|
|
|
|||||||
|
|||||||||
(Received for publication, December 2, 1994; and in revised form, January 27, 1995) From the
Expression of the c-myb proto-oncogene is primarily
detected in normal tissue and tumor cell lines of immature
hematopoietic origin, and the down-regulation of c-myb expression is associated with hematopoietic maturation. Cell lines
that represent mature, differentiated hematopoietic cell types contain
10-100-fold less c-myb mRNA than immature hematopoietic
cell types. Differences in steady-state c-myb mRNA levels
appear to be primarily maintained by a conditional block to
transcription elongation that occurs in the first intron of the gene.
The block to transcription elongation has been mapped, using nuclear
run-on analysis, to a region of DNA sequence that is highly conserved
between mouse and man. Two sets of DNA-protein interactions, flanking
the site of the block to transcription elongation, were detected that
exhibited DNA-binding activities that strongly correlated with low
steady-state c-myb mRNA levels. Several criteria demonstrated
that members of the nuclear factor The c-myb proto-oncogene was first identified as the
cellular homologue of the transforming gene in avian myeloblastosis
virus and encodes a 78-kDa transcription factor that binds to the
consensus DNA sequence (T/C)AAC(T/G)G(1, 2) . The
c-myb gene product has been shown to function as a
transcription activator and appears to be involved in the regulation of
a number of cellular genes associated with proliferation as well as
genes that are expressed in a lineage-specific
fashion(3, 4, 5, 6, 7, 8) .
Expression of c-myb is detected almost exclusively in
hematopoietic tissue, although c-myb mRNA expression has been
reported in primary chicken embryo fibroblasts(9) , smooth
muscle cells(10) , and several nonhematopoietic human
tumors(11, 12, 13) . The down-regulation of
c-myb expression is associated with hematopoietic maturation,
and in each hematopoietic lineage examined (erythroid, myeloid, and
lymphoid), expression of c-myb mRNA and protein is highest in
immature normal tissue and tumor cell
lines(9, 14, 15, 16, 17, 18) .
Several pieces of evidence suggest that the c-myb gene product
plays an important role during hematopoietic maturation. First,
c-myb antisense oligonucleotides have been shown to inhibit
both erythroid and myeloid colony formation in
vitro(19) . Second, murine erythroleukemia cells stably
transfected with either constitutively expressed or inducible c-myb expression vectors were blocked in their ability to terminally
differentiate in response to chemical inducing
agents(20, 21) . Similar transfection experiments
using a constitutively expressed c-myb transgene have
demonstrated that Myb will block the differentiation of myeloid
leukemic cells(22) . Most recently, Mucenski et al.(23) reported that transgenic mice lacking a functional
c-myb gene developed normally to day 14, after which they died
with severely disrupted patterns of erythroid and myeloid development. Although expression of c-myb mRNA has been extensively
studied, relatively little is known about the regulation of c-myb transcription. The c-myb promoter is constitutively
transcribed even in cell lines where there is no detectable c-myb mRNA, and no transcriptional control elements have been mapped
within the promoter region in the murine gene (24, 25) . Recently, cotransfection studies have
demonstrated that c-Jun, JunD, and c-Myb can transactivate
transcription from a human c-myb promoter/reporter
construct(6, 26) . However, similar experiments have
not been carried out with the murine c-myb promoter. In murine
B lymphoid tumors, steady-state c-myb mRNA is detected at
10-100-fold lower levels in B cell lymphoma and plasmacytoma cell
lines than in pre-B cell lymphoma cell lines(14) . Maintenance
of differential steady-state c-myb mRNA levels in these cell
lines is primarily attributed to a block to transcription elongation
(attenuation) that takes place in the first intron of the
gene(24, 27, 28) . In addition, the block to
transcription elongation is involved in the down-regulation of
c-myb mRNA that occurs during chemically induced terminal
differentiation of murine erythroleukemia cells (29) and human
HL-60 cells(30) . The conditional block to transcription
elongation is detected in cell lines that express both high and low
levels of c-myb mRNA, and it is changes in the efficiency of
the block that appear to be
regulated(24, 27, 28, 29) . In
murine B lymphoid tumors, a major DNase I-hypersensitive site (site IV)
has been mapped near the transcription block and is more readily
detected as the efficiency of attenuation increases, suggesting that
changes in higher order chromatin structure accompany changes in
attenuation(14) . DNA-protein interactions have been identified
in the first intron of the gene (near the site of attenuation) that
have been suggested to play a role in the transcription block, and the
presence of several of these factors correlated with high levels of
c-myb mRNA expression(31) . However, the identity of
these proteins is not known, and as yet, there is no direct evidence
that these proteins are involved in the regulation of c-myb transcription. Nuclear factor We have identified two NF-
Figure 3:
Detection of DNA-protein interactions on
the 155-bp BglII/BamHI intron I fragment. A,
DNA-protein interactions detected with the radiolabeled BglII/BamHI fragment by EMSA. Lane1 is the free
Figure 4:
DNase I footprinting analysis of the
DNA-protein interactions detected on the BglII/BamHI
fragment. A, the
Figure 1:
Schematic representation of the 7.6-kb
murine c-mybEcoRI genomic restriction fragment
containing 5`-flanking sequences/exon I (5`-untranslated sequences
denoted by the hatched box and coding sequences denoted by the filled boxes), intron I, exon II, and part of intron II. The
region containing the block to transcription elongation is designated ATT. The differentially detected DNase I-hypersensitive site
(site IV; DNase HS IV), which was more prominent in the A20.2J
B cell lymphoma than in the 70Z/3.12 pre-B cell lymphoma, is indicated
by the arrow(14) . The lower portion of the diagram
shows the 1.5-kb BamHI fragment from intron I including the
two restriction fragments (underlined) used as probes to
characterize DNA-protein interactions by EMSA in this study. Sites of
restriction enzyme digestion are indicated as follows: B, BamHI; Bg, BglII; Bs, BstE2; Bx, BstXI; R, EcoRI; St, StyI; X, XbaI.
The c-myb promoter/CAT reporter construct (see Fig. 8A),
which included the murine c-myb 5`-flanking/exon I region,
intron I, and part of exon II fused to a CAT reporter gene, was
assembled in pGEM-7Z(f-) (Promega). A 340-bp BclI/BamHI fragment from SV40, containing
polyadenylation sequences, was cloned 3` of a 734-bp HindIII/BamHI fragment from pSV
Figure 8:
A, diagrams of the c-myb/CAT and dRRBE/CAT reporter constructs. The shadedboxes in exons I and II denote coding sequences. The ATG start codon in
exon I was deleted by mung bean nuclease digestion to reduce aberrant
translation from c-myb sequences. CAT indicates the
734-bp HindIII/BamHI fragment from pSV
Murine c-myb exon I, intron I, and exon II DNA fragments used as targets in Fig. 2(A and B) were cloned into M13mp10 or
M13mp11 and used as single-stranded DNA. The target listed in Fig. 2A as cDNA is a 1.1-kb murine c-myb cDNA
fragment that contains coding sequences 3` of exon II (45) cloned into M13mp10 and used as single-stranded DNA.
Single-stranded M13mp10 was used to monitor background hybridization,
and a 1.2-kb PstI fragment containing cDNA sequence from the
avian glyceraldehyde-3-phosphate dehydrogenase mRNA (46) and
cloned into pGEM-3Z was used as a positive control for RNA polymerase
II transcription.
Figure 2:
The site of c-myb transcription
attenuation in murine B lymphoid tumors maps to a highly conserved
region in the c-myb first intron. A, differential
levels of steady-state c-myb mRNA are maintained by a block to
transcription elongation. [
Recently, the block to transcription elongation that occurs
in the first intron of the human c-myb gene has been suggested
to take place within a region of the c-myb first intron that
is highly conserved between mice and
humans(51, 52, 53) . However, data mapping
the transcription block to this region have not been presented. We used
a dot matrix program to align the murine and human c-myb intron I DNA sequences (data not shown) and identified a highly
conserved region of DNA that included the site of attenuation as
defined by nuclear run-on assay (Fig. 2, B and C). The DNA sequence similarity in the conserved region is
approximately 77% over the entire region and 78% across the 300-bp BstEII/XbaI fragment. This degree of sequence
conservation is quite high for intron DNA sequences and strongly
suggests that this region is involved in regulating c-myb transcription. The DNA sequence similarity breaks down on either
side of this region, although other less extensive regions of
similarity have been identified when comparing the murine and human
c-myb intron I DNA sequences(51, 53) .
To further characterize the DNA-binding site(s) on the BglII/BamHI fragment, DNase I footprinting was
performed. End-labeled BglII/BamHI probe was
incubated with nuclear extract from the plasmacytoma S194 and subjected
to limited DNase I digestion. The free and bound species (corresponding
to the slower mobility complex denoted by the asterisk in Fig. 3B) were identified by autoradiography and excised
from the gel. DNase I digestion products were resolved on an 8 M urea, 6% polyacrylamide gel in parallel with a Maxam-Gilbert G
reaction. As shown in Fig. 4A, the sequence GGAAAGTACC
was protected in the bound lane. This sequence was identical to the
RRBE recently identified in the promoter of the human urokinase gene
and is homologous to the NF- To determine if the c-myb RRBE sequence is involved in the
DNA-protein interaction detected on the parental BglII/BamHI fragment, a double-stranded
oligonucleotide corresponding to the c-myb RRBE
protein-binding sequence was synthesized and used to compete for
binding to the radiolabeled BglII/BamHI fragment. As
shown in Fig. 4B, this oligonucleotide was able to
completely inhibit the formation of complexes 1 and 2 on the BglII/BamHI fragment (lanes 2-5). An
irrelevant oligonucleotide containing a protein-binding sequence for
the octamer-binding proteins failed to compete for binding to the
c-myb RRBE (Fig. 4B, lane6). DNA-protein complexes that remain in lanes
3-5 are the nonspecific DNA-protein interactions that were
also detected in Fig. 3B. As with the BglII/BamHI fragment, detection of DNA-binding
activity correlated with efficient attenuation (data not shown).
Interestingly, a similar binding sequence (GGAAAGTGCT) is located 1.2
kb upstream of the BglII/BamHI fragment in a BamHI/StyI fragment (Fig. 1). This BamHI/StyI fragment, containing the c-myb RRBE-like sequence, demonstrated the same pattern of DNA-protein
interactions as the BglII/BamHI fragment, and the
c-myb RRBE oligonucleotide was able to compete for binding to
the BamHI/StyI fragment as well (data not shown).
Thus, two RRBE sequences that flank the site of the transcription block
were identified in a region of the c-myb first intron.
Figure 5:
DNA-binding activity detected with the
c-myb RRBE is induced by LPS treatment of 70Z/3.12 cells. The
To
determine whether the protein complexes that bind the c-myb RRBE intron sequence include members of the NF-
Figure 6:
Proteins related to the NF-
To
determine whether other members of the NF-
Figure 7:
Proteins related to the NF-
To
further examine if the DNA-binding activities detected on the c-myb RRBE were related to the NF-
We have identified two DNA-protein interactions in the first
intron of the murine c-myb gene flanking the region where
transcription attenuation occurs. DNA-binding activities detected with
the BamHI/StyI and BglII/BamHI
fragments correlated with low levels of c-myb mRNA expression (Fig. 3A). The protein-binding sequences detected on
the BamHI/StyI and BglII/BamHI
fragments were homologous to the NF- At present, the
level at which NF- The ability of NF- The c-myb RRBE sequences in the first
intron may have different effects on transcription depending upon which
NF-
Volume 270,
Number 13,
Issue of March 31, 1995 pp. 7661-7671
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
B Family Transactivate the Murine c-myb Gene (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
B (NF-B) family of
transcription factors were involved in the DNA-protein interactions
identified in these two sets. Surprisingly, cotransfection experiments
demonstrated that coexpression of members of the NF-B family,
specifically p50 with p65 and p65 with c-Rel, transactivated a
c-myb/chloramphenicol acetyltransferase reporter construct
that contained 5`-flanking sequences, exon I, intron I, and exon II of
the c-myb gene. Transactivation by these heterodimer
combinations was dependent on regions of the c-myb first
intron containing the NF-B-binding sites. These findings suggest
that NF-B family members may be involved in either modifying the
efficiency of transcription attenuation or acting as an enhancer-like
activity to increase transcription initiation. Thus, the regulation of
c-myb transcription may be quite complex, and members of the
NF-B family likely play an important role in this regulation.
B (NF-B) (
)was first characterized as a heterodimeric protein complex
that bound a regulatory site within the immunoglobulin -light
chain enhancer (32) . NF-B is now known to regulate a wide
range of cellular and viral genes by binding to the consensus DNA
sequence GGGRNNYYCC (33, 34, 35) .
NF-B-like DNA-binding activity is constitutive in mature B cells,
and an inactive form, bound to the specific inhibitor IB, exists
in the cytoplasm of most cell lines(35) . The release of an
active NF-B DNA-binding complex is induced by multiple signal
transduction pathways that involve dissociation from
IB(36) . A family of NF-B-related proteins has now
been identified, each member of which has different DNA-binding
specificities and transactivation properties(37) . The result
of such a diverse family is a plethora of functional combinations that
can affect the transcription rates of NF-B-regulated genes
differently depending on the specific sequence of the NF-B site,
the promoter context of the site, and the presence of additional,
heterologous DNA-binding factors in the transactivating
complex(38) .B-like binding
sites in the first intron of the murine c-myb gene that flank
the site of attenuation. Protein complexes that bind to these sequences
were readily detected in cell lines that contained small amounts of
c-myb mRNA, but not in cell lines that contained abundant
c-myb mRNA. The protein-binding sequence is similar to the
NF-B consensus sequence, and an oligonucleotide that includes an
NF-B site from the immunoglobulin -light chain enhancer
specifically competes for binding. Electrophoretic mobility shift
assays (EMSA) demonstrate that the p50 subunit of NF-B as well as
Rel-related proteins can bind to these sequences and that an
NF-B-like DNA-binding activity that interacts with these sequences
is induced by LPS in 70Z/3.12 cells. In addition, the specific
inhibitor IB-
/MAD-3 was able to inhibit the LPS-inducible
DNA-binding activity. In cotransfection studies, members of the
NF-B family of transcription factors were able to transactivate a
c-myb/CAT reporter construct dependent on regions containing
the two NF-B sites in the first intron of the c-myb gene.
These results provide strong evidence that DNA sequences in the murine
c-myb first intron are involved in the regulation of c-myb transcription, and this, in part, is mediated by members of the
NF-B family.
Cell Culture and Preparation of Nuclear
Extracts
Murine cell lines were grown in RPMI 1640 medium
supplemented with 10% fetal bovine serum and 50 µM 2-mercaptoethanol at 5% CO
in a humidified chamber. In
some experiments, 70Z/3.12 murine pre-B cell lymphoma cells were
stimulated with 10 µg/ml Escherichia coli LPS for 2 h.
HeLa cells were grown in RPMI 1640 medium supplemented with 5% fetal
bovine serum. Crude nuclear extracts used in Fig. 3and Fig. 4were prepared as described by Dignam et
al.(39) . All other extracts were prepared using a
modified Dignam protocol(40) .
P-labeled fragment (F). 4 µg
of protein from each nuclear extract were incubated with either 0.5 or
1 µg of poly(dI-dC). The cell lines used for the analysis were the
murine erythroleukemia cell line C19 (lanes2 and 3), the pre-B cell lymphoma 70Z/3.12 (lanes4 and 5), the B cell lymphoma WEHI-231 (lanes6 and 7), and the plasmacytoma S194 (lanes8 and 9). The major DNA-protein complexes are
designated 1 and 2. B, EMSA competition
analysis. 4 µg of protein from the plasmacytoma S194 were
preincubated with an unlabeled homologous BglII/BamHI
fragment at molar ratios of unlabeled to labeled probe of 5:1 (lane4), 20:1 (lane5), and 100:1 (lane6) as well as with an unlabeled nonhomologous c-myb exon I BglI/BstEII fragment at 5:1 (lane7) and 20:1 (lane8). Lane1 contains free probe, lane2 contains
probe incubated with 4 µg of protein from the S194 nuclear extract,
and lane3 is the same as lane2 with the addition of 2 µg of poly(dI-dC) as nonspecific
competitor. DNA-protein complexes denoted by the asterisk were
used for DNase I footprinting analysis in Fig. 4. The minor
DNA-protein interactions denoted by the tildes are nonspecific
interactions that are not competed by the unlabeled homologous BglII/BamHI fragment.
P-end-labeled BglII/BamHI fragment was incubated with 20 µg of
protein from the plasmacytoma S194, subjected to limited digestion with
0.01 units of DNase I, and isolated as described under ``Materials
and Methods.'' Free (F) and bound (B) fragment
DNase I digestion products (denoted by the asterisk in Fig. 3B) were fractionated on an 8 M urea, 6%
polyacrylamide gel alongside a Maxam-Gilbert G reaction (G) to
identify the protected DNA. The sequences protected by the addition of
nuclear extract are designated (GGTACTTTCC) next to the B lane. B, shown are the results from cold competition
analysis using the c-myb RRBE oligonucleotide as unlabeled
competitor for binding to the P-labeled BglII/BamHI fragment. 10 fmol of the radiolabeled BglII/BamHI fragment (lanes 1-6) were
incubated with 4 µg of nuclear extract from the plasmacytoma S194. Lane1 corresponds to free P-labeled
probe (F). Lanes1-6 contain 2 µg
of poly(dI-dC). The unlabeled RRBE oligonucleotide at the
unlabeled:labeled molar ratios shown was preincubated with nuclear
extract (NE) prior to the addition of radiolabeled probe. An
oligonucleotide containing the protein-binding sequence for the
octamer-binding proteins (OCTA; ATTTGCAT) was used at a 20:1
molar ratio as nonhomologous competitor (lane6).
Complexes 1 and 2 correspond to complexes 1 and 2
detected in Fig. 3A.
Plasmid Constructs and Oligonucleotide
Synthesis
Murine c-myb intron I DNA fragments to be
used as probes in EMSA were derived from the plasmid
pmyb13(27) , which contains a 7.6-kb murine c-mybEcoRI genomic DNA fragment (see Fig. 1), and were
subcloned into pGEM-3Z (Promega). DNA fragments used in EMSA were
isolated following restriction digestion with appropriate enzymes by
electrophoresis on 1% agarose gels, excised, and purified by
electroelution. Oligonucleotides were synthesized and high pressure
liquid chromatography-purified by the Protein and Nucleic Acid Research
Facility at the University of Virginia. The DNA sequences of the sense
strand of the double-stranded oligonucleotides used in this study are
as follows: c-myb, GCATGCTCTGGAAAGTACCTTAAAGATAGA; NF-B,
CAGAGGGGACTTTCCGAGAGGC; and TA-2, TCGCAGAAGCCACATCCTCTGGAAAGAAGA. The
NF-B-binding sequence was derived from the murine immunoglobulin
-locus enhancer region. The TA-2 (Ets-1)-binding sequence was from
the murine T cell receptor -chain enhancer.
CAT (41) that contains the CAT coding sequences. The 6.2-kb
c-myb fragment (see Fig. 8A) was inserted at
the EcoRI site in the pGEM-7Z(f-) polylinker upstream of
the CAT gene. The 6.2-kb fragment was isolated by introducing a
deletion into exon II, from the 3`-end of the 7.6-kb c-myb genomic fragment shown in Fig. 1, such that the EcoRI site was maintained. The resulting 6.2-kb EcoRI
DNA fragment was then cloned into the pGEM-7Z(f-)/CAT construct
at the EcoRI site. The ATG translation start codon in the
first exon of c-myb was deleted by mung bean nuclease
digestion to reduce aberrant translation. The dRRBE/CAT
reporter construct (see Fig. 8A) was built by replacing
the 1.5-kb BamHI intron I fragment of c-myb with an
internal 1.2-kb StyI/BstXI fragment, which resulted
in the deletion of the two RRBE sequences. To do this, the
c-myb/CAT reporter construct was partially digested with BamHI religated, and a ligation product was obtained that had
the 1.5-kb BamHI fragment deleted. This plasmid (d1.5Bam/CAT) was partially digested with BamHI, and
the linearized vector was isolated electrophoretically. The 1.2-kb StyI/BstXI fragment was derived from a subclone of
the 1.5-kb BamHI fragment by restriction digestion with BstXI and a partial digest of StyI, blunted with
Klenow fragment, isolated by gel purification, and subcloned into d1.5Bam/CAT. The dRRBE/CAT reporter construct was
then identified and characterized by restriction mapping of the
ligation products.
CAT
encoding the bacterial chloramphenicol acetyltransferase gene. polyA denotes the 340-bp BclI/BamHI fragment
from SV40 containing polyadenylation sequences. The two RRBE sequences
in the first intron are contained on BamHI/StyI and BstXI/BamHI restriction fragments. The dRRBE/CAT reporter construct is identical to the
c-myb/CAT reporter construct except that the 1.5-kb BamHI fragment from the first intron of c-myb was
replaced by the internal 1.2-kb StyI/BstXI fragment.
This specifically deleted the two c-myb RRBE sequences from
the c-myb/CAT reporter construct (see ``Materials and
Methods'' for details of construction). WT, wild-type. See legend to Fig. 1for definition of restriction
enzyme abbreviations. B, results from cotransfection
experiments that examined transactivation of the c-myb/CAT and dRRBE/CAT reporter constructs by p50 with p65 and p65 with
c-Rel heterodimer combinations. The xaxis corresponds to the microgram amount of each expression vector
cotransfected with 2 µg of the c-myb/CAT reporter
construct. The yaxis corresponds to the -fold
induction of CAT activity from each vector calculated by comparing the
CAT activity resulting from cotransfection of c-myb/CAT or dRRBE/CAT with the indicated NF-B family members to the
activity resulting from transfection of each construct alone. Results
are the average of duplicate transfections and are representative of
four independent experiments.
Nuclear Run-on Assay
Nuclei from exponentially
growing 70Z/3.12 murine pre-B cell lymphoma and A20/2J B cell lymphoma
cells were prepared in isosmotic buffer containing 0.5% Nonidet P-40,
followed by sucrose gradient centrifugation as described previously in
detail(28, 42) . Preparation of nitrocellulose slot
blots with single-stranded DNA targets, nuclear run-on transcription,
isolation and hybridization of
[-P]UTP-labeled nascent RNA probes, and
filter wash conditions were carried out as described previously by
Groudine et al.(43, 44) and as modified
elsewhere(27, 28) . Nitrocellulose filters were
exposed to Kodak XAR-5 film with a Cronex Lightning II Plus enhancer
screen at -80 °C for 5-7 days.
-P]UTP-labeled
nascent RNA was isolated from approximately 5 
10
70Z/3.12 pre-B cell lymphoma or A20/2J B cell lymphoma nuclei and
hybridized to nitrocellulose filters containing single-stranded target
DNA as described under ``Materials and Methods.'' The
target-labeled cDNA is a 1.1-kb murine c-myb cDNA fragment
that contains coding sequences 3` of exon (ex) II. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. B,
mapping the site of attenuation in the A20/2J B cell lymphoma cells
using nuclear run-on assay. P-Labeled nascent RNA was
isolated after nuclear run-on transcription from A20/2J nuclei. Half of
the run-on reaction was hybridized to the filter on the left and half
to the filter on the right. Derivation of single-stranded DNA targets
is represented schematically beneath the autoradiographs. The target
labeled 10.10.1 is a 2.4-kb murine c-myb cDNA
containing coding sequences 3` of exon II and the 3`-untranslated
region. See legend to Fig. 1for definition of restriction
enzyme abbreviations. C, alignment of the conserved murine and
human c-myb intron I sequences containing the site of
attenuation. The murine DNA sequence (upperstrand)
was derived from our previously reported 7.6-kb murine c-myb genomic clone, which contains 5`-flanking/exon I sequences, intron
I, exon II, and part of intron II(27) . The human DNA sequence (lowerstrand) is from Jacobs et al.(51) . Comparison of DNA sequences was carried out using
DNA sequence alignment programs from the Microgenie package of sequence
analysis programs (Beckman Instruments). The murine sequence starts at
the BstEII site, which is located 1448 bases 3` of the exon
I/intron I junction, while the human sequence begins 1451 bases 3` of
the exon I/intron I junction. Attenuation at the murine c-myb locus occurs either within or just 3` of the BstEII/XbaI fragment. The conserved c-myb 3`-RRBE (identified in Fig. 4A) is boxed and shaded.
Electrophoretic Mobility Shift Assay
Restriction
fragments to be used for EMSA were isolated electrophoretically,
end-labeled using the large fragment of E. coli DNA polymerase
I (Life Technologies, Inc.) with [-P]NTPs
(Amersham Corp.), and purified on Sephadex G-50 spun columns.
Oligonucleotides were end-labeled using T4 polynucleotide kinase (Life
Technologies, Inc.) with [
-P]ATP (Amersham
Corp.) and purified on Nen-Sorb columns (DuPont NEN) per the
manufacturer's instructions. The EMSA experiments were carried
out as described previously by Singh et al.(47) .
10,000 cpm of labeled probe (approximately 5-25 fmol) were used
per EMSA reaction in binding buffer (10 mM Tris-HCl, pH 7.4,
50 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA,
and 5% glycerol). DNA-protein complexes were resolved on 4% native
polyacrylamide gels at 11 V/cm in 25 mM Tris base, 25 mM boric acid, and 0.5 mM EDTA. The gels were dried and
exposed to Kodak XAR-5 film with a Cronex Lightning II Plus enhancer
screen at -80 °C. For competition, supershift, and IB
experiments, competitor DNAs, antibodies, or inhibitors were added
prior to the addition of labeled probe for 10 min at 22 °C. Two
polyclonal rabbit antisera made against human p50 (Ab2 and Ab3) were
the gift of Dr. A. Israel (Institut Pasteur, Paris). Polyclonal rabbit
antisera made against v-Rel and a human c-Rel peptide were the gift of
Dr. N. Rice (Frederick Cancer Research and Development Center,
Frederick, MD). IB-/MAD-3 protein was purified as described
by Haskill et al.(48) .DNase I Footprinting
The BglII/BamHI fragment, derived from the murine
c-myb first intron, was end-labeled using T4 polynucleotide
kinase (Life Technologies, Inc.) and gel-purified on a 6%
polyacrylamide gel. The labeled fragment was eluted overnight in 0.5 M ammonium acetate and 1 mM EDTA at room temperature.
EMSA binding reactions were scaled up 5-fold and digested with 0.1
units of DNase I (Worthington) for 90 s at room temperature. The
reaction was stopped by the addition of EDTA to a 140 mM final
concentration and subjected to electrophoresis on native 4%
polyacrylamide gels as described above. DNA-protein complexes were
visualized by autoradiography of the wet gel. Free and bound fragments
were excised from the gel and electroeluted onto DE81-cellulose paper
(Whatman). The DNA fragments were eluted from the filter paper by
incubation in 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, and
1 M NaCl at 65 °C for 30 min. Equal numbers of
counts/minute of free and bound DNA fragments were fractionated
electrophoretically on an 8 M urea, 6% polyacrylamide gel in
parallel with a Maxam-Gilbert G reaction of undigested probe for
determination of the binding sequence. Gels were dried and exposed to
Kodak XAR-5 film with a Cronex Lightning II Plus enhancer screen at
-80 °CTransient Transfections and Assays for CAT
Activity
Transient transfections into the EL4 murine thymoma
cell line were carried out using DEAE-dextran(49) . Transfected
cells were harvested 48 h post-transfection, washed in ice-cold
phosphate-buffered saline, and lysed by three cycles of freezing and
thawing. CAT assays were performed as described by Gorman et
al.(41) . The results were quantified using a Molecular
Dynamics PhosphorImager and normalized based on protein content of cell
extracts as determined using a Bradford protein assay (Bio-Rad).
The Block to Transcription Elongation at the Murine
c-myb Locus Maps to a Highly Conserved Region of the First
Intron
Our group (27, 50) as well as others (24, 29) have demonstrated that differential
expression of steady-state c-myb mRNA is mediated at the level
of transcription elongation. For example, the approximately 20-fold
difference in steady-state c-myb mRNA levels between the
70Z/3.12 murine pre-B cell lymphoma and the A20/2J murine B cell
lymphoma is maintained by a block to transcription elongation that
occurs in the first intron of the murine c-myb gene (see (27) and (28) and Fig. 2A). To more
accurately map the site of attenuation,
[-P]UTP-labeled nascent RNA transcripts
isolated from A20/2J murine B cell lymphoma nuclei were hybridized to
two overlapping sets of single-stranded M13 clones containing fragments
of murine c-myb exon I, intron I, and exon II. As shown in Fig. 2B, we readily detected hybridization of labeled
nascent transcripts to targets a-d, but not to targets e and f,
demonstrating that the block to transcription elongation occurs within
or just 3` of the 750-bp BstEII/BamHI fragment
contained in target d. Targets c` and d` subdivide target d into two
fragments. Hybridization of nascent c-myb transcripts was
detected with target c`, but not d`. Thus, the block to transcription
elongation must occur either within or just 3` of the 300-bp BstEII/XbaI region of the murine c-myb first
intron.Identification and Characterization of a Differentially
Detected DNA-Protein Interaction in the First Intron of the Murine
c-myb Gene
To begin to understand the regulation of c-myb transcription, DNA-protein interactions were characterized in the
highly conserved region of the first intron using EMSA. Crude nuclear
extracts were prepared from exponentially growing murine hematopoietic
cell lines and tested for DNA-binding activity with radiolabeled probes
derived from the first intron. As shown in Fig. 3A, a
set of DNA-protein interactions was detected using a 155-bp BglII/BamHI fragment (see Fig. 1) that
exhibited DNA-binding activity correlating with low levels of c-myb mRNA expression. Upon incubation with the P-labeled BglII/BamHI fragment, two major DNA-protein complexes
were detected, marked as complexes 1 and 2 (in some experiments,
complex 1 resolves into a doublet), with nuclear extracts from the
WEHI-231 immature B cell lymphoma (Fig. 3A, lanes6 and 7) and the S194 plasmacytoma (lanes8 and 9). In contrast, the C19 erythroleukemia
line and the 70Z/3.12 pre-B cell lymphoma contained little or no
DNA-binding activity that was detected with this DNA fragment (Fig. 3A, lanes 2-5). Seven additional
cell lines (murine erythroleukemia F-MEL; pre-B lymphomas Haftl1 and
LS8T.2; B cell lymphomas A20/1.11, 2PK3, and BCL; and
plasmacytoma MOPC 11) were examined for DNA-binding activity, and in
each case, the mature hematopoietic lines contained high levels of
DNA-binding activity, while the immature cell lines did not (data not
shown). The formation of complexes 1 and 2 was lost in cold competition
experiments in which an unlabeled homologous DNA fragment was used as
competitor (Fig. 3B, lanes 4-6). In
contrast, complex 1 was not competed, and complex 2 was only weakly
competed when a nonhomologous BglI/BstEII DNA
fragment from the first exon of the murine c-myb gene was used
as unlabeled competitor (Fig. 3B, lanes 7 and 8), demonstrating specificity of the two major interactions.
Minor DNA-protein interactions (denoted by the tildes in Fig. 3B) appear to be nonspecific interactions since
they were not effectively competed by a homologous fragment. Thus, a
set of DNA-protein interactions was detected whose binding activities
correlated with efficient attenuation, and the protein-binding site(s)
mapped in the region of conserved DNA sequence near the site of
attenuation.B consensus sequence(54) . The
c-myb RRBE protein-binding sequence is conserved in the human
c-myb intron (see Fig. 2C). We will refer to
this sequence as the c-myb RRBE throughout this manuscript. Members of the NF-
Since the protected sequences on the BglII/BamHI fragment were identical to the urokinase
RRBE sequence and resembled an NF-B Family Bind to the c-myb Intron
I RRBE SequenceB-binding site, further analysis
relating to the identity of the DNA-binding factors that bind to the
c-myb RRBE in vitro was carried out. One
characteristic of the NF-B family is that DNA-binding activity can
be induced by treatment of 70Z/3.12 cells with LPS(32) .
Nuclear extracts were prepared from 70Z/3.12 cells before and after
treatment for 2 h with 10 µg/ml LPS, and the P-labeled
c-myb RRBE oligonucleotide was used for EMSA to detect
DNA-binding activity. A strong induction of DNA-binding activity was
detected when comparing the lane containing nuclear extract from
untreated 70Z/3.12 cells with the lane containing nuclear extract from
2-h LPS-treated 70Z/3.12 cells (Fig. 5, lanes2 and 3, respectively). More important, a double-stranded
oligonucleotide containing the NF-B site from the immunoglobulin
-locus (GGGACTTTCC) was able to compete for binding, while a
control oligonucleotide containing a binding site for the Ets-1 protein
(TA-2, CAGAGGATGTG) was not (Fig. 5, lanes4 and 5). As expected, the unlabeled c-myb RRBE
oligonucleotide completely inhibited the formation of complexes 1 and 2
on the radiolabeled c-myb oligonucleotide (Fig. 5, lane6). Therefore, LPS-inducible DNA-binding
activities that interact with the NF-B-binding sequence in
vitro can also interact with the c-myb RRBE.
P-end-labeled c-myb RRBE was incubated with 4
µg of nuclear extract from untreated 70Z/3.12 cells (lane2) and from 70Z/3.12 cells treated with 10 µg/ml E. coli LPS (lanes 3-6). Lanes 4-6 are the results from unlabeled competition analysis of the
c-myb RRBE with the following oligonucleotides at a 50:1 molar
ratio of unlabeled to labeled probe: an oligonucleotide containing an
NF-B site from the immunoglobulin -locus (NFKB; lane4), an oligonucleotide containing an
Ets-1-binding site from the T cell receptor -chain enhancer TA-2 (TA2; lane5), and the c-myb RRBE (RRBE; lane6). Free RRBE (F) is in lane1. Complexes 1 and 2 correspond to complexes 1 and 2 detected in Fig. 3A.
B family,
polyclonal antisera directed against the p50 subunit of the NF-B
complex were used in EMSA(55) . However, as the available
antisera made against p50 only bind the human homologue, crude nuclear
extracts prepared from HeLa cells were used for these experiments
rather than nuclear extracts derived from murine cell lines. As shown
in Fig. 6, a similar pattern of DNA-binding complexes is
detected in HeLa cell nuclear extracts with both the c-myb RRBE and NF-B oligonucleotides. However, the signal detected
by binding to the c-myb RRBE oligonucleotide is less intense
than the signal detected with the NF-B oligonucleotide, suggesting
that human NF-B family members may bind this sequence less well
than murine proteins. The Ab2 antiserum was directed against epitopes
on p50 that are available when p50 binds DNA as either a homodimer or a
heterodimer. Preincubation of Ab2 with HeLa nuclear extract resulted in
the formation of a supershift (denoted by the arrow) with the
c-myb RRBE probe as well as with the NF-B probe (Fig. 6, lanes3 and 7). The
antiserum also inhibited the formation of complexes 1 and 2 with the
NF-B probe. However, it was difficult to determine whether
inhibition occurred with the c-myb RRBE oligonucleotide
because complexes 1 and 2 consistently did not resolve well in the
presence of serum. Antiserum Ab3 reacts with epitopes present only on
the p50 homodimer. With both probes, a supershift was detected (Fig. 6, lanes4 and 8, denoted by
the arrow) following preincubation of the nuclear extract with
Ab3. In addition, this antiserum appeared to stimulate the formation of
complex 2 (Fig. 6, lanes4 and 8),
suggesting that Ab3 alters the relative concentrations of the different
NF-B subunit combinations. As seen with Ab2, complex 1 was
inhibited in the NF-B lane. No changes in the EMSA patterns were
detected using a preimmune serum control (data not shown). Thus, the
p50 subunit of NF-B or proteins antigenically related to it
interact with the c-myb RRBE in vitro.
B p50
subunit bind to the c-myb RRBE. Polyclonal antisera directed
against the p50 subunit of the NF-B family (55) were
incubated with nuclear extract from HeLa cells prior to the addition of
the P-end-labeled c-myb RRBE oligonucleotide (lanes 1-4) or the murine NF-B oligonucleotide (lanes 5-8). NS corresponds to nonspecific DNA
binding (data not shown). Free RRBE (F) is in lane 1. Lanes 2-4 and 6-8 contain 4 µg of
protein from HeLa nuclear extracts (ext)and 0.5 µg of
poly(dI-dC). Antiserum Ab2 (lanes3 and 7)
is directed against epitopes accessible on either p50 homodimers or
p50-containing heterodimers. Antiserum Ab3 (lanes4 and 8) is directed against epitopes accessible only on
p50 when it binds DNA as a homodimer. The arrow designates a
supershifted ternary DNA-protein-antibody complex. The three major
DNA-protein complexes are denoted as complexes 1-3.
B family were able to
bind to the c-myb RRBE oligonucleotide, polyclonal antisera
made against v-Rel and a human c-Rel peptide were used in
EMSA(56, 57) . Crude nuclear extracts from 70Z/3.12
cells treated for 2 h with 10 µg/ml LPS were preincubated with the
two anti-Rel sera in separate experiments prior to addition of P-labeled oligonucleotides. Preincubation of the
LPS-induced 70Z/3.12 extract with the c-Rel antiserum did not result in
a supershift with either probe, but a slight stimulation of complex 2
was detected with both probes (Fig. 7, lanes3 and 8), suggesting that this antiserum alters the
available population of DNA-binding complexes. Preincubation with the
v-Rel antiserum induced a supershift with both the c-myb RRBE
and NF-B oligonucleotides (Fig. 7, lanes4 and 9, denoted by the arrow). The formation of a
supershift by preincubation of the v-Rel antiserum with nuclear extract
demonstrates that c-Rel or a Rel-related protein was detected in
protein complexes that bind the c-myb RRBE sequence.
B c-Rel
subunit bind to the c-myb RRBE and IB-/MAD-3
inhibition of DNA-binding activity detected on the c-myb RRBE.
Polyclonal antisera against a human c-Rel peptide (lanes3 and 8) and v-Rel protein (lanes4 and 9) were incubated with nuclear extract from 70Z/3.12 cells
treated for 2 h with 10 µg/ml LPS prior to the addition of the P-end-labeled c-myb RRBE oligonucleotide (lanes 1-5) or the murine NF-B oligonucleotide (lanes 6-10). The complex indicted by the arrow denotes a supershifted ternary complex of DNA-protein-antibody. Lanes1 and 6 contain free oligonucleotide (F). Lanes2 and 7 contain the P-end-labeled oligonucleotide incubated with 4 µg of
protein from the 70Z/3.12 LPS-induced nuclear extracts (ext)
and 0.5 µg of poly(dI-dC). The IB-/MAD-3 protein (48) was preincubated with 4 µg of protein from 70Z/3.12
cells treated for 2 h with LPS prior to the addition of the P-end-labeled oligonucleotide in lane5 (c-myb RRBE) and lane10 (NF-B).
Presumptive p50 homodimer-DNA complexes are denoted as complex 2. Complex 1 and the complex denoted by the singleasterisk were inhibited by the IB-/MAD-3
protein. The low mobility DNA-protein complex that was not inhibited by
IB-/MAD-3 is denoted by the doubleasterisks.
B family, the NF-B inhibitor
protein IB-/MAD-3, which is known to inhibit the DNA-binding
activity of heterodimers consisting of p49 with p65, p50 with p65, and
p50 with c-Rel to the cognate binding site, was used in
EMSA(48, 58) . Nuclear extracts from LPS-treated
70Z/3.12 cells were preincubated with the IB-/MAD-3 protein
prior to the addition of the labeled oligonucleotides. IB was able
to inhibit binding of complex 1 and the complex denoted by the asterisk in Fig. 7(lanes5 and 10). A stimulation of complex 2 DNA-binding activity, which is
probably due to increased affinity of p50 for DNA when complexed with
IB(59) , was also seen as a consequence of the IB
inhibition. In addition, one of the low mobility complexes (Fig. 7, denoted by the doubleasterisks) was
not affected by IB-/MAD-3, indicating that novel factors or
combinations may be involved in binding to the c-myb RRBE
sequence.Members of the NF-
To determine if the two c-myb RRBE
sequences potentially play a role in the transcriptional regulation of
the c-myb gene, a CAT reporter construct was built linking a
6.2-kb murine c-myb genomic fragment (containing 5`-flanking
sequences/exon I, intron I, and part of exon II) to the bacterial CAT
gene and 3`-polyadenylation sequences from SV40 (Fig. 8A). In addition, a second c-myb/CAT
reporter construct was built in which both RRBE sequences were deleted (Fig. 8A, dRRBE/CAT). The c-myb/CAT
reporter was cotransfected with expression vectors for the p50, p65,
and c-Rel members of the NF-B Family Transactivate a c-myb/CAT
Reporter ConstructB family (60) into the murine
thymoma EL4, which contains low levels of endogenous NF-B
DNA-binding activity(61) . Titration of each homodimer and
heterodimer was performed to assess the effects of their expression on
the c-myb/CAT reporter construct. Cotransfection of p50, p65,
c-Rel, or p50 with c-Rel did not result in altered expression from the
c-myb/CAT reporter construct (data not shown). However,
coexpression of p50 with p65 and c-myb/CAT resulted in a
3.7-fold increase in CAT activity at 4 µg and a 4.1-fold increase
at 6 µg of each expression vector (Fig. 8B, shaded bars). Coexpression of p65 with c-Rel resulted in the
strongest transactivation of the c-myb/CAT reporter construct:
an 8.2-fold increase at 4 µg and a 10-fold increase at 6 µg of
each vector (Fig. 8B, hatchedbars).
Since each expression vector alone failed to transactivate the
c-myb/CAT reporter construct, these results are not simply due
to competition for a negatively acting transcription factor(s) by the
NF-B family member expression vector sequences. To determine
whether transactivation of the c-myb/CAT reporter construct by
members of the NF-B family required the two RRBE sequences
identified in the first intron, the dRRBE/CAT reporter
construct was transfected in parallel experiments with the wild-type
c-myb/CAT reporter construct with 4 or 6 µg each of the
p50 with p65 or p65 with c-Rel heterodimer combinations. In contrast to
results obtained using the c-myb/CAT reporter construct,
expression of the dRRBE/CAT reporter construct was unchanged
or slightly decreased by cotransfection of p50 and p65: 0.84-fold with
4 µg and 0.77-fold with 6 µg of p50 and p65. Similarly,
expression of the dRRBE/CAT reporter was unaffected by
cotransfection of p65 and c-Rel: 0.90-fold with 4 µg and 1.1-fold
with 6 µg of p65 and c-Rel. Thus, deletion of regions containing
the RRBE sequences from the c-myb/CAT reporter construct
resulted in the loss of a transactivation response due to coexpression
with members of the NF-B family. These experiments demonstrate
that the c-myb RRBE sequences are required for NF-B
family members to transactivate the c-myb/CAT reporter
construct and suggest that members of the NF-B family play a role
in the transcriptional regulation of the c-myb gene.
B cognate binding sequence and
identical to the recently described RRBE element in the promoter of the
human urokinase gene, which binds members of the NF-B
family(35, 54) . We have demonstrated that members of
the NF-B family of transcription factors can bind to the c-myb RRBE element in vitro by several criteria. (i)
DNA-binding activity was induced upon LPS treatment of 70Z/3.12 cells,
and an NF-B oligonucleotide competed for binding to the c-myb RRBE; (ii) antisera raised against the p50 subunit of NF-B as
well as the c- and v-Rel proteins supershifted or inhibited several of
the DNA-protein complexes that formed on this element; and (iii)
IB-/MAD-3 inhibited the formation of several of the
DNA-protein complexes that were able to form on the c-myb RRBE
element. However, preincubation of the extracts with either of the Rel
antisera did not alter each of the complexes that we detected.
Similarly, preincubation of the extracts with IB-/MAD-3
resulted in the selective loss of some but not all of these same
complexes. Thus, our results suggest that additional factors or
modifications to NF-B family members may be involved in binding to
the c-myb RRBE. In addition, the DNA-binding patterns detected
with the c-myb RRBE were more complex than those reported with
the RRBE from the human urokinase gene, where only two DNA-binding
complexes were detected, suggesting that flanking sequences may be
important in determining binding to this element.B acts to increase expression from the
c-myb/CAT reporter construct is not understood. NF-B
family members may act at the level of transcription initiation to
increase transcription from the c-myb promoter. Both p65 and
c-Rel contain potent transcription activator
domains(62, 63, 64) , and transactivation of
the c-myb/CAT reporter construct correlated with coexpression
of both subunits. The strongest activation of the c-myb/CAT
reporter construct was obtained with the p65 and c-Rel combination,
suggesting that this novel heterodimer may play a role in activating
the c-myb promoter. Thus, it is of considerable interest to
note that Hansen et al.(65) have recently isolated a
p65 with c-Rel heterodimer that binds and transactivates the urokinase
promoter via the RRBE element. Similarly, Oeth et al.(66) have identified a B-related binding site in the
tissue factor promoter that mediates LPS-induced transcription of the
tissue factor gene in human monocytes. This element binds the p65 with
c-Rel heterodimer, but does not bind p50 with p65 heterodimers or p50
homodimers. Alternatively, since c-myb RRBE DNA-binding
activity correlated with efficient attenuation and the c-myb RRBE sites flank the site of attenuation, members of the NF-B
family may regulate c-myb mRNA at the level of transcription
elongation. In this case, NF-B binding may alter the elongation
competence of polymerase complexes at the promoter, modify the
processivity of the elongating transcription complex at the site of
attenuation, or alter the conformation of chromatin in the first
intron, resulting in the read-through of elongating transcription
complexes. Previous work has demonstrated that both the p50 and p65
subunits can induce DNA bending upon binding(67) , and the
location of the c-myb RRBE sequences within the first intron
suggests that they may play a role in determining the conformation of
the region through binding of NF-B family members. In this
respect, we have previously identified a DNase I-hypersensitive site
(site IV) in the A20/2J murine B cell lymphoma cell line that is
differentially detected and correlates with efficient
attenuation(27) . An alteration of the higher order chromatin
structure within the intron may make the region more accessible to
DNase I, and it is possible that the hypersensitive site is stimulated
by RRBE binding.B family members to
transactivate a c-myb/CAT reporter construct points to a
paradox in that we detected binding to the c-myb RRBE element
in cell lines that contain small amounts of c-myb mRNA and
that demonstrate efficient
attenuation(24, 27, 28, 29) .
Resting lymphocytes contain little, if any, detectable c-myb mRNA(68, 69) . However, during activation of
human peripheral blood T cells(68, 69) or cloned T
cell lines(70) , c-myb mRNA expression is induced
during late G/early S phase of the cell cycle. It is of
particular interest to note that cross-linking of the T cell receptor,
which is sufficient to induce G
to G transition, does not induce expression of c-myb mRNA and
that interleukin-2 is required both for G to S phase
transition and for induction of c-myb mRNA
expression(69, 70) . Similarly, the DNA-binding
activity of different members of the NF-B family is regulated
during T cell activation, and p50 with p65 heterodimers rapidly
translocate to the nucleus and are able to bind DNA within minutes of T
cell receptor cross-linking(68, 71) . However, it has
been reported that c-Rel is not detected in DNA-binding complexes until
G(71) . Thus, differential regulation of NF-B
family DNA-binding activity may play a role in regulating c-myb expression during lymphocyte activation. Previous studies
examining c-myb mRNA expression during T lymphocyte activation
did not characterize nascent c-myb mRNA expression by nuclear
run-on assay, and it is not known whether increased detection of
steady-state c-myb mRNA is due to changes in the rate of
transcription initiation or changes in the efficiency of
attenuation(69, 70) . Changes in the DNA-binding
activities of NF-B family members may act at either level.
Alternatively, non-NF-B DNA-binding activities that act
synergistically with NF-B family members may be induced by
interleukin-2 stimulation to increase steady-state c-myb mRNA
levels. For instance, activation of the 
-interferon and
interleukin-2 -receptor promoters involves the interaction of
NF-B with interferon-regulated factor-1 and the serum response
factor, respectively(72, 73) . Thus, interaction of
NF-B family members with other transcription factors may be
required for NF-B to transactivate expression of c-myb mRNA. Finally, Klug et al.(74) have recently
demonstrated that transformation of pre-B cells by Abelson leukemia
virus inhibits the activated state of NF-B-Rel complexes, while
pre-B cells expanded from normal bone marrow contain active NF-B
complexes. Thus, NF-B/Rel family members are active and may be
involved in regulating c-myb expression at several stages of B
cell development.B subunits occupy the sites. Even though the combination of p65
and c-Rel transactivated the c-myb/CAT reporter in
cotransfection assays in EL4 cells, c-Rel may have a repressive effect
on transcription in other cell types, at different stages of
differentiation, or in combination with other NF-B-binding
proteins. For example, decreased expression of c-myb mRNA in
maturing thymocytes has been inversely correlated with expression of
c-rel mRNA(75) , and c-Rel-like proteins have also
been shown to be involved in repression of the interleukin-6 gene in
lymphoid cells(76) . Thus, it should be noted that Miyamoto et al.(77) have reported a shift in the NF-B
subunits that bind the B site during B cell differentiation.
Changes in the relative subunit concentrations during development may
alter the function of the c-myb RRBE sites, resulting in
increased or decreased c-myb expression. Only three members of
the NF-B family were examined in this study, and other NF-B
family members or heterodimer combinations may be the actual factors
that regulate c-myb transcription. For example, there has been
a report of a novel NF-B DNA-binding activity (NP-TC
)
that is present in unstimulated as well as stimulated T and B cells,
but is not detected in nonhematopoietic cells(61) . It will be
of considerable interest to determine how members of the NF-B/Rel
family regulate c-myb transcription and the consequences of
shifts in the relative activity of the NF-B proteins to c-myb expression.
)B, nuclear factor B; EMSA, electrophoretic mobility shift
assay(s); LPS, lipopolysaccharide; CAT, chloramphenicol
acetyltransferase; kb, kilobase(s); bp, base pair(s); RRBE, Rel-related
protein-binding element; Ab, antibody.
We thank Dr. A. Israel for the gift of rabbit antisera
made against human p50, Dr. N. Rice for the gift of rabbit antisera
made against v-Rel and human c-Rel, and Dr. M. Mitchell Smith for
critical review of the manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  O. Ikeda, Y. Sekine, T. Yasui, K. Oritani, K. Sugiyma, R. Muromoto, N. Ohbayashi, A. Yoshimura, and T. Matsuda STAP-2 Negatively Regulates both Canonical and Noncanonical NF-{kappa}B Activation Induced by Epstein-Barr Virus-Derived Latent Membrane Protein 1 Mol. Cell. Biol., August 15, 2008; 28(16): 5027 - 5042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Drabsch, H. Hugo, R. Zhang, D. H. Dowhan, Y. R. Miao, A. M. Gewirtz, S. C. Barry, R. G. Ramsay, and T. J. Gonda Mechanism of and requirement for estrogen-regulated MYB expression in estrogen-receptor-positive breast cancer cells PNAS, August 21, 2007; 104(34): 13762 - 13767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. D. Mineva, T. L. Rothstein, J. A. Meyers, A. Lerner, and G. E. Sonenshein CD40 Ligand-mediated Activation of the de Novo RelB NF-{kappa}B Synthesis Pathway in Transformed B Cells Promotes Rescue from Apoptosis J. Biol. Chem., June 15, 2007; 282(24): 17475 - 17485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Jost and J. Ruland Aberrant NF-{kappa}B signaling in lymphoma: mechanisms, consequences, and therapeutic implications Blood, April 1, 2007; 109(7): 2700 - 2707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Liu, C. Zang, M. H. Fenner, D. Liu, K. Possinger, H. P. Koeffler, and E. Elstner Growth inhibition and apoptosis in human Philadelphia chromosome-positive lymphoblastic leukemia cell lines by treatment with the dual PPAR{alpha}/{gamma} ligand TZD18 Blood, May 1, 2006; 107(9): 3683 - 3692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Chen, M. S. Bhojani, A. C. Heaford, D. C. Chang, B. Laxman, D. G. Thomas, L. B. Griffin, J. Yu, J. M. Coppola, T. J. Giordano, et al. Phosphorylated FADD induces NF-{kappa}B, perturbs cell cycle, and is associated with poor outcome in lung adenocarcinomas PNAS, August 30, 2005; 102(35): 12507 - 12512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-J. Liu, S.-C. Hou, and C.-K. J. Shen Erythroid Gene Suppression by NF-{kappa}B J. Biol. Chem., May 23, 2003; 278(21): 19534 - 19540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Lauder, A. Castellanos, and K. Weston c-myb Transcription Is Activated by Protein Kinase B (PKB) following Interleukin 2 Stimulation of T Cells and Is Required for PKB-Mediated Protection from Apoptosis Mol. Cell. Biol., September 1, 2001; 21(17): 5797 - 5805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, L. Shelly, L. Miele, R. Boykins, M. A. Norcross, and E. Guan Human Notch-1 Inhibits NF-{{kappa}}B Activity in the Nucleus Through a Direct Interaction Involving a Novel Domain J. Immunol., July 1, 2001; 167(1): 289 - 295. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. W. Pyatt, Y. Yang, B. Mehos, A. Le, W. Stillman, and R. D. Irons Hematotoxicity of the Chinese Herbal Medicine Tripterygium wilfordii Hook f in CD34-Positive Human Bone Marrow Cells Mol. Pharmacol., March 1, 2000; 57(3): 512 - 518. [Abstract] [Full Text]
|
|
|
|
|
|
D. W. Pyatt, W. S. Stillman, Y. Yang, S. Gross, J. h. Zheng, and R. D. Irons An Essential Role for NF-{kappa}B in Human CD34+ Bone Marrow Cell Survival Blood, May 15, 1999; 93(10): 3302 - 3308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sullivan, B. Feeley, J. Guerra, and L. M. Boxer Identification of the Major Positive Regulators of c-myb Expression in Hematopoietic Cells of Different Lineages J. Biol. Chem., January 17, 1997; 272(3): 1943 - 1949. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yang and D. F. Klessig Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco PNAS, December 10, 1996; 93(25): 14972 - 14977. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |