JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ray, A.
Right arrow Articles by Hannink, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ray, A.
Right arrow Articles by Hannink, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7365-7374
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Concerted Participation of NF-B and C/EBP Heteromer in Lipopolysaccharide Induction of Serum Amyloid A Gene Expression in Liver (*)

(Received for publication, November 30, 1994; and in revised form, January 19, 1995)

Alpana Ray (1),  Mark Hannink (2),  Bimal K. Ray (1)(§)

From the  (1)Departments of Veterinary Microbiology and (2)Biochemistry, University of Missouri, Columbia, Missouri 65211

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The promoter region of the rabbit serum amyloid A (SAA) gene contains two adjacent C/EBP and one NF-kappaB binding element. Involvement of these elements in SAA gene induction, following lipopolysaccharide (LPS) stimulation of the liver, has been studied by investigating LPS-activated transcription factors and their interaction with the promoter elements of the SAA gene. Appearance of complexes in the electrophoretic mobility shift assay has indicated that DNA-binding proteins that interact with the NF-kappaB element of the SAA promoter are induced in the LPS-treated rabbit liver. Presence of RelA (p65 subunit of NF-kappaB) in these complexes was demonstrated by the ability of RelA-specific antisera to supershift the DNA-protein complexes. LPS also induced several members of the C/EBP family of transcription factors, which interacted with the C/EBP motifs of the SAA promoter. Activated C/EBP and RelA form a RelAbulletC/EBP heteromeric complex that associates with varying affinity to NF-kappaB and C/EBP elements of the SAA gene. Transfection assays using both transcription factor genes have demonstrated that the heteromeric complex of NF-kappaB and C/EBP is a much more potent transactivator of SAA expression than each transcription factor alone. The heteromeric complex efficiently promotes transcription from both NF-kappaB and C/EBP sites.

INTRODUCTION

Serum amyloid A is the precursor of amyloid A (AA) (^1)protein, one of the chief constituents of amyloid fibrils found in secondary and experimental amyloidosis (Husebekk et al., 1985). The structure of protein AA is identical to the N terminus of SAA (Anders et al., 1977), and a precursor-product relationship between SAA and AA has been documented (Husebekk et al., 1985). SAA is also a member of a group of acute phase proteins whose synthesis is highly induced under different inflammatory conditions such as tissue injury or infection (Kushner, 1982). Cytokines such as interleukin-1, interleukin-6, and tumor necrosis factor-alpha increase the synthesis of SAA in cultured cells via transcriptional induction (Ganapathi et al., 1991). Studies have shown that this protein is coded by multiple genes in human, mouse, rabbit, and rat. All three murine SAA genes are induced in the liver, and each gene accounts for approximately one-third of the total SAA mRNA (Lowell et al., 1986a). Analyses of the promoter region of the human, rat, and mouse SAA gene have shown that two of the protein-coding genes, termed SAA1 and SAA2, contain binding elements for both C/EBP and NF-kappaB transcription factors (Edbrooke et al., 1989; Li and Liao, 1991). The third murine gene, SAA3, contains the binding site for C/EBP in the upstream regulatory region (Huang and Liao, 1994; Lowell et al., 1986a). Studies on a rabbit SAA gene indicated the presence of both C/EBP and NF-kappaB elements in the 5`-proximal promoter region (Ray and Ray, 1991, 1993a, 1993b). Many acute-phase stimuli induce transcription of the SAA gene in liver, but induction mechanisms do not always follow the same route. Turpentine, an inducer of rabbit SAA gene expression, activates only C/EBP transcription factors (Ray and Ray, 1993a), while LPS induces both C/EBP and NF-kappaB-like factors (Alam et al., 1992; Ray and Ray, 1993b, 1994b). Activation of the beta and isoforms of C/EBP and their interaction with the two C/EBP binding sites are essential for turpentine-mediated acute-phase induction of the rabbit SAA gene (Ray and Ray, 1994a).

Recent studies on eukaryotic gene regulation show that the transcriptional control region often contains multiple binding sites for the same or several different transcription factors and a combined effect of these factors is important for the overall transcriptional activation. Other genes, such as those encoding IL-6, IL-8, and angiotensinogen proteins, also have adjacent or overlapping binding elements for NF-kappaB and C/EBP. NF-kappaB and C/EBP cooperate in the regulation of IL-6 and IL-8 (Kunsch et al., 1994; Matsusaka et al., 1993; Stein and Baldwin, 1993) but are antagonistic in angiotensinogen gene regulation (Ron et al., 1990). NF-kappaB is a pleiotropic inducible transcription factor initially identified as a nuclear factor that binds to the kappaB enhancer motif of immunoglobulin kappa light chains (Sen and Baltimore, 1986). The NF-kappaB family includes NFKB1 (p50), NFKB2 (p52), RelA (p65), RelB, v-Rel, and c-Rel proteins. NF-kappaB proteins regulate transcription of a wide variety of genes, including those encoding cytokines, viral proteins and immunoglobulin, through the kappaB binding element present at their promoter regions (Grilli et al., 1993; Grimm and Baeuerle, 1993). C/EBP is a family of transcription factors termed bZIP proteins (Vinson et al., 1989). They contain a leucine zipper domain linked to a DNA binding basic region, both located in the C-terminal region. C/EBP-alpha (Landschulz et al., 1988) was originally identified and shown to be involved in the transcriptional activation of adipose-specific genes during differentiation of 3T3-L1 preadipocytes (Christy et al., 1989; Friedman et al., 1989). C/EBP-beta (Akira et al., 1990; Cao et al., 1991; Poli et al., 1990) and C/EBP- (Cao et al., 1991; Kinoshita et al., 1992; William et al., 1991) are induced in response to IL-6 and involved in IL-6-mediated signal transduction. Members of the C/EBP family are capable of dimerization through the leucine zipper domain, and both C/EBP-beta (Nakajima et al., 1993; Wegner et al., 1992) and C/EBP- (Ray and Ray, 1994a) are activated by phosphorylation. Since LPS-mediated acute-phase inflammation activates both C/EBP and NF-kappaB transcription factors in the liver, it is likely that SAA gene transcription will be influenced by the concerted action of these two factors. Analyses of various deletion promoter constructs in transient transfection assays indicated that a potential cooperative interaction between C/EBP and NF-kappaB is involved in the regulation of expression of rat SAA1 and human SAA2 genes (Betts et al., 1993; Li and Liao, 1991, 1992), although identity of the members of the C/EBP and kappaB/Rel family was not well documented. Furthermore, activation of any C/EBP-like factors was not seen in conditioned medium-stimulated Hep3B cells (Li and Liao, 1991), and no cross-coupling or physical interaction was demonstrated between the two factors. Thus, the nature of cooperativity between these two elements of SAA gene in the hepatic expression following acute phase induction remained unclear. In the present study, we characterized members of the NF-kappaB and C/EBP family that are activated in the liver following LPS-mediated inflammatory condition and investigated their interaction with SAA promoter for its transcriptional activation under acute phase condition. We also showed, by in vitro DNA-protein binding assays, evidence of heteromeric complex of C/EBP and NF-kappaB and its interaction with both C/EBP and NF-kappaB elements. In vivo cotransfection assays provided evidence that the heteromeric complex is a stronger activator of SAA gene transcription than homomeric complexes of either C/EBP or NF-kappaB.

MATERIALS AND METHODS

SAA Probes and Plasmids

The SAA wild-type (wt) oligonucleotide probe contains sequences from -193 to -79 bp of the rabbit SAA promoter (Ray and Ray, 1993a). This region contains two adjacent C/EBP binding elements and a NF-kappaB binding element. The SAA wtC/EBP mtNF-kappaB oligonucleotide contains sequence from -193 to -79 where the NF-kappaB binding site has been mutated by converting the wt sequence GGGGCTTTCC, located between positions -93 and -84, to GCTCCTTTCC. The SAA mtC/EBPwtNF-kappaB oligonucleotide also includes sequence between -193 and -79, where the region containing two C/EBP sites is mutated by converting wt sequence between -193 and -136 to GGCCTTCATAGACTACACAACTAGGCACGGGATCTGCGCATCACGCAACCCTGTATGT. Underlined nucleotides represent mutated bases. The reporter gene construct SAA wtC/EBPwtNF-kappaB-CAT contains sequences from -193 to -79 of rabbit SAA promoter ligated to the pBLCAT2 vector (Luckow and Schutz, 1987). The SAA wtC/EBPmtNF-kappaB and SAA mtC/EBPwtNF-kappaB oligonucleotides were also separately ligated to the pBLCAT2 vector to prepare two mutant SAA reporter genes. Two other reporter plasmids, SAA wtNF-kappaB-CAT and SAA mtNF-kappaB-CAT, were prepared by separately ligating wild-type (GGGGCTTTCC) and mutated (GCTCCTTTCC) SAA NF-kappaB sequences to the pBLCAT2 vector. All constructs were verified by DNA sequence analysis to determine their authenticity and orientation. The MSV (murine sarcoma virus)-C/EBP- plasmid was a generous gift of S. L. McKnight (Cao et al., 1991). CMV (cytomegalovirus)-RelA contained cDNA encoding human NF-kappaB p65 subcloned into pCMV4 vector. CMV-NFKB1 contained a BglII-XbaI fragment of cDNA encoding human p105 ter. 1 (a truncated derivative of p105, the precursor of NFKB1) cloned into pCMV4. CMV-v-Rel contained the viral rel oncogene cloned into pCMV4.

Cell Cultures and Transfection Assays

Liver cells (BNL CL.2; obtained from the American Type Culture Collection) were grown in Dulbecco's modified Eagle's medium (DMEM) containing high glucose (4.5 g/liter) supplemented with 10% fetal calf serum. Cells were seeded at a density of 10^4 cells/plate, and transfections were carried out using the calcium phosphate method (Graham and Van der Eb, 1973). Ten µg of reporter plasmid was used in each transfection assay, with 2 µg of pSV-beta-gal plasmid (Promega) as a control for measuring transfection efficiency and carrier plasmid DNA so that the total amount of DNA in each transfection assay remained constant. In cotransfection experiments, various amounts of MSV-C/EBP-, CMV-RelA (p65), CMV-NFKB1 (p50), and CMV-v-Rel plasmid DNAs were added (indicated in figure legend) together with reporter plasmid DNAs. Cells were washed with phosphate-buffered saline after overnight incubation with calcium phosphate DNA mixture, shocked for 1 min with 15% glycerol in phosphate-buffered saline, and refed with fresh medium. Cells were harvested 24 h later, and cell extracts were prepared for measurement of beta-galactosidase and chloramphenicol acetyltransferase (CAT) activities as described previously (Ray and Ray, 1993a). All transfection experiments were performed in triplicate.

Oligonucleotides

The oligonucleotides, used as competitor for the C/EBP and NF-kappaB binding sites, consisted of the self-complementary, dyad-symmetric sequence listed below.

For self-annealing, the oligonucleotides were heated to 95 °C for 2 min in 50 mM Tris, pH 7.4, 60 mM NaCl, 1 mM EDTA and allowed to cool slowly to room temperature in 2-3 h.

Nuclear Extracts and Electromobility Shift Assays (EMSA)

The acute-phase condition in New Zealand White male rabbits was elicited by a single peritoneal injection of 3 mg of bacterial lipopolysaccharide (Sigma)/kg of body weight. Animals were sacrificed at different time points after injection, and livers were collected. Nuclear extracts were prepared from normal and induced rabbit livers essentially following the method of Dignam et al.(1983) with minor modifications as described previously (Ray et al., 1993). Protein concentrations were measured by the method of Bradford(1976). DNA binding assays were performed following a standard protocol described earlier (Ray and Ray, 1994a) with various P-labeled double-stranded DNA probes described in the text and figure legends. The labeling of DNA was performed by filling in the overhangs at the termini with Klenow fragment of DNA polymerase and incorporating [alpha-P]dATP. In some binding assays, competitor oligonucleotides were included in the reaction mixture. For antibody interaction studies, antisera specific to C/EBP-alpha, C/EBP-beta, and C/EBP- (a gift of S. L. McKnight and Santa Cruz Biotechnology), RelA, NFKB1, and v-Rel proteins, were added to the reaction during a 30-min preincubation on ice. All antisera were generated in rabbits against purified transcription factors or specific peptides. Nonspecific rabbit antiserum was also used in some binding assays to determine specificity of the antisera. A C/EBP--specific peptide and a nonspecific peptide were obtained from Santa Cruz Biotechnology. Purified NFKB1 (p50) was obtained from Promega Corp. RelA (p65) was prepared by pCMV-RelA transfection of COS-7 cells. Transfected cells were harvested, lysed by a repeated freeze-thaw cycle, and cell-free lysate dialyzed for 5 h in Buffer D (20 mM HEPES, pH 7.9, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 20% glycerol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mg/ml benzamidine). v-Rel factor used in the DNA binding assays was prepared from the nuclei of pCMV-v-Rel-transfected CM103 cells. Ammonium sulfate-fractionated nuclear extract, prepared from turpentine-induced rabbit liver, rich in C/EBP (Ray and Ray, 1993a, 1994a), was used as a source of C/EBP transcription factors in binding assay. This nuclear extract lacks NF-kappaB protein as determined by both DNA binding and Western immunoblot assays. C/EBP concentration in the fractionated extract was estimated at 0.1-0.5 µg/mg of total protein in the extract. Estimation was based on the DNA binding and Western immunoblot assays of the extract. Various quantities (described in figure legends) of NFKB1, RelA, v-Rel, and C/EBP were used in the DNA binding assays.

RESULTS

Kinetics of Activation of NF-kappaB and C/EBP Transcription Factors That Regulate SAA Gene Induction

Previous analysis of rabbit SAA gene expression revealed the presence of two regulatory regions that were responsive to cytokines and LPS (Ray and Ray, 1993a, 1993b). One of these regions, spanning nucleotides from position -193 to -136, contained two adjacent C/EBP binding elements and the second region, spanning -112 to -79, contained one NF-kappaB binding site. To determine the kinetics of activation of NF-kappaB and C/EBP family of transcription factors and their participation in the regulation of the SAA gene following LPS-induction, we have investigated the interaction of these two families of transcription factors with the rabbit SAA promoter elements. Nuclear extracts were prepared from the liver tissue of rabbits treated with LPS for various lengths of time and analyzed by EMSA (Fig. 1) using NF-kappaB-specific (-112 to -79) and C/EBP-specific (-193 to -136) regions of rabbit SAA promoter (Ray and Ray, 1993a) as probes. Two complexes, designated as complex B and C, were detected (Fig. 1A, lane3) within 1 h of LPS induction when NF-kappaB-specific DNA was used as probe. Using LPS 3-h nuclear extract, one additional complex, called complex A, and an increased level of complex B were detected (lane4). However, the level of both complexes A and B declined at 12 h and was barely noticeable 24 h after LPS injection. No appreciable change in the level of complex C was seen. These results indicated that within 1 h of induction, NF-kappaB-like transcription factors appeared in the liver nucleus, and their level declined within 24 h after LPS treatment. Using the C/EBP binding elements as probe, multiple complexes designated as complexes 1, 2, and 3a-c, were detected (Fig. 1B). Unique DNA-protein complexes (complexes 1 and 2) formed by the inducible isoforms of C/EBP appeared about 3 h post-LPS injection (Fig. 1B, lane4`). The level of these inducible factors also declined within 24 h. Interestingly, simultaneous presence of C/EBP and NF-kappaB proteins, interacting with both elements at about 3 h after LPS treatment, corresponds to the maximal transcriptional activity of SAA gene as determined earlier by nuclear run-off transcriptional analysis (Lowell et al., 1986b).

Figure 1: Induction kinetics of nuclear factors in LPS-treated rabbit liver that interact with the promoter elements of SAA gene. EMSAs were performed with P-labeled SAA promoter DNA fragments containing NF-kappaB elements (-112 to -79) and C/EBP element (-193 to -136) and shown in panels A and B, respectively. Nuclear extracts (10 µg of protein) from the liver tissue of uninduced and LPS-induced rabbits were incubated with the P-labeled NF-kappaB probe (lanes 2-6) and C/EBP probe (lanes 2`-6`). The resulting DNA-protein complexes were fractionated in a 6% native polyacrylamide gel. Lanes 1 and 1` contained probe only.


Characterization of the Activated NF-kappaB Proteins

We used antibodies specific to the several members of NF-kappaB family to determine which members of NF-kappaB family are activated in LPS-treated rabbit liver. EMSAs were performed using the NF-kappaB region of SAA promoter (-112/-79) as a probe (Fig. 2A). Antibody specific to RelA (p65) supershifted complexes A and B, formed by LPS 3-h nuclear extract (lanes3 and 4), suggesting activation of RelA in LPS-treated nuclear extract and its interaction with the SAA promoter. No change in the level of complexes A, B, and C was observed when anti-NFKB1 (p50) and anti-v-Rel antibodies were used (lanes 5-7). The identity of complex C could not be revealed in this assay. Its resistance to inhibition by a competitor NF-kappaB oligonucleotide (data not shown) indicated that it is unrelated to the NF-kappaB factors and probably is a nonspecific DNA-protein complex.

Figure 2: Characterization of the activated NF-kappaB nuclear factors in LPS-treated rabbit liver. A, identification of RelA and its interaction with NF-kappaB element of SAA promoter. EMSAs were performed with P-labeled SAA promoter DNA (-112 to -79) and nuclear extract (10 µg of protein) from the rabbit liver treated with LPS 3-h, which has the highest level of factors capable of interacting with this DNA probe. DNA binding assays were performed in the presence of antisera to RelA, NFKB1, and v-Rel (1 µl of 1:10 dilution of each). For RelA and NFKB1, two different antibody preparations, one raised against the N-terminal end of the protein (lanes3 and 5) and the other raised against the C-terminal end of the proteins (lanes4 and 6) were used. Lane1 contained probe incubated in the absence of any nuclear factors. Lane2 contained LPS 3-h nuclear extract depicting the DNA-protein complexes A, B, and C. In addition to nuclear extract, antiserum to either RelA (lanes3 and 4), NFKB1 (lanes5 and 6), or v-Rel (lane7) was also included in some binding reactions. Lane8 contains a nonspecific serum. Supershifted complexes in lanes3 and 4 are indicated by an arrow. B, binding of NFKB1 and v-Rel to the SAA promoter. Radiolabeled DNA probe containing the NF-kappaB element of rabbit SAA gene (-112 to -79) was incubated with recombinant NFKB1 (lanes1 and 3) or v-Rel protein (lanes2 and 4) in the absence (lanes1 and 2) or in the presence (lanes3 and 4) of a competitor oligonucleotide containing NF-kappaB core binding element whose sequence is described under ``Materials and Methods.'' Lane5 contained probe only. The complexes were analyzed in a 6% native polyacrylamide gel. C, transactivation of SAA-CAT reporter plasmids containing NF-kappaB element by the NF-kappaB expression plasmids. Reporter plasmids SAA wtNF-kappaB-CAT (designated by box, , and ) and SAA mtNF-kappaB-CAT (designated by circle, up triangle, and +) (10 µg of each) were transfected into BNL CL.2 cells along with increasing concentrations of pCMV-NFKB1 ( and up triangle), pCMV-RelA (box and circle), or pCMV-v-Rel plasmids ( and +). As a control, SAA wtNF-kappaB-CAT was cotransfected with pCMV4 vector plasmid (bullet). CAT activity was measured as described under ``Materials and Methods.'' The results represent an average of three independent transfection assays.


SAA Promoter Can Interact with Different Members of the NF-kappaB Family

The antibody supershifting experiments described above (Fig. 2A) showed no interaction of NFKB1 (p50) to the SAA NF-kappaB element. This could be due to the relative low abundance of this factor in the LPS-induced nuclear extracts or to the lower binding specificity of this factor for the NF-kappaB motif of SAA promoter. Studies on optimum binding sequence of different subunits of NF-kappaB revealed that all members of the NF-kappaB family do not interact equally with all NF-kappaB element (Kunsch et al., 1992). To determine whether such a situation also exists in the case of rabbit SAA gene, purified NFKB1 and v-Rel (a viral homolog of p50) proteins were used in the EMSAs. Results, shown in Fig. 2B, demonstrate that both of these proteins can interact with the SAA NF-kappaB binding element. Addition of molar excess of competitor NF-kappaB oligonucleotide inhibited formation of these DNA-protein complexes. These results indicate that NF-kappaB site of SAA promoter is capable of interacting nonselectively with at least three members of the NF-kappaB family.

To examine whether these proteins can activate transcription from the SAA-NF-kappaB element, transient transfections were performed using BNL CL.2 liver cells. One copy of the SAA promoter containing NF-kappaB element was ligated to the pBLCAT2 reporter gene containing minimal tk promoter (Luckow and Schutz, 1987) and cotransfected along with the expression plasmids encoding NFKB1, RelA, and v-Rel (Fig. 2C). These members of the NF-kappaB family activated the transcription of the reporter gene carrying NF-kappaB motif of SAA promoter in a dose-dependent manner.

Characterization of the Activated C/EBPs

We used antibodies specific to the different members of the C/EBP family to determine which members of the C/EBP family are activated during LPS induction. EMSAs performed using C/EBP binding elements (-193/-136) as a probe and uninduced liver nuclear extract (Fig. 3) demonstrated the presence of three specific DNA-protein complexes, termed 3a, 3b, and 3c. Complex 3a was inhibited by both C/EBP-beta- and C/EBP-alpha-specific antibodies (lanes3-6), while complexes 3b and 3c were inhibited by C/EBP-alpha-specific antibody (lanes3 and 4). Partly supershifted complexes were also detected in some lanes. No change in the intensities of these complexes was seen when anti-C/EBP- was added in the binding assay (lanes7 and 8), demonstrating absence of this isoform in the uninduced liver cells. However, when LPS 3-h nuclear extract was used as the protein source, two additional inducible DNA-protein complexes, termed 1 and 2, were detected (lane9). Formation of these two complexes was inhibited by C/EBP- antibody (lanes14 and 15), indicating the appearance of C/EBP- in the LPS-induced liver. The intensities of complexes 1 and 2 were considerably reduced in LPS 24-h nuclear extract (lane16) but complexes 3a-3c, formed by C/EBP-alpha and C/EBP-beta, were detected in the 24-h LPS-induced nuclear extract (lanes 16-22). This result, in conjunction with that of Fig. 1B, suggests that the C/EBP- isoform which is absent in the uninduced liver starts appearing at about 3 h following LPS induction and its level subsequently drops to the uninduced level within 24 h after the onset of inflammation. Also noticeable is the absence of complex 3c formed by C/EBP-alpha in lanes9-15, but detected in both uninduced and 24-h induced liver nuclear extracts (compare lanes2, 9, and 16). The level of complex 3b was reduced within 3 h of induction (lane9) but increased to the level of uninduced liver 24 h after LPS treatment (lane16). This is in agreement with an earlier observation that the level of C/EBP-alpha drops following the onset of inflammation and returns to the high basal level within 24 h (Alam et al., 1992). These results indicate that LPS-mediated inflammation leads to an appreciable induction of C/EBP- in the liver tissue.

Figure 3: Identification of C/EBP isoforms induced by LPS and their interaction with the C/EBP element of SAA promoter. EMSAs were performed with P-labeled SAA promoter DNA (-193 to -136) and nuclear extracts (10 µg of protein) prepared from the liver tissues of uninduced (lanes 2-8), LPS 3-h (lanes 9-15), and LPS 24-h (lanes16-22) induced rabbits. DNA binding assays were performed in the presence of two concentrations (0.5 and 1 µl of a 1:10 dilution) of antibody for three C/EBP isoforms. No cross-reactivity between the antisera was noticed. Lane1 contained probe only, and lanes 2, 9, and 16 contained nuclear extract without any antisera. Migration positions of DNA-protein complexes 1, 2, and 3a-3c are indicated. Arrowheads indicate the positions of some supershifted complexes.


Interaction of C/EBP and NF-kappaB Transcription Factors with the SAA Promoter

Coexistence of RelA and several members of C/EBP family of transcription factors in the rabbit liver nucleus following LPS induction prompted us to evaluate how RelA and C/EBP might interact with their cognate binding sites in SAA gene. We thus studied in vitro interaction of these transcription factors using a fractionated system where both of these factors could be provided in different combinations to test their binding abilities and relative affinities for the SAA promoter. EMSAs were performed with a RelA preparation obtained from CMV-RelA-transfected COS-7 cells and a C/EBP preparation obtained from the turpentine-induced rabbit liver nuclear extract, which lacks any NF-kappaB protein but contains C/EBP-alpha, -beta, and - isoforms (Ray and Ray, 1994a). As probes in the binding reactions, we used three forms of SAA promoter constructs containing either wild-type (wt) or mutant (mt) binding motifs for C/EBP and NF-kappaB. These probes were designated as SAA wtC/EBPwtNF-kappaB, SAA wtC/EBPmtNF-kappaB, and SAA mtC/EBPwtNF-kappaB. Addition of either RelA (lane 1) or C/EBP factors (lane2) resulted in the formation of respective DNA-protein complexes when SAA wtC/EBPwtNF-kappaB DNA was used as probe (Fig. 4A). The fastest moving DNA-protein complex was composed of both C/EBP-alpha and beta isoforms, and the two more slowly migrating complexes were formed by C/EBP- isoform (lane2). Characterization of these complexes was made in a previous study (Ray and Ray, 1994a). Additional slower moving DNA-protein complexes were detected when both C/EBP and NF-kappaB proteins were added (Fig. 4A, lane3). These complexes were competed by both NF-kappaB- and C/EBP-specific oligonucleotides (lanes4 and 5). These data indicated that these slower migrating complexes were formed by the interaction of both transcription factors with SAA promoter. In order to determine if these complexes could result from the formation of a heteromer of NF-kappaB and C/EBP, we used DNA fragments where one of these two sites was mutated by multiple oligonucleotide substitution. We observed binding of RelA (lane7) and no interaction of C/EBP (lane8) when SAA mtC/EBPwtNF-kappaB DNA was used as a probe (Fig. 4B). The absence of C/EBP-specific DNA-protein complexes (lane8) indicated that the C/EBP binding sites were adequately mutated, preventing interaction of C/EBP factors to these sites. However, when both factors were included in the binding assay, we detected slower migrating DNA-protein complexes (lane9) in addition to a RelAbulletDNA complex. Addition of NF-kappaB oligonucleotide as a competitor inhibited formation of both complexes (lane10) but C/EBP oligonucleotide (lane11) inhibited only the the more slowly migrating complex. These results indicated that the faster moving complex is composed of only NF-kappaB and the slower moving one contains both C/EBP and NF-kappaB. Addition of excess competitor C/EBP oligonucleotide sequestered available C/EBP factors in the reaction mixture and thereby prevented interaction of C/EBP with the NF-kappaB probe through protein-protein interaction. Inhibition of the NF-kappaBbulletC/EBP heteromeric complex by C/EBP oligonucleotide appeared to be less efficient as compared to that by the NF-kappaB-specific oligonucleotide (compare lanes10 and 11; further discussed under ``Results'' concerning Fig. 5and Fig. 6). Similar results were seen when SAA wtC/EBP mtNF-kappaB DNA (Fig. 4C) was used as probe. C/EBP formed DNA-protein complexes (lane14), but RelA did not interact with the probe (lane13), indicating the adequacy of the mutated NF-kappaB site. Combination of RelA and C/EBP resulted in the appearance of a slower migrating complex (lane15), which was inhibited by NF-kappaB oligonucleotide (lane16), indicating that this complex was formed due to an interaction of RelAbulletC/EBP heteromer with the C/EBP binding site of this probe. C/EBP-specific competitor oligonucleotide inhibited most of the DNA-protein complexes with some residual complex (lane17). Higher concentrations of competitor C/EBP oligonucleotide completely inhibited this complex formation (not shown). When both C/EBP and NF-kappaB competitor oligonucleotides were present, both C/EBP- and RelAbulletC/EBP-specific complex formation was inhibited (lane18). We have detected no binding of either of these two factors when a double mutant DNA probe containing impaired NF-kappaB and C/EBP binding elements was used (data not shown). These results provided evidence of heteromeric RelAbulletC/EBP complexes that interact with both C/EBP and NF-kappaB elements.

Figure 4: Binding of NF-kappaB and C/EBP to the SAA promoter. Radiolabeled SAA probes (5 pmol/assay) containing wtC/EBPwtNF-kappaB (panelA), mtC/EBPwtNF-kappaB (panelB), or wtC/EBPmtNF-kappaB (panelC) sequences were incubated with either NF-kappaB(RelA) prepared from pCMV-RelA-transfected COS-7 cells (3 µg of protein preparation) or C/EBP prepared from nuclear extract of turpentine-treated rabbit liver (4 µg of protein preparation) or both NF-kappaB and C/EBP as indicated. As competitors, oligonucleotides (50 pmol/assay) containing binding elements for NF-kappaB and C/EBP (sequences described under ``Materials and Methods'') were used in some binding assays as indicated.


Figure 5: Effect of increasing concentrations of C/EBP and NF-kappaB(RelA) on the binding of homo- and heteromeric complexes of the two transcription factors. EMSAs were performed using either mtC/EBPwtNF-kappaB (panelA) or wtC/EBPmtNF-kappaB (panelB) probe. A, a constant amount of RelA (3 µg of the protein preparation) was incubated with increasing concentrations of C/EBP (0, 2, 4, and 6 µg of C/EBP preparation) (lanes 1-4), and the resulting complexes were resolved in a 6% native polyacrylamide gel. B, a constant amount of C/EBP (5 µg of the protein preparation) was incubated with increasing concentrations of RelA (0, 1, 2, and 3 µg of RelA preparation) (lanes5-8). The products were fractionated in a 6% native polyacrylamide gel. Migration positions of NF-kappaB(RelA), C/EBP, and C/EBPbulletNF-kappaB(RelA) are indicated.


Figure 6: Relative affinity of C/EBPbulletNF-kappaB heteromers to interact with the NF-kappaB binding site. Panel A, radiolabeled wtNF-kappaBmtC/EBP probe (5 pmol/assay) was incubated with a mixture of NF-kappaB(RelA) (3 µg of protein) and C/EBP (6 µg of protein) preparations in the absence (lanes 2, 9, and 10) or in the presence of increasing concentrations of competitor NF-kappaB oligonucleotide (10, 25, and 50 pmol in lanes3, 4 ,and 5, respectively) or C/EBP oligonucleotide (10, 25, and 50 pmol in lanes6, 7, and 8, respectively). Panel B, prior to the addition of the probe, protein preparations were preincubated with antisera to C/EBP (lane9) or a nonspecific serum (lane10). The complexes were resolved in a 6% native polyacrylamide gel.


Although the results above (Fig. 4, lane8 in panelB and lane13 in panel C) showed that the mutated NF-kappaB and C/EBP sites used in these probes prevented binding of the corresponding factors to the respective mutated sites, it can still be argued that the slower migrating complex (the presumable heteromer seen in Fig. 4, lanes9 and 15) may arise due to some cooperative binding of NF-kappaB to its mutated site when C/EBP is present and vice versa. To rule out such a possibility, we performed similar experiments, as those in Fig. 4(B and C), but using probes that contained only wtNF-kappaB or wtC/EBP binding elements of SAA promoter. Appearance of identical slower migrating complexes, such as those seen in Fig. 4(lanes9 and 15), when both C/EBP and NF-kappaB were added (data not shown) asserted that indeed these complexes are composed of a heteromer of NF-kappaB and C/EBP.

EMSAs were performed using SAA mtC/EBPwtNF-kappaB probe and a combination of constant amount of RelA and increasing amounts of C/EBP factors for further characterization of the heteromer. Increasing amounts of C/EBPs considerably enhanced the formation of C/EBPbulletNF-kappaB heteromeric complex (Fig. 5A, lanes 1-4). In a reciprocal experiment, an increasing dose of RelA (NF-kappaB) was seen to favor the formation of C/EBPbulletNF-kappaB heteromer (Fig. 5B, lanes 5-8). It was further noticed that the intensity of the C/EBPbulletNF-kappaB heteromeric complex was somewhat higher with the NF-kappaB site than that with the C/EBP site (Fig. 5, compare the level of C/EBPbulletNF-kappaB heteromeric complex between panelsA and B). This finding suggested that C/EBPbulletNF-kappaB heteromer might have a higher affinity of binding to the NF-kappaB site than to the C/EBP site.

To test this possibility, EMSA was performed using SAA mtC/EBPwtNF-kappaB DNA as probe and molar excesses of NF-kappaB or C/EBP oligonucleotides as competitors of DNA-protein complex formation (Fig. 6). The heteromeric complex of NF-kappaB(RelA) and C/EBP was easily competed in the presence of excess NF-kappaB oligonucleotides (lanes3-5) but less efficiently inhibited by the excess C/EBP-specific oligonucleotide (lanes 6-8). If the affinity of the C/EBPbulletNF-kappaB heteromeric complex for the C/EBP or NF-kappaB element was similar, the level of competition by both oligonucleotides would be comparable. Lack of efficient competition by C/EBP oligonucleotide (lanes 6-8) indicated that the NF-kappaBbulletC/EBP heteromer interacts more avidly with the NF-kappaB site than with the C/EBP site of the SAA gene. Inclusion of C/EBP antisera in EMSA supershifted only the slower migrating C/EBPbulletNF-kappaB heteromer (lane9), whereas nonspecific antiserum had no effect on it (lane10). Similar results were also obtained in a reciprocal experiment when SAA wtC/EBPmtNF-kappaB element was used as probe (data not shown). These results further verified that the slower migrating complex is indeed composed of C/EBP and NF-kappaB proteins.

Synergistic Transactivation of SAA Promoter by C/EBP and NF-kappaB

To evaluate the in vivo effect of C/EBP and NF-kappaB interactions in the transcriptional activation of the SAA gene, we performed transfection assays using reporter plasmids carrying the SAA promoter containing wild-type and mutant C/EBP and NF-kappaB elements. In the cotransfection assay, expression plasmids carrying C/EBP and NF-kappaB genes were also used (Fig. 7). When used separately, both C/EBP and NF-kappaB considerably increased the expression of the reporter gene from the wt SAA promoter. However, in the presence of both transcription factors, we observed a synergistic increase of reporter gene expression, suggesting a cooperative role of C/EBP and NF-kappaB on SAA promoter function. The synergistic effect of C/EBP and NF-kappaB still occurred when either one of the two SAA promoter elements in the reporter plasmid was mutated, indicating that each of these two transcription factors can enhance the other's potential for transcriptional activation. C/EBP and NF-kappaB had no transactivating effects when both elements were mutated in the reporter plasmid DNA (data not shown).

Figure 7: Cotransfection analysis of the NF-kappaB and C/EBP expression plasmids on the SAA reporter genes. Three CAT reporter plasmids, derivatives of pBLCAT2 and carrying SAA promoters containing either wtC/EBPwtNF-kappaB, or mtC/EBPwtNF-kappaB or wtC/EBPmtNF-kappaB elements, were cotransfected with plasmids expressing either NF-kappaB(RelA), C/EBP (C/EBP-), or both. Reporter plasmids (10 µg of DNA) were transfected into BNL CL.2 cells alone (shadedbars) or cotransfected with 2 µg each of pCMV-RelA (solidbars), pMSV-C/EBP (stripedbars), or pCMV-RelA+pMSV-C/EBP (cross-hatched bars). CAT activity in the transfected cells was measured as described under ``Materials and Methods.'' -Fold induction of the CAT activity in the cotransfected cells relative to that of the reporter plasmid alone was determined and plotted as relative CAT activity.


Heteromeric Complex of NF-kappaB and C/EBP Has an Increased Transactivation Potential for SAA Promoter Activation

The transactivation potential of the C/EBPbulletNF-kappaB heteromer was analyzed by cotransfecting cells with SAA mtC/EBPwtNF-kappaB-promoter-containing reporter plasmid plus a combination of constant amount of NF-kappaB and increasing amounts of C/EBP- expression plasmid genes. A synergistic dose-dependent stimulation of the reporter gene expression was seen (Fig. 8A) in the presence of C/EBP- expression plasmid. Western blot analysis (data not shown) was performed, which verified that this increase of reporter gene expression was not due to the overproduction of NF-kappaB in the presence of C/EBP-. Similar observations were made by Stein et al. (1993), who reported that expression of NF-kappaB by the NF-kappaB-transfected cells is not altered by the cotransfection of these cells with C/EBP expression plasmids. Earlier, results of EMSAs (Fig. 4B and Fig. 5A) indicated that C/EBP could interact with the NF-kappaB element of SAA promoter only as a C/EBPbulletNF-kappaB heteromeric complex. This suggested that the synergistic dose-dependent increase in the expression of SAA mtC/EBPwtNF-kappaB promoter-containing CAT reporter gene (Fig. 8A) in the presence of increasing amount of C/EBP- and constant amount of NF-kappaB was possibly due to the interaction of C/EBP-bulletNF-kappaB heteromer with the SAA NF-kappaB element. Of the two members of NF-kappaB family, RelA and NFKB1, stronger transactivation was seen with RelA.

Figure 8: Cotransfection analysis of SAA promoter activity. Panel A, stimulation of SAA NF-kappaB promoter by C/EBP-. SAA-CAT reporter plasmid (10 µg of DNA) containing mtC/EBPwtNF-kappaB element was used to transfect BNL CL.2 cells either alone (solid bars) or with 2 µg of pCMV-RelA (shaded bars) or 2 µg of pCMV-NFKB1 (stripedbars). In addition, some transfection reactions also contained increasing concentrations of C/EBP- expression plasmid (2, 4, and 6 µg, respectively). Panel B, stimulation of SAA C/EBP promoter by NF-kappaB. SAA-CAT reporter plasmid (10 µg of DNA) containing wtC/EBPmtNF-kappaB element was used to transfect BNL CL.2 cells either alone (light shaded bars) or with 2 µg of pMSV-C/EBP- (dark shaded bars). In some transfection assays, increasing concentrations (2, 4, and 6 µg, respectively) of pCMV-NFKB1 or pCMV-RelA were included. CAT activity in the transfected cells was measured as described under ``Materials and Methods,'' and the induction of CAT activity relative to that of the reporter plasmid alone was presented.


Since the heteromeric complex of NF-kappaB and C/EBP can also interact with the C/EBP elements of SAA promoter (seen in Fig. 4C and 5B), we studied the transcriptional induction potential of SAA wtC/EBPmtNF-kappaB promoter-containing CAT reporter gene in the presence of constant amount of C/EBP- and increasing amounts of NF-kappaB expression plasmids. The results shown in Fig. 8B demonstrated that the combination of C/EBP- and NF-kappaB was a better transcriptional activator than C/EBP- alone. Western blot analysis for C/EBP- in the cotransfected cells (data not shown) indicated that the expression of C/EBP- was not altered by the increasing presence of NFKB1 or RelA. Increased expression of the reporter gene was due to simultaneous presence of the two families (NF-kappaB and C/EBP) of transcription factors. However, the level of synergistic transactivation was less than that obtained through the NF-kappaB element. About 2-fold induction was detected at the C/EBP element due to the presence of RelA (Fig. 8B), whereas more than 4-fold induction was detected at the NF-kappaB site (Fig. 8A). This was presumably due to the lower affinity of the heteromeric NF-kappaBbulletC/EBP complex for the C/EBP element seen earlier in the EMSAs ( Fig. 5and Fig. 6).

Evidence of Heteromeric Complex of RelAbulletC/EBP- in the LPS-treated Liver Nucleus

Simultaneous activation of RelA and C/EBP- in the rabbit liver nucleus following LPS induction and the in vitro demonstration of heteromeric complex formation with the SAA promoter led us to investigate if in vivo such a heteromeric complex of these two types of transcription factor exists. LPS 3-h nuclear extract, which contains both of these factors, was incubated in the presence of SAA NF-kappaB element as probe (Fig. 9). Antisera specific to the three C/EBP isoforms, alpha, beta and , were separately used to test if any of these antibodies could inhibit or supershift the DNA-protein complexes (lane1) formed due to the interaction of RelA with the SAA NF-kappaB motif. The DNA-protein complex A was supershifted in the presence of C/EBP- antibody (lane4). However, its intensity was considerably increased, which presumably occurred due to the stabilization of the supershifted complex. Lack of inhibition or supershifting of complex B by the C/EBP-specific antisera indicated that complex B does not contain any C/EBP. Taken together, these results indicate that complex B is a homomeric complex of RelA (p65) protein and complex A is the heteromer of RelA and C/EBP- protein. It is noticeable that the migration pattern of complex A is slower than complex B. This suggests that complex A possibly is a multimer of RelA (p65) and C/EBP-. Antibodies to the other two members of the C/EBP family, C/EBP-alpha and -beta had no effect, indicating that both C/EBP-alpha and C/EBP-beta have little or no interaction with the activated RelA present in the LPS 3-h nuclear extract (lanes2 and 3). These results provided an evidence of a heteromeric complex formation by RelA and C/EBP- in the LPS-induced rabbit liver nucleus and their interaction with the specific binding elements of the SAA promoter.

Figure 9: Interaction of heteromeric RelAbulletC/EBP- complex with the NF-kappaB element of SAA gene. EMSAs were performed using P-labeled SAA promoter DNA (-112 to -79) and nuclear extract from the LPS 3-h treated rabbit liver. Prior to the addition of the probe, nuclear extract was incubated with anti-C/EBP-alpha (lane2), anti-C/EBP-beta (lane3), anti-C/EBP- (lane4) antisera, or a nonspecific antiserum (lane5). In some reactions, antiserum to C/EBP- was blocked by adding either C/EBP--specific peptide (lane6) or a nonspecific peptide (lane 7) in the preincubation reaction. The migration positions of the three complexes A, B, and C are indicated. Supershifted complex in lanes4 and 7 is indicated by an arrow.


DISCUSSION

We have provided evidence of the concerted role of C/EBP and NF-kappaB in the regulation of SAA gene expression. The following novel findings were obtained. (i) There is in vivo evidence of RelAbulletC/EBP heteromer formation at the SAA promoter in the LPS-induced rabbit liver; (ii) RelA and C/EBP- cooperatively transactivate the expression of SAA gene; (iii) the heteromeric complex of NF-kappaB and C/EBP has a higher transactivation potential in activating SAA expression than their homomeric counterparts; (iv) the heteromeric complex of NF-kappaB and C/EBP can bind to both NF-kappaB and C/EBP binding elements; (v) the NF-kappaBbulletC/EBP heteromer interacts with the NF-kappaB element with a much higher affinity than that with the C/EBP element of SAA promoter.

Several earlier studies have shown that C/EBP or NF-kappaB alone can increase the transcription of SAA-CAT reporter gene quite effectively (Ray and Ray, 1993a, 1993b). Under certain acute inflammatory conditions, when both of these transcription factors are induced and activated, the expression of SAA gene is likely to be regulated by the combinative effect of these two factors. Although some previous studies suggested that both NF-kappaB and C/EBP transcription factors cooperate in the inducible expression of rat SAA gene (Li and Liao, 1991, 1992), no induction of any C/EBP binding activity under inflammatory condition was shown. Thus, the role of C/EBP was not established in the acute-phase induction of rat SAA1 gene expression. We have presented evidence indicating activation of both NF-kappaB(RelA) and C/EBP- in the nuclear extract of the liver and their interaction with the SAA promoter using LPS-treated rabbit liver that overexpresses SAA. We have also directly assessed the ability of various members of C/EBP and kappaB/Rel family to interact with SAA promoter and activate transcription of the SAA gene. Using RelA protein from CMV-RelA-transfected COS-7 cells and C/EBP from turpentine-induced liver, we have demonstrated the formation of homo- and heteromeric complexes between these two transcription factors and provided evidence that the heteromers of NF-kappaB and C/EBP are more potent in transactivating the SAA-CAT reporter gene expression.

In vitro binding studies showed that both NF-kappaB and C/EBP are capable of interacting with the SAA promoter quite efficiently and interactions of these factors to their cognate binding sites were not dependent on the presence of the other ( Fig. 4and Fig. 5). However, presence of both NF-kappaB and C/EBP factors resulted in the formation of slower migrating complexes at both binding sites, indicating the interaction of these factors as a heteromeric complex (Fig. 4). Using mutant oligonucleotides, in which either the NF-kappaB element or the C/EBP element was mutated by multiple sequence substitutions and probes containing one factor binding element, we detected the formation of a slower migrating complex that is presumably composed of both of these factors. Such a heteromer could interact with either the C/EBP or the NF-kappaB element of SAA gene (Fig. 5, A and B). Supporting our data, LeClair et al.(1992) reported that p50 and C/EBP-beta directly associate each other via the bZIP domain and the Rel homology domain. Functional and physical association between NF-kappaB and C/EBP family members have also been reported by several other groups (Stein et al., 1993; Stein and Baldwin, 1993; Matsusaka et al., 1993). However, in these studies the formation of a heteromeric complex between C/EBP and NF-kappaB protein, although suggested, could not be demonstrated under in vitro or in vivo condition (Stein et al., 1993). We have presented evidence for the formation of heteromer of C/EBP and NF-kappaB and demonstrated that such a heteromeric complex interact with C/EBP or NF-kappaB element of SAA promoter under in vitro and in vivo conditions (Fig. 4, Fig. 5, and Fig. 9).

Under LPS-mediated inflammatory conditions, mainly isoform of C/EBP and RelA (p65) are induced (Fig. 1Fig. 2Fig. 3). The appearance of NF-kappaB is rapid and detectable within 1 h after LPS treatment. The inducible isoform of C/EBP was detected well after 1 h of the onset of inflammation. The induction of C/EBP- is quite predominant, and this activity declines within 12 h of the onset of LPS induction. Cumulative accumulation of C/EBP isoforms and RelA thus represents a key event in LPS-mediated induction of SAA gene. Earlier Lowell et al. (1986b) had shown that SAA gene transcription reaches its maximum at about 3 h following LPS induction. Our findings of the appearance of the two families of transcription factors, which also accumulate at a high concentration at 3 h following LPS induction, suggest that these factors are likely to play a decisive role in SAA gene expression. Betts et al.(1993) recently showed the role of NF-kappaB and NF-IL6 (a human homolog of C/EBPbeta) in cytokine induction of the human SAA2 gene. We have demonstrated that C/EBP- and not C/EBPbeta is a major C/EBP isoform that is activated in LPS induction of rabbit SAA gene, and further studies on transactivation assays (Fig. 8) indicated that C/EBP- is capable of promoting transcription. This difference between the two findings may have been related to use of different inducers or cell types. Previous studies have shown that all kappaB-binding sites do not interact equally well with each member of kappaB/Rel family (Kunsch et al., 1992). In vitro DNA binding studies with purified NFKB1 (p50) and v-Rel showed that these factors can interact efficiently with the SAA promoter. Consistent with this observation, we found that RelA (p65), NFKB1 (p50), or v-Rel expression plasmids can transactivate the SAA NF-kappaB CAT reporter gene expression in a dose-dependent manner (Fig. 2C). v-Rel has been shown to be a weak transcriptional activator (Kamens et al., 1990) in certain cells and may even inhibit transcription from the kappaB sites (Inoue et al., 1991). It is quite possible that the differential transactivator effect of v-Rel may be dependent upon the cell types used in the transfection assay since we observed a positive transactivating ability of v-Rel in inducing SAA gene expression.

Synergistic transactivation of SAA gene by C/EBP and NF-kappaB transcription factors was confirmed by cotransfection experiments (Fig. 8), which showed synergistic stimulation of SAA promoter through both C/EBP and NF-kappaB elements. The synergy between RelA and C/EBP- was more prominent through the NF-kappaB element. This is consistent with the result obtained from EMSAs ( Fig. 5and Fig. 6), which indicated that NF-kappaBbulletC/EBP heteromer binds more efficiently with the NF-kappaB element of SAA gene. This observation is different from some previous reports. Using multimerized c-Fos response element and human immunodeficiency virus-1 kappaB enhancer motif linked to the ``TATA box,'' Stein et al.(1993) showed that cross-coupling of C/EBP and NF-kappaB results in the inhibition of promoter containing the NF-kappaB element but synergistically stimulates the promoters containing the C/EBP binding element. However, both binding sites are required for the synergistic stimulation of expression of IL-6 and IL-8 genes (Matsusaka et al., 1993). These differences in findings may occur due to the use of artificial promoters, reporter genes with different spatial arrangement of the two factor binding elements, or different cell types used in the transfection assays. We also noticed that RelAbulletC/EBP has a higher transactivation potential than the NFKB1bulletC/EBP (Fig. 8). This could be due to a higher binding affinity of the RelAbulletC/EBP to the SAA NF-kappaB site compared to that of NFKB1bulletC/EBP. A similar effect of differential binding affinity has been shown recently to be involved in Igkappa chain expression during B cell differentiation, where p50-Rel was found to have a higher binding affinity to the Igkappa promoter than the p50-p65 (Miyamoto et al., 1994). In addition to RelA and NFKB1, the contribution of c-Rel and RelB in SAA gene expression remains to be determined. In summary, we have shown that cooperative interaction between two transcription factors, C/EBP and NF-kappaB, is involved in the regulation of rabbit SAA gene expression under LPS-mediated acute inflammation. Accumulating evidence indicates that a gene is regulated by the combined actions of a group of transcription factors and interaction between them is a critical regulatory component of gene expression. It will be of interest to find out if other factors also participate in SAA gene regulation.

FOOTNOTES

*
This work was supported by USPHS Grant DK 45144-01 (to B. K. R. and A. R.) and USDA-NRICGP Grant 9202922 (to M. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Veterinary Microbiology, University of Missouri, 20 Connaway Hall, Columbia, MO 65211. Tel.: 314-882-4461; Fax: 314-884-5050.

(^1)
The abbreviations used are: AA, amyloid A; SAA, serum amyloid A; LPS, lipopolysaccharide; EMSA, electromobility shift assay; CAT, chloramphenicol acetyltransferase; wt, wild-type; mt, mutant; CMV, cytomegalovirus; MSV, mouse sarcoma virus; IL, interleukin.

ACKNOWLEDGEMENTS

We are grateful to Drs. S. L. McKnight and W. C. Yeh for their generous gift of C/EBP antisera and cloned expression plasmids containing C/EBP genes. We also thank Dr. C. A. Carson for critical reading of the manuscript.

REFERENCES

  1. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906 [Medline] [Order article via Infotrieve]
  2. Alam, T., An, M. R., and Papaconstantinou, J. (1992) J. Biol. Chem. 267, 5021-5024 [Abstract/Free Full Text]
  3. Anders, R. F., Natvig, J. B., Sletten, K., Husby, G., and Nordstoga, K. (1977) J. Immunol. 118, 229-234 [Abstract/Free Full Text]
  4. Betts, J. C., Cheshire, J. K., Akira, S., Kishimoto, T., and Woo, P. (1993) J. Biol. Chem. 268, 25624-25631 [Abstract/Free Full Text]
  5. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  6. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes & Dev. 5, 1538-1552
  7. Christy, R. J., Yang, V. W., Ntambi, J. M., Geiman, D. E., Landschulz, W. H., Friedman, A. D., Nakabeppu, Y., Kelly, T. J. and Lane, M. D. (1989) Genes & Dev. 3, 1323-1335
  8. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489 [Abstract/Free Full Text]
  9. Edbrooke, M. R., Burt, D. W., Chesire, J. K., and Woo, P. (1989) Mol. Cell. Biol. 9, 1908-1916 [Abstract/Free Full Text]
  10. Friedman, A. D., Landschulz, W. H., and McKnight, S. L. (1989) Genes & Dev. 3, 1314-1322
  11. Ganapathi, M. K., Rzewnicki, D., Samols, D., Jiang, S.-L., and Kushner, I. (1991) J. Immunol. 147, 1261-1265 [Abstract]
  12. Graham, F. L., and van der Eb, A. J. (1973) Virology 52, 456-461 [CrossRef][Medline] [Order article via Infotrieve]
  13. Grilli, M., Chiu, J. J.-S., and Lenardo, M. J. (1993) Int. Rev. Cytol. 148, 1-63
  14. Grimm, S., and Baeuerle, P. A. (1993) Biochem. J. 290, 297-308
  15. Huang, J. H., and Liao, W. S.-L. (1994) Mol. Cell. Biol. 14, 4475-4484 [Abstract/Free Full Text]
  16. Husebekk, A., Skogen, B., Husby, G. and Marhaug, G. (1985) Scand. J. Immunol. 21, 283-287 [CrossRef][Medline] [Order article via Infotrieve]
  17. Inoue, J.-I., Kerr, L. D., Ransone, L. J., Bengal, E., Hunter, T., and Verma, I. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3715-3719 [Abstract/Free Full Text]
  18. Kamens, J., Richardson, P., Mosialos, G., Brent, R., and Gilmore, T. (1990) Mol. Cell. Biol. 10, 2840-2847 [Abstract/Free Full Text]
  19. Kinoshita, S., Akira, S., and Kishimoto, T. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1473-1476 [Abstract/Free Full Text]
  20. Kunsch, C., Ruben, S. M., and Rosen, C. A. (1992) Mol. Cell. Biol. 12, 4412-4421 [Abstract/Free Full Text]
  21. Kunsch, C., Lang, R. K., Rosen, C. A., and Shannon, M. F. (1994) J. Immunol. 153, 153-164 [Abstract]
  22. Kushner, I. (1982) Ann. N. Y. Acad. Sci. 389, 39-48 [Medline] [Order article via Infotrieve]
  23. Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graver, B. J., and McKnight, S. L. (1988) Genes & Dev. 2, 786-800
  24. LeClair, K. P., Blanar, M. A., and Sharp, P. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8145-8149 [Abstract/Free Full Text]
  25. Li, X., and Liao, W. S. L. (1991) J. Biol. Chem. 266, 15192-15201 [Abstract/Free Full Text]
  26. Li, X., and Liao, W. S.-L. (1992) Nucleic Acids Res. 20, 4765-4772 [Abstract/Free Full Text]
  27. Lowell, C. A., Potter, D. A., Stearman, R. S., and Morrow, J. F. (1986a) J. Biol. Chem. 261, 8442-8452 [Abstract/Free Full Text]
  28. Lowell, C. A., Stearman, R. S., and Morrow, J. F. (1986b) J. Biol. Chem. 261, 8453-8461 [Abstract/Free Full Text]
  29. Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 15, 5490-5490 [Free Full Text]
  30. Matsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Matsushima, K., Kishimoto, T., and Akira, S.