![]()
|
|
||||||||
Fibrinogen Gene in Response
to Interleukin-6 (*)
(Received for publication, December 27, 1994; and in revised form, January 17, 1995)
From the
The three fibrinogen genes belong to the class II hepatic acute
phase proteins that are regulated in part by members of the
interleukin-6 (IL-6) family of cytokines and glucocorticoids. The
common DNA sequence that characterizes this group of proteins is a
hexanucleotide CTGGGA residing in the promoter regions of these genes.
Investigations of IL-6 control of the A
fibrinogen gene by
electrophoretic mobility shift assays using a 30-base pair DNA probe
containing the CTGGGA element revealed that a novel protein is
associated with this site during non-IL-6-stimulated conditions.
Sensitive time-course studies of IL-6 stimulation using primary
hepatocyte cultures, high resolution polyacrylamide gel
electrophoresis, and site-directed mutagenesis show that upon IL-6
stimulation of hepatocytes, this DNA binding protein transiently leaves
the CTGGGA site and binds 12 base pairs downstream but then begins to
re-associate with the original DNA site at 1 h and is completed by 2 h.
A recently characterized and cloned IL-6-activated transcription
factor, Stat-3, which has been reported to bind a CTGGGAA site in the
-2 macroglobulin gene, another member of the class II acute phase
proteins, does not bind to the CTGGGA sequence in the A
fibrinogen
gene. These findings reveal the presence of a previously undefined
IL-6-regulated event, which involves a new DNA binding protein and
demonstrates for the first time additional details of the kinetics of
IL-6 control of fibrinogen gene expression.
Two major inflammatory cytokines that influence hepatic plasma
protein gene expression are IL-1 (
)and IL-6 (1) .
The responding proteins are grouped into two classes, those controlled
by either IL-1 alone or a combination of IL-1 and IL-6 (class I) and
those controlled by IL-6 and glucocorticoid (class II) (1) .
The promoters in the genes of class I proteins contain a cytokine
response element characterized by the consensus sequence
T(T/G)NNGNAA(T/G), which is the binding site for the CAAT enhancer
binding protein (C/EBP)
family(2, 3, 4, 5, 6, 7, 8, 9) .
Interleukin-6 activates members of the C/EBP family (C/EBP
and
C/EBP
) by both posttranslational modifications (phosphorylation by
Ras-regulated mitogen-activated protein kinases) and increasing
transcription of the C/EBP protein(7, 8) . NF-
B
and NF-
B-like proteins also participate in the activation of class
I protein gene expression(10, 11) .
The class II
proteins, regulated by IL-6 and glucocorticoids, include
![]()
-macroglobulin, ![]()
-antichymotrypsin,
and fibrinogen among others. On the basis of sequence comparison of the
promoter regions, a consensus hexanucleotide sequence, CTGGGA (IL-6
RE), was identified in the regulatory region of all of these genes.
Functional analysis of promoters of B
fibrinogen and
2
macroglobulin genes showed that this hexanucleotide sequence was the
major IL-6-responsive sequence(12, 13, 14) .
This same element was also demonstrated to be required for maximal
induction of some class I acute phase proteins such as
1 acid
glycoprotein and T-kininogen(15, 16) . Recently, major
progress has been made in identifying molecules involved in this
Ras-independent IL-6 signaling pathway. APRF, identified in 1994 as an
IL-6-activated regulator of
2 macroglobulin gene, was recently
cloned(17, 18, 19, 20) . It is now
recognized that APRF (Stat 3) is a member of the family of cytokine signal transducers and activators of transcription (Stat), some of whom share the common DNA
binding site, thereby establishing the convergent activation pathway
that different cytokines use to regulate the same gene. Both APRF and
GAF (Stat 1
) recognize a consensus palindrome sequence
TT(A/C)(C/T)N(G/A)(G/T)AA (IL-6 RE palindrome) and are able to activate
2 macroglobulin gene transcription(21) . However, the
genes of some class II proteins, such as fibrinogen, are only activated
by IL-6 and not by interferon
. (
)In the current study,
we show that the Stat 3 is not an obvious participant in the enhanced
transcription of the A
gene. We also report the presence of a
50-kDa protein that binds to an expanded IL-6RE in the A
fibrinogen promoter. Mobility shift assays using the expanded IL-6RE
demonstrate that upon IL-6 stimulation, this protein forms a slightly
more retarded complex from that observed in the unstimulated condition.
After 2 h the initial migration pattern is observed.
M), nicotinamide
(1
M), and 5% fetal bovine serum.
For stimulation with cytokine, cells were grown to 90% confluency, and
recombinant murine (rm) IL-6 was added into the medium to a final
concentration of 100 ng/ml. Rat hepatoma cells (H-35) were obtained
from ATCC and grown in minimum essential media with Earle's salt, L-glutamine, penicillin (50 units/ml), streptomycin (50
µg/ml), minimum essential media nonessential amino acid (0.1
mM), and 10% fetal bovine serum.
P]TTP by a Klenow
fragment filling reaction. Free nucleotides were removed by ammonia
acetate ethanol precipitation(23) . In the electrophoretic
mobility shift assay, a 0.1-ng (20,000 cpm) radioactive probe was added
into 10 µg of extract protein solution, which had precedingly been
mixed with 4 µg of poly(dI-dC), 1 mM DTT, and reaction
buffer (10 mM Tris, pH 7.5, 1 mM DTT, 100 mM KCl, 1 mM EDTA, 0.2 mM PMSF, 1 mg/ml bovine
serum albumin, and 5% glycerol) at 25 °C for 10 min. In competition
assays, the cold (unlabeled) probe was added to the
radioactivity-labeled probe before they were placed into the reaction
mixture. Following 20 min of incubation at room temperature, the
samples were fractionated on nondenaturing polyacrylamide gel in 0.25
TBE(23) , 5% glycerol(13) . In the supershift assay, 2
µg of antibody was incubated with 10 µg of extract protein in
the binding buffer at 4 °C for 1 h prior to EMSA. Anti-Stat 3
antibodies were obtained from Santa Cruz Biotech Co., and anti-gp130
antibodies were prepared from rabbits immunized with Escherichiacoli-produced protein containing cytoplasmic domain of
gp130 (27) .
P]dCTP-labeled cDNA. Afterward, the filters
were washed three times and then exposed to film.
Figure 1:
Identification of the IL-6-responsive
region in the A
fibrinogen promoter. A series of DNA fragments
containing different regions of the A
promoter were amplified from
rat genomic DNA using the polymerase chain reaction and cloned into the
polylinker of luciferase expression vector pXP2. Each construct was
transfected into H-35 cells by Lipofectin (Life Technologies, Inc.).
The transfected cells were treated with 100 ng/ml rmIL-6 for 13 h, and
then the luciferase activity was measured. The figure shows a
representative experiment out of five performed. The -fold increased in
luciferase activity by IL-6 stimulation for each fragment is indicated
above each bar. The luciferase assays were carried out in five
independent transfection experiments, and the relative -fold increased
in the IL-6 stimulation is similar for each
experiment.
Figure 2:
Identification of the IL-6-responsive
sequence binding protein in fibrinogen A
promoter. A,
electrophoretic mobility shift assays to determine if the
IL-6-responsive sequence of A
fibrinogen binds activated Stat 3.
The DNA probes used were a 20-bp fragment corresponding to the rat
2 macroglobulin acute phase response element (denoted as
2
probe) (5`-GATCCTTCTGGGAATTCC-3`) and a 30-bp fragment of A
fibrinogen IL-6-responsive sequence in which the IL-6 RE was positioned
in the middle (A
probe 5`-GAGCAAGAATTTCTGGGATGCCGTGGTT-3`). Probes
were labeled with [
P]dNTP by Klenow fragment.
Nuclear extracts were prepared according to the protocol from liver of
rats, which had been treated with an intraperitoneal lipopolysaccharide (LPS) (10 mg of lipopolysaccharide/1-kg rat) injection (and
the liver extracted at 60 min post-injection) and a sham injection. The
EMSAs were run in 4% non-denaturing polyacrylamide gels. B,
verification of Stat 3 band in the EMSA. 2 µg of antibody was mixed
with 10 µg of extract protein at 4 °C for 1 h prior to EMSA.
The probe used in lanes1-3 was the
2
probe. The A
probe was used in lanes4-6.
The extract was prepared as described in A, and binding
conditions were also the same as in A above. C,
verifying activated Stat 3 by IL-6 does not interact with IL-6 RE of
A
fibrinogen. The probe used in lanes1-4 was the
2 probe. In lanes5-8, the
A
probe was used. The nuclear extract used in the reaction was
prepared from primary hepatocytes as described under ``Materials
and Methods.'' The binding reaction for detection of supershifted
bands was identical to that in B above.
Figure 3:
Response of the A
fibrinogen gene to
epidermal growth factor. A, Northern blot hybridization to
detect transcription of A
fibrinogen during IL-6 or EGF
stimulation. Total RNA from treated and untreated primary hepatocytes
was fractionated in the denatured agarose gel and then transferred to
nitrocellulose membranes to be hybridized with
P-labeled
A
cDNA. Lanes1-3 show RNA from untreated
and IL-6-treated primary hepatocytes; lanes4-6 show the RNA extracted from untreated and EGF-treated cells. B, determination of response of A
gene promoter to EGF
induction. The construct carrying A
promoter
(-254/+30)in the upstream of luciferase reporter gene in
pGL-2 vector was transfected into H-35 cells, and then the cells were
treated with 100 ng/ml rmIL-6 or 100 ng/ml EGF to be subjected to
luciferase assay.
Figure 4:
A, kinetics of IL-6-activated
transcription factor-A
probe complex formation. Nuclear extracts
from primary hepatocytes (in monolayer cell cultures), which were
exposed to 100 ng/ml rm IL-6 for different times were used, and the
products of the binding reaction were assessed on 10% polyacrylamide
gels for high resolution. B, verification specificity of the
complexes by competition assay. Nuclear extract from untreated and
IL-6-treated (20 min, 100 ng/ml) primary hepatocytes was subjected to
mobility shift assay in the presence of 30-, 60-, and 250-fold molar
excess of unlabeled A
probe.
Figure 5: Determination of CTGGGA domain in the complex formation. The results of EMSA using probes with base changes in the IL-6 RE are shown in panelsA and B. The altered bases in this site are shown below (M1-3). EMSAs were performed using nuclear extract from IL-6 (100 ng/ml)-treated and untreated cells. Regular probe (R), 5`GAGCAAGAATTTCTGGGATGCCGTGGTT3`; mutant 1 (M1), 5`-GAGCAAGAATTTAGTGGATGCCGTGGTT-3`; mutant 2 (M2), 5`-GAGCAAGAATTTCTGTTCTGCCGTGGTT-3`; mutant 3 (M3), 5`-GAGCAAGAATTTAGTTTCTGCCGTGGTT-3`.
Figure 6: Determination of function of flanking sequence in the complex formation. PanelsA and B show EMSA with probes altered in the flanking sequence of the IL-6 RE. The sequence of probes mutated on adjacent sides of the IL-6 RE are shown below (M4-5). The mutation site is underlined. Mutant 4 (M4), 5`-GAGCAATTCACTCTGGGATGCCGTGGTT-3`; mutant 5 (M5), 5`-GAGCAAGAATTTCTGGGACGTACGGGTT-3`; mutant 6 (M6), 5`-AAGTGATTCACTCTGGGAACGTACGAAT-3`.
Figure 7:
Functional analysis of the forming sites
of the two complexes. A fragment consisting of -254 to +30
nucleotides of the A
promoter was inserted upstream of luciferase
gene in pGL-2 vector. The selected nucleotide changes were introduced
in the CTGGGA and its flanking region by using site-directed
mutagenesis (Transformer Kit, Clontech). Each constructed plasmid was
transfected into H-35 cells using Lipofectin (Life Technologies, Inc.)
and then treated with (100 ng/ml) rmIL-6 for 13 h. The figure shows a
representative experiment carried out in triplicate. Three separate
transfection assays using these constructs were performed, and all
showed similar responses. The numberabove the bar indicates the -fold increased by IL-6
stimulation.
Figure 8:
Analysis of the protein that is involved
in complex I and II by UV cross-linking assay. The binding assay with
A
probe was the same as that in the EMSA described above. 100-fold
unlabeled A
probe was used in verifying the specificity of
protein. The products of UV cross-linking were fractionated on 10%
SDS-polyacrylamide.
An increasing body of information has demonstrated the presence of a major signaling pathway involving a family of cytoplasmic tyrosine kinases (Jak kinases) that are activated by cytoplasmic domains of receptors that do not themselves possess a tyrosine kinase motif(32, 33) . The signal-transducing protein for IL-6, gp130, belongs to this group(34) . Additional information linking the IL-6 pathway to that of gene transcription has demonstrated that substrates of the Jak kinases, once they become activated (phosphorylated), quickly transport to the nucleus and affect transcription of specific genes. Identification that Stat 3 served as a specific IL-6 transcription factor for a member of the class 2 group of acute phase proteins has led to the notion that perhaps Stat 3 may regulate all members of the class of proteins exhibiting the IL-6 RE consensus element. Information presented in this study appears to cast some doubt on Stat 3 being a ``universal'' regulator of acute phase proteins of the class II variety.
To understand more precisely
the regulation of fibrinogen gene expression, we investigated one of
the genes of this molecule, the A
gene. Fibrinogen can be regarded
as somewhat of a special case of acute phase proteins in that it is
constitutively expressed at a moderate
level(35, 36, 37) . In response to an IL-6
impulse, the transcription of each of the three fibrinogen genes
increase by approximately 3-fold, leading to an increase of circulating
levels from 2-2.5 to 5-6.5 mg/ml. The expression of the
three genes are stringently coordinated in both transcription and
translation(35, 36, 37, 38) .
Analysis of the promoter region of the A
gene revealed the
presence of sequence coinciding with that of the IL-RE. Functional
analyses of the A
promoter demonstrated a single IL-6-responsive
region that does not include the consensus sequence for C/EBP, since
the fragment (-142/+30) in which only partial putative CAAT
enhancer sequence resides still has normal response to IL-6. Thus, the
increased transcription of the A
gene during an acute inflammation
occurs by IL-6 response element of the class II variant only.
More
extensive examinations of the IL-6 binding element were carried out
using mobility shift assays utilizing a naturally occurring 30-bp base
sequence in which the CTGGGA element was positioned in the center of
the probe. Nuclear extracts made from primary hepatocytes in culture
that had been treated with or without IL-6 and glucocorticoids
revealed, unexpectedly, a protein associating with the IL-6 RE even
when the cells had not been stimulated with IL-6. Nuclear extracts
prepared from IL-6-treated hepatocytes also revealed a slightly slower
migrating band. The specificity of the bands was confirmed by
competition binding experiments. The position of the bands in the gel
suggested that the DNA-protein complex was smaller than that reported
for Stat 3 association with the IL-6 RE in the
2 macroglobulin
promoter(17, 18) . Utilization of anti-Stat 3
antibodies confirmed the presence of Stat 3 on the ![]()
probe and also demonstrated that the gel pattern of the A
probe does not contain Stat 3. These findings provide evidence that
Stat 3 is not associating with the IL-6 RE element in the A
gene.
In Fig. 2C, using extracts from IL-6-stimulated primary
hepatocytes, three complexes formed on the
2 probe. Recently, a
similar gel shift pattern was reported and indicated that Stat 1
is also activated by the IL-6 and forms a homodimer and a heterodimer
with Stat 3 to bind on the IL-6 RE
palindrome(29, 30) . Apparently, the complex formed by
A
probe is different from Stat 1
and Stat 3. UV cross-linking
assay indicated that the molecular weight of the protein binding A
probe is different from that of the members of the Stat family.
Two
recent reports (19, 31) demonstrated that epidermal
growth factor activated Stat 3 in hepatocytes. As a follow-up to these
observations, EGF was added to cultures of primary heptocytes, and its
effect on fibrinogen expression was determined by Northern gel
analyses. The presence of EGF had no stimulatory affect on fibrinogen
mRNA. Additionally, when H-35 hepatoma cells that had been transfected
with the A
promoter-luciferase construct were treated with EGF, no
luciferase activation was observed. These findings demonstrate that EGF
has no affect on fibrinogen synthesis, whereas it has been clearly
documented that Stat 3 is activated by this growth factor. These
findings reinforce the observations presented here that activation of
Stat 3 is not sufficient for increased fibrinogen expression.
It is
known that different cytokines can stimulate the same member of the
Stat family in the same tissues or cell
line(19, 21, 29, 30) . These
observations indicate that stimulation of the Stat family can occur by
different ligand and receptor complexes. Thus activation of a Stat may
represent only an early step in the signaling cascade and that other
proteins are involved downstream of activated Stat to affect the
expression of a specific gene. The data presented here suggest that an
IL-6 pathway exists for an acute phase protein (A
fibrinogen) that
does not involved Stat 3 directly.
An advantage of the primary hepatocyte culture model is the capacity to more precisely determine response time of these cells to IL-6. Nuclear extracts were prepared from cells that had been exposed to IL-6 for brief periods of time (10 min to 2 h), and then each extract was used in an EMSA. The gel migration patterns suggest an IL-6 activation cycle for this gene. A specific protein appears to reside on the IL-6 RE during non-stimulated, presumably constitutive conditions; then, upon IL-6 activation, the protein leaves this site, and either it re-associates a few bases downstream or another protein associates 12 bp downstream of the sequence from the IL-6 RE. The protein remains at the second site only briefly, and then the initial binding protein reappears on the IL-6 RE. It seems probable that the same protein is involved in the two identified bands and that the modest change in mobility is due to reversible protein modification. The formulation of this IL-6 activation cycle was based upon the results of constructing a series of six mutations in the IL-6 RE and its flanking regions and then determining the affect of each mutant on the formation of the different complexes.
The functional assays carried out using a large fragment
of the A
promoter (-250 to +30) containing the IL-6 RE
provided additional support for the importance of the CTGGGA element.
When mutated regions of this fragment were constructed and used in
luciferase assays, it was apparent that the ``functional''
IL-6 RE for this gene consists of a 12-bp region, GAATTTCTGGGA (an
additional six nucleotides upstream of the predicted CTGGGA element).
These findings provide evidence that the IL-6 response of the A
fibrinogen gene is accomplished by a previously unidentified protein
that resides in the IL-6 RE during nonstimulated conditions. Our
results suggest that an additional IL-6 signaling process is involved
in at least one class 2 acute phase protein. Precisely how the IL-6
signal is meditated to activate the A
core protein and how this
affects A
gene transcription is under investigation.
This article has been cited by other articles:
![]() |
M. Verschuur, M. de Jong, L. Felida, M. P. M. de Maat, and H. L. Vos A Hepatocyte Nuclear Factor-3 Site in the Fibrinogen {beta} Promoter Is Important for Interleukin 6-induced Expression, and Its Activity Is Influenced by the Adjacent -148C/T Polymorphism J. Biol. Chem., April 29, 2005; 280(17): 16763 - 16771. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xia Regulation of {gamma}-Fibrinogen Chain Expression by Heterogeneous Nuclear Ribonucleoprotein A1 J. Biol. Chem., April 1, 2005; 280(13): 13171 - 13178. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. O. Duan and P. J. Simpson-Haidaris Functional Analysis of Interleukin 6 Response Elements (IL-6REs) on the Human {gamma}-Fibrinogen Promoter: BINDING OF HEPATIC Stat3 CORRELATES NEGATIVELY WITH TRANSACTIVATION POTENTIAL OF TYPE II IL-6REs J. Biol. Chem., October 17, 2003; 278(42): 41270 - 41281. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Boffa, J. D. Hamill, N. Bastajian, R. Dillon, M. E. Nesheim, and M. L. Koschinsky A Role for CCAAT/Enhancer-binding Protein in Hepatic Expression of Thrombin-activable Fibrinolysis Inhibitor J. Biol. Chem., July 5, 2002; 277(28): 25329 - 25336. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Hagood, A. Mangalwadi, B. Guo, M. W. MacEwen, L. Salazar, and G. M. Fuller Concordant and Discordant Interleukin-1-Mediated Signaling in Lung Fibroblast Thy-1 Subpopulations Am. J. Respir. Cell Mol. Biol., June 1, 2002; 26(6): 702 - 708. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. FULLER and Z. ZHANG Transcriptional Control Mechanism of Fibrinogen Gene Expression Ann. N.Y. Acad. Sci., June 1, 2001; 936(1): 469 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Alonzi, D. Maritano, B. Gorgoni, G. Rizzuto, C. Libert, and V. Poli Essential Role of STAT3 in the Control of the Acute-Phase Response as Revealed by Inducible Gene Activation in the Liver Mol. Cell. Biol., March 1, 2001; 21(5): 1621 - 1632. [Abstract] [Full Text] |
||||
![]() |
J. I. Leu, M. A. S. Crissey, J. P. Leu, G. Ciliberto, and R. Taub Interleukin-6-Induced STAT3 and AP-1 Amplify Hepatocyte Nuclear Factor 1-Mediated Transactivation of Hepatic Genes, an Adaptive Response to Liver Injury Mol. Cell. Biol., January 15, 2001; 21(2): 414 - 424. [Abstract] [Full Text] |
||||
![]() |
C. F. Pieper, K. M. K. Rao, M. S. Currie, T. B. Harris, and H. J. Cohen Age, Functional Status, and Racial Differences in Plasma D-Dimer Levels in Community-Dwelling Elderly Persons J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2000; 55(11): 649M - 657. [Abstract] [Full Text] |
||||
![]() |
A. Ray A SAF Binding Site in the Promoter Region of Human {gamma}-Fibrinogen Gene Functions as an IL-6 Response Element J. Immunol., September 15, 2000; 165(6): 3411 - 3417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Olman, J. S. Hagood, W. L. Simmons, G. M. Fuller, C. Vinson, and K. E. White Fibrin Fragment Induction of Plasminogen Activator Inhibitor Transcription Is Mediated by Activator Protein-1 Through a Highly Conserved Element Blood, September 15, 1999; 94(6): 2029 - 2038. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Bing, S. A. G. Reddy, Y. Ren, J. Qin, and W. S.-L. Liao Purification and Characterization of the Serum Amyloid A3 Enhancer Factor J. Biol. Chem., August 27, 1999; 274(35): 24649 - 24656. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Phillips, R. Sharma, P. A. Leco, and D. R. Edwards A Sequence-selective Single-strand DNA-binding Protein Regulates Basal Transcription of the Murine Tissue Inhibitor of Metalloproteinases-1 (Timp-1) Gene J. Biol. Chem., August 6, 1999; 274(32): 22197 - 22207. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Cantwell, E. Sterneck, and P. F. Johnson Interleukin-6-Specific Activation of the C/EBPdelta Gene in Hepatocytes Is Mediated by Stat3 and Sp1 Mol. Cell. Biol., April 1, 1998; 18(4): 2108 - 2117. [Abstract] [Full Text] |
||||
![]() |
D. Zhang, M. Sun, D. Samols, and I. Kushner STAT3 Participates in Transcriptional Activation of the C-reactive Protein Gene by Interleukin-6 J. Biol. Chem., April 19, 1996; 271(16): 9503 - 9509. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Hu, J. E. Harris, E. W. Davie, and D. W. Chung Characterization of the 5`-Flanking Region of the Gene for the alpha Chain of Human Fibrinogen J. Biol. Chem., November 24, 1995; 270(47): 28342 - 28349. [Abstract] [Full Text] [PDF] |
||||
![]() |