JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, J. A.
Right arrow Articles by Dhar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, J. A.
Right arrow Articles by Dhar, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7411-7419
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Mutation in the Schizosaccharomyces pombe rae1 Gene Causes Defects in Poly(A) RNA Export and in the Cytoskeleton (*)

(Received for publication, June 11, 1994; and in revised form, November 17, 1994)

Julie A. Brown (§) Anekella Bharathi Anil Ghosh William Whalen Ellen Fitzgerald (1) Ravi Dhar (¶)

From the Laboratory of Molecular Virology and Surgery Branch, NCI, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A collection of fission yeast Schizosaccharomyces pombe conditional mutants was screened for defective nucleocytoplasmic transport of poly(A) RNA by fluorescence in situ hybridization. We identified a temperature-sensitive mutant that accumulated poly(A) RNA in the nucleus and have named it rae1-1, for ribonucleic acid export. All rae1-1 cells exhibit the defect in poly(A) RNA export within 30 min following a shift to the nonpermissive temperature. In addition, in the rae1-1 mutant, actin and tubulin become disorganized, and cells undergo an irreversible cycle arrest. Results from experiments in which rae1-1 cells were arrested in various phases of the cell division cycle and then shifted to nonpermissive temperature suggest that cells are particularly vulnerable to loss of rae1 function during G(2)/M. However, the inability to export RNA from the nucleus to the cytoplasm was not limited to a particular phase of the cell division cycle. The rae1 gene was isolated by complementation and encodes a predicted protein of 352 amino acids with four beta-transducin/WD40 repeats.


INTRODUCTION

Multiple steps are involved in the maturation of mRNA from initiation of transcription to transport to the site of translation. Splicing, 3`-end formation, and polyadenylation are well studied RNA maturation events that can be regulated(1) . RNA export from the nucleus to the cytoplasm is another potential step for regulating gene expression. To elucidate the factors involved in RNA export, we and others have identified RNA transport mutations in either Saccharomyces cerevisiae or Schizosaccharomyces pombe.

All of the RNA transport mutations identified to date affect other cellular processes as well. RNA1 affects nucleocytoplasmic localization of RNA in S. cerevisiae(2, 3) , as well as 5`-end formation, 3`-end formation, and poly(A) length(4) . Mutations in the S. cerevisiae SRM1/PRP20/MTR1 gene cause defects in RNA production that are similar to RNA1(4, 5, 6) . This gene is a member of a family of related genes that includes the hamster RCC1 gene (7) and pim1 in S. pombe(8) . RCC1 and pim1 were identified as regulators of chromatin condensation during the cell division cycle (8, 9, 10) and have since been shown to affect nucleocytoplasmic transport of poly(A) RNA(11) . The S. cerevisiae RAT1 gene is proposed to affect transcription as well as RNA export(12) . It is not yet clear how the products of these genes participate in RNA transport. To understand the process of RNA transport, we screened a collection of temperature-sensitive S. pombe mutants for conditional RNA export defects. Here we report the characterization of the rae1-1 mutant and the isolation of a gene that complements this defect.


MATERIALS AND METHODS

Strains and Culture

Strain 972 (h) was mutagenized. JBP15 (h, ura4-D18, leu1-32) was mated to the rae1-1 mutant for backcrossing. JBP48 (hrae1-1, ura4-D18, leu1-32), the product of two backcrosses to JBP15, was used for further studies. JBP101 (h, rae1-1, ura4-D18) was used for gene replacement, and SP816/SP826 (h, leu1-32, ura4-D18, ade6-210/h, leu1-32, ura4-D18, ade6-216) (gift of David Beach) was used for gene disruption. JBP102 (hrae1-1), the product of two backcrosses of JBP48 with strain 972, was used for cell cycle analysis. FYC5 (h, cdc25-22) is from the Cold Spring Harbor Fission yeast course. The cdc17 strain (h, cdc17-M75) was isolated by Naysmyth(13) . Standard techniques for yeast culture and genetic analysis were used(14, 15, 16) .

Isolation of Mutants

Ethyl methanesulfonate mutagenesis of strain 972 was performed as previously described (16) to a rate of 40% viability. A collection of 201 mutants and an additional 144 mutants (gift from J. Potashkin) were screened. The temperature-sensitive mutants were grown at 36 °C for 3 h and screened for defects in RNA transport by fluorescence in situ hybridization using a digoxygenin-labeled 50-nucleotide oligo(dT) probe to detect poly(A) RNA according to Forrester et al.(4) , with the following modifications. Cells were fixed with 4% formaldehyde (pH 7.5), washed, and converted to spheroplasts by digestion with with 0.4 µg/ml Zymolyase 100T (Miles) in 1 M sorbitol, 50 mM citrate, 4 mM EDTA, 0.2% beta-mercaptoethanol for 40 min. Cells were spotted onto polylysine-treated slides, hybridized, washed, and incubated with fluorescein isothiocyanate-conjugated anti-digoxygenin Fab antibody fragment (Boehringer Mannheim) as described elsewhere(4) .

Cloning the rae1 Gene

The gene was cloned by complementation of temperature sensitivity from a Sau3A partially digested genomic library in the vector pDW232 (gift of P. Nurse) transformed into the JBP48 strain. The cDNA clone was isolated from a zap cDNA library (gift of M. Wigler) by hybridization with the genomic clone. DNA sequencing of both strands of the cDNA clone was performed using the Sequenase kit (U. S. Biochemical Corp.). Marker rescue experiments were performed as previously described(17) . The rae1-1 allele was isolated from genomic DNA by polymerase chain reaction. Primers CTACCACAACTATTAGAATGT and CTCATGCCTCAACAGGATTG span the ATG codon and the termination codon, respectively. The 1.5-kilobase polymerase chain reaction products were cloned into the TA cloning vector (Invitrogen) and sequenced. The rae1-1 allele had a single mutation encoding a change from glycine 219 to glutamic acid. Sequence analysis was performed with GCG programs(18) . Two-step gene replacement was performed as previously described(19) . The plasmid shown in Fig. 2was deleted of the NarI-SalI ARS fragment, as well as the remaining genomic sequences (PvuII-SmaI). The resulting plasmid containing the rae1 gene and the ura4 gene was linearized with XhoI and transformed into JBP101. Transformants were selected for uracil prototrophy at permissive temperature. Stable integration into the rae1-1 locus was confirmed by Sourthern analysis, and these were temperature-resistant. Loss of the ura4 gene from ura4 recombinants was selected for on 5-fluoroorotic acid, and the resulting uracil minus recombinants was tested for temperature sensitivity. Southern analysis confirmed recombining out of the ura4 gene at the rae1 locus.


Figure 2: Diagram of the rae1 genomic clone. The rae1 gene is contained within a 5.3-kilobase insertion of genomic DNA indicated by the horizontal line. The three exons (black boxes) and two introns (open boxes) are indicated. The vector pDW232 contains the S. pombe ars1 fragment, ura4 gene, and the Escherichia coli beta-lactamase gene, indicated by shaded boxes.



For rae1 gene disruption, a plasmid was constructed by deleting the NarI-SalI ARS fragment and the PvuII-EspI ura4 fragment from the plasmid shown in Fig. 2. The approximately 800-base pair XhoI-FspI fragment from the rae1 gene was replaced with the ura4 gene. The HindIII fragment containing only the rae1::ura4 disruption was isolated and transformed into the diploid strain SP816/SP826. Screening for stable integration was done by polymerase chain reaction analysis using oligos from the ura4 gene and from rae1 flanking sequences that were outside of those included on the transformed DNA. Those clones with fragments of the expected length for ura4 replacement of the rae1 gene were confirmed by Southern analysis. The heterozygous diploids were sporulated at permissive temperature, and tetrad analysis was performed.

Cell Division Cycle Analysis

Cells arrested in G(1) phase were prepared by nitrogen starvation(16) . Cells arrested in S phase were prepared by hydroxyurea treatment (12 mM) for 4 h. Cells were arrested in mitosis with 70 µg/ml nocodazole treatment in the presence of 0.1% Me(2)SO for 100 min. Arrested cells were then incubated at 36 °C under cell cycle arrest conditions (either hydroxyurea or nocodazole) and then plated at permissive temperature on rich media (YEA) to assess viability. Colonies were counted after 9 days, and viability was expressed as the percentage of cells incubated at nonpermissive temperature that survived to form colonies compared to cells that underwent the same cell cycle block, but were not incubated at nonpermissive temperature. DNA content was measured in fixed, propidium iodide-stained cells (16) using an EPICS 753.

Fluorescence Localization of Actin and Tubulin, and rae1 Proteins

rae1 and rae1-1 cells were incubated at permissive or nonpermissive temperature for varying times and then fixed and incubated with rhodamine-conjugated phalloidin for actin detection. Tubulin was detected by incubating fixed cells with a mouse monoclonal anti-alpha tubulin antibody (clone DM1-a, Sigma), washing, and then incubation with a rhodamine-labeled anti-immunoglobulin antibody. The rae1 cDNA was tagged at the amino terminus with the 5-amino acid AU1 epitope(20) . The plasmid carrying the tagged gene was transformed into rae1 cells, and indirect immunofluorescence microscopy was performed as described elsewhere (16) using antibody to the AU1 epitope(20) .

Immunoprecipitations

Lysates were prepared as previously described(21) . Logarithmically growing cells were labeled with 1 mCi of [S]methionine and 1 mCi of [S]cysteine in a volume of 10 ml for 1 h at 30 °C. Then phenylmethylsulfonyl fluoride, N-tosyl-L-phenylalanine chloromethyl ketone, and N-p-tosyl-L-lysine chloromethyl ketone (Sigma) were added to a concentration of 100 µg/ml. Cells were then washed and resuspended in 50 mM Tris, 50 mM NaCl, 0.2% Triton X-100, broken with glass beads, and spun, and the supernatants were recovered. Lysates were mixed with the mouse monoclonal antibody to the AU1 epitope (20) and with protein A-Sepharose. The Sepharose beads were then washed six times with breaking buffer, and the proteins were eluted in Laemmli buffer and fractionated on a 4-20% gradient polyacrylamide gel. The actin and rae1 proteins were cloned into to TA vector (Invitrogen) and then transcribed and translated in vitro using [S]methionine as recommended by the manufacturer.


RESULTS

A collection of S. pombe temperature-sensitive mutants was screened for defects in RNA transport by fluorescence in situ hybridization. A single mutant was isolated that conditionally accumulated poly(A) RNA in the nucleus at nonpermissive temperature. We have named this mutant rae1-1, for ribonucleic acid export. Tetrad dissections showed that temperature sensitivity and the RNA localization defect cosegregated in all 10 tetrads analyzed for both phenotypes. Diploids that were heterozygous for rae1-1 were not temperature sensitive and exhibited a wild type RNA localization, indicating that the mutation is recessive (not shown).

We compared the poly(A) RNA distribution in rae1-1 at permissive temperature (21 °C) with its distribution at various times following a shift to nonpermissive temperature (36 °C), shown in Fig. 1. At the permissive temperature the poly(A) RNA was uniformly distributed throughout the cells (Fig. 1, panels C and D). Wild type cells showed the same fluorescence pattern (not shown). After 5 min at the nonpermissive temperature, the poly(A) RNA signal was brighter in the nucleus than in the cytoplasm in approximately 30% of rae1-1 cells (Fig. 1, panels E and F). The percentage of cells with defective RNA localization increased with time at the nonpermissive temperature (Fig. 1, panels G and H, 15 min) and reached 100% by 30 min (Fig. 1, panels I and J). With increasing time at the nonpermissive temperature, the intensity of the nuclear signal increased, while the intensity of cytoplasmic fluorescence decreased (compare panels G and I). The decrease in cytoplasmic signal may reflect a normal short mRNA half-life, since the average half-life of mRNA is approximately 20 min in S. cerevisiae(22) .


Figure 1: Localization of polyA RNA in rae1-1 cells. RNA was detected with fluorescence in situ hybridization of an digoxygenin-labeled dT50 probe followed by incubation with an fluorescein isothiocyanate-labeled anti-digoxygenin antibody. Panels A, C, E, G, I, and K show the polyA RNA distribution visualized as fluorescein isothiocyanate, while panels B, D, F, H, J, and L show the 4,6-diamidino-2-phenylindole-stained DNA of the corresponding fields. A and B, rae1-1 cells were incubated with competitor oligo(dT) as a control for background fluorescence of the anti-digoxygenin antibody; C and D, rae1-1 cells incubated at 21 °C; E and F, rae1-1 incubated at 36 °C for 5 min; G and H, 15 min; I and J, 30 min; K and L, rae1-1 cells incubated at 36 °C 30 min and then returned to 21 °C for 120 min.



Cells that were hybridized with excess competitor oligo(dT) did not have a fluorescence signal (Fig. 1, panels A and B), indicating a low background fluorescence from the anti-digoxygenin antibody. Similarly, pretreatment of cells with RNase T1 and RNase A eliminated the fluorescence signal (not shown), demonstrating that the probe was specific for poly(A) RNA. Fluorescence microscopy using acridine orange to detect total RNA showed that stable RNA was present in the cytoplasm of rae1-1 for at least 120 min at nonpermissive temperature (not shown). These observations are consistent with the oligo(dT) probe specifically detecting polymerase II derived poly(A) RNA.

We then determined if the defect in poly(A) RNA transport was reversible. rae1-1 cells that were incubated at nonpermissive temperature for varying periods of time were returned to permissive temperature for 120 min and subjected to in situ hybridization. All of the rae1-1 cells that were incubated at nonpermissive temperature for 5 min returned to the wild type pattern of cytoplasmic poly(A) RNA localization (not shown). However, after 30 min of incubation at nonpermissive temperature, only 20% of cells returned to the wild type pattern (panel K), suggesting that the defect is essentially irreversible. Cells were examined for viability by exclusion of methylene blue dye and were found to be greater then 90% viable after 50 min at the nonpermissive temperature.

Cloning the rae1 Gene

The rae1 gene was cloned by complementation of rae1-1 temperature sensitivity. Complementation of the temperature-sensitive defect correlated with a wild type pattern of fluorescence hybridization. The genomic clone contained a 5.3-kilobase insertion of yeast DNA (Fig. 2). Hybridization with the genomic clone identified three cDNA clones that corresponded to three separate regions of the genomic clone. Each of these cDNA clones was used in marker rescue experiments to determine which one encoded the rae1 gene. Only one cDNA clone was able to rescue the rae1-1 temperature sensitivity, and we have designated this the rae1 gene.

To provide further evidence that the rae1 gene is not an extragenic high copy suppressor of the rae1-1 mutation, we performed a two-step gene replacement as described in the methods. Both rae1 and rae1-1 phenotypes were recovered, indicating that rae1-1 is an allele of the cloned rae1 gene. Southern analysis confirmed that integration and recombining out of the ura4 gene occurred at the rae1 locus.

A diploid strain heterozygous for a rae1::ura4 disruption was constructed as described under ``Materials and Methods.'' Analysis of nine tetrads resulted in 2:2 segregation for viability in each tetrad. At 16 days, microscopic examination of the spores that did not form colonies revealed that, of 18 spores, 12 remained round, 4 had begun to elongate, and 2 appeared to have germinated but did not divide. The two viable colonies from every tetrad were uracil auxotrophs, suggesting that the rae1 gene is required for spore germination. The minority of spores that elongated may have received enough rae1 protein to progress to germination. To determine if the rae1 protein is also required for mitotic cell growth, the heterozygous diploid was sporulated in the presence of a plasmid containing the rae1 cDNA and a selectable leu1 gene. Haploids with the rae1::ura4 disruption were then tested for loss of the plasmid. No leucine auxotrophs were recovered, indicating that rae1 is required for mitotic cell growth as well as for spore germination.

The rae1 gene encodes a 352-amino acid protein and has two introns of 50 and 419 nucleotides (Fig. 3A) which were identified by comparison of the cDNA clone with the genomic clone. The rae1-1 allele was isolated as described under ``Materials and Methods'' and was found to encode a single mutation of glycine 219 to glutamic acid.



Figure 3: A, nucleotide sequence of the rae1-1 gene. The noncoding strand is shown, and nucleotide positions are indicated on the right. The predicted amino acid sequence is below. B, alignment of the predicted amino acid sequences of BUB3 and rae1-1. The beta-transducin repeat consensus sequence is shown on the first line, above BUB3. Amino acids in BUB3 and rae1 that fit the consensus are shown in boldface. The residues that are identical in BUB3 and rae1 are indicated by bars, and colons indicate conservative substitutions. Periods represent gaps introduced for alignment. Glycine 219, which is mutated to glutamic acid in rae1-1, is indicated in outline.



Comparison of the predicted amino acid sequence with sequences in the GenBank data base showed that rae1 shares significant sequence similarity with genes that encode beta-transducin/WD40 repeat-containing proteins(23) . In most cases the similarity was restricted to the repeats. However, rae1 shared similarity with the S. cerevisiae BUB3 gene (24) outside of the beta-transducin repeats. Fig. 3B shows the alignment of the BUB3 amino acid sequence with that of rae1. Analysis of their predicted amino acid sequences indicates that rae1 and BUB3 both have four regions of similarity to the beta-transducin repeat consensus sequence (25) . Amino acids 197-282 of rae1 have 37% identity with amino acids 170-279 of BUB3. The similarity is 57% if conservative substitutions are considered. There is also a region of slightly less similarity between BUB3 and rae1 at the amino terminus, with 33% identity and 50% with conservative substitutions. The rae1-1 allele contained a single point mutation in the region of greatest similarity between rae1 and BUB3: amino acid 219 is mutated from glycine to glutamic acid. BUB3 has a conservative substitution of serine at the corresponding position.

RNA Analysis

Mutations in SRM1/PRP20/MTR1 and RNA1 cause defects in RNA processing as well as RNA export (4) . To determine if splicing was defective in rae1-1 mutants, total cellular RNA was isolated from rae1-1 cells at various times after a shift to the nonpermissive temperature and subjected to Northern analysis. A probe of the genomic rae1 gene that would detect both intron and exon sequences hybridized to a single RNA species of approximately 1.5 kilobases (Fig. 4). RNA from wild type cells (lane 1) and rae1-1 cells at the permissive temperature (lane 3) showed a single rae1 RNA band of the same size. rae1-1 cells that were transformed with a multicopy plasmid containing the genomic rae1 gene possessed a greater quantity of rae1-1 RNA (lane 2) than wild type cells (lane 1). At 30 min following a shift to nonpermissive temperature, a time when 100% of the cells exhibited the defect in RNA export (Fig. 1I), there was no change in the size of rae1 RNA, indicating that rae1 mRNA continued to undergo splicing at the nonpermissive temperature. This Northern blot was hybridized with an alpha-tubulin exon probe(23, 26) that detected a single band of the expected size for mature alpha-tubulin mRNA (Fig. 4B). A probe from the alpha-tubulin intron did not detect pre-mRNA (not shown). Based on our analysis of the two intron containing genes rae1 and alpha-tubulin, we conclude that splicing is probably not defective in the rae1-1 mutant.


Figure 4: Northern analysis of wild type and rae1-1 mutants. Total RNA was extracted(40) , fractionated on a 1% agarose/formaldehyde gel, and transferred to nitrocellulose. A, the blot was sequentially hybridized with P-labeled probes of a rae1 genomic fragment, alpha-tubulin fragment, and an actin gene polymerase chain reaction product, with stripping of the previous probe prior to the next hybridization. The transcripts and their sizes are indicated at the left. Lane 1, RNA from rae1 cells; lane 2, RNA from rae1-1 cells transformed with a plasmid containing the rae1 gene; lane 3, RNA from rae1-1 cells at permissive temperature. RNA was isolated from rae1-1 cells incubated at 36 °C for varying times; lane 4, 30 min; lane 5, 1 h; lane 6, 1.5 h.



Although the rae1 and alpha-tubulin mRNAs appeared to be correctly spliced, a small, gradual decrease in the amount of both RNA species occurred with time at the nonpermissive temperature (lanes 4-6). The same Northern blot was hybridized with an actin probe (Fig. 4C), which detected the three actin RNA species generated by the intronless actin gene of S. pombe(27) . Actin RNA was more stable than rae1 and alpha-tubulin RNA after the shift to nonpermissive temperature. There were no detectable changes in the length of the three actin RNAs. Longer exposures (not shown) of each of these probes did not reveal any additional bands. Together with the constant size of the rae1 and alpha-tubulin RNAs, these results suggest that there are no gross abnormalities of other events involved in generation of mature mRNA in the rae1-1 mutant.

Cell Cycle Analysis

rae1-1 cells held at the nonpermissive temperature appeared to accumulate as individual cells of uniform size with a single nucleus, suggesting a cell cycle arrest. To investigate this possibility, we measured the DNA content of rae1-1 cells at permissive and nonpermissive temperatures by flow cytometry analysis. As markers for 1C and 2C DNA content we analyzed wild type cells arrested in G(1) phase of the cell division cycle by nitrogen starvation and wild type cells in log phase growth at permissive temperature, respectively (Fig. 5A, top panel). rae1-1 cells in log phase growth at permissive temperature had a DNA content similar to wild type cells (Fig. 5A). Incubation of rae1-1 cells at nonpermissive temperature for 3 h resulted in a DNA content of 2C (Fig. 5A, right peak of the bottom panel). We conclude that rae1-1 cells arrest after DNA replication at the nonpermissive temperature.


Figure 5: Cell division cycle analysis of rae1-1. A, DNA content of propidium iodide-stained cells was measured by flow cytometry. Top panel, histograms of control cells to locate the amount of fluorescence that corresponds to 1C and 2C DNA content, indicated at the top of the histogram. Left peak, wild type cells that were blocked in G(1) by nitrogen starvation; right peak, log phase cells indicate 2C DNA content. Bottom panel, DNA content of rae1-1 cells (left peak) in log phase growth at 21 °C and (right peak) rae1-1 cells incubated at 36 °C for 3 h. B, H1 kinase activity. rae1-1 cells were incubated for 1.5 or 3 h at the indicated temperature, and extracts were prepared (13) and assayed for H1 kinase activity(41) . Activities are expressed relative to that of rae1-1 cells at permissive temperature. C, viability experiments in which rae1 cells or rae1-1 cells were first arrested in the cell division cycle and then incubated for varying amounts of time at 36 °C in arrest conditions and then plated on YEA at 21 °C. Viability is expressed as percent of cells that survived to form colonies compared to cells that underwent the same cell cycle block, but were not incubated at 36 °C. rae1 cells (open symbols) in log phase (squares) as well as those blocked by nitrogen starvation (diamonds), hydroxyurea (triangles), or nocodazole (circles) resulted in overlapping curves. rae1-1 cells (filled symbols) in log phase (squares), G(1) arrest by nitrogen starvation (diamonds), in S phase arrest with hydroxyurea (triangles), and arrest in mitosis with nocodazole (circles). D, viability of rae1-1 (filled squares), rae1-1 cdc25-22 double mutant (diamonds), and cdc25-22 cells (open squares) after incubation at 36 °C. Viability is expressed as percent of cells that survived to form colonies compared to cells with the corresponding mutations that were not incubated at 36 °C.



The failure to observe cells with two nuclei suggested that cells were blocked prior to nuclear division. Increases in H1 kinase have been related to the activation of p34 kinase in late G2 and early M(28) , so we determined H1 kinase activity in rae1-1 cells at nonpermissive temperature (Fig. 5B). As a positive control, rae1-1 cells were blocked in mitosis with nocodazole at the permissive temperature, resulting in a 3-fold increase in kinase activity relative to log phase cells. When rae1-1 cells were incubated at nonpermissive temperature, H1 kinase activity increased 1.5-fold after 1.5 h and 5-fold after 3 h. These results are consistent with rae1-1 cells being blocked near the G(2)/M boundary.

To assess the relationship of rae1 function with the cell division cycle, viability and RNA export were examined in cells that were shifted to nonpermissive temperature during arrest at various phases of the cell division cycle. rae1-1 cells that were arrested in G(1) phase by nitrogen starvation, in early S phase by hydroxyurea, or in early mitosis by nocodazole treatment were incubated at nonpermissive temperature for varying periods of time while maintaining cell cycle arrest. Cell cycle arrest did not affect the viability of wild type cells incubated at nonpermissive temperature, indicated by the overlapping curves in Fig. 5C. Log phase rae1-1 cells showed a steady decrease in viability with increasing time at the nonpermissive temperature. Cell cycle arrest at G(1) phase or at S phase partially protected rae1-1 cells from loss of viability. In contrast, rae1-1 cells arrested with nocodazole were highly sensitive to increased temperature. Cells immediately became inviable, with 1.5% survival after only 5 min at nonpermissive temperature. These results suggest that the rae1-1 gene product is rapidly inactivated at nonpermissive temperature and that its normal activity is essential for survival of nocodazole block. rae1-1 cells are somewhat more sensitive to nocodazole at permissive temperature as well. Approximately 95% of wild type cells form colonies after 95 min in nocodazole, while only 70% of rae1-1 cells form colonies (not shown). The rae1-1 allele may cause a defect at permissive temperature that is revealed by nocodazole treatment.

A similar experiment was performed using a double mutant of rae1-1 and cdc25-22. The temperature-sensitive cdc25-22 mutation results in cell division cycle arrest in late G(2)(29) , and these cells are nearly 100% viable on return to the permissive temperature (Fig. 5D). The cdc25-22, rae1-1 double mutant displayed a viability intermediate to that of cdc25-22 and rae1-1 (Fig. 5D), indicating that induction of cell division cycle arrest at G(2)/M partially protects rae1-1 cells from loss of viability at nonpermissive temperature.

The difference in viability resulting from shifting the temperature of rae1-1 cells at different phases of the cell division cycle raised the possibility that the defect in RNA export may be different in arrested cells. Therefore we examined poly(A) RNA localization in arrested rae1-1 cells that were incubated at nonpermissive temperature. Poly(A) RNA accumulated in the nucleus regardless of the point of cell division cycle arrest (not shown). This indicates that the increased viability of cells blocked in the division cycle does not result from preventing the RNA transport defect.

Actin and Tubulin Distribution

Tubulin and actin have characteristic cell division cycle-dependent distributions that can be used for positioning the arrest point of cell division cycle mutants (30) . Therefore we examined the localization of actin and tubulin proteins in the rae1-1 mutant. Immunofluorescence localization of actin is shown in Fig. 6, series I. Wild type cells had the characteristic pattern of actin distribution(30) , where actin was clustered at one or both ends of cells with single nuclei and at the equatorial plate in cells with two nuclei (Fig. 6I, Panels A and B). At permissive temperature rae1-1 cells had an actin distribution similar to that of wild type cells (Fig. 6I, Panels C and D). After 15 min at nonpermissive temperature, the actin pattern of rae1-1 cells remained similar to that of wild type cells, but intensity at the cell tips was slightly lower (Fig. 6I, Panels E and F). Within 30 min the actin pattern was disorganized (Fig. 6I, Panels G and H). Instead of actin concentration at the ends of cells with single nuclei, smaller actin clusters were present throughout the cells. Cells with two nuclei had a marked reduction in the intensity of the equatorial actin pattern.


Figure 6: Fluorescence localization of actin and tubulin in rae1 and rae1-1 cells. Actin (series I, panels A, C, E, and G) and tubulin (series II, A, C, E, and G) patterns are shown. The corresponding fields visualizing 4,6-diamidino-2-phenylindole-stained DNA are shown in panels B, D, F, and H of each series. A and B, rae1 cells; C and D, rae1-1 cells at permissive temperature; E and F, rae1-1 cells incubated at 36 °C for 15 min (for actin) or 30 min (for tubulin). G and H, rae1-1 cells incubated at 36 °C for 30 min (actin) or 60 min (tubulin) with the anti-AU1 antibody.



Tubulin localization was also examined by immunofluorescence microscopy (Fig. 6, series II). The alpha-tubulin pattern in rae1-1 cells at permissive temperature (Fig. 6II, Panels C and D) was similar to that of wild type cells (Fig. 6II, Panels A and B), and there was little change in the alpha-tubulin pattern within 30 min at nonpermissive temperature (Fig. 6II, Panels E and F). Between 30 and 60 min, alpha-tubulin filaments became disorganized, and alpha-tubulin was located in spots throughout the cells (Fig. 6II, Panels G and H). Therefore, both actin and tubulin became disorganized at the nonpermissive temperature, but visible actin disorganization preceded tubulin disorganization. Since cells are greater than 90% viable at a time when cytoskeletal disorganization is observed, it is unlikely that the disorganiztion is the indirect result of loss of viability of rae1-1 cells at nonpermissive temperature. We examined the actin distribution of the DNA ligase temperature-sensitive mutant cdc17(13) to see if another cell cycle mutation that results in inviability would also display the actin defect. At 4 h after a shift to nonpermissive temperature, when 70% of the cells are inviable, actin distribution remained normal, suggesting that actin disorganization is not simply a result of loss of viability.

rae1 Protein Localization and Immunoprecipitation

We determined the localization of the rae1 protein by transforming rae1 cells with a plasmid that encodes the rae1 protein tagged with the AU1 epitope. This plasmid was capable of complementing temperature sensitivity and RNA export defects when transformed into an rae1-1 strain. By immunofluorescence microscopy the AU1-tagged rae1 protein was visible in the cytosol with reduced fluorescence intensity in the nucleus (Fig. 7, C and D), suggesting that the protein is primarily cytosolic. A control plasmid encoding rae1 without the epitope tag did not give a signal (Fig. 7A), indicating that the antibody specifically recognized the AU1 epitope.


Figure 7: Immunofluorescence localiztion of rae1 protein. The rae1 cDNA was expressed from the inducible nmt-1 promoter(42) . Cells that were transformed with a plasmid that encodes the rae1 protein tagged with the AU1 epitope (C and D) were compared with control cells transformed with a plasmid encoding untagged rae1 (A and B). Staining with antibody to the AU1 epitope (A and C) and with 4,6-diamidino-2-phenylindole (B and D) is shown.



Since a loss of wild type rae1 function results in early disruption of actin and later of tubulin organization, we looked for a physical interaction between the rae1 protein and actin or tubulin. We asked if actin or tubulin could be coimmunoprecipitated with the AU1-tagged rae1 protein (Fig. 8). In vitro labeled rae1 protein is shown in lane 1. Immunoprecipitations were performed from rae1 cells (lane 2) and from rae1 null cells carrying the plasmid that expresses AU1-tagged rae1 protein (lane 3). A band at molecular mass of 39 kDa containing the AU1-tagged rae1 protein was seen only in precipitations of the lysates containing the epitope-labeled protein (compare lanes 2 and 3). A faint band at about a molecular mass of 42 kDa where actin runs (see Fig. 8B, lane 5) is present in equal amount in lysates with tagged (lane 3) and untagged rae1 protein (lane 2). With the exception of rae1, no other bands were specific to the cells with AU1-tagged rae1 protein. In particular, actin (molecular mass of 41.7 kDa) and alpha- and beta-tubulin (molecular masses of 51 and 49.3 kDa, respectively) did not coprecipitate with rae1 protein. In vitro transcribed and translated actin and AU1-tagged rae1 were immunoprecipitated with the anti-AU1 epitope (Fig. 8B). Again, the antibody precipitated rae1 protein but not actin (lane 3). In vitro labeled rae1 protein (lane 4) and S. pombe actin (lane 5) are shown for size comparison.


Figure 8: Immunoprecipitation of AU1-tagged rae1 protein. A, rae1 null cells that were transformed with a plasmid that encodes the rae1 protein tagged with the AU1 epitope (lane 3) were compared with wild type 972 cells (lane 2). Cells were labeled with [S]methionine and broken as described, and lysates were immunoprecipitated with anti-AU1 antibody. In vitro labeled marker (M) and rae1 protein (lane 1) are shown. B, immunoprecipitation of in vitro translated actin and rae1 protein. Marker (M); ascites fluid (lane 1); immunoprecipitation with the anti-AU1 antibody of in vitro labeled actin (lane 2) and in vitro labeled rae1 plus actin (lane 3); in vitro labeled rae1 protein (lane 4) and actin (lane 5). The ratio of counts from rae1 protein and from actin in the immunoprecipitation (lane 3) was the same as the ratio of counts between rae1 and actin in lanes 4 and 5.




DISCUSSION

We have identified a S. pombe temperature-sensitive mutant that is defective in export of poly(A) RNA from the nucleus to the cytoplasm. The defect is recessive and is the result of a single amino acid change in the rae1 gene. The loss of RNA export is seen soon after a shift to the nonpermissive temperature, and within 30 min all cells have accumulated poly(A) RNA in the nucleus with a concomitant loss in the cytoplasm. Similarly, actin cytoskeleton and cytoplasmic microtubular structures become disorganized after shift of the mutant to the nonpermissive temperature. Finally, the terminal phenotype of the cells is one of a G(2) length with a single nucleus of 2C DNA content.

The rae1-1 phenotypes differ from those of several other RNA export mutants. The rate at which the RNA transport defect appears after temperature shift differs among the mutants. Within 30 min, rae1-1 cells all display the export defect, while S. cerevisiae mutations in the SRM1/PRP20/MTR1 or RAT1 genes require from 1 to 3 h for all cells to accumulate nuclear poly(A) RNA(4, 6, 11) . Alleles of RNA1, SRM1/PRP20/MTR1, and RAT1 confer defects in splicing, transcript initiation, and 3`-end formation of mRNA as well as RNA export(4, 6, 11) . Although we cannot rule out the possibility that other transcripts are defective, the three genes examined here appear to generate normal transcripts in rae1-1. The S. pombe pim 1-46 also displays a transient defect in RNA export and a cell division cycle arrest in G(2)/M(11) . The rae1-1 mutant differs from pim 1-46 in that RNA export defect is irreversible after approximately 30 min. Thus the rae1, SRM1/PRP20/MTR1, RAT1, and pim 1 genes probably perform different functions in RNA export. Further, the rae1-1 mutant has disorganized actin and tubulin structures. It is not known if other RNA export mutants have this phenotype.

The rapid accumulation of poly(A) RNA in the rae1-1 nucleus suggests that rae1 could be directly involved in the export process. The active transport of mRNA could require several components: the ribonucleoprotein particle, the nuclear pore complex, possibly microfilaments that guide the ribonucleoprotein particle to its destination, and a motor or energy source for the translocation. Actin mislocalization also occurs quickly in rae1-1 cells, and subtle changes may occur earlier than those detected here. It is possible that RNA export is defective in rae1-1 cells as a result of inappropriate microfilament structure and function. Intact microfilament structure has been shown to be necessary for correct localization of actin mRNA(31) .

The components of RNA export are likely to involve extensive protein-protein and protein-RNA interactions. The rapid and irreversible loss of viability resulting from rae1 temperature sensitivity is consistent with rae1 protein being part of an essential complex that is unable to return to a wild type conformation when cells are returned to permissive temperature. The rae1 amino acid sequence contains a C-terminal basic region which has been implicated in RNA-protein interaction(32) . Basic regions have also been implicated in nuclear import of proteins(33) . As is the case for several other genes that affect mRNA export(4, 6, 10, 11) , it has been difficult to demonstrate a direct role for rae1 in RNA export.

The possibility that rae1 protein interacts with other proteins is suggested by its similarity to beta-transducins. The beta-transducin repeat domain has been proposed to mediate interaction with proteins that contain a tetratricopeptide repeat and this has been demonstrated for SSN6/TUP1(34) . Transducin repeat-containing proteins are not necessarily beta subunits of transducins but can be involved in a variety of cellular processes. Of particular interest here are PRP4 of S. cerevisiae which is involved in mRNA splicing (35) and BUB3 and CDC20, components of cell division cycle regulation(24, 36) .

Of all of the proteins with transducin repeats, only the S. cerevisiae BUB3 gene shares similarity with rae1 outside of the transducin repeat regions. Mutations in the BUB genes result in supersensitivity to microtubule inhibitors, such as nocodazole, and formation of cells with multiple buds. The rapid loss of viability of nocodazole-arrested rae1-1 cells following a shift to the restrictive temperature raises the possibility that rae1 is the S. pombe analog of BUB3. The BUB genes function in a mitotic checkpoint that detects improper microtubule function and arrests cell division cycle progression until microtubules are functional(24) . The bub mutants continue to bud and replicate their DNA but do not undergo cytokinesis in the presence of microtubule inhibitors such as nocodazole, resulting in poor recovery from exposure to these agents. Although the phenotypes of rae1-1 and bub mutants differ somewhat, we are investigating the possibility that the rae1 gene is involved in a mitotic checkpoint.

It has been suggested that cytoskeletal microfilaments are involved in RNA trafficking(31, 37) . There is precedent for microfilament association of transducin repeat containing proteins. Coronin, an actin-binding protein in Dictystelium, contains transducin repeats, although the authors speculate that it is not this domain that mediates actin binding(38) . CIN4 is a microtubule accessory protein that contains transducin repeats(39) , and CDC20 is required for microtubule assembly(36) . One possible explanation for a disruption of cytoskeleton in the rae1-1 mutant is that rae1 protein interacts directly with actin. However, we do not see a direct interaction in immunoprecipitations of epitope-tagged rae1 protein. This suggests that it is unlikely that rae1 protein affects cytoskeleton through a direct interaction with actin or tubulin. We are using genetic and other biochemical techniques to identify elements that interact with rae1 to further understand the process of RNA export and its relationship to the cytoskeleton.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) U14951[GenBank].

§
Current address: Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892.

To whom correspondence should be addressed: Laboratory of Molecular Virology, Bldg. 41, Rm. B503, NCI, NIH, Bethesda, MD 20892. Tel.: 301-496-0989; Fax: 301-496-4951.


ACKNOWLEDGEMENTS

We thank Charles Cole and Alan Tartakoff for discussing results prior to publication, Michael Henry for excellent technical assistance, Paul Nurse and Michael Wigler for libraries, Judy Potashkin for mutants, Francoise Stutz and Hao-peng Xu for helpful discussions, and Carl Baker, James Gnarra, and Anita Roberts for helpful comments on the manuscript.


REFERENCES

  1. Mattaj (1990) Curr. Opin. Cell Biol. 2, 528-538 [CrossRef][Medline] [Order article via Infotrieve]
  2. Hutchison, H. T., Hartwell, L. H. & McLaughlin, C. S. (1969) J. Bacteriol. 99, 807-814 [Abstract/Free Full Text]
  3. Shiokawa, K. & Pogo, A. O. (1974) Proc. Natl. Acad. Sci. U. S. A. 71, 2658-2662 [Abstract/Free Full Text]
  4. Forrester, W., Stutz, F., Rosbash, M. & Wickens, M. (1992) Genes & Dev. 6, 1914-1926
  5. Clark, K. L. & Sprague, G. F., Jr. (1989) Mol. Cell. Biol. 9, 2682-2694 [Abstract/Free Full Text]
  6. Kadowaki, T., Zhao, Y. & Tartakoff, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2312-2316 [Abstract/Free Full Text]
  7. Aebi, M., Clark, M. W., Vijayraghavan, U. & Abelson, J. (1990) Mol. Gen. Genet. 224, 72-80 [CrossRef][Medline] [Order article via Infotrieve]
  8. Matsumoto, T. & Beach, D. (1991) Cell 66, 347-360 [CrossRef][Medline] [Order article via Infotrieve]
  9. Nishimoto, T., Eilen, E. & Basilico, C. (1978) Cell 15, 475-483 [CrossRef][Medline] [Order article via Infotrieve]
  10. Sazer, S. & Nurse, P. (1994) EMBO J. 13, 606-615 [Medline] [Order article via Infotrieve]
  11. Kadowaki, T., Goldfarb, D., Spitz, L. M., Tartakoff, A. M. & Ohno, M. (1993) EMBO J. 12, 2929-2937 [Medline] [Order article via Infotrieve]
  12. Amberg, D. C., Goldstein, A. L. & Cole, C. N. (1992) Genes & Dev. 6, 1173-1189
  13. Nasmyth, K. (1977) Cell 12, 1109-1120 [CrossRef][Medline] [Order article via Infotrieve]
  14. Sherman, F., Fink, G. & Hicks, J. (1986) Laboratory Course Manual for Methods in Yeast Genetics , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  15. Moreno, S., Klar, A. & Nurse, P. (1991) Methods Enzymol. 194, 795-823 [Medline] [Order article via Infotrieve]
  16. Alfa, C., Fantes, P., Hyams, J., McLeod, M. & Warbrick, E. (1993) Experiments with Fission Yeast: A Laboratory Course Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  17. Moerschell, R. P., Das, G. & Sherman, F. (1991) Methods Enzymol. 194, 362-369 [Medline] [Order article via Infotrieve]
  18. Devereux, J., Haeberli, P. & Smithies, O. (1984) Nucleic Acids Res. 12, 387-395
  19. Winston, F., Chemley, F. & Fink, G. R. (1983) Methods Enzymol. 101C, 211-228 [Medline] [Order article via Infotrieve]
  20. Goldstein, D. J., Toyama, R., Dhar, R. & Schlegel, R. (1992) Virology 170, 889-893
  21. Lamb, J. T., Michaud, W. A., Sikorski, R. S. & Hieter, P. A. (1994) EMBO J. 13, 4321-4328 [Medline] [Order article via Infotrieve]
  22. Brown, A. J. P. (1989) Yeast 5, 239-257 [CrossRef][Medline] [Order article via Infotrieve]
  23. Neer, E. J., Schmidt, C. J., Nambudritud, R. & Smith, T. F. (1994) Nature 371, 297-300 [CrossRef][Medline] [Order article via Infotrieve]
  24. Hoyt, M. A., Totis, L. & Roberts, B. T. (1991) Cell 66, 507-517 [CrossRef][Medline] [Order article via Infotrieve]
  25. Dalrymple, M. A., Petersen-Bjorn, S., Freisen, J. D. & Beggs, J. D. (1989) Cell 58, 811-812 [CrossRef][Medline] [Order article via Infotrieve]
  26. Toda, T., Adachi, Y., Hiraoka, Y. & Yanagida, M. (1984) Cell 37, 233-242 [CrossRef][Medline] [Order article via Infotrieve]
  27. Mertins, P. & Gallwitz, D. (1987) Nucleic Acids Res. 15, 7369-7379 [Abstract/Free Full Text]
  28. Enoch, T., Gould, K. L. & Nurse, P. (1991) Cold Spring Harbor Symp. Quant. Biol. 56, 409-416 [Medline] [Order article via Infotrieve]
  29. Fantes, P. (1979) Nature 279, 428-430
  30. Robinow, C. F. & Hyams, J. S. (1989) in Molecular Biology of the Fission Yeast (Nasim, A., Young, P. & Johnson, B. F., eds) pp. 273-331 Academic Press, London
  31. Sundell, C. L. & Singer, R. H. (1991) Science 253, 1275-1277 [Abstract/Free Full Text]
  32. Kenan, D. J., Query, C. C. & Keene, J. D. (1991) Trends Biochem. Sci. 16, 214-220 [CrossRef][Medline] [Order article via Infotrieve]
  33. Garcia-Bustos, J., Heitman, J. & Hall, M. N. (1991) Biochim. Biophys. Acta 1071, 83-101 [Medline] [Order article via Infotrieve]
  34. Keleher, C. A., Redd, M., Schultz, J., Carlson, M. & Johnson, A. D. (1992) Cell 68, 709-719 [CrossRef][Medline] [Order article via Infotrieve]
  35. Banroques, J. & Abelson, J. N. (1989) Mol. Cell. Biol. 9, 3710-3719 [Abstract/Free Full Text]
  36. Sethi, N., Monteagudo, M. C., Koshland, D., Hogan, E. & Burke, D. J. EMBO J. 12, 2697-2704
  37. Wilhelm, J. E. & Vale, R. D. (1993) J. Cell Biol. 123, 269-274 [Free Full Text]
  38. de Hostos, E. L., Bradtke, B., Lottspeich, F., Guggenheim, R. & Gerisch, G. (1991) EMBO J. 10, 4097-4104 [Medline] [Order article via Infotrieve]
  39. Stearns, T., Hoyt, M. A. & Botstein, D. (1990) Genetics 124, 251-262 [Abstract]
  40. Brevario, D., Hinnebusch, A. G. & Dhar, R. (1988) EMBO J. 7, 1805-1813 [Medline] [Order article via Infotrieve]
  41. Langan, T. A., Cautier J., Lohka M., Hollingsworth, Moreno, S., Nurse, P., Maller J. & Sclafani, R. A. (1989) Mol. Cell. Biol. 9, 3860-3868 [Abstract/Free Full Text]
  42. Maundrell, K. (1990) J. Biol. Chem. 265, 10857-10864 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Pfeifer, R. Elsby, M. Fernandez, P. A. Faria, D. R. Nussenzveig, I. S. Lossos, B. M. A. Fontoura, W. D. Martin, and G. N. Barber
NFAR-1 and -2 modulate translation and are required for efficient host defense
PNAS, March 18, 2008; 105(11): 4173 - 4178.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. G. Farny, J. A. Hurt, and P. A. Silver
Definition of global and transcript-specific mRNA export pathways in metazoans
Genes & Dev., January 1, 2008; 22(1): 66 - 78.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Satterly, P.-L. Tsai, J. van Deursen, D. R. Nussenzveig, Y. Wang, P. A. Faria, A. Levay, D. E. Levy, and B. M. A. Fontoura
Influenza virus targets the mRNA export machinery and the nuclear pore complex
PNAS, February 6, 2007; 104(6): 1853 - 1858.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. W. Wong, G. Blobel, and E. Coutavas
Rae1 interaction with NuMA is required for bipolar spindle formation
PNAS, December 26, 2006; 103(52): 19783 - 19787.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. J. Baker, K. B. Jeganathan, L. Malureanu, C. Perez-Terzic, A. Terzic, and J. M.A. van Deursen
Early aging-associated phenotypes in Bub3/Rae1 haploinsufficient mice.
J. Cell Biol., February 13, 2006; 172(4): 529 - 540.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
F. Kendirgi, D. J. Rexer, A. R. Alcazar-Roman, H. M. Onishko, and S. R. Wente
Interaction between the Shuttling mRNA Export Factor Gle1 and the Nucleoporin hCG1: A Conserved Mechanism in the Export of Hsp70 mRNA
Mol. Biol. Cell, September 1, 2005; 16(9): 4304 - 4315.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
R. H. Carnahan, A. Feoktistova, L. Ren, S. Niessen, J. R. Yates III, and K. L. Gould
Dim1p Is Required for Efficient Splicing and Export of mRNA Encoding Lid1p, a Component of the Fission Yeast Anaphase-Promoting Complex
Eukaryot. Cell, March 1, 2005; 4(3): 577 - 587.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Suntharalingam, A. R. Alcazar-Roman, and S. R. Wente
Nuclear Export of the Yeast mRNA-binding Protein Nab2 Is Linked to a Direct Interaction with Gfd1 and to Gle1 Function
J. Biol. Chem., August 20, 2004; 279(34): 35384 - 35391.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. W. Bai, J. Rouquette, M. Umeda, W. Faigle, D. Loew, S. Sazer, and V. Doye
The Fission Yeast Nup107-120 Complex Functionally Interacts with the Small GTPase Ran/Spi1 and Is Required for mRNA Export, Nuclear Pore Distribution, and Proper Cell Division
Mol. Cell. Biol., July 15, 2004; 24(14): 6379 - 6392.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. G. Thakurta, G. Gopal, J. H. Yoon, T. Saha, and R. Dhar
Conserved Nuclear Export Sequences in Schizosaccharomyces pombe Mex67 and Human TAP Function in mRNA Export by Direct Nuclear Pore Interactions
J