JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siegall, C. B.
Right arrow Articles by Fell, H. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siegall, C. B.
Right arrow Articles by Fell, H. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7625-7630
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
HER4 Expression Correlates with Cytotoxicity Directed by a Heregulin-Toxin Fusion Protein (*)

(Received for publication, December 2, 1994)

Clay B. Siegall (§) Sarah S. Bacus (2) Bruce D. Cohen Gregory D. Plowman (¶) Bruce Mixan Dana Chace Dot M. Chin (2) Andy Goetze (1) Janell M. Green Ingegerd Hellström Karl Erik Hellström H. Perry Fell

From the  (1)Molecular Immunology Department and the BioProcess Research Department, Bristol-Myers Squibb, Pharmaceutical Research Institute, Seattle, Washington 98121 and (2)Advanced Cellular Diagnostics, Inc., Elmhurst, Illinois 60126

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We have constructed, expressed, and purified a fusion protein, HAR-TX beta2, consisting of heregulin-beta2 fused to a binding-defective form of Pseudomonas exotoxin A, PE40. The fusion protein was found to induce receptor tyrosine phosphorylation in CEM cells transfected with HER4 alone or in combination with HER2 but not in cells transfected with HER2 or HER1 alone. The phosphorylation of receptor tyrosines was both dose-dependent and saturable in amounts similar to those shown to be active for native heregulin. HAR-TX beta2 was specifically cytotoxic toward a variety of carcinoma cell lines in the ng/ml range. However, some tumor cell lines were found to be insensitive to the cytotoxic action of the fusion protein even at >2 µg/ml. Relative amounts of HER4, HER3, and HER2 were determined on seven cell lines sensitive and four cell lines insensitive to HAR-TX beta2. All lines that express HER4 were killed by HAR-TX beta2, while none lacking HER4 were affected. HAR-TX beta2 was able to bind to and signal via tyrosine phosphorylation in cell lines that co-express HER2 and HER3 in the absence of HER4 without inducing cytotoxicity. Thus HAR-TX beta2 may prove to be a useful reagent for the targeting and elimination of HER4-positive tumor cells.


INTRODUCTION

Heregulin is part of a family of ligands that have structural homology with epidermal growth factor (EGF) (^1)and has been shown to specifically bind to the protein product of the HER4 gene, HER4/p(1) . Recent data indicate that heregulin also binds directly to HER3 (2) but that HER3 with HER2 forms a high affinity receptor for heregulin(3) . Heregulin has also been shown to bind to HER4 with 7-fold greater affinity than to HER3(4) . Heregulin was originally purified from conditioned medium of the human breast tumor line MDA-MB-231 as a variety of related forms and was postulated to bind directly to HER2(5) . To date, a variety of isoforms have been isolated that are members of the heregulin family. They include acetylcholine receptor-inducing activity, glial growth factor, gp30, and p75(6, 7, 8, 9) . Neu differentiation factor (NDF), a rat homologue of heregulin, has also been identified(10) .

To determine whether heregulin would be an effective ligand for the development of a targeted cytotoxic molecule, a gene fusion encoding heregulin beta2 with the hydrophilic leader sequence of amphiregulin (AR) at its amino terminus (for purification purposes) and a binding-defective form of Pseudomonas exotoxin A (11) was constructed and expressed in Escherichia coli. Following refolding and purification, HAR-TX beta2 was tested for direct binding to tumor cells and for the ability to induce tyrosine phosphorylation of receptors in cells transfected with various HER family members. The cell-killing activity of HAR-TX beta2 was measured against tumor cells and correlated with their expression levels of HER4, HER3, and HER2 as determined by image analysis with antibodies to each receptor.


EXPERIMENTAL PROCEDURES

Reagents and Cell Lines

Mouse monoclonal anti-PE antibody was supplied by Dr. Tony Siadek, and heregulin beta2-Ig came from Dr. J.-M. Colousco, both of Bristol-Myers Squibb (Seattle, WA). Breast carcinoma cell lines BT474, MDA-MB-453, T47D, SKBR3, and MCF-7, LNCaP prostate carcinoma, CEM T cell leukemia, and the ovarian carcinoma cell line SKOV3 were purchased from ATCC (Rockville, MD). The H3396 breast carcinoma line and the L2987 lung carcinoma line were established at Bristol-Myers Squibb, Seattle, WA. BT474 and T47-D cells were cultured in Iscove's modified Dulbecco's medium supplemented with 10% fetal bovine serum (FBS) and 10 µg/ml insulin. MCF-7, H3396, LNCaP, and L2987 were cultured in Iscove's modified Dulbecco's medium supplemented with 10% FBS. SKBR3 and SKOV3 cells were cultured in McCoy's medium supplemented with 10% FBS, and the MDA-MB-453 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS and 0.5% nonessential amino acids. AU565 human breast carcinoma cells were obtained from the Cell Culture Laboratory, Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA) and were cultured in RPMI 1640 supplemented with 15% FBS. CEM transfectants (1) (CEM/HER1, CEM/HER2, CEM/HER4, and CEM/HER2-HER4) were cultured in RPMI supplemented with 10% FBS and 500 µg/ml G418.

Construction of HAR-TX beta2 Expression Plasmid

Rat heregulin cDNA (12) was obtained by reverse transcription polymerase chain reaction from mRNA isolated from rat kidney cells. The cDNA was prepared in chimeric form with the AR leader sequence by a two-step polymerase chain reaction insertional cloning protocol using cDNA cARP (13) as template to amplify the 5`-end of the chimeric ligand using primers CARP5 (5`-CGGAAGCTTCTAGAGATCCCTCGAC-3`) and ANSHLIK2 (3`-CCGCACACTTTATGTGTTGGCTTGTGTTTCTTCTATTTTTTCCATTTTTG-5`). The EGF-like domain was polymerase chain reaction-amplified from cNDF1.6 (1) using primers ANSHLIK1 (5`CAAAAATGGAAAAAATAGAAGAAACAGAAGCCATCTCATAAAGTGTGCGG-3`) and XNDF1053 (3`-GTCTCTAGATTAGTAGAGTTCCTCCGCTTTTTCTTG-5`). The products were combined and reamplified using primers CARP5 and XNDF1053. The HAR (heregulin-amphiregulin) construct (cNANSHLIK) was polymerase chain reaction-amplified in order to insert an NdeI restriction site on the 5`-end and a HindIII restriction site on the 3`-end with primers NARP1 (5`-GTCAGAGTTCATATGGTAGTTAAGCCCCCCCAAAAC-3`) and NARP4 (3`GGCAGTTCTATGAACACGTTCACGGGCTTGCTTAAATGACCGCTGGCAACGGTCTTGATACAATACCGTAGAAAAATGTTTAGCCTCCTTGAGATGTTCGAATCTCCTAGAAAC5`). The resulting 287-base pair DNA fragment was digested with NdeI and HindIII followed by ligation into a similarly digested expression plasmid pBW 7.0(14) , resulting in an expression plasmid (pSE 8.4) that contained the gene fusion encoding the heregulin-toxin fusion protein.

Expression and Isolation of Recombinant Protein

HAR-TX beta2 encoded in pSE 8.4 was transformed into E. coli BL21 (DE3) and expressed by fermentation in T broth containing 100 µg/ml ampicillin at 37 °C until A = 4.8 followed by induction with 1 mM IPTG. The cells were harvested after 90 min by centrifugation and frozen at -70 °C. The cell pellet was thawed and suspended in 4 °C solubilization buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 µg/ml leupeptin, 2 µg/ml aprotinin, 1 µg/ml pepstatin A, 0.5 mM phenylmethylsulfonyl fluoride) containing 1% Tergitol by homogenization and sonication. The suspension was pelleted by centrifugation and washed three times with solubilization buffer containing 0.5% Tergitol (first wash), 1 M NaCl (second wash), and buffer alone (third wash). The final cell pellet was dissolved in 6.5 M guanidine HCl, 0.1 M Tris-HCl (pH 8.0), 5 mM EDTA, sonicated, and refolded by rapid dilution (100-fold) into 0.1 M Tris-HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, and 0.1 mM oxidized glutathione at 4 °C. Refolded HAR-TX beta2 protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cationexchange resin (POROS 50 HS; PerSeptive Biosystems, Cambridge, MA) equilibrated in the same buffer. HAR-TX beta2 protein was eluted at 400-450 mM NaCl in 50 mM sodium phosphate (pH 7.0), and fractions were analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie Blue staining. Final purification of pooled fractions was performed by chromatography using Source 15S cation-exchange media (Pharmacia Biotech Inc.) equilibrated with 50 mM sodium phosphate (pH 6.0). HAR-TX beta2 fusion protein was eluted with a gradient of 0-1 M NaCl in the same buffer and analyzed by SDS-polyacrylamide gel electrophoresis.

Phosphotyrosine Analysis

CEM cells expressing various HER receptors (1 times 10^6 cells) were stimulated with indicated amounts of HAR-TX beta2 for 5 min at room temperature. The cells were pelleted and resuspended in 0.1 ml of lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl(2), 1% Nonidet P-40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM sodium ortho-vanadate) at 4 °C. Insoluble material was pelleted for 30 s at 10,000 times g, and samples were analyzed by SDS-polyacrylamide gel electrophoresis and Western blot using anti-phosphotyrosine antibodies (4G10, ICN, Irvine, CA; and PY20, Upstate Biotechnology, Lake Placid, NY) followed by I-labeled sheep anti-mouse IgG, F(ab`)(2) fragment (DuPont NEN).

Cytotoxicity Assays

For cytotoxicity assays, tumor cells (10^5 cells/ml) in growth medium were added to 96-well flat bottom tissue culture plates (0.1 ml/well) and incubated at 37 °C for 16 h. Cells were incubated with HAR-TX beta2 for 48 h at 37 °C and washed twice with phosphate-buffered saline followed by addition of 200 µl/well of 1.5 µM calcein AM (Molecular Probes Inc., Eugene, OR). The plates were incubated for 40 min at room temperature, and the fluorescence was measured using a fluorescence concentration analyzer (Baxter Healthcare Corp., Mundelein, IL) at excitation/emission wavelengths of 485/530 nm. Calcein AM is membrane-permeable and virtually nonfluorescent. When it is hydrolyzed by intracellular esterases, an intensely fluorescent product, calcein, is formed. The percentage of cytotoxicity was calculated as described previously(15) . Competitive cytotoxicity assays were done by co-incubation of heregulin beta2-Ig (0.002-5.0 µg/ml) with HAR-TX beta2 (50 ng/ml) on LNCaP and MDA-MB-453 cells. Chimeric L6 (huIgG1) (16) was used as an isotype-matched control for the competition assay.

Generation of Monoclonal Antibodies to HER4

HER4, expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6-week-old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 µg of HER4 given each time. Spleen cells from immunized mice were removed 4 days after the final immunization and fused with the mouse myeloma line P2x63-Ag8.653 as described(15) . Hybridoma supernatants of interest were identified by enzyme-linked immunosorbent assay screening on plates coated with HER4-transfected CHO cells (1) compared with parental CHO cells and human fibroblasts. Secondary screening was done by enzyme-linked immunosorbent assay on plates coated with baculovirus/HER4 membranes. Positive hybridomas were rescreened by two additional rounds of enzyme-linked immunosorbent assay using CHO/HER4 cells, and false positives were removed by testing on HER4-negative cells. Remaining hybridomas were cloned in soft agar and tested for reactivity with MDA-MB-453 human breast carcinoma cells (HER4-positive) and CEM cells co-transfected with HER4 and HER2. Hybridoma 6-4-11 (IgG1) was cloned in soft agar and found to produce monoclonal antibody reactive to both native and denatured HER4. A second antibody (7-142, IgG2a) was also selected and found to bind to the cytoplasmic domain of HER4. Both 6-4-11 and 7-142 were reactive with HER4 protein in Western blot analysis (data not shown).

Quantitation of HER2, HER3, and HER4 Protein

Cells were stained for cell surface expression of HER2, HER3, and HER4 protein. HER2 staining was done using mouse anti-HER2 mAb 24.7 (17) as described (18) . Biotinylated goat anti-mouse IgG (Jackson Laboratories, West Grove, PA) followed by alkaline phosphatase-conjugated streptavidin (Jackson Laboratories) was used for detection. HER3 staining was done using mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 µg/ml concentration. Detection was performed using biotinylated rabbit anti-mouse IgG (Zymed Laboratories, South San Francisco, CA). HER4 staining was performed with mouse anti-HER4 mAb 6-4-11 at 15 µg/ml concentration and detected as described for HER3.

The staining procedure was as follows. Cells were fixed in 10% neutral buffered formalin for 60 min at room temperature, washed with H(2)O, rinsed with Tris-buffered saline (0.05 M Tris, 0.15 M NaCl, pH 7.6), and blocked with 10% goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1% bovine serum albumin/Tris-buffered saline for 15 min. Next, primary, secondary, and tertiary reagents were incubated for 30, 20, and 15 min, respectively, at room temperature and with Tris-buffered saline washing between steps. Final detection was achieved using Cellular Analysis Systems red chromagen (Becton Dickinson, Elmhurst, IL) for 4 (HER2), 8-10 (HER3), and 10-12 min (HER4) at room temperature. Counterstaining was performed with Cellular Analysis Systems DNA stain protocol (Becton Dickinson).

Image Analysis

Image analysis was performed as described previously(18, 19, 20) . In the quantitation of HER2, both solid state imaging channels of the Cellular Analysis Systems 200 image analyzer (Becton Dickinson), a microscope-based two-color system, were used. The two imaging channels were specifically matched to the two components of the stains used. One channel was used for quantitating the total DNA of the cells in the field following Feulgen staining as described (21) and the other for quantitating the level of HER2, HER3, and HER4 proteins following immunostaining. When the total DNA amount/cell was known, the average total HER2, HER3, and HER4/cell was computed. Sparsely growing AU565 cells were used for calibrating the HER2 protein. Their level of staining was defined as 100% of HER2 protein content (1.0 relative amounts = 10,000 sum of optical density); all other measurements of HER2, HER3, and HER4 protein were related to this value.

I-HAR-TX beta2 Binding Experiments

HAR-TX beta2 (100 µg) was labeled with IODO-GEN (Pierce) in phosphate-buffered saline for 15 min at room temperature and was purified through PD10 (Pharmacia) chromatography. The specific activity of the I-HAR-TX beta2 was determined to be 6.6 µCi/µg. Adherent tumor cells were gently removed from flasks by incubation for 10 min at 37 °C with 2 mM EDTA in phosphate-buffered saline. Receptor binding reactions were performed at 4 °C for 16 h with agitation using 1.67 times 10^5 cells/100-µl reaction volumes in the presence or absence of a 200-fold excess of unlabeled HAR-TX beta2. Cell-bound I-HAR-TX beta2 was separated from unbound by centrifugation through a 50:50 mixture of dibutyl phthalate and dioctyl phthalate at 4 °C, and the radioactivity present in both supernatant and cell pellet was determined using a -counter.


RESULTS

Construction, Expression, and Purification of HAR-TX beta2

The HAR-TX beta2 expression plasmid, encoding the hydrophilic leader sequence from AR, heregulin beta2, and PE40, under the control of the IPTG-inducible T7 promoter, was constructed as described under ``Experimental Procedures'' and is diagrammatically shown in Fig. 1A. The AR leader sequence was added to the N terminus of heregulin to facilitate purification as was previously demonstrated with ligand alone (1) (Fig. 1B).


Figure 1: A, schematic diagram of the expression plasmid (pSE 8.4) encoding HAR-TX beta2; B, amino acid sequence of the chimeric HAR beta2 ligand composed of the AR leader sequence and rat heregulin beta2.



HAR-TX beta2 fusion protein contained in E. coli inclusion bodies was denatured and refolded as described under ``Experimental Procedures'' and applied to cation-exchange chroma-tography on a POROS HS column. The major protein band migrating at 51 kDa corresponded to HAR-TX beta2 (Fig. 2, lane2). The column flow-through from POROS HS contained only small amounts of HAR-TX beta2 (Fig. 2, lane3). POROS HS chromatography resulted in >50% purity of HAR-TX beta2 (Fig. 2, lane4). Further purification, to >95% purity, was achieved by chromatography using Source 15S cation-exchange resin (Fig. 2, lane5). The monomeric nature of purified HAR-TX beta2 was determined by nonreducing SDS-polyacrylamide gel electrophoresis (Fig. 2, lane6), which showed the same migration pattern as under reducing conditions (Fig. 2, lane5).


Figure 2: Purification of HAR-TX beta2 fusion protein. SDS-polyacrylamide gel electrophoresis (4-20%) stained with Coomassie Brilliant Blue is shown. Lane1, molecular mass standards; lane2, refolded HAR-TX beta2 (concentrated 20 times); lane3, POROS HS flow-through (concentrated 20 times); lane4, POROS HS eluate; lane5, Source 15S eluate (pure HAR-TX beta2, 2 µg); lane6, 2 µg HAR-TX beta2 (lanes1-5 were reduced; lane6 was nonreduced).



Tyrosine Phosphorylation of HER Forms on Transfected CEM Cells

We next tested whether HAR-TX beta2 induced receptor phosphorylation of HER4 as previously demonstrated for heregulin(2) . CEM cells expressing different HER family members were analyzed by phosphotyrosine immunoblots following exposure to HAR-TX beta2. HAR-TX beta2 (10 nM) induced tyrosine phosphorylation in CEM cells expressing HER4 either alone or together with HER2 but not in cells expressing only HER2 or HER1 (Fig. 3A). This demonstrates that HER4 and not HER2 or HER1 is sufficient for tyrosine phosphorylation of receptor in response to HAR-TX beta2. The fact that HAR-TX beta2 does not induce tyrosine phosphorylation in CEM cells transfected with HER1 shows that the hydrophilic leader sequence from amphiregulin does not affect the specificity of the heregulin moiety in its selective interaction between receptor family members. HAR-TX beta2-mediated phosphorylation of receptors in CEM cells co-expressing HER2 and HER4 was found to be both dose-dependent and saturable (Fig. 3, B and C).


Figure 3: Tyrosine phosphorylation in CEM cells expressing HER4 is induced by HAR-TX beta2. A, CEM cells co-expressing HER4 (H4) and HER2 (H2), HER4 alone, HER2 alone, or HER1 (H1) alone were incubated in the presence (+) or absence(-) of 10 nM HAR-TX beta2, solubilized, and immunoblotted with anti-phosphotyrosine mAb (PY20). The arrow indicates phosphorylated receptor. Molecular mass standards are in kDa. B, CEM cells co-expressing HER4 and HER2 were incubated in the presence of HAR-TX beta2 (0.2-137 nM) and treated as in A. C, plot of radioactive counts found in each receptor band from B as determined by a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) versus the amount of added HAR-TX beta2.



Cytotoxicity of HAR-TXbeta2 against Tumor Cells

The cell-killing activity of HAR-TX beta2 was determined against a variety of human cancer cell lines. AU565 and SKBR3 breast carcinomas and LNCaP prostate carcinoma were sensitive to HAR-TX beta2 with EC values of 25, 20, and 4.5 ng/ml, respectively (Fig. 4A), while SKOV3 ovarian carcinoma cells were insensitive to HAR-TX beta2 (EC >2000 ng/ml). Addition of heregulin beta2-Ig to LNCaP cells reduced the cytotoxic activity of HAR-TX beta2 in a dose-dependent fashion (Fig. 4B). In contrast, cL6, a chimeric mouse-human antibody with a nonrelated specificity but matching human Fc domains(16) , did not inhibit the HAR-TX beta2 cytotoxic activity. Thus, the cytotoxic effect of HAR-TX beta2 was due to specific heregulin-mediated binding. Similar findings were observed using MDA-MB-453 cells (data not shown).


Figure 4: A, cytotoxic activity of HAR-TX beta2 on tumor cell lines. Cell killing of LNCaP (), AU565 (bullet), SKBR3 (circle), and SKOV3 (box) cells was determined following a 48-h incubation with HAR-TX beta2 by quantification of fluorescent calcein cleaved from calcein AM. B, competitive cytotoxicity of HAR-TX beta2 with heregulin beta2-Ig. LNCaP cells were co-incubated with 50 ng/ml HAR-TX beta2 and competed with either heregulin beta2-Ig (box) or L6-Ig () at concentrations ranging from 2 to 5000 ng/ml. The data represent the mean of triplicate assays.



HER2, HER3, and HER4 Receptor Density on Human Tumor Cells: Correlation with HAR-TX beta2-mediated Cytotoxicity

The levels of cell surface expression of HER2, HER3, and HER4 were quantitated on tumor cell lines by image analysis (18) using mAbs specific for these receptors (Table 1). The data indicate that HER4 expression is required for heregulindirected cytotoxic activity. All seven of the tumor cell lines that expressed detectable levels of HER4 were found to be sensitive to HAR-TX beta2-mediated killing with EC values ranging from 1 to 125 ng/ml. MCF-7 cells displayed the lowest detectable levels of HER4 and were found to be the least sensitive (EC = 125 ng/ml) of the cells that did respond. Four cell lines were found to be devoid of any detectable levels of HER4 on their surface, and each of these was completely resistant to the toxic effects of HAR-TX beta2. Three of these lines, L2987, SKOV3, and H3396, display both HER2 and HER3 in the absence of HER4. Thus, the expression of HER3, even in the presence of HER2, was not sufficient to render tumor cells sensitive to HAR-TX beta2.



Binding of HAR-TXbeta2 to MCF-7, MDA-MB-453, and H3396 Cells

The relative binding affinity of HAR-TX beta2 for three tumor cell lines was determined. Iodinated HAR-TX beta2 specifically bound to MCF-7 and MDA-MB-453 cells, both expressing cell surface HER2, HER3, and HER4. High and low affinity sites were present as determined by Scatchard analysis of the binding results for MCF-7 (K = 125 pM, K = 2.1 nM) and for MDA-MB-453 (K = 88 pM, K = 1.25 nM) (Fig. 5). H3396 cells, co-expressing cell surface HER2 and HER3 and insensitive to HAR-TX beta2, also displayed high and low affinity sites (K = 300 pM, K = 3.3 nM). Thus, cells expressing HER2 and HER3, in the presence or absence of HER4, form both high and low affinity heregulin binding sites. This demonstrates that while HAR-TX beta2 binding to tumor cells is essential for cytotoxicity, by itself it is not sufficient.


Figure 5: Direct binding of I-HAR-TX beta2 to tumor cells. Saturation binding (insets) and Scatchard plots are shown for MCF-7 (A), MDA-MB-453 (B), and H3396 (C) breast carcinoma cells. Cells were incubated at 4 °C with increasing amounts of radiolabeled HAR-TX beta2 for 16 h in the presence (nonspecific bound) or absence (total bound) of a 200-fold excess of unlabeled HAR-TX beta2. Specific binding was calculated by subtracting the nonspecific radioactivity from the total cell-bound radioactivity. The average of triplicate counts is shown.



HAR-TX beta2 Induces Tyrosine Phosphorylation in Tumor Cells That Are Resistant to Cytotoxic Effects

Heregulin directly binds to both HER3 and HER2/HER3 in a heterodimer configuration(2, 3) , and HAR-TX beta2 binds to H3396 cells that co-express HER2 and HER3. Despite binding, cells expressing HER2 and HER3 (L2987, H3396, and SKOV3) were insensitive to HAR-TX beta2. Direct interaction via signaling of H3396 and L2987 cells with the fusion protein was determined by phosphotyrosine immunoblots following exposure to HAR-TX beta2. HAR-TX beta2 was found to induce tyrosine phosphorylation in both tumor cell types (Fig. 6) similarly to that previously seen in COS-7 cells transfected with HER2 and HER3(3) . SKOV3 cells were found to be constitutively phosphorylated in the presence or absence of heregulin (data not shown), and no further activation was observed. However, previous studies reported that heregulin does not bind to these cells(20) . Thus, despite direct binding (H3396) and phosphotyrosine signaling via HAR-TX beta2 (H3396 and L2987), these cells are insensitive to the cytotoxic effects of the fusion protein.


Figure 6: Tyrosine phosphorylation in tumor cells expressing HER3 (L2987) or co-expressing HER2 and HER3 (H3396) is induced by HAR-TX beta2. Cells were incubated in the presence (+) or absence(-) of HAR-TX beta2 (10 nM), solubilized, and immunoblotted with anti-phosphotyrosine mAb (PY20). The arrow indicates phosphorylated receptor.




DISCUSSION

We have constructed and characterized a ligand-toxin fusion protein, HAR-TX beta2, that kills a variety of carcinoma cells that express HER4. HAR-TX beta2 was produced in E. coli by expressing a gene fusion encoding a chimeric form of heregulin beta2 and a binding mutant form of PE. The fusion protein was isolated as insoluble material, denatured, refolded, and purified by cation-exchange chromatography.

HAR-TX beta2 induced tyrosine phosphorylation in CEM cells expressing either HER4 alone or co-expressing HER4 and HER2 but not in cells expressing either HER1 or HER2 alone (Fig. 3). These data confirm earlier findings that heregulin can induce tyrosine phosphorylation in cells expressing cell surface HER4 in the presence or absence of HER2 but not in cells expressing HER2 alone(1) . The phosphotyrosine activity of HAR-TX beta2 was dose-dependent and saturable (Fig. 3, B and C) and reached 50% maximal phosphorylation at approximately 10 nM. This amount is comparable with that used in other reports describing the phosphotyrosine activity of heregulin(2, 3, 5) .

HAR-TX beta2 was effective at killing breast and prostate cancer cells (Fig. 4A). HAR-TX alpha, containing heregulin alpha, was also produced. It was found to bind >10-fold less well to MDA-MB-453 cells, and it was >10-fold less cytotoxic to tumor cells including MDA-MB-453, BT474, and SKBR3 cells (data not shown). Because of these results, we focused our efforts on characterizing the in vitro activities of HAR-TX beta2.

Measurements of HER2, HER3, and HER4 by image analysis have allowed us to gain a more accurate understanding of the expression levels of these receptors on the cell surface of tumor cell lines and to correlate their expression with sensitivity to the heregulin-based toxin fusion protein. The tumor cell lines that were sensitive to HAR-TX beta2, including MDA-MB-453, LNCaP, and T47D, co-expressed HER2, HER3, and HER4 (Table 1). L2987, SKOV3, and H3396 cells, which co-express HER2 and HER3 but do not express HER4, were insensitive to the cell-killing activities of HAR-TX beta2. Therefore, the expression of HER2 and HER3 is not sufficient for HAR-TX beta2-mediated killing.

It has been shown that heregulin can bind to either HER3 or HER4 in transfected cell lines (1, 2, 4) and that COS-7 cells co-transfected with HER2 and HER3 bind heregulin with a higher affinity than do cells transfected with HER3 alone(3) . Radiolabeled HAR-TX beta2 bound directly to MCF-7, MDA-MB-453, and H3396 breast carcinoma cells, demonstrating the presence of both high and low affinity sites with K(d) values ranging from 88 pM to 3.3 nM (Fig. 5). The high affinity binding site identified on MCF-7 cells (125 pM) was similar to that previously reported for heregulin (105 pM)(5) . In addition we also report the presence of a low affinity site on MCF-7 cells (2.1 nM). HAR-TX beta2 can also induce tyrosine phosphorylation in H3396 cells and L2987 cells (Fig. 6), which co-express HER3 and HER2. Thus, in MCF-7 and MDA-MB-453 cells, which express HER2, HER3, and HER4, direct binding and cell killing are found following incubation with HAR-TX beta2. In contrast, H3396 and L2987 cells, which co-express HER2 and HER3, are insensitive to HAR-TX beta2 despite direct binding (H3396) and signaling (H3396 and L2987) via the fusion protein.

The expression of HER4 correlates with sensitivity to HAR-TX beta2. This may be due in part to the higher affinity of heregulin for HER4, thereby maximizing uptake of the toxin. Alternatively, HER4 may also be associated with distinct signals directing internalization and/or subcellular trafficking, such that PE40 reaches its target in the cytosol. In addition to the expression of HER4, this process may require HER2, HER3, and/or some other cellular components or HER family members whose identity is still unknown. Regardless, our results demonstrate that heregulin-based fusion proteins can be used to kill tumor cells that express HER4 and suggest that such proteins may prove useful for the in vivo targeting of HER4-positive tumors.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Molecular Immunology Dept., Bristol-Myers Squibb, Pharmaceutical Inst., 3005 First Ave., Seattle, WA 98121. Tel.: 206-727-3542; Fax: 206-727-3603.

Present address: SUGEN Corp., 515 Galveston Dr., Redwood City, CA 94063.

(^1)
The abbreviations used are: EGF, epidermal growth factor; HER, human EGF receptor; PE, Pseudomonas exotoxin; HAR-TX beta2, heregulin/amphiregulin leader sequence-PE40 fusion protein; NDF, neu differentiation factor; FBS, fetal bovine serum; CHO, Chinese hamster ovary; AR, amphiregulin; IPTG, isopropyl-1-thio-beta-D-galactopyranoside; mAb, monoclonal antibody; CAS, cellular analysis system.


ACKNOWLEDGEMENTS

We thank Dr. P. Kiener for helpful discussions, R. Morton and Dr. L. Lyass for technical assistance, U. Garrigues and M. Stebbins for mAb production, and Dr. J.-M Culouscou (Bristol-Myers Squibb, Seattle, WA) for heregulin beta2-Ig.


REFERENCES

  1. Plowman, G. D., Green, J. M., Culouscou, J.-M., Carlton, G. W., Rothwell, V. M., and Buckley, S. (1993) Nature 366, 473-475 [CrossRef][Medline] [Order article via Infotrieve]
  2. Carraway, K. L., III, Sliwkowski, M. X., Akita, R. W., Platko, J. V., Guy, P. M., Nuijens, A., Diamonti, A. J., Vandlen, R. L., Cantley, L. C., and Cerione, R. A. (1994) J. Biol. Chem. 269, 14303-14306 [Abstract/Free Full Text]
  3. Sliwkowski, M. X., Schaefer, G., Akita, R. W., Lofgren, J. A., Fitzpatrick, V. D., Nuijens, A., Fendly, B. M., Cerione, R. A., Vandlen, R. L., and Carraway, K. L., III (1994) J. Biol. Chem. 269, 14661-14665 [Abstract/Free Full Text]
  4. Tzahar, E., Levkowitz, G., Karunagaran, D., Yi, L., Peles, E., Lavi, S., Chang, D., Liu, N., Yayon, A., Wen, D., and Yarden, Y. (1994) J. Biol. Chem. 269, 25226-25233 [Abstract/Free Full Text]
  5. Holmes, W. E., Sliwkowski, M. X., Akita, R. W., Henzel, W. J., Lee, J., Park, J. W., Yansura, D., Adabi, N., Raab, H., Lewis, G. D., Shepard, H. M., Kuang, W.-J., Wood, W. I., Goeddel, D. V., and Vandlen, R. L. (1992) Science 256, 1205-1210 [Abstract/Free Full Text]
  6. Falls, D. L., Rosen, K. M., Corfas, G., Lane, W. S., and Fischbach, G. D. (1993) Cell 72, 801-815 [CrossRef][Medline] [Order article via Infotrieve]
  7. Marchionni, M. A., Goodearl, A. D., Chen, M. S., Bermingham-McDonough, O., Kirk, C., Hendricks, M., Danehy, F., Misumi, D., Sudhalter, J., Kobayashi, K., Wroblewski, D., Lynch, C., Baldasare, M., Hiles, I., Davis, J. B., Hsuan, J. J., Totty, N. F., Otsu, M., McBurney, R. N., Waterfield, M. D., Stroobant, P., and Gwynne, D. (1993) Nature 362, 312-318 [CrossRef][Medline] [Order article via Infotrieve]
  8. Lupu, R., Colomer, R., Zugmaier, G., Sarup, J., Shepard, M., Slamon, D., and Lippman, M. E. (1990) Science 249, 1552-1555 [Abstract/Free Full Text]
  9. Lupu, R., Colomer, R., Kannan, B., and Lippman, M. E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2287-2291 [Abstract/Free Full Text]
  10. Wen, D., Peles, E., Cupples, R., Suggs, S. V., Bacus, S. S., Luo, Y., Trail, G., Hu, S., Silbiger, S. M., Levy, R. B., Koski, R. A., Lu, H. S., and Yarden, Y. (1992) Cell 69, 559-572 [CrossRef][Medline] [Order article via Infotrieve]
  11. Kondo, T., FitzGerald, D. J. P., Adhya, S., and Pastan, I. (1988) J. Biol. Chem. 263, 9470-9475 [Abstract/Free Full Text]
  12. Wen, D., Suggs, S. V., Karunagaran, D., Liu, N., Cupples, R. L., Luo, Y., Janssen, A. M., Ben-Baruch, N., Trollinger, D. B., Yang, W., Yanigahar, D., Koski, R. A., and Yarden, Y. (1994) Mol. Cell. Biol. 14, 1909-1919 [Abstract/Free Full Text]
  13. Plowman, G. D., Green, J. M., McDonald, V. L., Neubauer, M. G., Disteche, C. M., and Todaro, G. J. (1990) Mol. Cell. Biol. 10, 1969-1981 [Abstract/Free Full Text]
  14. Friedman, P. N., McAndrew, S. J., Gawlak, S. L., Chace, D., Trail, P. A., Brown, J. P., and Siegall, C. B. (1993) Cancer Res. 53, 334-339 [Abstract/Free Full Text]
  15. Siegall, C. B., Chace, D., Mixan, B., Garrigues, U., Wan, H., Paul, L., Wolff, E., Hellström, I., and Hellström, K. E. (1994) J. Immunol. 152, 2377-2384 [Abstract]
  16. Fell, H. P., Gayle, M. A., Yelton, D., Lipsich, L., Schieven, G. L., Marken, J. S., Aruffo, A., Hellström, K. E., Hellström, I., and Bajorath, J. (1992) J. Biol. Chem. 267, 15552-15558 [Abstract/Free Full Text]
  17. Stancovski, I., Hurwitz, E., Leitner, D., Ullrich, A., Yarden, Y., and Sela, M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8691-8695 [Abstract/Free Full Text]
  18. Bacus, S. S., Gudkov, A. V., Zelnick, C. R., Chin, D., Stern, R., Stancovski, I., Peles, E., Ben-Baruch, N., Farbstein, H., Lupu, R., Wen, D., Sela, M., and Yarden, Y. (1993) Cancer Res. 53, 5251-5261 [Abstract/Free Full Text]
  19. Bacus, S. S., Stancovski, I., Huberman, E., Chin, D., Hurwitz, E., Mills, G. B., Ullrich, A., Sela, M., and Yarden, Y. (1992) Cancer Res. 52, 2580-2589 [Abstract/Free Full Text]
  20. Peles, E., Bacus, S. S., Koski, R. A., Lu, H. S., Wen, D., Ogden, S. G., Levy, R. B., and Yarden, Y. (1992) Cell 69, 205-216 [CrossRef][Medline] [Order article via Infotrieve]
  21. Bacus, S. S., Kiguchi, K., Chin, D., King, C. R., and Huberman, E. (1990) Mol. Carcinog. 3, 350-362 [Medline] [Order article via Infotrieve]
  22. Peles, E., Ben-Levy, R., Tzahar, E., Liu, N., Wen, D., and Yarden, Y. (1993) EMBO J. 12, 961-971 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
R. Srinivasan, C. E. Gillett, D. M. Barnes, and W. J. Gullick
Nuclear Expression of the c-erbB-4/HER-4 Growth Factor Receptor in Invasive Breast Cancers
Cancer Res., March 1, 2000; 60(6): 1483 - 1487.
[Abstract] [Full Text]


Home page
Protein Eng Des SelHome page
R. Landgraf, D. Fischer, and D. Eisenberg
Analysis of heregulin symmetry by weighted evolutionary tracing
Protein Eng. Des. Sel., November 1, 1999; 12(11): 943 - 951.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Cohen, P. A. Kiener, J. M. Green, L. Foy, H. P. Fell, and K. Zhang
The Relationship between Human Epidermal Growth-like Factor Receptor Expression and Cellular Transformation in NIH3T3 Cells
J. Biol. Chem., November 29, 1996; 271(48): 30897 - 30903.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Cohen, J. M. Green, L. Foy, and H. P. Fell
HER4-mediated Biological and Biochemical Properties in NIH 3T3 Cells
J. Biol. Chem., March 1, 1996; 271(9): 4813 - 4818.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Baulida, M. H. Kraus, M. Alimandi, P. P. Di Fiore, and G. Carpenter
All ErbB Receptors Other Than the Epidermal Growth Factor Receptor Are Endocytosis Impaired
J. Biol. Chem., March 1, 1996; 271(9): 5251 - 5257.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O Bermingham-McDonogh, K. McCabe, and T. Reh
Effects of GGF/neuregulins on neuronal survival and neurite outgrowth correlate with erbB2/neu expression in developing rat retina
Development, January 5, 1996; 122(5): 1427 - 1438.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siegall, C. B.
Right arrow Articles by Fell, H. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siegall, C. B.
Right arrow Articles by Fell, H. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.