcome ARP-1-mediated repression, and activation by Egr-1 is not dependent upon prior repression by ARP-1. It therefore appears that Egr-1 is essentially insensitive to the transcription factor configuration of the apoAI enhancer and is consequently optimally suited to function as a device for overriding apoAI transcriptional controls in special situations (see below).

The apparent dispensability of Egr-1-responsive sites E1 and E2 for constitutive enhancer function further reinforces the notion that they are contingent enhancer modules that can be mobilized only in selected situations such as during development or in periods of unusual stress (see below). This is reminiscent of LFA1 (HNF-4) binding to its cognate site in the alpha-1-antitrypsin promoter where the factor is essential for the activity of this promoter in HepG2 cells, fetal liver, and the yolk sac but not for expression in adult liver(34) . Similarly, HNF-4 binds to sites in the transthyretin gene promoter in vitro, although in vivo footprinting revealed that the same sites were vacant(35) . This implied that HNF-4 recruitment to its cognate site may also occur only under specialized circumstances.

Experiments designed to determine whether E1 and E2 are occupied by Egr-1 or other related factors in HepG2 cells revealed that site E1 is vacant while E2 is occupied by the transcription factor Sp1 (Fig. 2D). The E2 sequence is composed of extensively overlapping Egr-1 and Sp1 motifs, which suggests that Egr-1 and Sp-1 bind E2 in a mutually exclusive fashion. While this has not been formally proven for E2, a similar situation has been documented for a regulatory site nearly identical to E2 in the murine adenosine deaminase promoter(36) . However, in contrast to the E2 site where replacement of Sp1 by Egr-1 stimulates the activity of the apoAI promoter, replacement of Sp1 by Egr-1 in the context of the adenosine deaminase promoter results in transcriptional repression(36) , exemplifying that the capacity of Egr-1 to function as an activator or repressor is dependent upon the gene promoter and cell-type contexts(37) . A single nucleotide substitution in E2 that abolishes its ability to bind either Egr-1 or Sp1 has little impact on the basal activity of the apoAI enhancer in HepG2 cells, although it reduces its responsiveness to Egr-1. Thus, although Sp1 binding to E2 contributes very little to the overall transcriptional activity of the apoAI promoter in HepG2 cells, it is tempting to speculate that it may also represent a contingency mechanism required for some hitherto unidentified mode of expression of the apoAI gene.

What physiological conditions would lead to recruitment of Egr-1 to the apoAI enhancer? Egr-1 control of the apoAI enhancer obviously reflects some specialized program that is not called upon during routine circumstances. Egr-1 was originally defined as a gene whose expression is induced in response to mitogenic signals in all mammalian cells tested(26, 30, 38, 39, 40, 41, 42, 43) as well as regenerating hepatocytes in partially hepatectomized animals(39, 44, 45, 46) . Recent evidence suggests that Egr-1 is an important effector for the start of cell differentiation(47, 48) . It is also involved in restricting the development of monocyte precursors along the macrophage lineage(49) . Furthermore, since Egr-1 is expressed in murine peritoneal macrophages (50) and mature human myeloid leukemic (51) and cardiac cells(52) , it may play additional roles in more terminally differentiated cells(49) . However, with the exception of its early induction during hepatocyte proliferation following partial hepatectomy, Egr-1 has not been implicated in any signaling cascades regulating the behavior of mature hepatocytes. Our data predict that induction of Egr-1 in mature hepatocytes could reprogram the transcriptional apparatus of the apoAI gene (or other genes) leading to appropriate alterations in gene expression that result in sustained production of apoAI. It is therefore interesting that during liver regeneration, apoAI gene transcription remains nearly unchanged (53) despite major alterations in the levels of transcription factors involved in apoAI gene regulation(13, 54) . Together with our current results, this suggests that under these conditions, Egr-1 takes over apoAI gene regulation by overriding previously imposed transcriptional constraints. This implies that apoAI may play an as-yet unknown role in liver regeneration.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Present address: Arthritis Center, Boston University School of Medicine, Boston, MA 02118.

To whom correspondence should be addressed. Tel.: 914-732-4778; Fax: 914-732-5665.

(^1)
The abbreviations used are: apoAI, apolipoprotein AI; HNF, hepatic nuclear factor; ARP-1, apolipoprotein regulatory protein-1; Egr, early growth response; CMV, cytomegalovirus; C/EBP, CAAT/enhancer binding protein; EMSA, electrophoretic mobility shift assay; CAT, chloramphenicol acetyltransferase.

(^2)
E. Kilbourne, R. Widom, D. C. Harnish, S. Malik, and S. K. Karathanasis, unpublished results.


ACKNOWLEDGEMENTS

We thank V. Sukhatme for the Egr-1 vectors, N. Papanicolaou and E. Ferris for expert technical assistance, and N. Stapleton for help with the preparation of the manuscript.


REFERENCES

  1. Tjian, R., and Maniatis, T. (1994) Cell 77, 5-8 [CrossRef][Medline] [Order article via Infotrieve]
  2. Xanthopoulos, K. G., and Mirkovitch, J. (1993) Eur. J. Biochem. 216, 353-360 [Medline] [Order article via Infotrieve]
  3. Karathanasis, S. K. (1992) Monogr. Hum. Genet. 14, 140-171
  4. Sastry, K. N., Seedorf, U., and Karathanasis, S. K. (1988) Mol. Cell. Biol. 8, 605-614 [Abstract/Free Full Text]
  5. Widom, R. L., Ladias, J. A., Kouidou, S., and Karathanasis, S. K. (1991) Mol. Cell. Biol. 11, 677-686 [Abstract/Free Full Text]
  6. Rottman, J. N., Widom, R. L., Nadal-Ginard, B., Mahdavi, V., and Karathanasis, S. K. (1991) Mol. Cell. Biol. 11, 3814-3820 [Abstract/Free Full Text]
  7. Ladias, J. A., and Karathanasis, S. K. (1991) Science 251, 561-565 [Abstract/Free Full Text]
  8. Widom, R. L., Rhee, M., and Karathanasis, S. K. (1992) Mol. Cell. Biol. 12, 3380-3389 [Abstract/Free Full Text]
  9. Ge, R., Rhee, M., Malik, S., and Karathanasis, S. K. (1994) J. Biol. Chem. 269, 13185-13192 [Abstract/Free Full Text]
  10. Harnish, D. C., Malik, S., and Karathanasis, S. K. (1994) J. Biol. Chem. 269, 28220-28226 [Abstract/Free Full Text]
  11. Evans, R. (1988) Science 240, 889-895 [Abstract/Free Full Text]
  12. Chan, J., Nakabayashi, H., and Wong, N. C. W. (1993) Nucleic Acids Res. 21, 1205-1211 [Abstract/Free Full Text]
  13. Mischoulon, D., Rana, B., Bucher, N., and Farmer, S. R. (1992) Mol. Cell. Biol. 12, 2553-2560 [Abstract/Free Full Text]
  14. Elshourbagy, N. A., Boguski, M. S., Liao, W. S. L., Jefferson, L. S., Gordon, J. I., and Taylor, J. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8242-8246 [Abstract/Free Full Text]
  15. Haddad, I. A., Ordovas, J. M., Fitzpatrick, T., and Karathanasis, S. K. (1986) J. Biol. Chem. 261, 13268-13277 [Abstract/Free Full Text]
  16. Tam, S. P., Archer, T. K., and Deeley, R. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 3111-3115 [Abstract/Free Full Text]
  17. Sorci-Thomas, M., Prack, M. M., Dashti, N., Johnson, F., Rudel, L. L., and Williams, D. L. (1989) J. Lipid Res. 30, 1397-1403 [Abstract]
  18. Ettinger, W. H., Varma, V. K., Sorci-Thomas, M., Parks, J. S., Sigmon, R. C, Smith, T. K., and Verdery, R. B. (1994) Arterioscler. Thromb. 14, 8-13 [Abstract/Free Full Text]
  19. Apostopoulos, J. J., La Scala, M. J., and Howlett, G. J. (1988) Biochem. Biophys. Res. Commun. 154, 997-1002 [CrossRef][Medline] [Order article via Infotrieve]
  20. Staels, B., van Tol, A., Andreu, T., and Auwerx, J. (1992) Arterioscler. Thromb. 12, 286-294 [Abstract/Free Full Text]
  21. Cao, X., Koski, R. A., Gashler, A., McKiernan, M., Morris, C. F., Gaffney, R., Hay, R. V., and Sukhatme, V. P. (1990) Mol. Cell. Biol. 10, 1931-1939 [Abstract/Free Full Text]
  22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  23. Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456-467 [CrossRef][Medline] [Order article via Infotrieve]
  24. Christy, B., and Nathans, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8737-8741 [Abstract/Free Full Text]
  25. Papazafiri, P., Ogami, D., Ramji, D. P., Nicosia, A., Monaci, P., Cladaras, C., and Zannis, V. I. (1991) J. Biol. Chem. 266, 5790-5797 [Abstract/Free Full Text]
  26. Sukhatme, V. P., Cao, X., Chang, L. C., Tsai-Morris, C.-H., Stamenkovitch, D., Ferreira, P. C. P., Cohen, D. R., Edwards, S. A., Curran, T., Le Beau, M. M., and Adamson, E. D. (1988) Cell 53, 37-43 [CrossRef][Medline] [Order article via Infotrieve]
  27. Milbrandt, J. (1987) Science 238, 797-799 [Abstract/Free Full Text]
  28. Almendral, J. M., Sommer, D., Macdonald-Bravo, H., Burchhardt, J., Perera, J., and Bravo, R. (1988) Mol. Cell. Biol. 8, 2140-2148 [Abstract/Free Full Text]
  29. Lemaire, P., Revelant, O., Bravo, R., and Charnay, P. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 4691-4695 [Abstract/Free Full Text]
  30. Lim, R. W., Varnum, B. C., and Herschman, H. R. (1987) Oncogene 1, 263-270 [Medline] [Order article via Infotrieve]
  31. Simmons, D. L., Levy, D. B., and Erikson, R. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1178-1182 [Abstract/Free Full Text]
  32. Madden, S. L., and Rauscher, F. J., III (1993) Ann. N. Y. Acad. Sci. 684, 75-84 [Medline] [Order article via Infotrieve]
  33. Mermod, N., O'Neill, E. A., Kelly, T. J., and Tjian, R. (1989) Cell 58, 741-753 [CrossRef][Medline] [Order article via Infotrieve]
  34. Tripodi, M., Abbott, C., Vivian, N., Cortese, R., and Lovell-Badge, R. (1991) EMBO J. 10, 3177-3182 [Medline] [Order article via Infotrieve]
  35. Mirkovitch, J., and Darnell, J. E. (1991) Genes and Dev. 1, 256-267 [Abstract/Free Full Text]
  36. Ackerman, S. L., Minden, A. G., Williams, G. T., Bobonis, C., and Yeung, C.-Y. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7523-7527 [Abstract/Free Full Text]
  37. Wang, Z. Y., Madden, S. L., Deuel, T. F., Rauscher F. J., III (1992) J. Biol. Chem. 267, 21999-22002 [Abstract/Free Full Text]
  38. Sukhatme, V. P., Kartha, S., Toback, F. G., Taub, R., Hoover, R. G., and Tsai-Morris, C. (1987) Oncogene Res. 1, 343-355 [Medline] [Order article via Infotrieve]
  39. Lau, L. F., and Nathans, D. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1182-1186 [Abstract/Free Full Text]
  40. Bartel, D. P., Sheng, M., Lau, L. F., and Greenberg, M. E. (1989) Genes & Dev. 3, 304-313
  41. Seyfert, V. L., Sukhatme, V. P., and Monroe, J. G. (1989) Mol. Cell. Biol. 9, 2081-2088
  42. Zerial, M., Toschi, L., Ryseck, R.-P., Schuermann, M., Muller, R., and Bravo, R. (1989) EMBO J. 8, 805-813 [Medline] [Order article via Infotrieve]
  43. Sukhatme, V. P. (1990) J. Am. Soc. Nephrol. 1, 859-866 [Abstract]
  44. Nathans, D., Lau, L. F., Christy, B., Hartzell, S., Nakabeppu, Y., and Ryder, K. (1988) Cold Spring Harbor Symp. Quant. Biol. 53, 893-900
  45. Fausto, N. (1990) Curr. Op. Cell Biol. 2, 1036-1042 [CrossRef][Medline] [Order article via Infotrieve]
  46. Michalopoulos, G. K. (1990) FASEB J. 4, 176-187 [Abstract]
  47. Suva, L. J., Ernst, M., and Rodan, G. (1991) Mol. Cell. Biol. 11, 2503-2510 [Abstract/Free Full Text]
  48. Edwards, S. A., Darland, T., Sosnowski, R., Samuels, M., and Adamson, E. (1991) Dev. Biol. 148, 165-173 [CrossRef][Medline] [Order article via Infotrieve]
  49. Nguyen, H. Q., Hoffman-Lieberman, B., and Lieberman, D. A. (1993) Cell 72, 197-209 [CrossRef][Medline] [Order article via Infotrieve]
  50. Henderson, S. A., Lee, P. H., Aeberhard, E. E., Adams, J. W., Ignarro, L. J., Murphy, W. J., and Sherman, M. P. (1994) J. Biol. Chem. 269, 25239-25242 [Abstract/Free Full Text]
  51. Merryman, P. F., Clancy, R. M., He, X. Y., and Abramson, S. B. (1993) Arthritis Rheum. 36, 1414-1422 [Medline] [Order article via Infotrieve]
  52. Cao, X., Mahendran, R., Guy, G. R., and Tan, Y. H. (1993) J. Biol. Chem. 268, 16949-16957 [Abstract/Free Full Text]
  53. Panduro, A., Lin-Lee, Y., Chan, L., and Shafritz, D. A. (1990) Biochemistry 29, 8430-8435 [CrossRef][Medline] [Order article via Infotrieve]
  54. Flodby, P., Antonson, P., Barlow, C., Blanck, A., Porsch-Hallstrom, I., and Xanthopoulos, K. (1993) Exp. Cell Res. 208, 248-256 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Qin, T. Liu, V. S. Kamanna, and M. L. Kashyap
Pioglitazone Stimulates Apolipoprotein A-I Production Without Affecting HDL Removal in HepG2 Cells: Involvement of PPAR-{alpha}
Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2428 - 2434.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
E. Bertrand, C. Fritsch, S. Diether, G. Lambrou, D. Muller, F. Schaeffel, P. Schindler, K. L. Schmid, J. van Oostrum, and H. Voshol
Identification of Apolipoprotein A-I as a "STOP" Signal for Myopia
Mol. Cell. Proteomics, November 1, 2006; 5(11): 2158 - 2166.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. Morello, T. W.A. de Bruin, J. I. Rotter, R. E. Pratt, C. J.H. van der Kallen, G. A. Hladik, V. J. Dzau, C.-C. Liew, and Y.-D. I. Chen
Differential Gene Expression of Blood-Derived Cell Lines in Familial Combined Hyperlipidemia
Arterioscler. Thromb. Vasc. Biol., November 1, 2004; 24(11): 2149 - 2154.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Lamon-Fava and D. Micherone
Regulation of apoA-I gene expression: mechanism of action of estrogen and genistein
J. Lipid Res., January 1, 2004; 45(1): 106 - 112.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. B. Keeton, K. D. Bortoff, W. L. Bennett, J. L. Franklin, D. Y. Venable, and J. L. Messina
Insulin-Regulated Expression of Egr-1 and Krox20: Dependence on ERK1/2 and Interaction with p38 and PI3-Kinase Pathways
Endocrinology, December 1, 2003; 144(12): 5402 - 5410.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Cui, N. W. Schoene, L. Zhu, J. C. Fanzo, A. Alshatwi, and K. Y. Lei
Zinc depletion reduced Egr-1 and HNF-3beta expression and apolipoprotein A-I promoter activity in Hep G2 cells
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C623 - C630.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. C. Tsai, L. Liu, J. Zhang, K. C. Spokes, J. N. Topper, and W. C. Aird
Epidermal growth factor induces Egr-1 promoter activity in hepatocytes in vitro and in vivo
Am J Physiol Gastrointest Liver Physiol, November 1, 2001; 281(5): G1271 - G1278.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. B. Rich, M. R. Fontanilla, M. Nugent, and J. A. Foster
Basic Fibroblast Growth Factor Decreases Elastin Gene Transcription through an AP1/cAMP-response Element Hybrid Site in the Distal Promoter
J. Biol. Chem., November 19, 1999; 274(47): 33433 - 33439.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. S. Silverman, L. M. Khachigian, F. S. Santiago, A. J. Williams, V. Lindner, and T. Collins
Vascular Smooth Muscle Cells Express the Transcriptional Corepressor NAB2 in Response to Injury
Am. J. Pathol., October 1, 1999; 155(4): 1311 - 1317.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. S. Silverman and T. Collins
Pathways of Egr-1-Mediated Gene Transcription in Vascular Biology
Am. J. Pathol., March 1, 1999; 154(3): 665 - 670.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Zhang and D. M. Cohen
Hypotonicity increases transcription, expression, and action of Egr-1 in murine renal medullary mIMCD3 cells
Am J Physiol Renal Physiol, November 1, 1997; 273(5): F837 - F842.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. M. Khachigian and T. Collins
Inducible Expression of Egr-1–Dependent Genes : A Paradigm of Transcriptional Activation in Vascular Endothelium
Circ. Res., October 19, 1997; 81(4): 457 - 461.
[Full Text]


Home page
J. Biol. Chem.Home page
S. R. Trejo, W. E. Fahl, and L. Ratner
c-sis/PDGF-B Promoter Transactivation by the Tax Protein of Human T-cell Leukemia Virus Type 1
J. Biol. Chem., June 14, 1996; 271(24): 14584 - 14590.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Kardassis, M. Laccotripe, I. Talianidis, and V. Zannis
Transcriptional Regulation of the Genes Involved in Lipoprotein Transport : The Role of Proximal Promoters and Long-range Regulatory Elements and Factors in Apolipoprotein Gene Regulation
Hypertension, April 1, 1996; 27(4): 980 - 1008.
[Full Text]


Home page
J. Biol. Chem.Home page
X.-L. Zheng, S. Matsubara, C. Diao, M. D. Hollenberg, and N. C. W. Wong
Activation of Apolipoprotein AI Gene Expression by Protein Kinase A and Kinase C through Transcription Factor, Sp1
J. Biol. Chem., October 6, 2000; 275(41): 31747 - 31754.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kilbourne, E. J.
Right arrow Articles by Karathanasis, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kilbourne, E. J.
Right arrow Articles by Karathanasis, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement