JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Z.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7580-7586
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Detection of a Novel Transcription Factor for the A Fibrinogen Gene in Response to Interleukin-6 (*)

(Received for publication, December 27, 1994; and in revised form, January 17, 1995)

Zhiyong Liu Gerald M. Fuller (§)

From the Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 35294-0005

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

The three fibrinogen genes belong to the class II hepatic acute phase proteins that are regulated in part by members of the interleukin-6 (IL-6) family of cytokines and glucocorticoids. The common DNA sequence that characterizes this group of proteins is a hexanucleotide CTGGGA residing in the promoter regions of these genes. Investigations of IL-6 control of the Aalpha fibrinogen gene by electrophoretic mobility shift assays using a 30-base pair DNA probe containing the CTGGGA element revealed that a novel protein is associated with this site during non-IL-6-stimulated conditions. Sensitive time-course studies of IL-6 stimulation using primary hepatocyte cultures, high resolution polyacrylamide gel electrophoresis, and site-directed mutagenesis show that upon IL-6 stimulation of hepatocytes, this DNA binding protein transiently leaves the CTGGGA site and binds 12 base pairs downstream but then begins to re-associate with the original DNA site at 1 h and is completed by 2 h. A recently characterized and cloned IL-6-activated transcription factor, Stat-3, which has been reported to bind a CTGGGAA site in the alpha-2 macroglobulin gene, another member of the class II acute phase proteins, does not bind to the CTGGGA sequence in the Aalpha fibrinogen gene. These findings reveal the presence of a previously undefined IL-6-regulated event, which involves a new DNA binding protein and demonstrates for the first time additional details of the kinetics of IL-6 control of fibrinogen gene expression.


INTRODUCTION

Two major inflammatory cytokines that influence hepatic plasma protein gene expression are IL-1 (^1)and IL-6 (1) . The responding proteins are grouped into two classes, those controlled by either IL-1 alone or a combination of IL-1 and IL-6 (class I) and those controlled by IL-6 and glucocorticoid (class II) (1) . The promoters in the genes of class I proteins contain a cytokine response element characterized by the consensus sequence T(T/G)NNGNAA(T/G), which is the binding site for the CAAT enhancer binding protein (C/EBP) family(2, 3, 4, 5, 6, 7, 8, 9) . Interleukin-6 activates members of the C/EBP family (C/EBPbeta and C/EBP) by both posttranslational modifications (phosphorylation by Ras-regulated mitogen-activated protein kinases) and increasing transcription of the C/EBP protein(7, 8) . NF-kappaB and NF-kappaB-like proteins also participate in the activation of class I protein gene expression(10, 11) .

The class II proteins, regulated by IL-6 and glucocorticoids, include alpha(2)-macroglobulin, alpha(1)-antichymotrypsin, and fibrinogen among others. On the basis of sequence comparison of the promoter regions, a consensus hexanucleotide sequence, CTGGGA (IL-6 RE), was identified in the regulatory region of all of these genes. Functional analysis of promoters of Bbeta fibrinogen and alpha2 macroglobulin genes showed that this hexanucleotide sequence was the major IL-6-responsive sequence(12, 13, 14) . This same element was also demonstrated to be required for maximal induction of some class I acute phase proteins such as alpha1 acid glycoprotein and T-kininogen(15, 16) . Recently, major progress has been made in identifying molecules involved in this Ras-independent IL-6 signaling pathway. APRF, identified in 1994 as an IL-6-activated regulator of alpha2 macroglobulin gene, was recently cloned(17, 18, 19, 20) . It is now recognized that APRF (Stat 3) is a member of the family of cytokine signal transducers and activators of transcription (Stat), some of whom share the common DNA binding site, thereby establishing the convergent activation pathway that different cytokines use to regulate the same gene. Both APRF and GAF (Stat 1alpha) recognize a consensus palindrome sequence TT(A/C)(C/T)N(G/A)(G/T)AA (IL-6 RE palindrome) and are able to activate alpha2 macroglobulin gene transcription(21) . However, the genes of some class II proteins, such as fibrinogen, are only activated by IL-6 and not by interferon . (^2)In the current study, we show that the Stat 3 is not an obvious participant in the enhanced transcription of the Aalpha gene. We also report the presence of a 50-kDa protein that binds to an expanded IL-6RE in the Aalpha fibrinogen promoter. Mobility shift assays using the expanded IL-6RE demonstrate that upon IL-6 stimulation, this protein forms a slightly more retarded complex from that observed in the unstimulated condition. After 2 h the initial migration pattern is observed.


MATERIALS AND METHODS

Cell Culture

Primary hepatocytes of rat were prepared as previously described (22) and maintained in the William's media minus arginine, supplemented with insulin (0.1 units/ml), heparin (2 units/ml), penicillin (50 units/ml), streptomycin (50 µg/ml), gentamicin (50 µg/ml), dexamethasone (1bullet10M), nicotinamide (1bullet10M), and 5% fetal bovine serum. For stimulation with cytokine, cells were grown to 90% confluency, and recombinant murine (rm) IL-6 was added into the medium to a final concentration of 100 ng/ml. Rat hepatoma cells (H-35) were obtained from ATCC and grown in minimum essential media with Earle's salt, L-glutamine, penicillin (50 units/ml), streptomycin (50 µg/ml), minimum essential media nonessential amino acid (0.1 mM), and 10% fetal bovine serum.

Plasmid Constructions

A series of DNA fragments containing different Aalpha promoter regions was amplified from genomic DNA of rat by polymerase chain reaction (23) and cloned into the polylinker region of the luciferase expression vector pXP2(24) . These plasmids were sequenced to confirm that the sequence and orientation were correct. Site-directed mutagenesis in the Aalpha promoter region was performed in the pGL-2 vector according to the protocol supplied by the manufacturer (Clontech).

Transfection

Transfection reactions were carried out using Lipofectin as the transfection reagent following the procedures provided by the manufacturer (Life Technologies, Inc.). The various constructs of the Aalpha promoter and site-directed mutant clones were transiently transfected into the H-35 cells, and then the cells were stimulated by 100 ng/ml rmIL-6 at 37 °C for 13 h. Prior to luciferase assay, the cells were washed two times with phosphate-buffered salt, dissolved in 250 µl of lysis buffer, and shaken at 25 °C for 30 min. The lysed cells were scraped from the plates, and the debris of the cells was precipitated at 12,000 rpm in a microcentrifuge tube for 5 s. The luciferase assay was carried out according to the manufacturer's protocol (Promega).

Nuclear Extract

For preparation of nuclear extracts from inflamed rat livers, rats (Sprague-Dawley) were injected intraperitoneally with bacterial lipopolysaccharide (10 mg/kg of body weight). After 1 h, the liver was removed and quickly frozen in liquid nitrogen(17) . Nuclear extracts were prepared following the modified method described by Deryckere and Gannon(25) . About 100-500 mg of tissue, frozen in liquid nitrogen, were broken with a hammer between layers of aluminum foil and then transferred to a mortar and reduced to powder in liquid nitrogen. All of the following steps were carried out on ice and centrifugation at 0 °C. In a 15-ml Dounce tissue homogenizer, the thawed powder was homogenized using a lose fitting pestle (B) in 5 ml of solution A (0.6% Nonidet P-40, 150 mM NaCl, 10 mM HEPES, pH 7.9, 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), and 1 mM DTT). After 5 strokes, the solution was transferred to a 15-ml tube and centrifuged for 30 s at 2000 rpm to remove any unbroken cells and tissue debris. The supernatant was incubated for 5 min on ice and then centrifuged for 5 min at 5000 rpm. Pelleted nuclei were resuspended in 100-500 µl of solution B (25% glycerol, 20 mM HEPES, pH 7.9, 420 mM NaCl, 1.2 mM MgCl(2), 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 2 mM benzamidine, protease inhibitors (pepstatin, leupeptin, and aprotinin (5 µg/ml each)), 0.1 mM sodium vanadate, 1 mM sodium pyrophosphate, and 1 mM NaF) and incubated on ice for 20 min for high salt extraction. The extracted nuclei were transferred to a microcentrifuge tube, and the nuclear debris was pelleted by centrifugation for 15 s. The supernatant, containing DNA binding proteins, was aliquoted into fractions, frozen in liquid nitrogen, and stored at -80 °C. The nuclear proteins from hepatocytes (in monolayer cell culture) were prepared according to protocol described by Gorski et al.(26) with some modification. The cells were washed twice with cold phosphate-buffered saline (10 mM NaPO(4), pH 7.4, 150 mM NaCl) and then were scraped from plates into the cold phosphate-buffered saline buffer. The cells were harvested at 270 times g for 5 min at 4 °C. The cell pellet was resuspended into the 2.5 times packed cell volume buffer (10 mM HEPES, pH 7.6, 15 mM KCl, 0.15 mM spermine, 0.5 mM spermidine, 2 mM EDTA, 2.4 M sucrose, 0.5 mM DTT, 0.5 mM PMSF, 1% Trasylol), transferred into Dounce homogenizer and then homogenized with type B pestle for 15 strokes. The lysed cell homogenate was overlaid on a cushion of 10 mM HEPES, pH 7.6, 15 mM KCl, 0.15 mM spermine, 0.5 mM spermidine, 2 mM EDTA, 2.0 M sucrose, 10% glycerol, 0.5 mM DTT, 0.5 mM PMSF, 1% Trasylol and centrifuged at 80,000 times g for 30 min. The nuclear pellet was resuspended in buffer B described above for high salt extraction and then centrifuged at 70,000 for 1 h to precipitate the chromatin. The protein concentration of this high speed supernatant was determined by protein assay reagent kit (Pierce), and aliquots were frozen at -80 °C for electrophoretic mobility shift assay.

Electrophoretic Mobility Shift Assay (EMSA)

Oligonucleotides used in EMSA were synthesized at the University of Alabama at Birmingham (Oligonucleotide Core Facility). Complementary oligonucleotides were annealed by heating single-stranded oligonucleotides to 100 °C for 2 min and slowly cooling at 37 °C in approximately 4 h. The double-stranded probes were labeled with [alpha-P]TTP by a Klenow fragment filling reaction. Free nucleotides were removed by ammonia acetate ethanol precipitation(23) . In the electrophoretic mobility shift assay, a 0.1-ng (20,000 cpm) radioactive probe was added into 10 µg of extract protein solution, which had precedingly been mixed with 4 µg of poly(dI-dC), 1 mM DTT, and reaction buffer (10 mM Tris, pH 7.5, 1 mM DTT, 100 mM KCl, 1 mM EDTA, 0.2 mM PMSF, 1 mg/ml bovine serum albumin, and 5% glycerol) at 25 °C for 10 min. In competition assays, the cold (unlabeled) probe was added to the radioactivity-labeled probe before they were placed into the reaction mixture. Following 20 min of incubation at room temperature, the samples were fractionated on nondenaturing polyacrylamide gel in 0.25 TBE(23) , 5% glycerol(13) . In the supershift assay, 2 µg of antibody was incubated with 10 µg of extract protein in the binding buffer at 4 °C for 1 h prior to EMSA. Anti-Stat 3 antibodies were obtained from Santa Cruz Biotech Co., and anti-gp130 antibodies were prepared from rabbits immunized with Escherichiacoli-produced protein containing cytoplasmic domain of gp130 (27) .

UV Cross-linking Assay

Cross-linking the Aalpha probe to the binding protein was carried out as described(28) . For UV cross-linking, the reaction solution is identical to that used for preparing samples of electrophoretic mobility shift assays. Following the binding reaction, the microcentrifuge tubes containing the DNA-protein complexes were sealed with plastic wrap and placed 5 cm from a UV light source (emanating wavelengths of 254 nm) for 3.5 min. Following the cross-linking reaction, the complexes were fractionated on 10% SDS-polyacrylamide gel electrophoresis under non-reducing conditions.

Northern Blot Hybridization

Equivalent amounts of RNA, as determined by absorbing at 260 nm, were fractionated by electrophoresis through 1.5% agarose gel, 2.0 M formaldehyde gels. Ethidium bromide (1 µg) was added to each sample prior to loading on the gel to allow us to view the integrity of the RNA samples by short-wave ultraviolet trans-illumination following electrophoresis. After transfer onto nitrocellulose membranes, the RNA was cross-linked to the filter paper using a Stratalinker 1800 (Stratagene). The membranes were hybridized overnight at 42 °C with 1 times 10^6 cpm/ml of [P]dCTP-labeled cDNA. Afterward, the filters were washed three times and then exposed to film.


RESULTS

Identification of IL-6-responsive Sequence in the Promoter of Aalpha Gene

To determine the molecular basis of cytokine-stimulated transcription of the Aalpha fibrinogen gene, it was necessary to characterize the interactions between the IL-6-responsive sequence in the promoter of the Aalpha fibrinogen gene and specific transcription factors. To identify these specific IL-6 response regions, we constructed a series of upstream DNA fragments in the Aalpha promoter region and linked each of the fragments to the reporter gene (luciferase) in the pXP2 vector. Following transfection of the constructed plasmids into an IL-6-responsive rat hepatoma cell (H-35), the cells were treated with IL-6, and lysates were prepared for luciferase assay. The results of each fragment response to IL-6 showed that IL-6 response substantially decreased when the fragment of -142 to -122 was deleted (Fig. 1). We noted that the fragment of -122/+30 still showed some response to IL-6 stimulation; however, strength of this response is similar to that of SV40 promoter cloned in the pGL-2 vector (pGL-2 promoter). The response of SV40 promoter to IL-6 may result from some nonspecific enhancing effects on background transcription in this cell line. The specific IL-6-responsive sequence in the Aalpha promoter resides in the bases -142 to -122, which contain the typical IL-6 RE (Fig. 1).


Figure 1: Identification of the IL-6-responsive region in the Aalpha fibrinogen promoter. A series of DNA fragments containing different regions of the Aalpha promoter were amplified from rat genomic DNA using the polymerase chain reaction and cloned into the polylinker of luciferase expression vector pXP2. Each construct was transfected into H-35 cells by Lipofectin (Life Technologies, Inc.). The transfected cells were treated with 100 ng/ml rmIL-6 for 13 h, and then the luciferase activity was measured. The figure shows a representative experiment out of five performed. The -fold increased in luciferase activity by IL-6 stimulation for each fragment is indicated above each bar. The luciferase assays were carried out in five independent transfection experiments, and the relative -fold increased in the IL-6 stimulation is similar for each experiment.



Stat 3 Does Not Bind to IL-6-responsive Sequence of Aalpha Fibrinogen Promoter

The IL-6-responsive sequence of Aalpha fibrinogen does not fully conform to the IL-6 RE palindrome previously described(21) . We used a 30-bp oligonucleotide containing the natural IL-6-responsive sequence of Aalpha fibrinogen gene and a natural 20-bp probe that does conform to the IL-6 RE palindrome located within the alpha2 macroglobulin gene. EMSAs were performed by using these two oligonucleotides as probes to determine if Stat 3 was involved in regulating Aalpha gene expression during IL-6 stimulation. Nuclear proteins used in the EMSA were taken from the livers of uninjected (control) and lipopolysaccharide-injected rats. The results in Fig. 2A) show that, using the alpha2-macroglobulin probe, a gel shift pattern presented similar to a previously termed Stat 3 (APRF) shift(17, 18, 19, 20) ; however, this same gel pattern did not occur with the Aalpha probe. To verify that the band in the alpha2 macroglobulin probe was due to an interaction with Stat 3, we carried out a supershift assay with anti-Stat 3 polyclonal antibody (Fig. 2B). As can be seen, a slower migrating supershift band was formed with anti-Stat 3 but not with nonspecific antibody (anti-gp130). These results provide additional evidence for the presence of Stat 3 in the extracts taken from the inflamed animal. However, the same experiment was done with Aalpha probe, and no difference was found by adding Stat 3 antibody. In a different set of experiments, nuclear extracts were prepared from primary hepatocytes (both control and IL-6-stimulated cells). The result shown in Fig. 2C indicates that IL-6 stimulated the formation of three complexes on the alpha2-macroglobulin probe. Anti-Stat 3 antibody interacted with one of the complexes to form a supershifted band, whereas the other two bands were unaffected by this antibody. It is likely that the unaffected two bands are formed with Stat 1alpha(29, 30) . On the other hand, activated Stat 3 (as detected by the supershift) does not form a complex with the IL-6-responsive sequence of Aalpha fibrinogen gene. This finding strongly indicates that Stat 3 is not directly involved in Aalpha gene activation. We emphasize, however, that a specific protein does interact with the IL-6 element of this gene. In Fig. 2C, the upperbands in lanes5-8 are nonspecific bands as determined by competition and mutant probe assay. Although there is a diminished intensity of the Aalpha band (in lane7), the upper (nonspecific) band is also diminished. This could indicate that some destabilization of the binding occurs in the reaction in the presence of anti-Stat 3 by an unknown mechanism.


Figure 2: Identification of the IL-6-responsive sequence binding protein in fibrinogen Aalpha promoter. A, electrophoretic mobility shift assays to determine if the IL-6-responsive sequence of Aalpha fibrinogen binds activated Stat 3. The DNA probes used were a 20-bp fragment corresponding to the rat alpha2 macroglobulin acute phase response element (denoted as alpha2 probe) (5`-GATCCTTCTGGGAATTCC-3`) and a 30-bp fragment of Aalpha fibrinogen IL-6-responsive sequence in which the IL-6 RE was positioned in the middle (Aalpha probe 5`-GAGCAAGAATTTCTGGGATGCCGTGGTT-3`). Probes were labeled with [P]dNTP by Klenow fragment. Nuclear extracts were prepared according to the protocol from liver of rats, which had been treated with an intraperitoneal lipopolysaccharide (LPS) (10 mg of lipopolysaccharide/1-kg rat) injection (and the liver extracted at 60 min post-injection) and a sham injection. The EMSAs were run in 4% non-denaturing polyacrylamide gels. B, verification of Stat 3 band in the EMSA. 2 µg of antibody was mixed with 10 µg of extract protein at 4 °C for 1 h prior to EMSA. The probe used in lanes1-3 was the alpha2 probe. The Aalpha probe was used in lanes4-6. The extract was prepared as described in A, and binding conditions were also the same as in A above. C, verifying activated Stat 3 by IL-6 does not interact with IL-6 RE of Aalpha fibrinogen. The probe used in lanes1-4 was the alpha2 probe. In lanes5-8, the Aalpha probe was used. The nuclear extract used in the reaction was prepared from primary hepatocytes as described under ``Materials and Methods.'' The binding reaction for detection of supershifted bands was identical to that in B above.



Response of Aalpha Fibrinogen Gene to Epidermal Growth Factor

The recent observations that epidermal growth factor can stimulate the phosphorylation of Stat 3 (19, 31) expands the number of activating ligand-receptor complexes that may control downstream genes. To determine if the genes of fibrinogen could be among those that also respond to EGF and to see if the activation of Stat 3 by another pathway not involving the IL-6 signal transducer, gp130, might affect the fibrinogen genes, we treated primary hepatocytes with epidermal growth factor and then examined the Aalpha response by Northern gels. The results shown in Fig. 3A demonstrate that EGF has no effect on the expression on the Aalpha mRNA in these cells. Additionally, when transfected H-35 cells with the Aalpha-promoter-luciferase construct were stimulated with EGF, no increased luciferase activation was observed, as shown in Fig. 3B.


Figure 3: Response of the Aalpha fibrinogen gene to epidermal growth factor. A, Northern blot hybridization to detect transcription of Aalpha fibrinogen during IL-6 or EGF stimulation. Total RNA from treated and untreated primary hepatocytes was fractionated in the denatured agarose gel and then transferred to nitrocellulose membranes to be hybridized with P-labeled Aalpha cDNA. Lanes1-3 show RNA from untreated and IL-6-treated primary hepatocytes; lanes4-6 show the RNA extracted from untreated and EGF-treated cells. B, determination of response of Aalpha gene promoter to EGF induction. The construct carrying Aalpha promoter (-254/+30)in the upstream of luciferase reporter gene in pGL-2 vector was transfected into H-35 cells, and then the cells were treated with 100 ng/ml rmIL-6 or 100 ng/ml EGF to be subjected to luciferase assay.



Kinetics of IL-6 Transcription Factor-DNA Complex Formation

To better define the kinetics of IL-6 activation of the Aalpha gene, we prepared nuclear extracts from primary hepatocyte monolayers that had been exposed to rmIL-6 for different times. Results in Fig. 4A demonstrate that moderate but unvaryingly reproducible differences in migration of the complexes occur during IL-6 activation of this gene. We emphasize several points shown in the figure. Lane1 contains a strong well defined complex (we designate this as complex I and reiterate its presence at zero time or in unstimulated conditions); lane2 (nuclear extracts taken 10 min post-IL-6 stimulation) shows the formation of a second band, migrating slightly slower than complex I, and is designated complex II; in lane3 (40 min post-IL-6 stimulation), only complex II is present, and there is no appearance of a Stat 3-like band; in lane 4 (60 min post-IL-6 induction), complex I reappears, and complex II diminishes; in lane5 (120 min post-IL-6 stimulation), complex II has disappeared, and complex I is the most prominently retarded band, thus completing the IL-6 activation cycle in the Aalpha gene. The time course of IL-6 induction of the hepatocytes at 20, 40, 60, and 120 min was carried out in five separate experiments. Nearly all of complex I disappeared by 20 min, and complex II became the major band and remained for as long as 40 min. The specificity of the protein binding to the Aalpha probe was verified by competition binding experiments in which increasing molar excess of unlabeled probe was added and EMSA was performed (Fig. 4B).


Figure 4: A, kinetics of IL-6-activated transcription factor-Aalpha probe complex formation. Nuclear extracts from primary hepatocytes (in monolayer cell cultures), which were exposed to 100 ng/ml rm IL-6 for different times were used, and the products of the binding reaction were assessed on 10% polyacrylamide gels for high resolution. B, verification specificity of the complexes by competition assay. Nuclear extract from untreated and IL-6-treated (20 min, 100 ng/ml) primary hepatocytes was subjected to mobility shift assay in the presence of 30-, 60-, and 250-fold molar excess of unlabeled Aalpha probe.



Mutational Analysis of the IL-6 RE Site in the Complex Formation

To confirm the role of the IL-6 RE in the formation of complex I and II, we constructed a series of mutant forms of this 30-bp probe by altering selected nucleotides. Mutant 1 changes the first 3 bp of the CTGGGA element, mutant 2 changes the last three bases, and mutant 3 changes all of the bases in the hexanucleotide; all three mutant probes were used in EMSA (Fig. 5). Results in panelsA and B showed that the probes mutated in the IL-6 RE failed to form the complex I; however, complex II was present. These findings demonstrate that all base pairs of the IL-6 RE are essential for complex I formation but not complex II.


Figure 5: Determination of CTGGGA domain in the complex formation. The results of EMSA using probes with base changes in the IL-6 RE are shown in panelsA and B. The altered bases in this site are shown below (M1-3). EMSAs were performed using nuclear extract from IL-6 (100 ng/ml)-treated and untreated cells. Regular probe (R), 5`GAGCAAGAATTTCTGGGATGCCGTGGTT3`; mutant 1 (M1), 5`-GAGCAAGAATTTAGTGGATGCCGTGGTT-3`; mutant 2 (M2), 5`-GAGCAAGAATTTCTGTTCTGCCGTGGTT-3`; mutant 3 (M3), 5`-GAGCAAGAATTTAGTTTCTGCCGTGGTT-3`.



Importance of IL-6 RE Flanking Sequence in the Complex I and II Formation

To explore the importance of the nucleotides surrounding the IL-6 RE, we made probes mutated in the upstream and downstream flanking regions. Six base pairs immediately 5` to the IL-6 RE were altered, and this probe was designated M-4; likewise, six bp 3` to the IL-6 RE were changed, and this probe was called M-5. The results in the EMSA using these mutant probes shown in Fig. 6A display that, in addition to the six bases within IL-6 RE, adjacent upstream hexanucleotides are required for forming complex I. On the other hand, the M-5 probe abolished the formation of complex II but did permit complex I formation. The latter result was reinforced by the finding that an additional mutation of the last 6 bp in the 3` side also abolished the formation of complex II (data not shown). Thus, the formation of complex II depends on the nucleotide sequence in the downstream of IL-6 RE, whereas the IL-6 RE and an adjacent six upstream nucleotides are required for complex I formation. That the flanking regions are essential for the formation of both complexes was verified by randomizing the nucleotide sequences in both upstream and downstream regions of the CTGGGA sequence, respectively. Since neither complex could form (Fig. 6B), we conclude that the 5`- and 3`-flanking regions are essential for the two complexes to form.


Figure 6: Determination of function of flanking sequence in the complex formation. PanelsA and B show EMSA with probes altered in the flanking sequence of the IL-6 RE. The sequence of probes mutated on adjacent sides of the IL-6 RE are shown below (M4-5). The mutation site is underlined. Mutant 4 (M4), 5`-GAGCAATTCACTCTGGGATGCCGTGGTT-3`; mutant 5 (M5), 5`-GAGCAAGAATTTCTGGGACGTACGGGTT-3`; mutant 6 (M6), 5`-AAGTGATTCACTCTGGGAACGTACGAAT-3`.



Functional Analysis of the Forming Sites of the Two Complexes

To gain additional information concerning the function of complex I and complex II in the IL-6 response, we carried out functional studies (luciferase-reporter gene assay) by mutagenizing selected nucleotides within the IL-6 RE and its flanking region. A 284-bp fragment containing -254 to +30 of Aalpha promoter was inserted upstream of luciferase gene in pGL-2 vector and subjected to specific site-directed mutagenesis. Mutations were introduced in the CTGGGA domain and its flanking region. The sites altered are shown in Fig. 7. These constructs were then transfected into H-35 cells. The results showed that mutation in the IL-6 RE drastically decreased IL-6 response of the promoter. That the mutation in the upstream flanking sequence also diminished the response to IL-6 demonstrated that both the Aalpha IL-6 RE and the upstream flanking sequence are essential for a full response to IL-6. This finding is consistent with complex I formation and indicates that a specific binding at the IL-6 RE and its 5`-flanking region prior to IL-6 stimulation is required for an IL-6 response. The mutation in three nucleotides of IL-6 RE (M7) shows less effect to IL-6 response than that in all six nucleotides of IL-RE. Since alteration of the downstream domain did not affect the IL-6 activation of the reporter gene, it indicates that complex II formation is not an essential event in the IL-6 up-regulation of the Aalpha gene. Because of its close proximity to complex I, we suggest it may provide a nearby ``docking site'' for the protein that is bound to the IL-6 RE during the activation process.


Figure 7: Functional analysis of the forming sites of the two complexes. A fragment consisting of -254 to +30 nucleotides of the Aalpha promoter was inserted upstream of luciferase gene in pGL-2 vector. The selected nucleotide changes were introduced in the CTGGGA and its flanking region by using site-directed mutagenesis (Transformer Kit, Clontech). Each constructed plasmid was transfected into H-35 cells using Lipofectin (Life Technologies, Inc.) and then treated with (100 ng/ml) rmIL-6 for 13 h. The figure shows a representative experiment carried out in triplicate. Three separate transfection assays using these constructs were performed, and all showed similar responses. The numberabove the bar indicates the -fold increased by IL-6 stimulation.



Analysis of Protein Involved in the Complex Formation by UV Cross-linking Assay

UV cross-linking of protein to DNA is a sensitive method to determine a specific DNA binding protein. To determine the approximate size of the protein that associates with the IL-6 RE in the Aalpha fibrinogen gene, we carried out UV cross-linking analysis. Following exposing to 254 nm of UV light for 3.5 min, the protein complexes were separated by SDS-polyacrylamide gel electrophoresis. As can be seen in Fig. 8, a protein from nuclear extract of non-treated primary hepatocytes cross-linked with the labeled probe. The molecular mass of this protein was approximately 50 kDa, which is similar to that of the cross-linked protein from nuclear extract of IL-6-stimulated primary hepatocytes. This finding suggests that the protein forming complex I and complex II may be the same. The difference in mobility between these two complexes is due to an IL-6-induced modification of this protein.


Figure 8: Analysis of the protein that is involved in complex I and II by UV cross-linking assay. The binding assay with Aalpha probe was the same as that in the EMSA described above. 100-fold unlabeled Aalpha probe was used in verifying the specificity of protein. The products of UV cross-linking were fractionated on 10% SDS-polyacrylamide.




DISCUSSION

An increasing body of information has demonstrated the presence of a major signaling pathway involving a family of cytoplasmic tyrosine kinases (Jak kinases) that are activated by cytoplasmic domains of receptors that do not themselves possess a tyrosine kinase motif(32, 33) . The signal-transducing protein for IL-6, gp130, belongs to this group(34) . Additional information linking the IL-6 pathway to that of gene transcription has demonstrated that substrates of the Jak kinases, once they become activated (phosphorylated), quickly transport to the nucleus and affect transcription of specific genes. Identification that Stat 3 served as a specific IL-6 transcription factor for a member of the class 2 group of acute phase proteins has led to the notion that perhaps Stat 3 may regulate all members of the class of proteins exhibiting the IL-6 RE consensus element. Information presented in this study appears to cast some doubt on Stat 3 being a ``universal'' regulator of acute phase proteins of the class II variety.

To understand more precisely the regulation of fibrinogen gene expression, we investigated one of the genes of this molecule, the Aalpha gene. Fibrinogen can be regarded as somewhat of a special case of acute phase proteins in that it is constitutively expressed at a moderate level(35, 36, 37) . In response to an IL-6 impulse, the transcription of each of the three fibrinogen genes increase by approximately 3-fold, leading to an increase of circulating levels from 2-2.5 to 5-6.5 mg/ml. The expression of the three genes are stringently coordinated in both transcription and translation(35, 36, 37, 38) . Analysis of the promoter region of the Aalpha gene revealed the presence of sequence coinciding with that of the IL-RE. Functional analyses of the Aalpha promoter demonstrated a single IL-6-responsive region that does not include the consensus sequence for C/EBP, since the fragment (-142/+30) in which only partial putative CAAT enhancer sequence resides still has normal response to IL-6. Thus, the increased transcription of the Aalpha gene during an acute inflammation occurs by IL-6 response element of the class II variant only.

More extensive examinations of the IL-6 binding element were carried out using mobility shift assays utilizing a naturally occurring 30-bp base sequence in which the CTGGGA element was positioned in the center of the probe. Nuclear extracts made from primary hepatocytes in culture that had been treated with or without IL-6 and glucocorticoids revealed, unexpectedly, a protein associating with the IL-6 RE even when the cells had not been stimulated with IL-6. Nuclear extracts prepared from IL-6-treated hepatocytes also revealed a slightly slower migrating band. The specificity of the bands was confirmed by competition binding experiments. The position of the bands in the gel suggested that the DNA-protein complex was smaller than that reported for Stat 3 association with the IL-6 RE in the alpha2 macroglobulin promoter(17, 18) . Utilization of anti-Stat 3 antibodies confirmed the presence of Stat 3 on the alpha(2) probe and also demonstrated that the gel pattern of the Aalpha probe does not contain Stat 3. These findings provide evidence that Stat 3 is not associating with the IL-6 RE element in the Aalpha gene. In Fig. 2C, using extracts from IL-6-stimulated primary hepatocytes, three complexes formed on the alpha2 probe. Recently, a similar gel shift pattern was reported and indicated that Stat 1alpha is also activated by the IL-6 and forms a homodimer and a heterodimer with Stat 3 to bind on the IL-6 RE palindrome(29, 30) . Apparently, the complex formed by Aalpha probe is different from Stat 1alpha and Stat 3. UV cross-linking assay indicated that the molecular weight of the protein binding Aalpha probe is different from that of the members of the Stat family.

Two recent reports (19, 31) demonstrated that epidermal growth factor activated Stat 3 in hepatocytes. As a follow-up to these observations, EGF was added to cultures of primary heptocytes, and its effect on fibrinogen expression was determined by Northern gel analyses. The presence of EGF had no stimulatory affect on fibrinogen mRNA. Additionally, when H-35 hepatoma cells that had been transfected with the Aalpha promoter-luciferase construct were treated with EGF, no luciferase activation was observed. These findings demonstrate that EGF has no affect on fibrinogen synthesis, whereas it has been clearly documented that Stat 3 is activated by this growth factor. These findings reinforce the observations presented here that activation of Stat 3 is not sufficient for increased fibrinogen expression.

It is known that different cytokines can stimulate the same member of the Stat family in the same tissues or cell line(19, 21, 29, 30) . These observations indicate that stimulation of the Stat family can occur by different ligand and receptor complexes. Thus activation of a Stat may represent only an early step in the signaling cascade and that other proteins are involved downstream of activated Stat to affect the expression of a specific gene. The data presented here suggest that an IL-6 pathway exists for an acute phase protein (Aalpha fibrinogen) that does not involved Stat 3 directly.

An advantage of the primary hepatocyte culture model is the capacity to more precisely determine response time of these cells to IL-6. Nuclear extracts were prepared from cells that had been exposed to IL-6 for brief periods of time (10 min to 2 h), and then each extract was used in an EMSA. The gel migration patterns suggest an IL-6 activation cycle for this gene. A specific protein appears to reside on the IL-6 RE during non-stimulated, presumably constitutive conditions; then, upon IL-6 activation, the protein leaves this site, and either it re-associates a few bases downstream or another protein associates 12 bp downstream of the sequence from the IL-6 RE. The protein remains at the second site only briefly, and then the initial binding protein reappears on the IL-6 RE. It seems probable that the same protein is involved in the two identified bands and that the modest change in mobility is due to reversible protein modification. The formulation of this IL-6 activation cycle was based upon the results of constructing a series of six mutations in the IL-6 RE and its flanking regions and then determining the affect of each mutant on the formation of the different complexes.

The functional assays carried out using a large fragment of the Aalpha promoter (-250 to +30) containing the IL-6 RE provided additional support for the importance of the CTGGGA element. When mutated regions of this fragment were constructed and used in luciferase assays, it was apparent that the ``functional'' IL-6 RE for this gene consists of a 12-bp region, GAATTTCTGGGA (an additional six nucleotides upstream of the predicted CTGGGA element).

These findings provide evidence that the IL-6 response of the Aalpha fibrinogen gene is accomplished by a previously unidentified protein that resides in the IL-6 RE during nonstimulated conditions. Our results suggest that an additional IL-6 signaling process is involved in at least one class 2 acute phase protein. Precisely how the IL-6 signal is meditated to activate the Aalpha core protein and how this affects Aalpha gene transcription is under investigation.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Cell Biology, Basic Health Science Bldg., Rm. 680, University of Alabama at Birmingham, Birmingham, AL 35294-0005. Tel.: 205-934-7596; Fax: 205-934-0950; gmfuller{at}bmg.uab.edu.

(^1)
The abbreviations used are: IL, interleukin; bp, base pair(s); EMSA, electrophoretic mobility shift assay; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; EGF, epidermal growth factor; C/EBP, CAAT enhancer binding protein; IL-6 RE, interleukin-6 response element; rm, recombinant murine.

(^2)
Z. Liu and G. M. Fuller, unpublished data.


REFERENCES

  1. Baumann, H., Prowse, K. R., Marinkovie, S., Wea, K. A., and Jahreis, G. P. (1989) Ann. N. Y. Acad. Sci. 557, 280-295 [Medline] [Order article via Infotrieve]
  2. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C. (1990) Mol. Cell. Biol. 10, 6642-6653 [Abstract/Free Full Text]
  3. Ganter, U., Arcone, R., Toniatti, C., Morrone, G., and Ciliberto, G. (1989) EMBO J. 8, 3773-3779 [Medline] [Order article via Infotrieve]
  4. Oliviero, S., and Cortese, R. (1989) EMBO J. 8, 1145-1151 [Medline] [Order article via Infotrieve]
  5. Poli, V., and Cortese, R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8202-8206 [Abstract/Free Full Text]
  6. Wilson, D. R., Juan, T. S., Wilde, M. D., Fey, G. H., and Darlington, G. J. (1990) Mol. Cell. Biol. 10, 6282-6191
  7. Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 63, 643-653 [CrossRef][Medline] [Order article via Infotrieve]
  8. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897-1906 [Medline] [Order article via Infotrieve]
  9. Kinoshita, S., Akira, S., and Kishimoto, T. (1992) Proc. Natl. Acad. Sci. U. S. A. 87, 1473-1476
  10. Nonaka, M., and Huang, Z. M. (1990) Mol. Cell. Biol. 10, 6283-6289 [Abstract/Free Full Text]
  11. Ron, D., Brasier, A. R., McGehee, R. J., and Habener, J. F. (1992) J. Clin. Invest. 89, 223-233
  12. Hocke, G. M., Barry, D., and Fey, G. H. (1992) Mol. Cell. Biol. 12, 2282-2294 [Abstract/Free Full Text]
  13. Dalmon, J., Laurent, M., and Courtois, G. (1993) Mol. Cell. Biol. 13, 1183-1193 [Abstract/Free Full Text]
  14. Anderson, G. M., Shaw, A. R., and Shaeffer, J. A. (1993) J. Biol. Chem. 268, 22650-22655 [Abstract/Free Full Text]
  15. Won, K.-A., and Baumann, H. (1990) Mol. Cell. Biol. 10, 3965-3978 [Abstract/Free Full Text]
  16. Chen, H., and Liao, W. S. L. (1993) J. Biol. Chem. 268, 25311-25319 [Abstract/Free Full Text]
  17. Wegenka, U. M., Buschmann, J., Lutticken, C., Heinrich, P. C., and Horn, F. (1993) Mol. Cell. Biol. 13, 276-288 [Abstract/Free Full Text]
  18. Wegenka, U. M., Lutticken, C., Buschmann, J., Yuan, J., Lottspeich, F., Muller-Esterl, W., Schindler, C., Roeb, E., Heinrich, P. C., and Horn, F. (1994) Mol. Cell. Biol. 14, 3186-3196 [Abstract/Free Full Text]
  19. Zhong, Z., Wen, Z., and Darnell, J. E. J. (1994) Science 264, 95-98 [Abstract/Free Full Text]
  20. Akira, S., Nishio, Y., Inoue, M., Wang, X., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M., and Kishimoto, T. (1994) Cell 77, 63-71 [CrossRef][Medline] [Order article via Infotrieve]
  21. Yuan, J., Wegenka, U. M., Lutticken, C., Buschmann, J., Decker, T., Schindler, C., Heinrich, P. C., and Horn, F. (1994) Mol. Cell. Biol. 14, 1657-1668 [Abstract/Free Full Text]
  22. Fuller, G. M., Bunzel, R. J., and Nesbitt, J. E. (1988) Methods Enzymol. 163, 474-485 [Medline] [Order article via Infotrieve]
  23. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., pp. 14.2-14.4, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  24. Nordeen, S. K. (1988) BioTechniques 6, 454-457 [Medline] [Order article via Infotrieve]
  25. Deryckere, F., and Gannon, F. (1994) BioTechniques 16, 405 [Medline] [Order article via Infotrieve]
  26. Gorski, K., Carneiro, M., and Schibler, U. (1986) Cell 47, 767-776 [CrossRef][Medline] [Order article via Infotrieve]
  27. Wang, Y., and Fuller, G. M. (1994) Mol. Biol. Cell 5, 819-828 [Abstract]
  28. Ausubel, F. M., Brent, R., Kingston, R., Moore, D., Seidman, J. G., Smith, J. A., and Struhl, K. (1989) Current Protocols in Molecular Biology , pp. 12.5.1-12.5.8, Greene Publishing Associates and Wily-Interscience, New York
  29. Sadowski, H. B., Shuai, K., Darnell, J. E. J., and Gilman, M. Z. (1993) Science 261, 1739-1744 [Abstract/Free Full Text]
  30. Horroch, S., Revel, M., and Chebath, J. (1994) J. Biol. Chem. 269, 26191-26195 [Abstract/Free Full Text]
  31. Ruff-Jamison, S., Zhong, Z., Wen, Z., Chen, K., Darnell, J. E., Jr., and Cohen, S. (1994) J. Biol. Chem. 269, 21933-21935 [Abstract/Free Full Text]
  32. Ihle, J. N., Witthuhn, B. A., Quelle, F. W., Yamamoto, K., Thierfelder, W. E., Kreider, B., and Silvennoinen, O. (1994) Trends Biochem. Sci. 19, 222-227 [CrossRef][Medline] [Order article via Infotrieve]
  33. Wilks, A. F. (1991) Methods Enzymol. 200, 533-546 [Medline] [Order article via Infotrieve]
  34. Kishimoto, T., Akira, S., and Taga, T. (1992) Science 258, 593-597 [Abstract/Free Full Text]
  35. Otto, J. M., Grenett, H. E., and Fuller, G. M. (1987) J. Cell Biol. 105, 1067-1072 [Abstract/Free Full Text]
  36. Crabtree, G. R. (1987) in The Molecular Basis of Blood Diseases (Stamatoyannopoulos, G., Nienhuis, A. W., Leder, P., and Majerus, P. W., eds) pp. 631-658, W. B. Saunders Co., Philadelphia, PA
  37. Roy, S. N., Muknopadhyay, G., and Redman, C. M. (1990) J. Biol. Chem. 265, 6389-6393 [Abstract/Free Full Text]
  38. Nesbitt, J. E., and Fuller, G. M. (1991) Biochim. Biophys. Acta 1089, 88-94 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Verschuur, M. de Jong, L. Felida, M. P. M. de Maat, and H. L. Vos
A Hepatocyte Nuclear Factor-3 Site in the Fibrinogen {beta} Promoter Is Important for Interleukin 6-induced Expression, and Its Activity Is Influenced by the Adjacent -148C/T Polymorphism
J. Biol. Chem., April 29, 2005; 280(17): 16763 - 16771.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Xia
Regulation of {gamma}-Fibrinogen Chain Expression by Heterogeneous Nuclear Ribonucleoprotein A1
J. Biol. Chem., April 1, 2005; 280(13): 13171 - 13178.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. O. Duan and P. J. Simpson-Haidaris
Functional Analysis of Interleukin 6 Response Elements (IL-6REs) on the Human {gamma}-Fibrinogen Promoter: BINDING OF HEPATIC Stat3 CORRELATES NEGATIVELY WITH TRANSACTIVATION POTENTIAL OF TYPE II IL-6REs
J. Biol. Chem., October 17, 2003; 278(42): 41270 - 41281.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. B. Boffa, J. D. Hamill, N. Bastajian, R. Dillon, M. E. Nesheim, and M. L. Koschinsky
A Role for CCAAT/Enhancer-binding Protein in Hepatic Expression of Thrombin-activable Fibrinolysis Inhibitor
J. Biol. Chem., July 5, 2002; 277(28): 25329 - 25336.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. S. Hagood, A. Mangalwadi, B. Guo, M. W. MacEwen, L. Salazar, and G. M. Fuller
Concordant and Discordant Interleukin-1-Mediated Signaling in Lung Fibroblast Thy-1 Subpopulations
Am. J. Respir. Cell Mol. Biol., June 1, 2002; 26(6): 702 - 708.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
G. M. FULLER and Z. ZHANG
Transcriptional Control Mechanism of Fibrinogen Gene Expression
Ann. N.Y. Acad. Sci., June 1, 2001; 936(1): 469 - 479.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Alonzi, D. Maritano, B. Gorgoni, G. Rizzuto, C. Libert, and V. Poli
Essential Role of STAT3 in the Control of the Acute-Phase Response as Revealed by Inducible Gene Activation in the Liver
Mol. Cell. Biol., March 1, 2001; 21(5): 1621 - 1632.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. I. Leu, M. A. S. Crissey, J. P. Leu, G. Ciliberto, and R. Taub
Interleukin-6-Induced STAT3 and AP-1 Amplify Hepatocyte Nuclear Factor 1-Mediated Transactivation of Hepatic Genes, an Adaptive Response to Liver Injury
Mol. Cell. Biol., January 15, 2001; 21(2): 414 - 424.
[Abstract] [Full Text]


Home page
J. Gerontol. A Biol. Sci. Med. Sci.Home page
C. F. Pieper, K. M. K. Rao, M. S. Currie, T. B. Harris, and H. J. Cohen
Age, Functional Status, and Racial Differences in Plasma D-Dimer Levels in Community-Dwelling Elderly Persons
J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2000; 55(11): 649M - 657.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
A. Ray
A SAF Binding Site in the Promoter Region of Human {gamma}-Fibrinogen Gene Functions as an IL-6 Response Element
J. Immunol., September 15, 2000; 165(6): 3411 - 3417.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. Olman, J. S. Hagood, W. L. Simmons, G. M. Fuller, C. Vinson, and K. E. White
Fibrin Fragment Induction of Plasminogen Activator Inhibitor Transcription Is Mediated by Activator Protein-1 Through a Highly Conserved Element
Blood, September 15, 1999; 94(6): 2029 - 2038.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Bing, S. A. G. Reddy, Y. Ren, J. Qin, and W. S.-L. Liao
Purification and Characterization of the Serum Amyloid A3 Enhancer Factor
J. Biol. Chem., August 27, 1999; 274(35): 24649 - 24656.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. W. Phillips, R. Sharma, P. A. Leco, and D. R. Edwards
A Sequence-selective Single-strand DNA-binding Protein Regulates Basal Transcription of the Murine Tissue Inhibitor of Metalloproteinases-1 (Timp-1) Gene
J. Biol. Chem., August 6, 1999; 274(32): 22197 - 22207.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. A. Cantwell, E. Sterneck, and P. F. Johnson
Interleukin-6-Specific Activation of the C/EBPdelta Gene in Hepatocytes Is Mediated by Stat3 and Sp1
Mol. Cell. Biol., April 1, 1998; 18(4): 2108 - 2117.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. Zhang, M. Sun, D. Samols, and I. Kushner
STAT3 Participates in Transcriptional Activation of the C-reactive Protein Gene by Interleukin-6
J. Biol. Chem., April 19, 1996; 271(16): 9503 - 9509.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-H. Hu, J. E. Harris, E. W. Davie, and D. W. Chung
Characterization of the 5`-Flanking Region of the Gene for the alpha Chain of Human Fibrinogen
J. Biol. Chem., November 24, 1995; 270(47): 28342 - 28349.
[Abstract] [Full Text] [PDF]


Home page