JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gamm, D. M.
Right arrow Articles by Uhler, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gamm, D. M.
Right arrow Articles by Uhler, M. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7227-7232
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Isoform-specific Differences in the Potencies of Murine Protein Kinase Inhibitors Are Due to Nonconserved Amino-terminal Residues (*)

(Received for publication, December 7, 1994; and in revised form, January 13, 1995)

David M. Gamm (1) Michael D. Uhler (2)(§)

From the  (1)Neuroscience Program, (2)Mental Health Research Institute and (3)Department of Biological Chemistry, University of Michigan, Ann Arbor, Michigan 48109

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We provide here a detailed characterization of two isoforms of the protein kinase inhibitor (PKI) protein of cAMP-dependent protein kinase that have dramatically different inhibition constants. Murine PKIbeta1 possesses a 32-fold higher K than murine PKIalpha as determined by Henderson analysis. This finding led to the investigation of C subunitbulletPKI interactions involving nonconserved regions in the carboxyl and amino termini of murine PKIalpha and PKIbeta1. Chimeric cDNAs coding for amino acid sequences from both PKI isoforms were constructed and expressed in bacteria. Surprisingly, exchanging the carboxyl-terminal two-thirds of PKIalpha and PKIbeta1 has relatively little effect on the inhibition constants of the two isoforms. Similarly, introducing amino acid residues corresponding to a beta-turn region of PKIalpha into PKIbeta1 fails to lower PKIbeta1 inhibition constants. However, introducing the amino-terminal alpha-helical region of PKIalpha into PKIbeta1 reduces the K and IC of PKIbeta1 to values identical with full length PKIalpha. Site-directed mutagenesis of specific residues within this region implicates the presence of a tyrosine at position 7 in PKIalpha as a major contributor to its enhanced inhibitory potency. The results of this study suggest that variations in C subunitbulletPKI interactions within an amino-terminal alpha-helix provide a major mechanism for altering the inhibitory properties of PKI isoforms.


INTRODUCTION

An early method for assaying cAMP levels in crude extracts of skeletal muscle led to the discovery of a heat-stable inhibitor protein of cAMP-induced phosphorylation(1) . This protein kinase inhibitor (PKIalpha) (^1)was eventually purified (2) and shown to be a small, specific(3) , and potent (K = 0.2 nM) competitive inhibitor of the catalytic (C) subunit of cAMP-dependent protein kinase(4, 5) .

A variety of peptide studies have established the significance of certain PKIalpha amino acids in the inhibition of C subunit by PKI(6, 7) . Two such residues, Arg^18 and Arg, are located in the amino-terminal inhibitory region of PKIalpha as part of a pseudosubstrate site (Arg^18-Arg-Asn-Ala) that mimics the Arg-Arg-X-(Ser or Thr) consensus sequence for phosphorylation of substrates by cAMP-dependent protein kinase(8, 9) . While these pseudosubstrate arginines are necessary for inhibition of C subunit by PKIalpha peptides, their presence is not sufficient to explain the subnanomolar K of native PKIalpha. Indeed, inhibitors and substrates possessing analogous dibasic consensus sequences have affinities for C subunit in the micromolar range(10, 11) . This discrepancy was partially explained in synthetic PKIalpha peptide studies which extended the optimal inhibitory motif to include Phe, Arg, and Ile(6, 12) .

The molecular cloning of a cDNA from testis encoding a distinct isoform of PKI, PKIbeta1, provided additional insight into the structural determinants of kinase inhibition(13, 14) . A cDNA encoding a second PKIbeta isoform, PKIbeta2, appears to represent an alternatively spliced mRNA which contains an amino-terminal extension of the PKIbeta1 coding region(14) . While rat PKIbeta1 shares only 41% amino acid identity with rabbit PKIalpha(13) , the extended inhibitory motif of rabbit PKIalpha is fully conserved in PKIbeta1 and PKIbeta2. However, despite the distinct developmental and tissue distributions of PKIalpha and PKIbeta1 mRNAs(15) , a rationale for the existence of multiple PKI isoforms has yet to be determined conclusively.

An earlier report demonstrated that rat PKIbeta1 and rabbit PKIalpha had similar K values(13) . However, murine PKIbeta1 recently was shown to possess a 64-fold higher IC than human PKIalpha(16) , providing evidence for a possible functional difference between PKI isoforms. To probe the structural cause of this difference in inhibitory potency, we produced recombinant PKI proteins that contained selected amino acid sequences from both murine PKIalpha and PKIbeta1. These chimeric PKIs were then subjected to kinetic analysis. Results from this study suggest that amino acid changes within the amino-terminal amphipathic alpha-helix of murine PKIalpha can fully account for the difference in inhibitory potency between the two murine PKI isoforms. Together, these experiments constitute the first mutational analysis of a PKIbeta protein, and the first investigation of the structural basis for a difference in PKI isoform function.


MATERIALS AND METHODS

Construction of Chimeric PKI cDNAs and Site-directed Mutagenesis of Murine PKIbeta1

The polymerase chain reaction (PCR) was used to create chimeric PKI cDNAs, each possessing nucleotide sequences from both murine PKIalpha and murine PKIbeta1. PCR was also used to mutagenize murine PKIbeta1 cDNAs at the Tyr^7, Thr^8, and Ser codons. The standard PCR reaction mixture contained 50 mM KCl, 10 mM Tris-HCl (pH 8.4), 1.5 mM MgCl(2), 10% (v/v) dimethyl sulfoxide, 200 µM each of dATP, dCTP, dGTP, dTTP, and 5 units of Taq DNA polymerase (Life Technologies, Inc.). Oligonucleotides were synthesized at the University of Michigan Biomedical Research Core Facilities.

To generate the PKI chimeras containing carboxyl-terminal swaps, cDNAs coding for the amino- and carboxyl-terminal residues of murine PKIalpha and PKIbeta1 were amplified in separate PCR reactions.

Reaction A

cDNA coding for the amino-terminal 21 residues of PKIalpha was amplified using 200 ng of the cDNA construct pGEM(PKI-7)Z (17) , 2 µg of the oligonucleotide MSPKI.E5 (GCGAATTCACTGATGTGGAAACTACG), and 2 µg of the chimeric oligonucleotide STHPKI.A1 (CTGGATGTCGGGTAATGCATTTCTTCTACC) in a final volume of 100 µl. The sample was overlaid with 70 µl of paraffin oil and placed in a model 60 Tempcycler (Coy Laboratories, Ann Arbor, MI) for 20 cycles of PCR. The sample was denatured at 95 °C for 30 s, annealed at 45 °C for 30 s, and elongated at 72 °C for 1 min. The reaction was electrophoresed on a 3% (w/v) NuSieve-agarose (FMC Bioproducts), 1% agarose (w/v) gel, and an 83-bp fragment was isolated. In reactions B-J, the PCR amplifications were carried out in the same manner as reaction A with the exception of the noted differences in the oligonucleotide primers and cDNA templates.

Reaction B

cDNA coding for the carboxyl-terminal 49 residues of PKIbeta1 was amplified using pGEM(MTPKI1.1)5Z(14) , the chimeric oligonucleotide STHPKI.S1 (GGTAGAAGAAATGCATTACCCGACATCCAG), and the oligonucleotide TPKI.E3 (GCGAATTCTCATTTTCCTTCATTTAG), resulting in a 175-bp fragment.

Reaction C

cDNA coding for the amino-terminal 21 residues of PKIbeta1 was amplified using pGEM(MTPKI1.1)5Z, the oligonucleotide TPKI.E5 (GCGAATTCACTGATGTGGAATCTGTGATC), and the chimeric oligonucleotide TSHPKI.A1 (CAGGATATCATGTATGGCATTGCGGCGGCC), yielding an 83-bp fragment.

Reaction D

cDNA coding for the carboxyl-terminal 54 residues of PKIalpha was amplified using pGEM(PKI-7)Z, the chimeric oligonucleotide TSHPKI.S1 (GGCCGCCGCAATGCCATACATGATATCCTG), and the oligonucleotide MSPKI.E3 (GCGAATTCTTAGCTTTCAGACTTGGC), producing a 188-bp fragment.

Reactions E and F yielded partially overlapping 5` and 3` fragments of murine PKIbeta1 containing a complete beta-turn sequence from PKIalpha. Altered nucleotides are underlined.

Reaction E

For the 61-bp 5` fragment, TPKI.E5 and the chimeric oligonucleotide BTURN.A (CGGCCTG TCCTT CCTGAGGACGCAAAGCT) were employed to amplify pGEM(MTPKI1.1)5Z.

Reaction F

For the 187-bp 3` fragment, the chimeric oligonucleotide BTURN.S (CCTCAG GAAGG ACAGGCCGCCGCAATGCC) and TPKI. E3 were used to amplify pGEM(MTPKI1.1)5Z.

Reactions G and H produced partially overlapping 5` and 3` fragments coding for a murine PKIalpha(1-12)/beta1(13-70) mutant.

Reaction G

For the 59-bp 5` murine PKIalpha fragment, MSPKI.E5 and the chimeric oligonucleotide HELIX.A (GCCTGCCCTTGCTGAAGCAATGAAATCTGC) were employed to amplify pGEM(PKI-7)Z.

Reaction H

For the 200-bp 3` murine PKIbeta1 fragment, the chimeric oligonucleotide HELIX.S (GCAGATTTCATTGCTTCAGCAAGGGCAGGC) and TPKI.E3 were used to amplify pGEM(MTPKI1.1)5Z.

Reactions I and J yielded partially overlapping 5` and 3` fragments coding for a murine PKIbeta1(T8A/S12A) mutant. Altered nucleotides are underlined.

Reaction I

For the 47-bp 5` fragment, TPKI.E5 and the mutagenic oligonucleotide PKIBT8S12.A (TGAGG CCGCAAAGCTGG CGATCACAGATT) were employed to amplify pGEM(MTPKI1.1)5Z.

Reaction J

For the 203-bp 3` fragment, the mutagenic oligonucleotide PKIBT8S12.S (ATC GCCAGCTTTGCG GCCTCAGCAAGGGC) and TPKI.E3 were used to amplify pGEM(MTPKI1.1)5Z.

Reaction K yielded a full length fragment coding for a murine PKIbeta1(I7Y) mutant. Altered nucleotides are underlined.

Reaction K

The mutagenic oligonucleotide PKIBI7Y (GCGAATTCACTGATGTGGAATCTGTG TACACCAGC) and TPKI.E3 were employed to amplify pGEM(MTPKI1.1)5Z, resulting in a 229-bp fragment.

The reaction products (A, B), (C, D), (E, F), (G, H), and (I, J) were appended in reactions L-N.

Reaction L

The products of reactions (A, B) and (G, H) were combined separately with the oligonucleotides MSPKI.E5 and TPKI.E3 and subjected to a second round of PCR to produce 229-bp cDNA fragments coding for PKIalpha(1-21)/beta1(22-70) and PKIalpha(1-12)/beta1(13-70), respectively.

Reaction M

The products of reactions C and D were combined with the oligonucleotides TPKI.E5 and MSPKI.E3 to create a 244-bp cDNA fragment coding for PKIbeta1(1-21)/alpha(22-75).

Reaction N

The products from reactions (E, F) and (I, J) were combined in separate tubes with the oligonucleotides TPKI.E5 and TPKI.E3 to generate 229-bp cDNA fragments coding for PKIbeta1(A14G/A16T) and PKIbeta1(T8A/S12A), respectively.

The products of reactions K, L, M, and N were digested with EcoRI (Life Technologies, Inc.), and the resulting fragments were isolated and ligated into the EcoRI site of pMALcRI (18) (New England Biolabs). The pMALcRI plasmid expresses cDNA inserts as fusion proteins with maltose binding protein. The chimeric PKI and mutant PKIbeta1 expression vectors were then electroporated into Escherichia coli XL1Blue (Stratagene). Individual clones were sequenced using a modified T7 DNA polymerase (Sequenase, U. S. Biochemical Corp.) in the dideoxy chain termination method (19) to verify mutations and to ensure that no additional modifications to the cDNAs were introduced.

The same steps described above were also used to amplify murine wild-type PKIalpha using the cDNA template pGEM(PKI-7)Z and the oligonucleotides MSPKI.E5 and MSPKI.E3 and introduce it into the pMALcRI prokaryotic expression vector.

Expression and Purification of Maltose Binding Protein Fusion Proteins

Murine PKIalpha wild-type, PKIbeta1 wild-type(20) , PKIalpha(1-21)/beta1(22-70), PKIbeta1(1-21)/alpha(22-75), PKIbeta1(A14G/A16T), PKIalpha(1-12)/beta1(13-70), PKIbeta1(T8A/S12A), and PKIbeta1(I7Y) fusion proteins were expressed in E. coli and purified by amylose resin chromatography as described earlier(20) , with the exception that cells were harvested 2.5 h after induction with isopropyl-1-thio-beta-D-galactopyranoside (Life Technologies, Inc.). The fusion proteins were greater than 90% pure as determined by scanning densitometry of Coomassie Blue R-250-stained SDS-polyacrylamide gel electrophoresis gels.

Determination of PKI IC Values

Purified recombinant Calpha subunit (20) was preincubated with the various PKIs and 0.2 mg/ml bovine serum albumin (Boehringer Mannheim) in a phosphotransferase assay mixture for 10 min at 30 °C essentially as described(21) . [-P]ATP was obtained from ICN, and the specific activity of ATP used in the phosphotransferase assays was 200 cpm/pmol. Calpha (0.3 nM) was used in assays containing murine wild-type PKIbeta1, PKIbeta1(1-21)/alpha(22-75), and PKIbeta1(A14G/A16T). However, wild-type PKIalpha, PKIalpha(1-21)/beta1(22-70), PKIalpha(1-12)/beta1(13-70), PKIbeta1(T8A/S12A), and PKIbeta1(I7Y) have IC values close to 0.3 nM and therefore required a reduced (0.05 nM) Calpha concentration in assays of inhibition. The assay was initiated by the addition of Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) (Sigma) to a final concentration of 30 µM, incubated for an additional 40 min, and then terminated. Activities were determined in triplicate at each inhibitor concentration, plotted, and fitted to a logistic function using SigmaPlot software (Jandel Scientific). IC values (constants representing 50% inhibition of activity) were obtained from at least three experiments for each PKI. MBP-beta-galactosidase was also subjected to an identical analysis for IC determination. The control activity for Calpha in these experiments was 4.0 units/mg.

Determination of PKI K(i) Values

To compare the inhibitory potency of the PKIs with previous studies(6, 12, 13) , K(i) values were determined at least three times for each inhibitor using the Henderson method for tightly bound inhibitors(22) .


RESULTS AND DISCUSSION

Previous peptide studies revealed five amino acids in the amino terminus of PKIalpha that are responsible for the majority of its potent inhibitory activity(6, 12) . The two pseudosubstrate site arginines, Arg^18 and Arg, interact with residues within the active site of C subunit(5, 23) . The roles of the remaining critical amino acids, Phe, Arg, and Ile, became clear upon the elucidation of the crystal structure of C subunit complexed with synthetic PKIalpha(5-24) peptide (23) . The aromatic side chain of Phe is positioned along an amphipathic alpha-helix to interact with Tyr and Phe within a hydrophobic pocket in C subunit. Arg forms part of a beta-turn structure that positions its guanidinium group to ion-pair with Glu of C subunit. Ile is located within an extended portion of PKIalpha(5-24) and interacts with a second hydrophobic pocket in C subunit.

Protein Sequence Comparison of Murine PKIalpha and PKIbeta1

Amino acid alignment of murine PKIalpha and PKIbeta1 reveals only 22 identical amino acids between the two isoforms (Fig. 1). However, the extended inhibitory motif (Phe-X-X-X-X-Arg-X-X-Arg-Arg-X-Ala-Ile/Leu) is conserved with the exception of the substitution of leucine for isoleucine at position 22 in PKIbeta1. Although PKIbeta1 retains these critical amino acids, the detailed secondary structure of PKIbeta1 protein or PKIbeta1-derived peptides has not been solved. Therefore, PKIbeta1 interactions with C subunit can only be inferred based upon C subunitbulletPKIalpha data.


Figure 1: Amino acid comparison of murine PKIalpha and PKIbeta1. The predicted amino acid sequences of murine PKIalpha (top line) (17) and PKIbeta1 (bottom line) (14) are shown. Boxed amino acids indicate identical residues between murine PKIalpha and PKIbeta1. Double arrows above the murine PKIalpha sequence localize structural domains present in the PKIalpha amino terminus as determined by x-ray crystallographic studies using a PKIalpha(5-24) peptide(23) . The first four PKIalpha amino acids (dotted line) were not included in the crystal structure, but may also participate in an alpha-helix(25) .



Determination of K(i) Values for Murine PKIalpha and PKIbeta1

cDNAs encoding murine PKIalpha and PKIbeta1 were PCR-amplified, sequenced, and cloned into pMALcRI for expression as maltose binding protein (MBP) fusion proteins. A previous report has demonstrated no effect of MBP on the inhibitory activity of PKI(20) . To confirm this finding, murine MBP-PKIalpha and MBP-PKIbeta1 were subjected to factor Xa cleavage to remove MBP. The extent of MBP cleavage was monitored using SDS-polyacrylamide gel electrophoresis, and the resulting free PKIs were tested for their ability to inhibit Calpha phosphotransferase activity. With greater than 95% of the MBP cleaved, there is no effect on the inhibitory potency of PKIalpha or PKIbeta1 (data not shown). In addition, there is no effect of an MBP-beta-galactosidase fusion protein on inhibition of Calpha activity at concentrations up to 80 µM (data not shown).

Kinetic analyses of the murine PKIalpha and PKIbeta1 fusion proteins were performed using the method of Henderson for high affinity inhibitors (22) as described previously for PKI(6, 7, 12) . Henderson analysis demonstrates that murine PKIbeta1, like all PKIs examined to date(13, 24) , is a competitive inhibitor of Calpha (Fig. 2). Replots of slopes (Fig. 2, inset) from the Henderson analyses of both murine PKIalpha and PKIbeta1 versus Kemptide substrate (9) reveal a K(i) for PKIbeta1 of 7.1 nM, reflecting a 32-fold decrease in inhibitory potency compared to PKIalpha (K(i) = 0.22 nM). Since both murine isoforms possess the optimal PKI inhibitory motif, these results suggest that additional, nonconserved residues are responsible for the difference in K(i) between PKIalpha and PKIbeta1.


Figure 2: Murine PKIbeta1 and PKIalpha K determinations by Henderson analyses. cAMP-dependent protein kinase activity was determined in the presence or absence of murine wild-type PKIbeta1 or PKIalpha at the following Kemptide concentrations: 90 µM (), 60 µM (circle), 30 µM (), and 5 µM (box). Shown are the data for murine PKIbeta1 plotted in accordance with Henderson (22) , where I is the total inhibitory protein concentration and V and V are the reaction velocities in the presence and absence of inhibitory proteins, respectively. The inset shows replots of the slopes from Henderson analyses versus Kemptide concentration for murine PKIbeta1 (circle) and PKIalpha (). K values obtained from the replots are listed in Fig. 4.




Figure 4: Inhibition constants of wild-type and chimeric PKIs. The relative lengths of wild-type murine PKIalpha (hatched bar) and PKIbeta1 (solid bar) and the lengths and isoform compositions of the chimeric PKIs used in this study are shown on the left. All PKIs were expressed as fusion proteins with maltose binding protein (MBP), although cleavage of MBP from the fusion proteins did not affect the inhibitory activity of murine PKIalpha and PKIbeta1. Inhibition constants of the wild-type and chimeric PKIs are shown in the table to the right of the respective inhibitors. Inhibition constants are expressed as the average of three or more experiments ± S.D. for each PKI. K values for the chimeric PKIs were determined via Henderson analysis as described for wild-type murine PKIalpha and PKIbeta1.



Construction and Kinetic Analysis of PKI Chimeras

To investigate the structural basis for the difference in inhibitory activity between murine PKIalpha and PKIbeta1, chimeric PKI cDNAs were generated using PCR mutagenesis. The cDNAs were subcloned into the prokaryotic expression vector pMALcRI, ultimately producing the following fusion proteins: PKIalpha(1-21)/beta1(22-70), PKIbeta1(1-21)/alpha(22-75), PKIbeta1(A14G/A16T), and PKIalpha(1-12)/beta1(13-70).

To assess the effect of the PKI mutagenesis on the inhibition of Calpha, phosphotransferase activity was assayed in the presence of 30 µM Kemptide substrate and increasing concentrations of the chimeric PKIs (Fig. 3, A and B). Swapping the carboxyl-terminal two-thirds of murine PKIalpha and PKIbeta1 causes only minor changes in inhibitory activity (Fig. 3A). PKIalpha(1-21)/beta1(22-70) demonstrates a respective 1.3- and 1.7-fold increase in IC and K(i) relative to wild-type murine PKIalpha (Fig. 4). PKIbeta1(1-21)/alpha(22-75) exhibits a respective 1.7- and 1.4-fold decrease in IC and K(i) compared to wild-type murine PKIbeta1 (Fig. 4). These modest effects suggest that nonconserved amino-terminal residues are responsible for the majority of the isoform-specific difference in inhibitory potency between murine PKIalpha and PKIbeta1.


Figure 3: Inhibition of C subunit by chimeric PKIs. Calpha activity was assayed in the presence of 30 µM Kemptide and increasing concentrations of murine wild-type PKIalpha (circle), PKIalpha(1-21)/beta1(22-70) (bullet), PKIbeta1 (down triangle), and PKIbeta1(1-21)/alpha(22-75) () (A) or murine wild-type PKIalpha (circle), PKIalpha(1-12)/beta1(13-70) (bullet), PKIbeta1 (down triangle), and PKIbeta1(A14G/A16T) () (B). Activity was determined as described under ``Materials and Methods'' and expressed as the percentage of Calpha specific activity in the absence of inhibitor. The curves were fitted using the average values of triplicate assay points from representative experiments, and the error bars depict the standard deviation from the mean. The experiments were performed at least three times for each inhibitor. Average IC values and measurements of error for each PKI are reported in Fig. 4.



Since the pseudosubstrate site is conserved between the murine PKI isoforms, there remained only nine amino acid differences in the amino termini to investigate. Two of these residues in PKIalpha, Gly^14 and Thr, are located within a beta-turn. Gly^14, in particular, is thought to be important for turn formation or for providing flexibility for binding of Arg(23) . The importance of Arg interactions in full length PKIalpha inhibition was investigated previously by mutating it to an alanine, which resulted in a large decrease in inhibitory activity(16, 20) . The remaining seven nonconserved residues in the amino terminus participate in an amphipathic alpha-helix in PKIalpha. The high affinity binding of PKIalpha peptides is largely due to hydrophobic interactions between C subunit and residues along this helix, most notably Phe(16, 23) . Together, the beta-turn and alpha-helix regions serve to fix the amino terminus of PKIalpha, optimizing pseudosubstrate site contacts with active site residues in C subunit. To test whether either of these two PKIalpha structural domains can account for the observed difference in K(i) between the murine PKI isoforms, two additional PKI chimeras were examined.

PKIbeta1(A14G/A16T), which contains the exact amino acid sequence corresponding to the beta-turn of PKIalpha, does not demonstrate enhanced inhibitory activity relative to wild-type murine PKIbeta1 (Fig. 3B). In fact, this chimeric PKI has IC and K(i) values 1.5- and 1.1-fold greater than wild-type murine PKIbeta1 (Fig. 4).

The final PKI chimera, PKIalpha(1-12)/beta1(13-70), replaces the amino-terminal 12 amino acids of PKIbeta1 with the exact amino acid sequence corresponding to the alpha-helical region of PKIalpha. Surprisingly, this chimeric PKI exhibits inhibition constants identical with wild-type murine PKIalpha (Fig. 3B and 4).

The results of the chimeric PKI experiments suggest that an amino-terminal 12 amino acid region can fully account for the difference in murine PKI isoform inhibitory activity. At least part of this region forms an amphipathic alpha-helix in PKIalpha(23) , but the corresponding secondary structure in PKIbeta1 is unknown. Nonconserved residues within the first 12 amino acids of murine PKIbeta1 could decrease inhibitory activity through at least three different mechanisms. First, one or more of these residues may preclude the formation of an amphipathic alpha-helix in PKIbeta1. Second, murine PKIbeta1 may possess an amino-terminal alpha-helix whose amphipathicity differs from PKIalpha. Third, murine PKIbeta1 could possess an amphipathic alpha-helix similar to PKIalpha; however, variations in individual amino acid side chains may result in altered interactions with C subunit residues. The first mechanism is less probable, since the complete absence of an alpha-helix would be predicted to severely disrupt interactions between Phe and its hydrophobic pocket in C subunit. The resulting decrease in inhibitory potency would likely be more striking than the 32-fold difference observed between murine PKIalpha and PKIbeta1, since direct mutation of Phe caused a 1200-fold increase in the IC of PKIalpha(16) .

Inhibition of C Subunit by Amino-terminal Site-directed Mutants of Murine PKIbeta1

Comparison of the amino-terminal 12 amino acids of murine PKIalpha and PKIbeta1 reveal candidate residues that may contribute to their K(i) difference (Fig. 5, A and B). Murine PKIalpha possesses alanines at positions 8 and 12 which strongly favor alpha-helix formation(25) . Murine PKIbeta1 has a threonine and a serine at positions 8 and 12, respectively, which do not favor alpha-helical structure. Therefore, these two amino acid differences may be responsible for disrupting alpha-helix formation in murine PKIbeta1. Alternatively, Thr^8 and Ser may affect the orientation of the hydrophobic surface of the amphipathic alpha-helix to C subunit, thus altering Phe contacts and decreasing inhibitory activity.


Figure 5: Comparison of amino-terminal amino acid sequences of murine PKIalpha and PKIbeta1. A, comparison of the amino-terminal 12 amino acids of murine PKIalpha and PKIbeta1. Residues in bold were further investigated for their role in determining isoform-specific inhibitory activity. B, helical wheel diagram of the amino terminus of PKIalpha. Residues in parentheses correspond to amino acid differences in murine PKIbeta1. Specific amino acid positions examined in this study are designated with a filled circle.



The PKI mutant PKIbeta1(T8A/S12A) replaces Thr^8 and Ser in murine PKIbeta1 with the alanine residues present in PKIalpha. Calpha phosphotransferase inhibition assays reveal an IC of 3.0 ± 1.0 nM for PKIbeta1(T8A/S12A), reflecting a 4.0-fold decrease relative to wild-type murine PKIbeta1 (Fig. 6). The fact that these mutations only partially improve the inhibitory potency of murine PKIbeta1 suggests that Thr^8 and/or Ser do not dramatically inhibit alpha-helix formation. Hence, other nonconserved amino-terminal residues would be predicted to account for the remaining difference in the inhibition constants of murine PKIalpha and PKIbeta1. A strong candidate is Tyr^7, which is replaced by an isoleucine in murine PKIbeta1. In a previous report utilizing synthetic PKIalpha peptides, substitution at Tyr^7 caused a greater increase in K(i) than substitution of other nonconserved amino-terminal amino acids(12) . In addition, chemical modification of Tyr^7 resulted in large decreases in the inhibitory potency of PKIalpha(26) . Since Tyr^7 is located adjacent to Phe in the amino-terminal alpha-helix of PKIalpha (Fig. 5B), it was speculated to interact with the hydrophobic pocket that accommodates Phe(23) .


Figure 6: Inhibition of Calpha by murine PKIbeta1 amino-terminal mutants. Recombinant Calpha was assayed for phosphotransferase activity in the presence of 30 µM Kemptide and increasing concentrations of murine wild-type PKIalpha (circle), PKIbeta1 (bullet), PKIbeta1(T8A/S12A) (down triangle), and PKIbeta1(I7Y) (). Activity was determined as described under ``Materials and Methods'' and expressed as the percentage of Calpha specific activity in the absence of inhibitor. The curves were fitted using the average values of triplicate assay points from representative experiments, and the error bars depict the standard deviation from the mean. The experiments were performed at least three times for each inhibitor. Average IC values ± S.D. for the PKI mutants are discussed in the text.



In this study, site-directed mutagenesis of Ile^7 of murine PKIbeta1 to tyrosine yields an IC of 0.95 ± 0.45 nM, which constitutes a 13-fold increase in inhibitory activity (Fig. 6). Since isoleucines more strongly facilitate alpha-helical structure than tyrosines(25) , PKIbeta1(I7Y) is less likely to form an amino-terminal alpha-helix than wild-type PKIbeta1. Therefore, it would seem that specific interactions between the phenolic group of Tyr^7 and C subunit residues are responsible for the enhanced inhibitory potency of murine PKIalpha. This tyrosine residue was implicated as a potential PKIalpha regulatory site in studies of in vitro phosphorylation by the epidermal growth factor receptor (27) . In these studies, phosphorylation at Tyr^7 increased the IC of PKIalpha by approximately 9-fold relative to dephosphorylated PKIalpha, suggesting that interactions between Tyr^7 and C subunit are important in C subunitbulletPKI complex formation.

Results presented here imply a mechanism whereby C subunit can discriminate between various PKI isoforms. Specifically, we have shown that differences in amino acids such as Tyr^7, located in an amino-terminal region corresponding to the alpha-helix of PKIalpha, can result in distinct PKI inhibitory properties. Different C subunitbulletPKI interactions may in turn lead to physiological changes in PKI function. Although a specific role for PKI has not been unequivocally assigned, recent studies by Fantozzi et al.(28) demonstrated that PKIalpha can enhance C subunit export from the nucleus. Additional reports showed that full length PKIalpha or a PKIalpha peptide could preferentially inhibit basal transcriptional activity of some cAMP-regulated DNA response elements(29, 30) . Therefore, in an unstimulated cell with resting levels of cAMP, the difference in K(i) between murine PKIalpha and PKIbeta1 could play a significant role in determining either the amount of C subunit present in the nucleus or the rate at which C subunit activates specific transcription factors. In particular, differential expression of PKI isoforms during development offers an intriguing mechanism to regulate the basal level of C subunit phosphotransferase activity(15) . While the exact number of PKI isoforms is not known, numerous chromatographically separable forms of PKI have been observed in testis (13, 31) . Of interest, one recently cloned murine PKIbeta1 isoform, PKIbeta2, possesses a unique amino terminus due to alternative splicing (14) . Although the inhibitory potency of PKIbeta2 has not yet been examined, work here demonstrates that the existence of distinct amino-terminal amino acid sequences in multiple PKI isoforms may provide for further diversity in the regulation of cAMP-dependent protein kinase function.


FOOTNOTES

*
This work was supported by National Institutes of Health Grant GM 38788 (to M. D. U.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence and reprint requests should be addressed: Neuroscience Laboratories Bldg., University of Michigan, 1103 E. Huron St., Ann Arbor, MI 48104-1687. Tel.: 313-747-3172; Fax: 313-936-2690.

(^1)
The abbreviations used are: PKI, cAMP-dependent protein kinase inhibitor; bp, base pair(s); PCR, polymerase chain reaction; C, catalytic; MBP, maltose binding protein.


ACKNOWLEDGEMENTS

We thank Eric Baude and Vincent Massey for helpful discussions and Adele Barres for assistance in the preparation of this manuscript. We extend additional thanks to Eric Baude for providing recombinant Calpha.


REFERENCES

  1. Posner, J. B., Hammermeister, K. E., Bratvold, G. E., and Krebs, E. G. (1964) Biochemistry 3, 1040-1044
  2. Walsh, D. A., Ashby, C. D., Gonzalez, C., Calkins, D., Fischer, E. H., and Krebs, E. G. (1971) J. Biol. Chem. 246, 1977-1985 [Abstract/Free Full Text]
  3. Glass, D. B., Cheng, H.-C., Kemp, B. E., and Walsh, D. A. (1986) J. Biol. Chem. 261, 12166-12171 [Abstract/Free Full Text]
  4. Whitehouse, S., and Walsh, D. A. (1982) J. Biol. Chem. 257, 6028-6032 [Abstract/Free Full Text]
  5. Walsh, D. A., Angelos, K. L., Van Patten, S. M., Glass, D. B., and Garetto, L. P. (1990) in Peptides and Protein Phosphorylation (Kemp, B. E., ed) pp. 43-84, CRC Press, Boca Raton, FL
  6. Scott, J. D., Glaccum, M. B., Fischer, E. H., and Krebs, E. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1613-1616 [Abstract/Free Full Text]
  7. Cheng, H.-C., Kemp, B. E., Pearson, R. B., Smith, A. J., Misconi, L., Van Patten, S. M., and Walsh, D. A. (1986) J. Biol. Chem. 261, 989-992 [Abstract/Free Full Text]
  8. Walsh, D. A., Glass, D. B., and Mitchell, R. D. (1992) Curr. Opin. Cell Biol. 4, 241- 251 [CrossRef][Medline] [Order article via Infotrieve]
  9. Kemp, B. E., Graves, D. J., Benjamini, E., and Krebs, E. G. (1977) J. Biol. Chem. 252, 4888-4894 [Free Full Text]
  10. Whitehouse, S., Feramisco, J. R., Casnellie, J. E., Krebs, E. G., and Walsh, D. A. (1983) J. Biol. Chem. 258, 3693-3701 [Abstract/Free Full Text]
  11. Reed, J., Kinzel, V., Kemp, B. E., Cheng, H.-C., and Walsh, D. A. (1985) Biochemistry 24, 2967-2973 [CrossRef][Medline] [Order article via Infotrieve]
  12. Glass, D. B., Cheng, H.-C., Mende-Mueller, L., Reed, J., and Walsh, D. A. (1989) J. Biol. Chem. 264, 8802-8810 [Abstract/Free Full Text]
  13. Van Patten, S. M., Ng, D. C., Th'ng, J. P. H., Angelos, K. L., Smith, A. J., and Walsh, D. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5383-5387 [Abstract/Free Full Text]
  14. Scarpetta, M. A., and Uhler, M. D. (1993) J. Biol. Chem. 268, 10927-10931 [Abstract/Free Full Text]
  15. Van Patten, S. M., Howard, P., Walsh, D. A., and Maurer, R. A. (1992) Mol. Endocrinol. 6, 2114-2122 [Abstract]
  16. Baude, E. J., Dignam, S. S., Reimann, E. M., and Uhler, M. D. (1994) J. Biol. Chem 269, 18128-18133 [Abstract/Free Full Text]
  17. Olsen, S. R., and Uhler, M. D. (1991) J. Biol. Chem. 266, 11158-11162 [Abstract/Free Full Text]
  18. Maina, C. V., Riggs, P. D., Grandea, A. G., III, Slatko, B. E., Moran, L. S., Tagliamonte, J. A., McReynolds, L. A., and Guan, C. (1988) Gene (Amst.) 74, 365-373 [CrossRef][Medline] [Order article via Infotrieve]
  19. Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. A., and Roe, B. A. (1980) J. Mol. Biol. 143, 161-178 [CrossRef][Medline] [Order article via Infotrieve]
  20. Baude, E. J., Dignam, S. S., Olsen, S. R., Reimann, E. M., and Uhler, M. D. (1994) J. Biol. Chem. 269, 2316-2323 [Abstract/Free Full Text]
  21. Whitehouse, S., and Walsh, D. A. (1983) J. Biol. Chem. 258, 3682-3692 [Abstract/Free Full Text]
  22. Henderson, P. J. F. (1972) Biochem. J. 127, 321-333 [Medline] [Order article via Infotrieve]
  23. Knighton, D. R., Zheng, J., Ten Eyck, L. F., Xuong, N.-H., Taylor, S. S., and Sowadski, J. M. (1991) Science 253, 414-420 [Abstract/Free Full Text]
  24. Demaille, J. G., Peters, K. A., and Fischer, E. H. (1977) Biochemistry 16, 3080-3086 [CrossRef][Medline] [Order article via Infotrieve]
  25. Chou, P. Y., and Fasman, G. D. (1974) Biochemistry 13, 222-245 [CrossRef][Medline] [Order article via Infotrieve]
  26. Demaille, J. G., Ferraz, C., and Fischer, E. H. (1979) Biochim. Biophys. Acta 586, 374-383 [Medline] [Order article via Infotrieve]
  27. Van Patten, S. M., Heisermann, G. J., Cheng, H.-C., and Walsh, D. A. (1987) J. Biol. Chem. 262, 3398-3403 [Abstract/Free Full Text]
  28. Fantozzi, D. A., Harootunian, A. T., Wen, W., Taylor, S. S., Feramisco, J. R., Tsien, R. Y., and Meinkoth, J. L. (1994) J. Biol. Chem. 269, 2676-2686 [Abstract/Free Full Text]
  29. Grove, J. R., Price, D. J., Goodman, H. M., and Avruch, J. (1987) Science 238, 530-533 [Abstract/Free Full Text]
  30. Day, R. N., Walder, J. A., and Maurer, R. A. (1989) J. Biol. Chem. 264, 431-436 [Abstract/Free Full Text]
  31. Beale, E. G., Dadman, J. R., and Means, A. R. (1977) J. Biol. Chem. 252, 6322-6327 [Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. K. Taylor, R. Ahmed, M. Begley, and M. D. Uhler
Autoinhibition and Isoform-specific Dominant Negative Inhibition of the Type II cGMP-dependent Protein Kinase
J. Biol. Chem., September 27, 2002; 277(40): 37242 - 37253.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. P. Collins and M. D. Uhler
Cyclic AMP- and Cyclic GMP-dependent Protein Kinases Differ in Their Regulation of Cyclic AMP Response Element-dependent Gene Transcription
J. Biol. Chem., March 26, 1999; 274(13): 8391 - 8404.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. P. Collins and M. D. Uhler
Characterization of PKIgamma , a Novel Isoform of the Protein Kinase Inhibitor of cAMP-dependent Protein Kinase
J. Biol. Chem., July 18, 1997; 272(29): 18169 - 18178.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Gamm, E. J. Baude, and M. D. Uhler
The Major Catalytic Subunit Isoforms of cAMP-dependent Protein Kinase Have Distinct Biochemical Properties in Vitro and in Vivo
J. Biol. Chem., June 28, 1996; 271(26): 15736 - 15742.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Gamm, S. H. Francis, T. P. Angelotti, J. D. Corbin, and M. D. Uhler
The Type II Isoform of cGMP-dependent Protein Kinase Is Dimeric and Possesses Regulatory and Catalytic Properties Distinct from the Type I Isoforms
J. Biol. Chem., November 10, 1995; 270(45): 27380 - 27388.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Taylor and M. D. Uhler
The Amino-terminal Cyclic Nucleotide Binding Site of the Type II cGMP-dependent Protein Kinase Is Essential for Full Cyclic Nucleotide-dependent Activation
J. Biol. Chem., September 1, 2000; 275(36): 28053 - 28062.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Lum, Z. Hao, D. Gayle, P. Kumar, C. E. Patterson, and M. D. Uhler
Vascular endothelial cells express isoforms of protein kinase A inhibitor
Am J Physiol Cell Physiol, January 1, 2002; 282(1): C59 - C66.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map