![]()
|
|
||||||||
(Received for publication, June 11, 1994; and in revised form, November 17, 1994) From the
A collection of fission yeast Schizosaccharomyces pombe conditional mutants was screened for defective nucleocytoplasmic
transport of poly(A) Multiple steps are involved in the maturation of mRNA from
initiation of transcription to transport to the site of translation.
Splicing, 3`-end formation, and polyadenylation are well studied RNA
maturation events that can be regulated(1) . RNA export from
the nucleus to the cytoplasm is another potential step for regulating
gene expression. To elucidate the factors involved in RNA export, we
and others have identified RNA transport mutations in either Saccharomyces cerevisiae or Schizosaccharomyces
pombe. All of the RNA transport mutations identified to date
affect other cellular processes as well. RNA1 affects
nucleocytoplasmic localization of RNA in S.
cerevisiae(2, 3) , as well as 5`-end formation,
3`-end formation, and poly(A) length(4) . Mutations in the S. cerevisiae SRM1/PRP20/MTR1 gene cause defects in RNA
production that are similar to RNA1(4, 5, 6) . This gene is a
member of a family of related genes that includes the hamster RCC1 gene (7) and pim1 in S. pombe(8) . RCC1 and pim1 were identified as
regulators of chromatin condensation during the cell division cycle (8, 9, 10) and have since been shown to
affect nucleocytoplasmic transport of poly(A)
Figure 2:
Diagram of the rae1 genomic
clone. The rae1 gene is contained within a 5.3-kilobase
insertion of genomic DNA indicated by the horizontal line. The
three exons (black boxes) and two introns (open
boxes) are indicated. The vector pDW232 contains the S. pombe
ars1 fragment, ura4 gene, and the Escherichia coli
For rae1 gene disruption, a plasmid was constructed by
deleting the NarI-SalI ARS fragment and the PvuII-EspI ura4 fragment from the plasmid
shown in Fig. 2. The approximately 800-base pair XhoI-FspI fragment from the rae1
A collection of S. pombe temperature-sensitive
mutants was screened for defects in RNA transport by fluorescence in situ hybridization. A single mutant was isolated that
conditionally accumulated poly(A) We compared the poly(A)
Figure 1:
Localization of
polyA
Cells that were hybridized
with excess competitor oligo(dT) did not have a fluorescence signal (Fig. 1, panels A and B), indicating a low
background fluorescence from the anti-digoxygenin antibody. Similarly,
pretreatment of cells with RNase T1 and RNase A eliminated the
fluorescence signal (not shown), demonstrating that the probe was
specific for poly(A) We then determined if the
defect in poly(A)
To
provide further evidence that the rae1 gene is not an
extragenic high copy suppressor of the rae1-1 mutation, we
performed a two-step gene replacement as described in the methods. Both rae1 A diploid strain heterozygous for a rae1::ura4 disruption was constructed as described under
``Materials and Methods.'' Analysis of nine tetrads resulted
in 2:2 segregation for viability in each tetrad. At 16 days,
microscopic examination of the spores that did not form colonies
revealed that, of 18 spores, 12 remained round, 4 had begun to
elongate, and 2 appeared to have germinated but did not divide. The two
viable colonies from every tetrad were uracil auxotrophs, suggesting
that the rae1 The rae1 gene
encodes a 352-amino acid protein and has two introns of 50 and 419
nucleotides (Fig. 3A) which were identified by
comparison of the cDNA clone with the genomic clone. The rae1-1 allele was isolated as described under ``Materials and
Methods'' and was found to encode a single mutation of glycine 219
to glutamic acid.
Figure 3:
A, nucleotide sequence of the rae1-1 gene. The noncoding strand is shown, and nucleotide
positions are indicated on the right. The predicted amino acid
sequence is below. B, alignment of the predicted
amino acid sequences of BUB3 and rae1-1. The
Comparison of the predicted amino acid sequence
with sequences in the GenBank
Figure 4:
Northern analysis of wild type and rae1-1 mutants. Total RNA was extracted(40) ,
fractionated on a 1% agarose/formaldehyde gel, and transferred to
nitrocellulose. A, the blot was sequentially hybridized with
Although the rae1 and
Figure 5:
Cell division cycle analysis of rae1-1. A, DNA content of propidium iodide-stained
cells was measured by flow cytometry. Top panel, histograms of
control cells to locate the amount of fluorescence that corresponds to
1C and 2C DNA content, indicated at the top of the histogram. Left peak, wild type cells that were blocked in G
The failure
to observe cells with two nuclei suggested that cells were blocked
prior to nuclear division. Increases in H1 kinase have been related to
the activation of p34 To assess the relationship of rae1 function with the cell division cycle, viability and RNA
export were examined in cells that were shifted to nonpermissive
temperature during arrest at various phases of the cell division cycle. rae1-1 cells that were arrested in G A similar experiment was performed using a double mutant
of rae1-1 and cdc25-22. The temperature-sensitive cdc25-22 mutation results in cell division cycle arrest in
late G The
difference in viability resulting from shifting the temperature of rae1-1 cells at different phases of the cell division cycle
raised the possibility that the defect in RNA export may be different
in arrested cells. Therefore we examined poly(A)
Figure 6:
Fluorescence localization of actin and
tubulin in rae1
Tubulin localization was also examined
by immunofluorescence microscopy (Fig. 6, series II).
The
Figure 7:
Immunofluorescence localiztion of rae1 protein. The rae1
Since a loss of wild type rae1 function results in early disruption of actin and later
of tubulin organization, we looked for a physical interaction between
the rae1 protein and actin or tubulin. We asked if actin or
tubulin could be coimmunoprecipitated with the AU1-tagged rae1 protein (Fig. 8). In vitro labeled rae1 protein is shown in lane 1. Immunoprecipitations were
performed from rae1
Figure 8:
Immunoprecipitation of AU1-tagged rae1 protein. A, rae1 null cells that were
transformed with a plasmid that encodes the rae1 protein
tagged with the AU1 epitope (lane 3) were compared with wild
type 972 cells (lane 2). Cells were labeled with
[
We have identified a S. pombe temperature-sensitive
mutant that is defective in export of poly(A) The rae1-1 phenotypes differ from those of several other RNA
export mutants. The rate at which the RNA transport defect appears
after temperature shift differs among the mutants. Within 30 min, rae1-1 cells all display the export defect, while S.
cerevisiae mutations in the SRM1/PRP20/MTR1 or RAT1 genes require from 1 to 3 h for all cells to accumulate nuclear
poly(A) The rapid accumulation of
poly(A) The components of RNA
export are likely to involve extensive protein-protein and protein-RNA
interactions. The rapid and irreversible loss of viability resulting
from rae1 temperature sensitivity is consistent with rae1 protein being part of an essential complex that is unable to
return to a wild type conformation when cells are returned to
permissive temperature. The rae1 amino acid sequence contains
a C-terminal basic region which has been implicated in RNA-protein
interaction(32) . Basic regions have also been implicated in
nuclear import of proteins(33) . As is the case for several
other genes that affect mRNA
export(4, 6, 10, 11) , it has been
difficult to demonstrate a direct role for rae1 in RNA export. The possibility that rae1 protein interacts with other
proteins is suggested by its similarity to Of all of the proteins with
transducin repeats, only the S. cerevisiae BUB3 gene shares
similarity with rae1 outside of the transducin repeat regions.
Mutations in the BUB genes result in supersensitivity to
microtubule inhibitors, such as nocodazole, and formation of cells with
multiple buds. The rapid loss of viability of nocodazole-arrested rae1-1 cells following a shift to the restrictive temperature
raises the possibility that rae1 is the S. pombe analog of BUB3. The BUB genes function in a
mitotic checkpoint that detects improper microtubule function and
arrests cell division cycle progression until microtubules are
functional(24) . The bub mutants continue to bud and
replicate their DNA but do not undergo cytokinesis in the presence of
microtubule inhibitors such as nocodazole, resulting in poor recovery
from exposure to these agents. Although the phenotypes of rae1-1 and bub mutants differ somewhat, we are investigating the
possibility that the rae1 gene is involved in a mitotic
checkpoint. It has been suggested that cytoskeletal microfilaments
are involved in RNA trafficking(31, 37) . There is
precedent for microfilament association of transducin repeat containing
proteins. Coronin, an actin-binding protein in Dictystelium,
contains transducin repeats, although the authors speculate that it is
not this domain that mediates actin binding(38) . CIN4 is a microtubule accessory protein that contains transducin
repeats(39) , and CDC20 is required for microtubule
assembly(36) . One possible explanation for a disruption of
cytoskeleton in the rae1-1 mutant is that rae1 protein interacts directly with actin. However, we do not see a
direct interaction in immunoprecipitations of epitope-tagged rae1 protein. This suggests that it is unlikely that rae1 protein affects cytoskeleton through a direct interaction with
actin or tubulin. We are using genetic and other biochemical techniques
to identify elements that interact with rae1 to further
understand the process of RNA export and its relationship to the
cytoskeleton. The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
U14951[GenBank].
Volume 270,
Number 13,
Issue of March 31, 1995 pp. 7411-7419
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
RNA Export and in the Cytoskeleton (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
RNA by fluorescence in situ hybridization. We identified a temperature-sensitive mutant that
accumulated poly(A)
RNA in the nucleus and have named
it rae1-1, for ribonucleic acid export. All rae1-1 cells exhibit the defect in
poly(A)
RNA export within 30 min following a shift to
the nonpermissive temperature. In addition, in the rae1-1 mutant, actin and tubulin become disorganized, and cells undergo
an irreversible cycle arrest. Results from experiments in which rae1-1 cells were arrested in various phases of the cell
division cycle and then shifted to nonpermissive temperature suggest
that cells are particularly vulnerable to loss of rae1 function during G
/M. However, the inability to export
RNA from the nucleus to the cytoplasm was not limited to a particular
phase of the cell division cycle. The rae1 gene was isolated
by complementation and encodes a predicted protein of 352 amino acids
with four
-transducin/WD40 repeats.
RNA(11) . The S. cerevisiae RAT1 gene is
proposed to affect transcription as well as RNA export(12) . It
is not yet clear how the products of these genes participate in RNA
transport. To understand the process of RNA transport, we screened a
collection of temperature-sensitive S. pombe mutants for
conditional RNA export defects. Here we report the characterization of
the rae1-1 mutant and the isolation of a gene that complements
this defect.
Strains and Culture
Strain 972 (h
) was mutagenized. JBP15 (h
, ura4-D18, leu1-32) was
mated to the rae1-1 mutant for backcrossing. JBP48 (h
rae1-1, ura4-D18, leu1-32), the product of two backcrosses to JBP15, was used
for further studies. JBP101 (h
, rae1-1, ura4-D18) was used for gene replacement, and
SP816/SP826 (h
, leu1-32, ura4-D18, ade6-210/h
, leu1-32, ura4-D18, ade6-216) (gift of David
Beach) was used for gene disruption. JBP102 (h
rae1-1), the product of two
backcrosses of JBP48 with strain 972, was used for cell cycle analysis.
FYC5 (h
, cdc25-22) is from the Cold
Spring Harbor Fission yeast course. The cdc17 strain (h
, cdc17-M75) was isolated by
Naysmyth(13) . Standard techniques for yeast culture and
genetic analysis were used(14, 15, 16) .Isolation of Mutants
Ethyl methanesulfonate
mutagenesis of strain 972 was performed as previously described (16) to a rate of 40% viability. A collection of 201 mutants
and an additional 144 mutants (gift from J. Potashkin) were screened.
The temperature-sensitive mutants were grown at 36 °C for 3 h and
screened for defects in RNA transport by fluorescence in situ hybridization using a digoxygenin-labeled 50-nucleotide oligo(dT)
probe to detect poly(A)
RNA according to Forrester et al.(4) , with the following modifications. Cells
were fixed with 4% formaldehyde (pH 7.5), washed, and converted to
spheroplasts by digestion with with 0.4 µg/ml Zymolyase 100T
(Miles) in 1 M sorbitol, 50 mM citrate, 4 mM EDTA, 0.2%
-mercaptoethanol for 40 min. Cells were spotted
onto polylysine-treated slides, hybridized, washed, and incubated with
fluorescein isothiocyanate-conjugated anti-digoxygenin Fab antibody
fragment (Boehringer Mannheim) as described elsewhere(4) .Cloning the rae1 Gene
The gene was cloned by
complementation of temperature sensitivity from a Sau3A
partially digested genomic library in the vector pDW232 (gift of P.
Nurse) transformed into the JBP48 strain. The cDNA clone was isolated
from a
zap cDNA library (gift of M. Wigler) by hybridization with
the genomic clone. DNA sequencing of both strands of the cDNA clone was
performed using the Sequenase kit (U. S. Biochemical Corp.). Marker
rescue experiments were performed as previously described(17) .
The rae1-1 allele was isolated from genomic DNA by polymerase
chain reaction. Primers CTACCACAACTATTAGAATGT and CTCATGCCTCAACAGGATTG
span the ATG codon and the termination codon, respectively. The
1.5-kilobase polymerase chain reaction products were cloned into the TA
cloning vector (Invitrogen) and sequenced. The rae1-1 allele
had a single mutation encoding a change from glycine 219 to glutamic
acid. Sequence analysis was performed with GCG programs(18) .
Two-step gene replacement was performed as previously
described(19) . The plasmid shown in Fig. 2was deleted
of the NarI-SalI ARS fragment, as well as the
remaining genomic sequences (PvuII-SmaI). The
resulting plasmid containing the rae1
gene
and the ura4 gene was linearized with XhoI and
transformed into JBP101. Transformants were selected for uracil
prototrophy at permissive temperature. Stable integration into the rae1-1 locus was confirmed by Sourthern analysis, and these
were temperature-resistant. Loss of the ura4 gene from ura4
recombinants was selected for on
5-fluoroorotic acid, and the resulting uracil minus recombinants was
tested for temperature sensitivity. Southern analysis confirmed
recombining out of the ura4 gene at the rae1 locus.
-lactamase gene, indicated by shaded
boxes.
gene was replaced with the ura4 gene. The HindIII fragment containing only the rae1::ura4 disruption was isolated and transformed into the diploid strain
SP816/SP826. Screening for stable integration was done by polymerase
chain reaction analysis using oligos from the ura4 gene and
from rae1 flanking sequences that were outside of those
included on the transformed DNA. Those clones with fragments of the
expected length for ura4 replacement of the rae1 gene
were confirmed by Southern analysis. The heterozygous diploids were
sporulated at permissive temperature, and tetrad analysis was
performed.Cell Division Cycle Analysis
Cells arrested in
G
phase were prepared by nitrogen starvation(16) .
Cells arrested in S phase were prepared by hydroxyurea treatment (12
mM) for 4 h. Cells were arrested in mitosis with 70 µg/ml
nocodazole treatment in the presence of 0.1% Me
SO for 100
min. Arrested cells were then incubated at 36 °C under cell cycle
arrest conditions (either hydroxyurea or nocodazole) and then plated at
permissive temperature on rich media (YEA) to assess viability.
Colonies were counted after 9 days, and viability was expressed as the
percentage of cells incubated at nonpermissive temperature that
survived to form colonies compared to cells that underwent the same
cell cycle block, but were not incubated at nonpermissive temperature.
DNA content was measured in fixed, propidium iodide-stained cells (16) using an EPICS 753.Fluorescence Localization of Actin and Tubulin, and rae1
Proteins
rae1
and rae1-1 cells were incubated at permissive or nonpermissive temperature
for varying times and then fixed and incubated with
rhodamine-conjugated phalloidin for actin detection. Tubulin was
detected by incubating fixed cells with a mouse monoclonal anti-
tubulin antibody (clone DM1-a, Sigma), washing, and then incubation
with a rhodamine-labeled anti-immunoglobulin antibody. The rae1
cDNA was tagged at the amino terminus
with the 5-amino acid AU1 epitope(20) . The plasmid carrying
the tagged gene was transformed into rae1
cells, and indirect immunofluorescence microscopy was performed
as described elsewhere (16) using antibody to the AU1
epitope(20) .Immunoprecipitations
Lysates were prepared as
previously described(21) . Logarithmically growing cells were
labeled with 1 mCi of [
S]methionine and 1 mCi of
[
S]cysteine in a volume of 10 ml for 1 h at 30
°C. Then phenylmethylsulfonyl fluoride, N-tosyl-L-phenylalanine chloromethyl ketone, and N
-p-tosyl-L-lysine
chloromethyl ketone (Sigma) were added to a concentration of 100
µg/ml. Cells were then washed and resuspended in 50 mM Tris, 50 mM NaCl, 0.2% Triton X-100, broken with glass
beads, and spun, and the supernatants were recovered. Lysates were
mixed with the mouse monoclonal antibody to the AU1 epitope (20) and with protein A-Sepharose. The Sepharose beads were
then washed six times with breaking buffer, and the proteins were
eluted in Laemmli buffer and fractionated on a 4-20% gradient
polyacrylamide gel. The actin and rae1 proteins were cloned
into to TA vector (Invitrogen) and then transcribed and translated in vitro using [
S]methionine as
recommended by the manufacturer.
RNA in the nucleus
at nonpermissive temperature. We have named this mutant rae1-1, for ribonucleic acid export. Tetrad dissections showed that temperature sensitivity
and the RNA localization defect cosegregated in all 10 tetrads analyzed
for both phenotypes. Diploids that were heterozygous for rae1-1 were not temperature sensitive and exhibited a wild type RNA
localization, indicating that the mutation is recessive (not shown).
RNA distribution in rae1-1 at permissive temperature (21 °C) with its
distribution at various times following a shift to nonpermissive
temperature (36 °C), shown in Fig. 1. At the permissive
temperature the poly(A)
RNA was uniformly distributed
throughout the cells (Fig. 1, panels C and D).
Wild type cells showed the same fluorescence pattern (not shown). After
5 min at the nonpermissive temperature, the poly(A)
RNA signal was brighter in the nucleus than in the cytoplasm in
approximately 30% of rae1-1 cells (Fig. 1, panels E and F). The percentage of cells with defective RNA
localization increased with time at the nonpermissive temperature (Fig. 1, panels G and H, 15 min) and reached
100% by 30 min (Fig. 1, panels I and J). With
increasing time at the nonpermissive temperature, the intensity of the
nuclear signal increased, while the intensity of cytoplasmic
fluorescence decreased (compare panels G and I). The
decrease in cytoplasmic signal may reflect a normal short mRNA
half-life, since the average half-life of mRNA is approximately 20 min
in S. cerevisiae(22) .
RNA in rae1-1 cells. RNA was detected
with fluorescence in situ hybridization of an
digoxygenin-labeled dT50 probe followed by incubation with an
fluorescein isothiocyanate-labeled anti-digoxygenin antibody. Panels A, C, E, G, I, and K show the polyA
RNA distribution visualized
as fluorescein isothiocyanate, while panels B, D, F, H, J, and L show the
4,6-diamidino-2-phenylindole-stained DNA of the corresponding fields. A and B, rae1-1 cells were incubated with
competitor oligo(dT) as a control for background fluorescence of the
anti-digoxygenin antibody; C and D, rae1-1 cells incubated at 21 °C; E and F, rae1-1 incubated at 36 °C for 5 min; G and H, 15 min; I and J, 30 min; K and L, rae1-1 cells incubated at 36 °C 30 min and
then returned to 21 °C for 120 min.
RNA. Fluorescence microscopy
using acridine orange to detect total RNA showed that stable RNA was
present in the cytoplasm of rae1-1 for at least 120 min at
nonpermissive temperature (not shown). These observations are
consistent with the oligo(dT) probe specifically detecting polymerase
II derived poly(A)
RNA.
RNA transport was reversible. rae1-1 cells that were incubated at nonpermissive temperature
for varying periods of time were returned to permissive temperature for
120 min and subjected to in situ hybridization. All of the rae1-1 cells that were incubated at nonpermissive temperature
for 5 min returned to the wild type pattern of cytoplasmic
poly(A)
RNA localization (not shown). However, after
30 min of incubation at nonpermissive temperature, only 20% of cells
returned to the wild type pattern (panel K), suggesting that
the defect is essentially irreversible. Cells were examined for
viability by exclusion of methylene blue dye and were found to be
greater then 90% viable after 50 min at the nonpermissive temperature.Cloning the rae1 Gene
The rae1 gene was cloned
by complementation of rae1-1 temperature sensitivity.
Complementation of the temperature-sensitive defect correlated with a
wild type pattern of fluorescence hybridization. The genomic clone
contained a 5.3-kilobase insertion of yeast DNA (Fig. 2).
Hybridization with the genomic clone identified three cDNA clones that
corresponded to three separate regions of the genomic clone. Each of
these cDNA clones was used in marker rescue experiments to determine
which one encoded the rae1
gene. Only one
cDNA clone was able to rescue the rae1-1 temperature
sensitivity, and we have designated this the rae1 gene.
and rae1-1 phenotypes were
recovered, indicating that rae1-1 is an allele of the cloned rae1
gene. Southern analysis confirmed that
integration and recombining out of the ura4 gene occurred at
the rae1 locus.
gene is required for spore
germination. The minority of spores that elongated may have received
enough rae1
protein to progress to
germination. To determine if the rae1
protein
is also required for mitotic cell growth, the heterozygous diploid was
sporulated in the presence of a plasmid containing the rae1
cDNA and a selectable leu1 gene. Haploids with the rae1::ura4 disruption were then
tested for loss of the plasmid. No leucine auxotrophs were recovered,
indicating that rae1
is required for mitotic
cell growth as well as for spore germination.
-transducin repeat consensus sequence is shown on the first
line, above BUB3. Amino acids in BUB3 and rae1 that fit the consensus are shown in boldface.
The residues that are identical in BUB3 and rae1 are
indicated by bars, and colons indicate conservative
substitutions. Periods represent gaps introduced for
alignment. Glycine 219, which is mutated to glutamic acid in rae1-1, is indicated in outline.
data base showed that rae1 shares significant sequence similarity with genes that
encode
-transducin/WD40 repeat-containing proteins(23) .
In most cases the similarity was restricted to the repeats. However, rae1 shared similarity with the S. cerevisiae BUB3 gene (24) outside of the
-transducin repeats. Fig. 3B shows the alignment of the BUB3 amino
acid sequence with that of rae1. Analysis of their predicted
amino acid sequences indicates that rae1 and BUB3 both have four regions of similarity to the
-transducin
repeat consensus sequence (25) . Amino acids 197-282 of rae1 have 37% identity with amino acids 170-279 of BUB3. The similarity is 57% if conservative substitutions are
considered. There is also a region of slightly less similarity between BUB3 and rae1 at the amino terminus, with 33%
identity and 50% with conservative substitutions. The rae1-1 allele contained a single point mutation in the region of greatest
similarity between rae1 and BUB3: amino acid 219 is
mutated from glycine to glutamic acid. BUB3 has a conservative
substitution of serine at the corresponding position.RNA Analysis
Mutations in SRM1/PRP20/MTR1 and RNA1 cause defects in RNA processing as well as RNA
export (4) . To determine if splicing was defective in rae1-1 mutants, total cellular RNA was isolated from rae1-1 cells at various times after a shift to the
nonpermissive temperature and subjected to Northern analysis. A probe
of the genomic rae1 gene that would detect both intron and
exon sequences hybridized to a single RNA species of approximately 1.5
kilobases (Fig. 4). RNA from wild type cells (lane 1)
and rae1-1 cells at the permissive temperature (lane
3) showed a single rae1 RNA band of the same size. rae1-1 cells that were transformed with a multicopy plasmid
containing the genomic rae1
gene possessed a
greater quantity of rae1-1 RNA (lane 2) than wild
type cells (lane 1). At 30 min following a shift to
nonpermissive temperature, a time when 100% of the cells exhibited the
defect in RNA export (Fig. 1I), there was no change in
the size of rae1 RNA, indicating that rae1 mRNA
continued to undergo splicing at the nonpermissive temperature. This
Northern blot was hybridized with an
-tubulin exon
probe(23, 26) that detected a single band of the
expected size for mature
-tubulin mRNA (Fig. 4B).
A probe from the
-tubulin intron did not detect pre-mRNA (not
shown). Based on our analysis of the two intron containing genes rae1 and
-tubulin, we conclude that splicing is probably
not defective in the rae1-1 mutant.
P-labeled probes of a rae1 genomic fragment,
-tubulin fragment, and an actin gene polymerase chain reaction
product, with stripping of the previous probe prior to the next
hybridization. The transcripts and their sizes are indicated at the left. Lane 1, RNA from rae1
cells; lane 2, RNA from rae1-1 cells
transformed with a plasmid containing the rae1 gene; lane
3, RNA from rae1-1 cells at permissive temperature. RNA
was isolated from rae1-1 cells incubated at 36 °C for
varying times; lane 4, 30 min; lane 5, 1 h; lane
6, 1.5 h.
-tubulin mRNAs appeared to be correctly spliced, a small,
gradual decrease in the amount of both RNA species occurred with time
at the nonpermissive temperature (lanes 4-6). The same
Northern blot was hybridized with an actin probe (Fig. 4C), which detected the three actin RNA species
generated by the intronless actin gene of S.
pombe(27) . Actin RNA was more stable than rae1 and
-tubulin RNA after the shift to nonpermissive
temperature. There were no detectable changes in the length of the
three actin RNAs. Longer exposures (not shown) of each of these probes
did not reveal any additional bands. Together with the constant size of
the rae1 and
-tubulin RNAs, these results suggest that
there are no gross abnormalities of other events involved in generation
of mature mRNA in the rae1-1 mutant.Cell Cycle Analysis
rae1-1 cells held at
the nonpermissive temperature appeared to accumulate as individual
cells of uniform size with a single nucleus, suggesting a cell cycle
arrest. To investigate this possibility, we measured the DNA content of rae1-1 cells at permissive and nonpermissive temperatures by
flow cytometry analysis. As markers for 1C and 2C DNA content we
analyzed wild type cells arrested in G
phase of the cell
division cycle by nitrogen starvation and wild type cells in log phase
growth at permissive temperature, respectively (Fig. 5A, top panel). rae1-1 cells in
log phase growth at permissive temperature had a DNA content similar to
wild type cells (Fig. 5A). Incubation of rae1-1 cells at nonpermissive temperature for 3 h resulted in a DNA
content of 2C (Fig. 5A, right peak of the bottom panel). We conclude that rae1-1 cells arrest
after DNA replication at the nonpermissive temperature.
by nitrogen starvation; right peak, log phase cells
indicate 2C DNA content. Bottom panel, DNA content of rae1-1 cells (left peak) in log phase growth at 21
°C and (right peak) rae1-1 cells incubated at 36
°C for 3 h. B, H1 kinase activity. rae1-1 cells
were incubated for 1.5 or 3 h at the indicated temperature, and
extracts were prepared (13) and assayed for H1 kinase
activity(41) . Activities are expressed relative to that of rae1-1 cells at permissive temperature. C, viability
experiments in which rae1
cells or rae1-1 cells were first arrested in the cell division cycle and then
incubated for varying amounts of time at 36 °C in arrest conditions
and then plated on YEA at 21 °C. Viability is expressed as percent
of cells that survived to form colonies compared to cells that
underwent the same cell cycle block, but were not incubated at 36
°C. rae1
cells (open symbols) in
log phase (squares) as well as those blocked by nitrogen
starvation (diamonds), hydroxyurea (triangles), or
nocodazole (circles) resulted in overlapping curves. rae1-1 cells (filled symbols) in log phase (squares), G
arrest by nitrogen starvation (diamonds), in S phase arrest with hydroxyurea (triangles), and arrest in mitosis with nocodazole (circles). D, viability of rae1-1 (filled squares), rae1-1 cdc25-22 double mutant (diamonds), and cdc25-22 cells (open
squares) after incubation at 36 °C. Viability is expressed as
percent of cells that survived to form colonies compared to cells with
the corresponding mutations that were not incubated at 36
°C.
kinase in late G2 and
early M(28) , so we determined H1 kinase activity in rae1-1 cells at nonpermissive temperature (Fig. 5B). As a
positive control, rae1-1 cells were blocked in mitosis with
nocodazole at the permissive temperature, resulting in a 3-fold
increase in kinase activity relative to log phase cells. When rae1-1 cells were incubated at nonpermissive temperature, H1
kinase activity increased 1.5-fold after 1.5 h and 5-fold after 3 h.
These results are consistent with rae1-1 cells being blocked
near the G
/M boundary.
phase by
nitrogen starvation, in early S phase by hydroxyurea, or in early
mitosis by nocodazole treatment were incubated at nonpermissive
temperature for varying periods of time while maintaining cell cycle
arrest. Cell cycle arrest did not affect the viability of wild type
cells incubated at nonpermissive temperature, indicated by the
overlapping curves in Fig. 5C. Log phase rae1-1 cells showed a steady decrease in viability with increasing time
at the nonpermissive temperature. Cell cycle arrest at G
phase or at S phase partially protected rae1-1 cells
from loss of viability. In contrast, rae1-1 cells arrested
with nocodazole were highly sensitive to increased temperature. Cells
immediately became inviable, with 1.5% survival after only 5 min at
nonpermissive temperature. These results suggest that the rae1-1 gene product is rapidly inactivated at nonpermissive temperature
and that its normal activity is essential for survival of nocodazole
block. rae1-1 cells are somewhat more sensitive to nocodazole
at permissive temperature as well. Approximately 95% of wild type cells
form colonies after 95 min in nocodazole, while only 70% of rae1-1 cells form colonies (not shown). The rae1-1 allele may
cause a defect at permissive temperature that is revealed by nocodazole
treatment.
(29) , and these cells are nearly 100% viable
on return to the permissive temperature (Fig. 5D). The cdc25-22, rae1-1 double mutant displayed a viability
intermediate to that of cdc25-22 and rae1-1 (Fig. 5D), indicating that induction of cell
division cycle arrest at G
/M partially protects rae1-1 cells from loss of viability at nonpermissive temperature.
RNA
localization in arrested rae1-1 cells that were incubated at
nonpermissive temperature. Poly(A)
RNA accumulated in
the nucleus regardless of the point of cell division cycle arrest (not
shown). This indicates that the increased viability of cells blocked in
the division cycle does not result from preventing the RNA transport
defect.Actin and Tubulin Distribution
Tubulin and actin
have characteristic cell division cycle-dependent distributions that
can be used for positioning the arrest point of cell division cycle
mutants (30) . Therefore we examined the localization of actin
and tubulin proteins in the rae1-1 mutant. Immunofluorescence
localization of actin is shown in Fig. 6, series I.
Wild type cells had the characteristic pattern of actin
distribution(30) , where actin was clustered at one or both
ends of cells with single nuclei and at the equatorial plate in cells
with two nuclei (Fig. 6I, Panels A and B). At permissive temperature rae1-1 cells had an
actin distribution similar to that of wild type cells (Fig. 6I, Panels C and D). After 15
min at nonpermissive temperature, the actin pattern of rae1-1 cells remained similar to that of wild type cells, but intensity
at the cell tips was slightly lower (Fig. 6I, Panels E and F). Within 30 min the actin pattern was
disorganized (Fig. 6I, Panels G and H). Instead of actin concentration at the ends of cells with
single nuclei, smaller actin clusters were present throughout the
cells. Cells with two nuclei had a marked reduction in the intensity of
the equatorial actin pattern.
and rae1-1 cells.
Actin (series I, panels A, C, E,
and G) and tubulin (series II, A, C, E, and G) patterns are shown. The
corresponding fields visualizing 4,6-diamidino-2-phenylindole-stained
DNA are shown in panels B, D, F, and H of each series. A and B, rae1
cells; C and D, rae1-1 cells at permissive temperature; E and F, rae1-1 cells incubated at 36 °C for 15 min
(for actin) or 30 min (for tubulin). G and H, rae1-1 cells incubated at 36 °C for 30 min (actin) or 60
min (tubulin) with the anti-AU1 antibody.
-tubulin pattern in rae1-1 cells at permissive
temperature (Fig. 6II, Panels C and D) was similar to that of wild type cells (Fig. 6II, Panels A and B), and there
was little change in the
-tubulin pattern within 30 min at
nonpermissive temperature (Fig. 6II, Panels E and F). Between 30 and 60 min,
-tubulin filaments
became disorganized, and
-tubulin was located in spots throughout
the cells (Fig. 6II, Panels G and H).
Therefore, both actin and tubulin became disorganized at the
nonpermissive temperature, but visible actin disorganization preceded
tubulin disorganization. Since cells are greater than 90% viable at a
time when cytoskeletal disorganization is observed, it is unlikely that
the disorganiztion is the indirect result of loss of viability of rae1-1 cells at nonpermissive temperature. We examined the
actin distribution of the DNA ligase temperature-sensitive mutant cdc17(13) to see if another cell cycle mutation that
results in inviability would also display the actin defect. At 4 h
after a shift to nonpermissive temperature, when 70% of the cells are
inviable, actin distribution remained normal, suggesting that actin
disorganization is not simply a result of loss of viability.rae1 Protein Localization and
Immunoprecipitation
We determined the localization of the rae1 protein by transforming rae1
cells with a plasmid that encodes the rae1 protein
tagged with the AU1 epitope. This plasmid was capable of complementing
temperature sensitivity and RNA export defects when transformed into an rae1-1 strain. By immunofluorescence microscopy the AU1-tagged rae1 protein was visible in the cytosol with reduced
fluorescence intensity in the nucleus (Fig. 7, C and D), suggesting that the protein is primarily cytosolic. A
control plasmid encoding rae1 without the epitope tag did not
give a signal (Fig. 7A), indicating that the antibody
specifically recognized the AU1 epitope.
cDNA was expressed
from the inducible nmt-1 promoter(42) . Cells that
were transformed with a plasmid that encodes the rae1 protein
tagged with the AU1 epitope (C and D) were compared
with control cells transformed with a plasmid encoding untagged rae1 (A and B). Staining with antibody to
the AU1 epitope (A and C) and with
4,6-diamidino-2-phenylindole (B and D) is
shown.
cells (lane 2)
and from rae1 null cells carrying the plasmid that expresses
AU1-tagged rae1 protein (lane 3). A band at molecular
mass of 39 kDa containing the AU1-tagged rae1 protein was seen
only in precipitations of the lysates containing the epitope-labeled
protein (compare lanes 2 and 3). A faint band at
about a molecular mass of 42 kDa where actin runs (see Fig. 8B, lane 5) is present in equal amount in
lysates with tagged (lane 3) and untagged rae1 protein (lane 2). With the exception of rae1, no
other bands were specific to the cells with AU1-tagged rae1 protein. In particular, actin (molecular mass of 41.7 kDa) and
- and
-tubulin (molecular masses of 51 and 49.3 kDa,
respectively) did not coprecipitate with rae1 protein. In
vitro transcribed and translated actin and AU1-tagged rae1 were immunoprecipitated with the anti-AU1 epitope (Fig. 8B). Again, the antibody precipitated rae1 protein but not actin (lane 3). In vitro labeled rae1 protein (lane 4) and S. pombe actin (lane 5) are shown for size comparison.
S]methionine and broken as described, and
lysates were immunoprecipitated with anti-AU1 antibody. In vitro labeled marker (M) and rae1 protein (lane
1) are shown. B, immunoprecipitation of in vitro translated actin and rae1 protein. Marker (M);
ascites fluid (lane 1); immunoprecipitation with the anti-AU1
antibody of in vitro labeled actin (lane 2) and in vitro labeled rae1 plus actin (lane 3); in vitro labeled rae1 protein (lane 4) and
actin (lane 5). The ratio of counts from rae1 protein
and from actin in the immunoprecipitation (lane 3) was the
same as the ratio of counts between rae1 and actin in lanes 4 and 5.
RNA from
the nucleus to the cytoplasm. The defect is recessive and is the result
of a single amino acid change in the rae1 gene. The loss of
RNA export is seen soon after a shift to the nonpermissive temperature,
and within 30 min all cells have accumulated poly(A)
RNA in the nucleus with a concomitant loss in the cytoplasm.
Similarly, actin cytoskeleton and cytoplasmic microtubular structures
become disorganized after shift of the mutant to the nonpermissive
temperature. Finally, the terminal phenotype of the cells is one of a
G
length with a single nucleus of 2C DNA content.
RNA(4, 6, 11) .
Alleles of RNA1, SRM1/PRP20/MTR1, and RAT1 confer defects in splicing, transcript initiation, and 3`-end
formation of mRNA as well as RNA
export(4, 6, 11) . Although we cannot rule
out the possibility that other transcripts are defective, the three
genes examined here appear to generate normal transcripts in rae1-1. The S. pombe pim 1-46 also displays a
transient defect in RNA export and a cell division cycle arrest in
G
/M(11) . The rae1-1 mutant differs from pim 1-46 in that RNA export defect is irreversible after
approximately 30 min. Thus the rae1, SRM1/PRP20/MTR1, RAT1, and pim 1 genes probably perform different
functions in RNA export. Further, the rae1-1 mutant has
disorganized actin and tubulin structures. It is not known if other RNA
export mutants have this phenotype.
RNA in the rae1-1 nucleus suggests
that rae1 could be directly involved in the export process.
The active transport of mRNA could require several components: the
ribonucleoprotein particle, the nuclear pore complex, possibly
microfilaments that guide the ribonucleoprotein particle to its
destination, and a motor or energy source for the translocation. Actin
mislocalization also occurs quickly in rae1-1 cells, and
subtle changes may occur earlier than those detected here. It is
possible that RNA export is defective in rae1-1 cells as a
result of inappropriate microfilament structure and function. Intact
microfilament structure has been shown to be necessary for correct
localization of actin mRNA(31) .
-transducins. The
-transducin repeat domain has been proposed to mediate interaction
with proteins that contain a tetratricopeptide repeat and this has been
demonstrated for SSN6/TUP1(34) . Transducin
repeat-containing proteins are not necessarily
subunits of
transducins but can be involved in a variety of cellular processes. Of
particular interest here are PRP4 of S. cerevisiae which is involved in mRNA splicing (35) and BUB3 and CDC20, components of cell division cycle
regulation(24, 36) .
We thank Charles Cole and Alan Tartakoff for
discussing results prior to publication, Michael Henry for excellent
technical assistance, Paul Nurse and Michael Wigler for libraries, Judy
Potashkin for mutants, Francoise Stutz and Hao-peng Xu for helpful
discussions, and Carl Baker, James Gnarra, and Anita Roberts for
helpful comments on the manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
I. Pfeifer, R. Elsby, M. Fernandez, P. A. Faria, D. R. Nussenzveig, I. S. Lossos, B. M. A. Fontoura, W. D. Martin, and G. N. Barber NFAR-1 and -2 modulate translation and are required for efficient host defense PNAS, March 18, 2008; 105(11): 4173 - 4178. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Farny, J. A. Hurt, and P. A. Silver Definition of global and transcript-specific mRNA export pathways in metazoans Genes & Dev., January 1, 2008; 22(1): 66 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Satterly, P.-L. Tsai, J. van Deursen, D. R. Nussenzveig, Y. Wang, P. A. Faria, A. Levay, D. E. Levy, and B. M. A. Fontoura Influenza virus targets the mRNA export machinery and the nuclear pore complex PNAS, February 6, 2007; 104(6): 1853 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Wong, G. Blobel, and E. Coutavas Rae1 interaction with NuMA is required for bipolar spindle formation PNAS, December 26, 2006; 103(52): 19783 - 19787. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Baker, K. B. Jeganathan, L. Malureanu, C. Perez-Terzic, A. Terzic, and J. M.A. van Deursen Early aging-associated phenotypes in Bub3/Rae1 haploinsufficient mice. J. Cell Biol., February 13, 2006; 172(4): 529 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kendirgi, D. J. Rexer, A. R. Alcazar-Roman, H. M. Onishko, and S. R. Wente Interaction between the Shuttling mRNA Export Factor Gle1 and the Nucleoporin hCG1: A Conserved Mechanism in the Export of Hsp70 mRNA Mol. Biol. Cell, September 1, 2005; 16(9): 4304 - 4315. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Carnahan, A. Feoktistova, L. Ren, S. Niessen, J. R. Yates III, and K. L. Gould Dim1p Is Required for Efficient Splicing and Export of mRNA Encoding Lid1p, a Component of the Fission Yeast Anaphase-Promoting Complex Eukaryot. Cell, March 1, 2005; 4(3): 577 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suntharalingam, A. R. Alcazar-Roman, and S. R. Wente Nuclear Export of the Yeast mRNA-binding Protein Nab2 Is Linked to a Direct Interaction with Gfd1 and to Gle1 Function J. Biol. Chem., August 20, 2004; 279(34): 35384 - 35391. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Bai, J. Rouquette, M. Umeda, W. Faigle, D. Loew, S. Sazer, and V. Doye The Fission Yeast Nup107-120 Complex Functionally Interacts with the Small GTPase Ran/Spi1 and Is Required for mRNA Export, Nuclear Pore Distribution, and Proper Cell Division Mol. Cell. Biol., July 15, 2004; 24(14): 6379 - 6392. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Thakurta, G. Gopal, J. H. Yoon, T. Saha, and R. Dhar Conserved Nuclear Export Sequences in Schizosaccharomyces pombe Mex67 and Human TAP Function in mRNA Export by Direct Nuclear Pore Interactions J |