![]()
|
|
||||||||
(Received for publication, December 7, 1994; and in revised form, January 13,
1995) From the
We provide here a detailed characterization of two isoforms of
the protein kinase inhibitor (PKI) protein of cAMP-dependent protein
kinase that have dramatically different inhibition constants. Murine
PKI An early method for assaying cAMP levels in crude extracts of
skeletal muscle led to the discovery of a heat-stable inhibitor protein
of cAMP-induced phosphorylation(1) . This protein kinase
inhibitor (PKI A variety of peptide studies have
established the significance of certain PKI The molecular cloning
of a cDNA from testis encoding a distinct isoform of PKI, PKI An earlier report demonstrated that rat PKI
To generate the PKI chimeras containing carboxyl-terminal swaps,
cDNAs coding for the amino- and carboxyl-terminal residues of murine
PKI
Reactions E and F yielded partially overlapping 5`
and 3` fragments of murine PKI
Reactions G and H
produced partially overlapping 5` and 3` fragments coding for a murine
PKI
Reactions I and J yielded partially overlapping 5`
and 3` fragments coding for a murine PKI
Reaction K
yielded a full length fragment coding for a murine PKI
The
reaction products (A, B), (C, D), (E, F), (G, H), and (I, J) were
appended in reactions L-N.
The
products of reactions K, L, M, and N were digested with EcoRI
(Life Technologies, Inc.), and the resulting fragments were isolated
and ligated into the EcoRI site of pMALcRI (18) (New
England Biolabs). The pMALcRI plasmid expresses cDNA inserts as fusion
proteins with maltose binding protein. The chimeric PKI and mutant
PKI The same steps described
above were also used to amplify murine wild-type PKI
Previous peptide studies revealed five amino acids in the
amino terminus of PKI
Figure 1:
Amino acid
comparison of murine PKI
Kinetic analyses of the murine PKI
Figure 2:
Murine PKI
Figure 4:
Inhibition constants of wild-type and
chimeric PKIs. The relative lengths of wild-type murine PKI
To assess the effect of
the PKI mutagenesis on the inhibition of C
Figure 3:
Inhibition of C subunit by chimeric PKIs.
C
Since the
pseudosubstrate site is conserved between the murine PKI isoforms,
there remained only nine amino acid differences in the amino termini to
investigate. Two of these residues in PKI PKI The final
PKI chimera, PKI The
results of the chimeric PKI experiments suggest that an amino-terminal
12 amino acid region can fully account for the difference in murine PKI
isoform inhibitory activity. At least part of this region forms an
amphipathic
Figure 5:
Comparison of amino-terminal amino acid
sequences of murine PKI
The PKI mutant PKI
Figure 6:
Inhibition of C
In this study, site-directed
mutagenesis of Ile Results presented here imply a
mechanism whereby C subunit can discriminate between various PKI
isoforms. Specifically, we have shown that differences in amino acids
such as Tyr
Volume 270,
Number 13,
Issue of March 31, 1995 pp. 7227-7232
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
1 possesses a 32-fold higher K
than murine PKI
as determined by Henderson analysis.
This finding led to the investigation of C subunitPKI
interactions involving nonconserved regions in the carboxyl and amino
termini of murine PKI
and PKI
1. Chimeric cDNAs coding for
amino acid sequences from both PKI isoforms were constructed and
expressed in bacteria. Surprisingly, exchanging the carboxyl-terminal
two-thirds of PKI
and PKI
1 has relatively little effect on
the inhibition constants of the two isoforms. Similarly, introducing
amino acid residues corresponding to a
-turn region of PKI
into PKI
1 fails to lower PKI
1 inhibition constants. However,
introducing the amino-terminal
-helical region of PKI
into
PKI
1 reduces the K
and IC
of PKI
1 to values identical with full length PKI
.
Site-directed mutagenesis of specific residues within this region
implicates the presence of a tyrosine at position 7 in PKI
as a
major contributor to its enhanced inhibitory potency. The results of
this study suggest that variations in C subunitPKI interactions
within an amino-terminal
-helix provide a major mechanism for
altering the inhibitory properties of PKI isoforms.
) (
)was eventually purified (2) and shown to be a small, specific(3) , and potent (K
= 0.2 nM) competitive
inhibitor of the catalytic (C) subunit of cAMP-dependent protein
kinase(4, 5) .
amino acids in the
inhibition of C subunit by PKI(6, 7) . Two such
residues, Arg
and Arg
, are located in the
amino-terminal inhibitory region of PKI
as part of a
pseudosubstrate site (Arg
-Arg-Asn-Ala
) that
mimics the Arg-Arg-X-(Ser or Thr) consensus sequence for
phosphorylation of substrates by cAMP-dependent protein
kinase(8, 9) . While these pseudosubstrate arginines
are necessary for inhibition of C subunit by PKI
peptides, their
presence is not sufficient to explain the subnanomolar K
of native PKI
. Indeed, inhibitors
and substrates possessing analogous dibasic consensus sequences have
affinities for C subunit in the micromolar
range(10, 11) . This discrepancy was partially
explained in synthetic PKI
peptide studies which extended the
optimal inhibitory motif to include Phe
, Arg
,
and Ile
(6, 12) .
1,
provided additional insight into the structural determinants of kinase
inhibition(13, 14) . A cDNA encoding a second PKI
isoform, PKI
2, appears to represent an alternatively spliced mRNA
which contains an amino-terminal extension of the PKI
1 coding
region(14) . While rat PKI
1 shares only 41% amino acid
identity with rabbit PKI
(13) , the extended inhibitory
motif of rabbit PKI
is fully conserved in PKI
1 and PKI
2.
However, despite the distinct developmental and tissue distributions of
PKI
and PKI
1 mRNAs(15) , a rationale for the
existence of multiple PKI isoforms has yet to be determined
conclusively.
1 and
rabbit PKI
had similar K
values(13) . However, murine PKI
1 recently was
shown to possess a 64-fold higher IC
than human
PKI
(16) , providing evidence for a possible functional
difference between PKI isoforms. To probe the structural cause of this
difference in inhibitory potency, we produced recombinant PKI proteins
that contained selected amino acid sequences from both murine PKI
and PKI
1. These chimeric PKIs were then subjected to kinetic
analysis. Results from this study suggest that amino acid changes
within the amino-terminal amphipathic
-helix of murine PKI
can fully account for the difference in inhibitory potency between the
two murine PKI isoforms. Together, these experiments constitute the
first mutational analysis of a PKI
protein, and the first
investigation of the structural basis for a difference in PKI isoform
function.
Construction of Chimeric PKI cDNAs and Site-directed
Mutagenesis of Murine PKI
The polymerase chain reaction (PCR) was used to create
chimeric PKI cDNAs, each possessing nucleotide sequences from both
murine PKI
1
and murine PKI
1. PCR was also used to mutagenize
murine PKI
1 cDNAs at the Tyr
, Thr
, and
Ser
codons. The standard PCR reaction mixture contained 50
mM KCl, 10 mM Tris-HCl (pH 8.4), 1.5 mM MgCl
, 10% (v/v) dimethyl sulfoxide, 200 µM each of dATP, dCTP, dGTP, dTTP, and 5 units of Taq DNA
polymerase (Life Technologies, Inc.). Oligonucleotides were synthesized
at the University of Michigan Biomedical Research Core Facilities.
and PKI
1 were amplified in separate PCR reactions.Reaction A
cDNA coding for the amino-terminal 21
residues of PKI
was amplified using 200 ng of the cDNA construct
pGEM(PKI-7)Z (17) , 2 µg of the oligonucleotide MSPKI.E5
(GCGAATTCACTGATGTGGAAACTACG), and 2 µg of the chimeric
oligonucleotide STHPKI.A1 (CTGGATGTCGGGTAATGCATTTCTTCTACC) in a final
volume of 100 µl. The sample was overlaid with 70 µl of
paraffin oil and placed in a model 60 Tempcycler (Coy Laboratories, Ann
Arbor, MI) for 20 cycles of PCR. The sample was denatured at 95 °C
for 30 s, annealed at 45 °C for 30 s, and elongated at 72 °C
for 1 min. The reaction was electrophoresed on a 3% (w/v)
NuSieve-agarose (FMC Bioproducts), 1% agarose (w/v) gel, and an 83-bp
fragment was isolated. In reactions B-J, the PCR amplifications
were carried out in the same manner as reaction A with the exception of
the noted differences in the oligonucleotide primers and cDNA
templates.Reaction B
cDNA coding for the carboxyl-terminal
49 residues of PKI
1 was amplified using
pGEM(MTPKI1.1)5Z(14) , the chimeric oligonucleotide STHPKI.S1
(GGTAGAAGAAATGCATTACCCGACATCCAG), and the oligonucleotide TPKI.E3
(GCGAATTCTCATTTTCCTTCATTTAG), resulting in a 175-bp fragment.Reaction C
cDNA coding for the amino-terminal 21
residues of PKI
1 was amplified using pGEM(MTPKI1.1)5Z, the
oligonucleotide TPKI.E5 (GCGAATTCACTGATGTGGAATCTGTGATC), and the
chimeric oligonucleotide TSHPKI.A1 (CAGGATATCATGTATGGCATTGCGGCGGCC),
yielding an 83-bp fragment.Reaction D
cDNA coding for the carboxyl-terminal
54 residues of PKI
was amplified using pGEM(PKI-7)Z, the chimeric
oligonucleotide TSHPKI.S1 (GGCCGCCGCAATGCCATACATGATATCCTG), and the
oligonucleotide MSPKI.E3 (GCGAATTCTTAGCTTTCAGACTTGGC), producing a
188-bp fragment.
1 containing a complete
-turn
sequence from PKI
. Altered nucleotides are underlined.Reaction E
For the 61-bp 5` fragment, TPKI.E5 and
the chimeric oligonucleotide BTURN.A (CGGCCTG TCCTT CCTGAGGACGCAAAGCT)
were employed to amplify pGEM(MTPKI1.1)5Z.Reaction F
For the 187-bp 3` fragment, the
chimeric oligonucleotide BTURN.S (CCTCAG GAAGG ACAGGCCGCCGCAATGCC) and
TPKI. E3 were used to amplify pGEM(MTPKI1.1)5Z.
(1-12)/
1(13-70) mutant.Reaction G
For the 59-bp 5` murine PKI
fragment, MSPKI.E5 and the chimeric oligonucleotide HELIX.A
(GCCTGCCCTTGCTGAAGCAATGAAATCTGC) were employed to amplify pGEM(PKI-7)Z. Reaction H
For the 200-bp 3` murine PKI
1
fragment, the chimeric oligonucleotide HELIX.S
(GCAGATTTCATTGCTTCAGCAAGGGCAGGC) and TPKI.E3 were used to amplify
pGEM(MTPKI1.1)5Z.
1(T8A/S12A) mutant.
Altered nucleotides are underlined.Reaction I
For the 47-bp 5` fragment, TPKI.E5 and
the mutagenic oligonucleotide PKIBT8S12.A (TGAGG CCGCAAAGCTGG
CGATCACAGATT) were employed to amplify pGEM(MTPKI1.1)5Z.Reaction J
For the 203-bp 3` fragment, the
mutagenic oligonucleotide PKIBT8S12.S (ATC GCCAGCTTTGCG GCCTCAGCAAGGGC)
and TPKI.E3 were used to amplify pGEM(MTPKI1.1)5Z.
1(I7Y)
mutant. Altered nucleotides are underlined.Reaction K
The mutagenic oligonucleotide PKIBI7Y
(GCGAATTCACTGATGTGGAATCTGTG TACACCAGC) and TPKI.E3 were employed to
amplify pGEM(MTPKI1.1)5Z, resulting in a 229-bp fragment.Reaction L
The products of reactions (A, B) and
(G, H) were combined separately with the oligonucleotides MSPKI.E5 and
TPKI.E3 and subjected to a second round of PCR to produce 229-bp cDNA
fragments coding for PKI
(1-21)/
1(22-70) and
PKI
(1-12)/
1(13-70), respectively.Reaction M
The products of reactions C and D were
combined with the oligonucleotides TPKI.E5 and MSPKI.E3 to create a
244-bp cDNA fragment coding for
PKI
1(1-21)/
(22-75).Reaction N
The products from reactions (E, F) and
(I, J) were combined in separate tubes with the oligonucleotides
TPKI.E5 and TPKI.E3 to generate 229-bp cDNA fragments coding for
PKI
1(A14G/A16T) and PKI
1(T8A/S12A), respectively.
1 expression vectors were then electroporated into Escherichia coli XL1Blue (Stratagene). Individual clones were
sequenced using a modified T7 DNA polymerase (Sequenase, U. S.
Biochemical Corp.) in the dideoxy chain termination method (19) to verify mutations and to ensure that no additional
modifications to the cDNAs were introduced.
using the
cDNA template pGEM(PKI-7)Z and the oligonucleotides MSPKI.E5 and
MSPKI.E3 and introduce it into the pMALcRI prokaryotic expression
vector.Expression and Purification of Maltose Binding
Protein Fusion Proteins
Murine PKI
wild-type, PKI
1 wild-type(20) ,
PKI
(1-21)/
1(22-70),
PKI
1(1-21)/
(22-75), PKI
1(A14G/A16T),
PKI
(1-12)/
1(13-70), PKI
1(T8A/S12A), and
PKI
1(I7Y) fusion proteins were expressed in E. coli and
purified by amylose resin chromatography as described
earlier(20) , with the exception that cells were harvested 2.5
h after induction with
isopropyl-1-thio-
-D-galactopyranoside (Life Technologies,
Inc.). The fusion proteins were greater than 90% pure as determined by
scanning densitometry of Coomassie Blue R-250-stained
SDS-polyacrylamide gel electrophoresis gels.Determination of PKI IC
Purified recombinant C
Values
subunit (20) was
preincubated with the various PKIs and 0.2 mg/ml bovine serum albumin
(Boehringer Mannheim) in a phosphotransferase assay mixture for 10 min
at 30 °C essentially as described(21) .
[
-
P]ATP was obtained from ICN, and the
specific activity of ATP used in the phosphotransferase assays was 200
cpm/pmol. C
(0.3 nM) was used in assays containing murine
wild-type PKI
1, PKI
1(1-21)/
(22-75), and
PKI
1(A14G/A16T). However, wild-type PKI
,
PKI
(1-21)/
1(22-70),
PKI
(1-12)/
1(13-70), PKI
1(T8A/S12A), and
PKI
1(I7Y) have IC
values close to 0.3 nM and
therefore required a reduced (0.05 nM) C
concentration in
assays of inhibition. The assay was initiated by the addition of
Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) (Sigma) to a final concentration
of 30 µM, incubated for an additional 40 min, and then
terminated. Activities were determined in triplicate at each inhibitor
concentration, plotted, and fitted to a logistic function using
SigmaPlot software (Jandel Scientific). IC
values
(constants representing 50% inhibition of activity) were obtained from
at least three experiments for each PKI. MBP-
-galactosidase was
also subjected to an identical analysis for IC
determination. The control activity for C
in these
experiments was 4.0 units/mg.Determination of PKI K
To compare the inhibitory potency of the PKIs with previous
studies(6, 12, 13) , K
Values
values were determined at least three times for each inhibitor
using the Henderson method for tightly bound inhibitors(22) .
that are responsible for the majority of its
potent inhibitory activity(6, 12) . The two
pseudosubstrate site arginines, Arg
and Arg
,
interact with residues within the active site of C
subunit(5, 23) . The roles of the remaining critical
amino acids, Phe
, Arg
, and Ile
,
became clear upon the elucidation of the crystal structure of C subunit
complexed with synthetic PKI
(5-24) peptide (23) .
The aromatic side chain of Phe
is positioned along an
amphipathic
-helix to interact with Tyr
and
Phe
within a hydrophobic pocket in C subunit. Arg
forms part of a
-turn structure that positions its
guanidinium group to ion-pair with Glu
of C subunit.
Ile
is located within an extended portion of
PKI
(5-24) and interacts with a second hydrophobic pocket in
C subunit.Protein Sequence Comparison of Murine PKI
Amino acid alignment of murine PKI
and
PKI
1
and PKI
1
reveals only 22 identical amino acids between the two isoforms (Fig. 1). However, the extended inhibitory motif
(Phe-X-X-X-X-Arg-X-X-Arg-Arg-X-Ala-Ile/Leu)
is conserved with the exception of the substitution of leucine for
isoleucine at position 22 in PKI
1. Although PKI
1 retains
these critical amino acids, the detailed secondary structure of
PKI
1 protein or PKI
1-derived peptides has not been solved.
Therefore, PKI
1 interactions with C subunit can only be inferred
based upon C subunitPKI
data.
and PKI
1. The predicted amino acid
sequences of murine PKI
(top line) (17) and
PKI
1 (bottom line) (14) are shown. Boxed amino acids indicate identical residues between murine PKI
and PKI
1. Double arrows above the murine PKI
sequence localize structural domains present in the PKI
amino
terminus as determined by x-ray crystallographic studies using a
PKI
(5-24) peptide(23) . The first four PKI
amino acids (dotted line) were not included in the crystal
structure, but may also participate in an
-helix(25) .
Determination of K
cDNAs encoding murine PKI
Values for Murine PKI
and PKI
1
and PKI
1 were
PCR-amplified, sequenced, and cloned into pMALcRI for expression as
maltose binding protein (MBP) fusion proteins. A previous report has
demonstrated no effect of MBP on the inhibitory activity of
PKI(20) . To confirm this finding, murine MBP-PKI
and
MBP-PKI
1 were subjected to factor Xa cleavage to remove MBP. The
extent of MBP cleavage was monitored using SDS-polyacrylamide gel
electrophoresis, and the resulting free PKIs were tested for their
ability to inhibit C
phosphotransferase activity. With greater
than 95% of the MBP cleaved, there is no effect on the inhibitory
potency of PKI
or PKI
1 (data not shown). In addition, there
is no effect of an MBP-
-galactosidase fusion protein on inhibition
of C
activity at concentrations up to 80 µM (data not
shown).
and PKI
1 fusion
proteins were performed using the method of Henderson for high affinity
inhibitors (22) as described previously for
PKI(6, 7, 12) . Henderson analysis
demonstrates that murine PKI
1, like all PKIs examined to
date(13, 24) , is a competitive inhibitor of C
(Fig. 2). Replots of slopes (Fig. 2, inset) from
the Henderson analyses of both murine PKI
and PKI
1 versus Kemptide substrate (9) reveal a K
for
PKI
1 of 7.1 nM, reflecting a 32-fold decrease in
inhibitory potency compared to PKI
(K
= 0.22 nM). Since both murine isoforms possess
the optimal PKI inhibitory motif, these results suggest that
additional, nonconserved residues are responsible for the difference in K
between PKI
and PKI
1.
1 and PKI
K
determinations by Henderson analyses.
cAMP-dependent protein kinase activity was determined in the presence
or absence of murine wild-type PKI
1 or PKI
at the following
Kemptide concentrations: 90 µM (
), 60 µM (), 30 µM (
), and 5 µM (). Shown are the data for murine PKI
1 plotted in
accordance with Henderson (22) , where I
is the total inhibitory protein concentration and V
and V
are
the reaction velocities in the presence and absence of inhibitory
proteins, respectively. The inset shows replots of the slopes
from Henderson analyses versus Kemptide concentration for
murine PKI
1 () and PKI
(
). K
values obtained from the replots are listed in Fig. 4.
(hatched bar) and PKI
1 (solid bar) and the
lengths and isoform compositions of the chimeric PKIs used in this
study are shown on the left. All PKIs were expressed as fusion
proteins with maltose binding protein (MBP), although cleavage of MBP
from the fusion proteins did not affect the inhibitory activity of
murine PKI
and PKI
1. Inhibition constants of the wild-type
and chimeric PKIs are shown in the table to the right of the respective inhibitors. Inhibition constants are expressed
as the average of three or more experiments ± S.D. for each PKI. K
values for the chimeric PKIs were
determined via Henderson analysis as described for wild-type murine
PKI
and PKI
1.
Construction and Kinetic Analysis of PKI
Chimeras
To investigate the structural basis for the difference
in inhibitory activity between murine PKI
and PKI
1, chimeric
PKI cDNAs were generated using PCR mutagenesis. The cDNAs were
subcloned into the prokaryotic expression vector pMALcRI, ultimately
producing the following fusion proteins:
PKI
(1-21)/
1(22-70),
PKI
1(1-21)/
(22-75), PKI
1(A14G/A16T), and
PKI
(1-12)/
1(13-70).
, phosphotransferase
activity was assayed in the presence of 30 µM Kemptide
substrate and increasing concentrations of the chimeric PKIs (Fig. 3, A and B). Swapping the
carboxyl-terminal two-thirds of murine PKI
and PKI
1 causes
only minor changes in inhibitory activity (Fig. 3A).
PKI
(1-21)/
1(22-70) demonstrates a respective 1.3-
and 1.7-fold increase in IC
and K
relative to wild-type murine PKI
(Fig. 4).
PKI
1(1-21)/
(22-75) exhibits a respective 1.7- and
1.4-fold decrease in IC
and K
compared to wild-type murine PKI
1 (Fig. 4). These
modest effects suggest that nonconserved amino-terminal residues are
responsible for the majority of the isoform-specific difference in
inhibitory potency between murine PKI
and PKI
1.
activity was assayed in the presence of 30 µM Kemptide and increasing concentrations of murine wild-type
PKI
(), PKI
(1-21)/
1(22-70) (),
PKI
1 (), and PKI
1(1-21)/
(22-75)
(
) (A) or murine wild-type PKI
(),
PKI
(1-12)/
1(13-70) (), PKI
1 (),
and PKI
1(A14G/A16T) (
) (B). Activity was
determined as described under ``Materials and Methods'' and
expressed as the percentage of C
specific activity in the absence
of inhibitor. The curves were fitted using the average values
of triplicate assay points from representative experiments, and the error bars depict the standard deviation from the mean. The
experiments were performed at least three times for each inhibitor.
Average IC
values and measurements of error for each PKI
are reported in Fig. 4.
, Gly
and
Thr
, are located within a
-turn. Gly
, in
particular, is thought to be important for turn formation or for
providing flexibility for binding of Arg
(23) .
The importance of Arg
interactions in full length PKI
inhibition was investigated previously by mutating it to an alanine,
which resulted in a large decrease in inhibitory
activity(16, 20) . The remaining seven nonconserved
residues in the amino terminus participate in an amphipathic
-helix in PKI
. The high affinity binding of PKI
peptides
is largely due to hydrophobic interactions between C subunit and
residues along this helix, most notably
Phe
(16, 23) . Together, the
-turn
and
-helix regions serve to fix the amino terminus of PKI
,
optimizing pseudosubstrate site contacts with active site residues in C
subunit. To test whether either of these two PKI
structural
domains can account for the observed difference in K
between the murine PKI isoforms, two additional PKI chimeras were
examined.
1(A14G/A16T), which contains the exact amino acid
sequence corresponding to the
-turn of PKI
, does not
demonstrate enhanced inhibitory activity relative to wild-type murine
PKI
1 (Fig. 3B). In fact, this chimeric PKI has
IC
and K
values 1.5- and 1.1-fold
greater than wild-type murine PKI
1 (Fig. 4).
(1-12)/
1(13-70), replaces the
amino-terminal 12 amino acids of PKI
1 with the exact amino acid
sequence corresponding to the
-helical region of PKI
.
Surprisingly, this chimeric PKI exhibits inhibition constants identical
with wild-type murine PKI
(Fig. 3B and 4).
-helix in PKI
(23) , but the corresponding
secondary structure in PKI
1 is unknown. Nonconserved residues
within the first 12 amino acids of murine PKI
1 could decrease
inhibitory activity through at least three different mechanisms. First,
one or more of these residues may preclude the formation of an
amphipathic
-helix in PKI
1. Second, murine PKI
1 may
possess an amino-terminal
-helix whose amphipathicity differs from
PKI
. Third, murine PKI
1 could possess an amphipathic
-helix similar to PKI
; however, variations in individual
amino acid side chains may result in altered interactions with C
subunit residues. The first mechanism is less probable, since the
complete absence of an
-helix would be predicted to severely
disrupt interactions between Phe
and its hydrophobic
pocket in C subunit. The resulting decrease in inhibitory potency would
likely be more striking than the 32-fold difference observed between
murine PKI
and PKI
1, since direct mutation of Phe
caused a 1200-fold increase in the IC
of
PKI
(16) .Inhibition of C Subunit by Amino-terminal Site-directed
Mutants of Murine PKI
Comparison of the amino-terminal 12
amino acids of murine PKI
1
and PKI
1 reveal candidate residues
that may contribute to their K
difference (Fig. 5, A and B). Murine PKI
possesses
alanines at positions 8 and 12 which strongly favor
-helix
formation(25) . Murine PKI
1 has a threonine and a serine
at positions 8 and 12, respectively, which do not favor
-helical
structure. Therefore, these two amino acid differences may be
responsible for disrupting
-helix formation in murine PKI
1.
Alternatively, Thr
and Ser
may affect the
orientation of the hydrophobic surface of the amphipathic
-helix
to C subunit, thus altering Phe
contacts and decreasing
inhibitory activity.
and PKI
1. A, comparison of
the amino-terminal 12 amino acids of murine PKI
and PKI
1.
Residues in bold were further investigated for their role in
determining isoform-specific inhibitory activity. B, helical
wheel diagram of the amino terminus of PKI
. Residues in parentheses correspond to amino acid differences in murine
PKI
1. Specific amino acid positions examined in this study are
designated with a filled circle.
1(T8A/S12A) replaces
Thr
and Ser
in murine PKI
1 with the
alanine residues present in PKI
. C
phosphotransferase
inhibition assays reveal an IC
of 3.0 ± 1.0 nM for PKI
1(T8A/S12A), reflecting a 4.0-fold decrease relative
to wild-type murine PKI
1 (Fig. 6). The fact that these
mutations only partially improve the inhibitory potency of murine
PKI
1 suggests that Thr
and/or Ser
do not
dramatically inhibit
-helix formation. Hence, other nonconserved
amino-terminal residues would be predicted to account for the remaining
difference in the inhibition constants of murine PKI
and
PKI
1. A strong candidate is Tyr
, which is replaced by
an isoleucine in murine PKI
1. In a previous report utilizing
synthetic PKI
peptides, substitution at Tyr
caused a
greater increase in K
than substitution of other
nonconserved amino-terminal amino acids(12) . In addition,
chemical modification of Tyr
resulted in large decreases in
the inhibitory potency of PKI
(26) . Since Tyr
is located adjacent to Phe
in the amino-terminal
-helix of PKI
(Fig. 5B), it was speculated to
interact with the hydrophobic pocket that accommodates
Phe
(23) .
by murine PKI
1
amino-terminal mutants. Recombinant C
was assayed for
phosphotransferase activity in the presence of 30 µM Kemptide and increasing concentrations of murine wild-type
PKI
(), PKI
1 (), PKI
1(T8A/S12A) (), and
PKI
1(I7Y) (
). Activity was determined as described under
``Materials and Methods'' and expressed as the percentage of
C
specific activity in the absence of inhibitor. The curves were fitted using the average values of triplicate assay points
from representative experiments, and the error bars depict the
standard deviation from the mean. The experiments were performed at
least three times for each inhibitor. Average IC
values
± S.D. for the PKI mutants are discussed in the
text.
of murine PKI
1 to tyrosine yields
an IC
of 0.95 ± 0.45 nM, which constitutes
a 13-fold increase in inhibitory activity (Fig. 6). Since
isoleucines more strongly facilitate
-helical structure than
tyrosines(25) , PKI
1(I7Y) is less likely to form an
amino-terminal
-helix than wild-type PKI
1. Therefore, it
would seem that specific interactions between the phenolic group of
Tyr
and C subunit residues are responsible for the enhanced
inhibitory potency of murine PKI
. This tyrosine residue was
implicated as a potential PKI
regulatory site in studies of in
vitro phosphorylation by the epidermal growth factor receptor (27) . In these studies, phosphorylation at Tyr
increased the IC
of PKI
by approximately 9-fold
relative to dephosphorylated PKI
, suggesting that interactions
between Tyr
and C subunit are important in C
subunitPKI complex formation.
, located in an amino-terminal region
corresponding to the
-helix of PKI
, can result in distinct
PKI inhibitory properties. Different C subunitPKI interactions
may in turn lead to physiological changes in PKI function. Although a
specific role for PKI has not been unequivocally assigned, recent
studies by Fantozzi et al.(28) demonstrated that
PKI
can enhance C subunit export from the nucleus. Additional
reports showed that full length PKI
or a PKI
peptide could
preferentially inhibit basal transcriptional activity of some
cAMP-regulated DNA response elements(29, 30) .
Therefore, in an unstimulated cell with resting levels of cAMP, the
difference in K
between murine PKI
and
PKI
1 could play a significant role in determining either the
amount of C subunit present in the nucleus or the rate at which C
subunit activates specific transcription factors. In particular,
differential expression of PKI isoforms during development offers an
intriguing mechanism to regulate the basal level of C subunit
phosphotransferase activity(15) . While the exact number of PKI
isoforms is not known, numerous chromatographically separable forms of
PKI have been observed in testis (13, 31) . Of
interest, one recently cloned murine PKI
1 isoform, PKI
2,
possesses a unique amino terminus due to alternative splicing (14) . Although the inhibitory potency of PKI
2 has not yet
been examined, work here demonstrates that the existence of distinct
amino-terminal amino acid sequences in multiple PKI isoforms may
provide for further diversity in the regulation of cAMP-dependent
protein kinase function.
)
We thank Eric Baude and Vincent Massey for helpful
discussions and Adele Barres for assistance in the preparation of this
manuscript. We extend additional thanks to Eric Baude for providing
recombinant C
.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. K. Taylor, R. Ahmed, M. Begley, and M. D. Uhler Autoinhibition and Isoform-specific Dominant Negative Inhibition of the Type II cGMP-dependent Protein Kinase J. Biol. Chem., September 27, 2002; 277(40): 37242 - 37253. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Collins and M. D. Uhler Cyclic AMP- and Cyclic GMP-dependent Protein Kinases Differ in Their Regulation of Cyclic AMP Response Element-dependent Gene Transcription J. Biol. Chem., March 26, 1999; 274(13): 8391 - 8404. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Collins and M. D. Uhler Characterization of PKIgamma , a Novel Isoform of the Protein Kinase Inhibitor of cAMP-dependent Protein Kinase J. Biol. Chem., July 18, 1997; 272(29): 18169 - 18178. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Gamm, E. J. Baude, and M. D. Uhler The Major Catalytic Subunit Isoforms of cAMP-dependent Protein Kinase Have Distinct Biochemical Properties in Vitro and in Vivo J. Biol. Chem., June 28, 1996; 271(26): 15736 - 15742. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Gamm, S. H. Francis, T. P. Angelotti, J. D. Corbin, and M. D. Uhler The Type II Isoform of cGMP-dependent Protein Kinase Is Dimeric and Possesses Regulatory and Catalytic Properties Distinct from the Type I Isoforms J. Biol. Chem., November 10, 1995; 270(45): 27380 - 27388. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Taylor and M. D. Uhler The Amino-terminal Cyclic Nucleotide Binding Site of the Type II cGMP-dependent Protein Kinase Is Essential for Full Cyclic Nucleotide-dependent Activation J. Biol. Chem., September 1, 2000; 275(36): 28053 - 28062. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lum, Z. Hao, D. Gayle, P. Kumar, C. E. Patterson, and M. D. Uhler Vascular endothelial cells express isoforms of protein kinase A inhibitor Am J Physiol Cell Physiol, January 1, 2002; 282(1): C59 - C66. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||