JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bai, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bai, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 13, Issue of March 31, 1995 pp. 7737-7744
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional Analysis of the Proximal 5`-Flanking Region of the N-Methyl-

D

-aspartate Receptor Subunit Gene, NMDAR1 (*)

(Received for publication, December 9, 1994; and in revised form, January 16, 1995)

Guang Bai (§), ,  John W. Kusiak

From the Molecular Neurobiology Unit, Gerontology Research Center, NIA, National Institutes of Health, Baltimore, Maryland 21224

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The NMDAR1 receptor subunit is a common subunit of N-methyl-D-aspartate receptors. We have previously characterized 3 kilobases (kb) of 5`-flanking sequence of the NMDAR1 gene and now report on the ability of this region to direct transcription of a reporter gene and on its interaction with nuclear proteins. The sequence 356 base pairs (bp) 5` of the first nucleotide of codon 1 was sufficient to express a luciferase reporter gene in rat PC12 pheochromocytoma cells. Additional sequences upstream of nucleotide -356 influenced the activity approximately 2-fold. A labeled 112-bp fragment (position -356 to -245) formed six complexes (C1A and -B, C2A and -B, and C3A and -B), grouped as three double bands, with nuclear extracts from PC12 cells. Competition with Sp1 oligonucleotides abolished formation of C2A and -B and C3A and -B complexes. Sp1 antibody recognized the C3A complex in supershift experiments. Prior immunoprecipitation of nuclear extracts with Sp1 antibody abolished formation of C2A and -B and C3A and -B complexes. Purified Sp1 protein alone did not form a C3A complex but potentiated its formation when PC12 nuclear extract was added. A GC-rich sequence in this fragment was protected from DNase I digestion by nuclear extract. These results suggest that a 356-bp sequence comprises the NMDAR1 basal promoter, and that NMDAR1 gene expression may be regulated by Sp1-like nuclear factors.

INTRODUCTION

N-Methyl-D-aspartate (NMDA) (^1)receptors are members of the glutamate family of ligand-gated ion channels. They play important roles in the central nervous system and have been implicated in both neurotrophic and neurotoxic mechanisms. Their activity is important in neuronal long-term potentiation, a cellular process thought to underlie memory formation(1, 2, 3) . Overactivity of NMDA receptors is toxic and results in neuronal death brought about by excessive intracellular calcium accumulation and a subsequent cascade of events which may involve activation of intracellular hydrolases or an apoptotic genetic program(3, 4) .

Recently, two families of NMDA receptor subunits were cloned, and their functional characteristics were delineated. The NMDAR1 gene, the sole member of this family cloned so far, appears to be a subunit common to all NMDA receptors and is capable of forming functional homomeric and heteromeric NMDA receptors(5, 6, 7) . The NMDAR1 gene undergoes alternative splicing to generate several protein isoforms(8, 9, 10) . The NMDAR2 gene family is comprised of four members designated 2A, 2B, 2C, and 2D, which only exhibit channel activity when co-expressed with the NMDAR1 gene(5, 7, 11) . In situ hybridization studies revealed that the NMDAR1 gene is expressed widely in the central nervous system with more prevalent expression in the hippocampus, cerebral cortex, and olfactory bulb(6, 7) . In contrast, the NMDAR2 genes have a more restricted and differential distribution(5, 7, 11) . These expression patterns have been substantiated by immunohistochemical methods with specific antibodies to the various subunits(12, 13) .

The expression of the NMDAR1 gene is neuron-specific and highly regulated under both physiological and pathological conditions(2, 3) . In the developing mammalian central nervous system, there is a progressive increase in NMDAR1 expression until the cessation of cortical neuronal migration(14, 15, 16) . NMDAR1 receptor mRNA is expressed in embryonic carcinoma cells differentiated with retinoic acid into a neuronal phenotype(17) . The levels in cerebral cortex and hippocampus of adult brain are somewhat lower than those found postnatally(14, 15) . Evidence based upon receptor ligand binding studies suggests that NMDA receptors may be diminished during aging and in various neurological diseases(3, 4, 18) . Furthermore, NMDA receptors are down-regulated in hippocampus and cerebral cortex by long-term administration of competitive antagonists(19) , in dentate gyrus granule cells by full kindling-induced epileptogenesis(20) , and in hippocampal CA1 neurons by transient global ischemia(21) . Estrogen replacement in ovariectomized rats significantly up-regulates NMDAR1 mRNA in cerebral cortex(22) . Interestingly, it has recently been shown that NMDAR1 mRNA levels change in a circadian pattern in the suprachiasmatic nucleus of the rat(23) . Taken together, these results suggest that NMDA receptor expression may be highly regulated at the level of gene transcription in both a temporal and cell-specific manner.

As a first step to explore this regulation, we previously isolated and characterized a 3-kb genomic fragment encompassing the 5`-flanking sequence of the NMDAR1 gene and mapped the transcriptional start sites (24) . Our results suggested that the NMDAR1 gene promoter has the characteristics of a housekeeping gene in that there are multiple start sites and it contains a proximal GC-rich region with no TATA or CAAT box motifs.

In the present study we studied the ability of rat pheochromocytoma cells (PC12) to correctly transcribe NMDAR1 mRNA and evaluated the ability of the 3-kb promoter fragment to direct the expression of a reporter gene construct in transient transfection assays. We also investigated DNA-protein interactions by gel mobility shift assays and DNA footprinting assays with promoter fragments thought to be important in the expression of the NMDAR1 gene. Our results suggest that the NMDAR1 gene proximal promoter region is sufficient for gene expression and that this promoter may be regulated by immediate early genes.

EXPERIMENTAL PROCEDURES

Materials

The following kits were utilized: mini and maxi DNA purification from Qiagen, Sequenase II from U. S. Biochemicals, Riboprobe and Gel Shift Assay from Promega, and DNA footprinting from Pharmacia Biotech Inc. Luciferase and beta-galactosidase were purchased from Promega Corp. and Boehringer Mannheim, respectively; Lipofectin reagent was purchased from Life Technologies, Inc. All radiolabeled nucleotides were from Amersham Corp., and Sp1 antibody was from Santa Cruz Biotechnology, Inc.

RNase Protection

Total RNA from rat brain and cultured cells was extracted using guanidinium thiocyanate/phenol as described by Chomczynski and Sacchi(25) . Plasmid pG918K/S was constructed by subcloning into pGEM-3Zf(+) a KpnI-SacI product (918 bp) from the 3.8-kb EcoRI fragment reported previously(24) . Riboprobes 1 and 2 were transcribed by T7 RNA polymerase from plasmid pG918 K/S linearized by PstI and XbaI, respectively, using a Promega Riboprobe kit in the presence of [alpha-P]UTP. Sizes of the probes were indicated previously(24) . Transcribed probes were purified on a denaturing polyacrylamide gel(26) . Riboprobe 2 was hybridized to 10 µg of RNA at 45 °C overnight and digested with 7 units of RNase ONE (Promega) for 30 min at 30 °C(24) . The digestion was stopped by adding 0.1% SDS and extracted once with phenol/chloroform. After precipitation, the protected RNA probe was fractionated on an 8% sequencing gel. A DNA sequence ladder was generated from the single strand of M13 phagemid by a M13 sequencing primer with U. S. Biochemical Corp. Sequenase II kit in the presence of [alpha-S]dATP. Riboprobe 1 with a size of 253 nucleotides was used for correcting the difference in the migration of RNA and DNA ladders. The dried gel was exposed to x-ray film for autoradiography.

Preparation of Chimeric NMDAR1-Luciferase Constructs

The 5`-flanking sequence of NMDAR1 gene reported by us previously (24) has 3029 bp whose last 3` base pair is numbered -1 relative to the first nucleotide in codon 1. This fragment ends with a 5` EcoRI site and a 3` SacI site and was subcloned into pGEM-3Zf(+) to form pG3029. To create 5` non-overlapping deletions presented schematically in Fig. 1, the following strategies were applied to retrieve fragments from pG3029 and ligate them into a polylinker in front of a firefly luciferase gene harbored in pGL-2Basic (Promega). Individual constructs are named pNRL followed by a number indicating the 5` end of the genomic fragment inserted into the vector. The 3` end of each insert is at nucleotide -1(24) . Partial digestion with SacI and ligation to pGL2-Basic vector linearized by SacI were used to form pNRL2837, -1880, and -1113; AccI digestion of pG3029, blunt ending of the AccI ends with Klenow enzyme, partial SacI digestion, isolation of 2.3-kb fragment, and ligation to SmaI/SacI-digested vector were performed, in order, for pNRL2326. In another aliquot of the above ligation mixture, a 340-bp AccI fragment (-2666/-2327) purified from the same blunted mixture was added for formation of pNRL2666. Removal of KpnI-KpnI and KpnI-PstI fragment from pNRL1113 was used for pNRL919 and -239 constructs, respectively. Insertion of an EcoRI-KpnI fragment into KpnI-digested pNRL919 followed by blunting KpnI/EcoRI and religation was employed for pNRL3029. The ligation-blunt-ligation strategy was also applied to an XbaI-SacI fragment for pNRL731; partial BsmI plus SacI for pNRL579 and -356; partial SmaI plus SacI for pNRL473 and -100. A PstI-SacI fragment (-243/-2) from pNRL356 was removed to form pNRL356Delta242. The boundaries of the inserted DNAs in all constructs were sequenced by extending primers GL1 and GL2 (Promega) which are complementary to the sequences flanking the multiple cloning sites in pGL2-Basic. All plasmid DNAs were isolated using Qiagen columns according to the manufacturer's instructions.

Figure 1: 5` Non-overlapping deletions of the NMDAR1 gene promoter. The 3029-bp 5`-flanking sequence of NMDAR1 gene is shown with an open bar. Progressive 5` deletions of this fragment were derived as described in detail under ``Experimental Procedures.'' Their 5` ends are indicated with numbers, which also represent their size. The locations of the putative motifs are indicated on the top of the bar. The arrow and surrounding tick marks represent the cluster of multiple transcription start sites. For other details about the 3029-bp sequence, please see (24) .


Cell Culture and Transient Transfections

PC12 cells were cultured as described previously(27) . C6 glioma cells were obtained from Paragon Biotech and maintained in Ham's F14 nutrient medium containing 15% horse serum and 2.5% fetal bovine serum. Human cervical carcinoma, HeLa cells, were cultured in Dulbecco's modified Eagle's medium with 10% horse serum and 5% fetal bovine serum. One day before transfection, cells (5 times 10^5 for PC12, 5 times 10^5 for C6, or 3 times 10^5 for HeLa) were plated on 60-mm plates. PC12 cells were grown on collagen-coated plates. A lacZ gene driven by the enhancer/promoter of the major immediate early gene of human cytomegalovirus, pCMVbeta (Clontech), was co-transfected with luciferase constructs to correct for transfection efficiency. We introduced 0.45 pmol of luciferase constructs and 0.4 pmol of pCMVbeta with a cationic liposome reagent, Lipofectin (Life Technologies, Inc.) at 10 µg/ml for PC12 and HeLa cells, as described by Muller et al.(28) . C6 cells were transfected by the calcium phosphate precipitation method with the same amount of DNA as above(26) . The cells were returned to serum-containing media 6 h after transfection, and C6 cells underwent glycerol shock before addition of serum-containing medium. Two days after transfection, cells were harvested with 0.04% EDTA containing PBS and washed twice.

Reporter Gene Assay

Pelleted cells were resuspended in buffer consisting of 25 mM Tris phosphate, pH 7.4, 2 mM dithiothreitol, 2 mM EDTA, bovine serum albumin at 1 mg/ml, and 10% glycerol and sonicated at 4.0 watts for 3 times 5 s to lyse the cells. Sonication was found to be the best technique to lyse cells and preserve the activity of reporter enzymes(29) . For the luciferase gene assay, 10 µl of lysate was mixed with ATP-containing buffer B and injected with luciferin-containing buffer A in a Monolight 2101 luminometer (Analytical Luminescence Laboratories, San Diego). Firefly luciferase (Boehringer Mannheim) was serially diluted and used to establish a standard curve to convert luminescence units into the amount of luciferase activity. To measure beta-galactosidase, 2-nitrophenyl-beta-D-galactopyranoside was used as substrate. One to five µl of lysate together with dH(2)O to 60 µl was incubated with 60 µl of 2 times substrate buffer containing 120 mM Na(2)HPO(4), 80 mM NaH(2)PO(4), 2 mM MgCl(2), 100 µM beta-mercaptoethanol, 40 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl and 1.33 mg/ml 2-nitrophenyl-beta-D-galactopyranoside, at 37 °C for 30 min. The reaction was terminated by adding 200 µl of 2 M Na(2)CO(3), and the optical density at 420 nm was recorded. The activity of enzyme was calibrated by a standard curve established with purified beta-galactosidase (Promega).

Gel Shift and DNA Footprinting

To prepare probe for gel shift experiments, a 112-bp BsmI/PstI blunt-ended fragment (position -356 to -245) was inserted into the HincII site of pGEM-3Zf(+) to form pG112. Radiolabeled probes were prepared by filling in the ends of restriction enzyme-digested pG112 (XbaI/PstI for antisense strand and HindIII/SmaI for sense strand) with an appropriate [alpha-P]dNTP and Klenow enzyme. Labeled DNA was then purified through a native polyacrylamide gel. Cell nuclear extracts were made by a modified Dignam method(30) , and washed nuclei were extracted with buffer containing 0.45 M KCl. Contaminating nuclease activity in extracts was examined by incubating 1 µg of HindIII-digested -DNA with 9.5 µg of protein overnight at 37 °C and comparing its integrity with untreated DNA. A Promega kit was used for gel mobility shift experiments with the following modifications. In a 10-µl final volume, nonspecific binding was blocked with 3 µg of poly(dI:dC) at room temperature for 10 min and, in competition experiments, oligonucleotides containing specific consensus sequences supplied by the kits were also added for 10 min of blocking. Labeled probe was incubated at room temperature with extracts for another 20 min and, for supershift experiments, antibody was added 10 min after addition of the probe. The mixtures were electrophoresed on a 4% native polyacrylamide gel in 0.5 times TBE buffer at 4 °C for 2 h. The dried gel was exposed to x-ray film. For some experiments, the PC12 nuclear extract was heated at 100 °C for 10 min and cooled on ice prior to incubation. In other experiments, the extract was pretreated by immunoprecipitation with polyclonal Sp1 antibody as follows: in 11 µl volume, 95 µg of PC12 nuclear extract was incubated with 1 µg of Sp1 antibody at 4 °C for 4 h and then 2 µl of activated protein A-Sepharose (Pharmacia Biotech Inc.) was added for an additional 2 h. After centrifugation at 14,000 times g for 20 min at 4 °C, the supernatants were removed and used.

A Pharmacia kit was utilized for DNA footprinting. After titrating the DNase I concentration to create the best ladder, enough extract was applied under the conditions in gel mobility shift assay to saturate the probe. For the control ladder, the same amount of bovine serum albumin was added. At the end of the incubation, the probe was nicked by DNase I digestion for 1 min at room temperature. The digestion was stopped by adding 120 µl of stop buffer and extracted once with phenol/chloroform. Precipitated DNA was denatured at 95 °C for 5 min in loading buffer from the Sequenase II kit and fractionated on a 10% sequencing gel. DNA ladders of chemically cleaved G and G + A were also prepared and run on the gel(26) .

In some experiments, the density of specific bands in autoradiographs was analyzed with an LKB Ultroscan XL Enhanced Laser Densitometer.

RESULTS

Expression of the Endogenous NMDAR1 Transcripts in PC12 Cell

We previously reported on the isolation and characterization of a 3-kb 5`-flanking sequence of the rat NMDAR1 gene. In rat brain, this gene was transcribed from two major and several minor start sites (24) . We examined the transcriptional start sites of the NMDAR1 gene in PC12 cells and compared them with those of rat brain, a glioma cell line (C6), and HeLa cells (Fig. 2). Riboprobe 2 (24) generated from the genomic sequence and encompassing all transcription start sites was used in this experiment. PC12 cells (lane 3) utilized the same sites as the brain (lane 2) to transcribe the NMDAR1 gene, but C6 and HeLa cells did not contain any detectable NMDAR1 message (lanes 4 and 5). It is interesting to note that PC12 cells use primarily the distal major transcription start site. In contrast, the proximal start site is predominately used in rat brain, which was observed previously(24) .

Figure 2: PC12 cells transcribe the NMDAR1 gene from the same sites as in the brain. The 5` ends of NMDAR1 mRNA were mapped by RNase protection with riboprobe 2 as described under ``Experimental Procedures.'' Ten µg of total cellular RNA were hybridized to probe, and the protected bands were fractionated on an 8% DNA sequencing gel. Lane 1, riboprobe 1 (253 nucleotides) that was used to correct for the migration of RNA; lane 2, rat brain RNA; lane 3, PC12 cell RNA; lane 4, C6 cell RNA; lane 5, HeLa cell RNA; lane 6, yeast RNA. This is an autoradiograph exposed for 3 days at -80 °C with one intensifying screen. A 2-week exposure showed the same results.


NMDAR1 Promoter Is Composed of Proximal 5`-Flanking Sequence and the 5` Portion of Exon I

A series of luciferase constructs were prepared, as shown schematically in Fig. 1, with progressive 5`, non-overlapping deletions of the 3-kb 5`-flanking sequence and were transiently transfected into PC12, C6, and HeLa cells. The construct pNRL356 gave a high level of activity in PC12 cells (Fig. 3A). pNRL239, which lacks the 5` 117 bp (-356/-240) in pNRL356, gave activity which was 1/35 of pNRL356, suggesting that the 356-bp fragment contains major cis-acting elements required for NMDAR1 promoter activity. This region encompasses all 5` transcription start sites and the GC-rich sequence including putative GSG and Sp1 motifs(24) . The SV40 early promoter (pSVL) containing a cluster of six Sp1 motifs (31) exhibited an activity similar to that of pNRL356 in PC12 cells (Fig. 3A). Relative to pNRL356, constructs containing additional sequences 5` of pNRL356 changed the activity less than 2-fold. These data strongly suggest that pNRL356 contains the core promoter of NMDAR1 gene. pNRL356Delta242, a construct in which nucleotides -243/-2 were deleted from pNRL356, i.e. linking directly the 5` 113-bp DNA (-356/-244) to the reporter gene had 20.64% of the activity of pNRL356 (Fig. 3D).

Figure 3: The activity of NMDAR1 promoter in transiently transfected cells. Cells were transfected with chimeric NMDAR1 promoter constructs, and the reporter gene assays were performed as described under ``Experimental Procedures.'' Relative luciferase activity is expressed after correcting for the transfection efficiency with co-transfected pCMV/beta-galactosidase. A luciferase gene driven by SV40 early gene promoter was used as positive control, and the luciferase vector pGL-2Basic was used as a promoterless gene control. All values are presented as the mean ± S.E. from at least three separate experiments. The results were from PC12 cells (A and D), C6 cells (B), and HeLa cells (C). The results from construct pNRL356Delta242 with the deletion at the 3` end of exon 1 are shown in D.


To determine whether the NMDAR1 core promoter only contains nonspecific basal transcription activity, additional transfection studies were carried out in non-neuronal C6 glioma and HeLa cells. Results in Fig. 3, B and C, showed that this NMDAR1 promoter construct in these two cell lines had low activity compared to the SV40 construct. The changes in activity among the other NMDAR1 constructs are small and vary less than 2-fold in HeLa and 7-fold in C6 cells. In HeLa cells, since the cytomegalovirus promoter has high beta-galactosidase activity and luciferase activity overall was low, the relative luciferase activity is lower than that in either PC12 or C6 cells. In view of these results, this proximal sequence may have a role in basal, cell type-specific NMDAR1 gene expression.

A Complex Including a Sp1-like Factor Is Involved in the Interaction with NMDAR1 Promoter

We labeled a 112-bp fragment (position -356 to -245) located at the 5` end of pNRL356 and investigated its ability to interact with nuclear factors. Six complexes, migrating as three doublet bands, were formed using PC12 cell nuclear extracts (Fig. 4A). The bands in each doublet showed even density. Increasing poly(dI:dC) up to 10 µg per sample did not significantly change the density of each complex (data not shown). Preincubation of the crude nuclear extract with unlabeled DNA completely abolished complex C2 and C3 doublet formation, but failed to remove the smallest doublet, C1A + B (data not shown). Hence, we believe that the C1A + B complexes represent nonspecific binding. In comparison with PC12, C6 cell nuclear extracts exhibited weak complex formation with multiple bands. HeLa cell nuclear extracts formed complexes with this fragment similar to PC12 cell extracts except that C3A (see Fig. 4C) is almost 4 times stronger than the others.

Figure 4: Gel mobility shift analysis of the interactions of NMDAR1 promoter with nuclear factors. A 112-bp fragment (position -356 to -245) of NMDAR1 promoter was labeled either on the sense or antisense strand by Klenow enzyme. Gel mobility shift experiments were done as described under ``Experimental Procedures.'' A, binding of different nuclear extracts. Increasing amounts of crude nuclear extracts, 2.25, 4.5, and 9 µg for PC12 and HeLa, 4.5 and 9 µg for C6, were added to reaction mixtures. Six major complexes and free probe are indicated. The smearing in the lane with the highest nuclear extract appeared due to overloading. Overexposure of autoradiography showed that C6 had multiple bands with similar density including duplexes C1 to C3. The left-hand lane is a control with probe alone. B, competition by consensus oligonucleotides. 4.5 µg of crude PC12 nuclear extract was preincubated with or without 100-fold excess of consensus oligonucleotides as indicated in the figure before adding labeled probe. All oligonucleotides used for competition were from Promega or Stratagene. The sequences of consensus oligonucleotides are as follows: AP1(c-jun), CGCTTGATGAGTCAGCCGGAA; AP2, GATCGAACTGACCGCCCGCGGCCCGT; AP3, CTAGTGGGACTTTCCACAGATC; CREB, AGAGATTGCCTGACGTCAGAGAGCTAG; CTF/NF1, CCTTTGGCATGCTGCCAATATG; GRE, TCGACTGTACAGGATGTTCTAGCTACT; NF kappa/B, AGTTGAGGGGACTTTCCCAGGC; Oct1, TGTCGAATGCAAATCACTAGAA; Sp1, ATTCGATCGGGGCGGGGCGAGC; TFIID, GCAGAGCATATAAGGTGAGGTAGGA. C, supershift of nuclear factor-DNA complex by Sp1 antibody. Ten minutes after addition of probe to 4.5 µg of PC12 nuclear extract, increasing amounts of Sp1 antibody, 3.12, 6.25, 12.5, 25, and 50 ng were added to the mixture and incubated for a further 20 min. In duplex C3, band A was further retarded in the presence of Sp1 antibody. D, the binding of purified Sp1 protein. Human Sp1 protein purified from Sp1 cDNA-transfected HeLa cells was added to labeled 112-bp probe in the absence or the presence of PC12 extract (2.25 µg) represented with the solid bar. Increasing amounts of Sp1 protein, from 0.0625, 0.125, 0.25, and 0.5 footprinting unit, were added to probe with PC12 cell extracts and 2 units of Sp1 protein to probe without extract (left lane). Addition of 0.0625 unit of Sp1 increased the intensity of band A approximately 8-fold based upon densitometric scanning of the autoradiograph. E, effect of heating on potentiation of C3A formation by Sp1 protein. Labeled 112-bp probe was incubated with buffer (lane 1), 2.25 µg of PC12 extract (lane 2), or 4.5 µg of boiled PC12 extract (lanes 3 and 4). Sp1 protein (0.125 unit) was added to the reaction in lane 4. The band appearing in lane 4 migrated at the same position as C3A in lane 2 and is 53.13% of C3A in lane 2 based upon densitometric scanning of the autoradiograph. F, effect of Sp1 protein removal on the formation of protein-DNA complexes in NMDAR1 promoter. Sp1 protein in PC12 extract was precipitated by antibody as described under ``Experimental Procedures.'' Labeled probe was exposed to PC12 extract (lane 1, 4.5 µg; lane 2, 2.25 µg) or Sp1-deficient extract (lane 3, 9 µg; lane 4, 18 µg).


As the first step to identify the nuclear factors, competition experiments with a series of double-stranded oligonucleotides, which contain specific motifs including many GC-rich consensus sequences, were performed. As can be seen in Fig. 4B, C2 and C3 doublets were completely competed by preincubation with a 100-fold excess of Sp1 oligonucleotide. Other oligonucleotides did not compete with the binding. We then tested the effect of an Sp1 specific antibody on the reaction mixture (Fig. 4C). In PC12 extracts, only one band, C3A, was further retarded by the polyclonal Sp1 antibody which is capable of specifically binding Sp1 proteins in human, rat, and mouse tissues. This antibody showed high titer since 25 ng of antibody was able to shift almost all C3A complex from 4.5 µg of extracts to a new, slower migrating band. Increasing the amount of antibody to 50 ng did not significantly change the other three bands. This suggests that the C3A complex may contain Sp1-like proteins. Then we attempted to verify this by adding purified Sp1 protein to the labeled 112-bp DNA. However, even though we put 2 footprinting units in a single reaction, we did not see any binding (Fig. 4D, left lane). Sp1 protein belongs to a family of zinc finger proteins and requires zinc ions as cofactor. Although the storage buffer of Sp1 protein contains 5 µM ZnSO(4), we did not supplement any buffers with zinc during nuclear extraction. Metal ions, such as ZnCl(2), ZnSO(4), CaCl(2), or MgCl(2) up to 1 mM, were added in the assay, but no binding was seen (data not shown). These same results were observed with three different lots of Sp1 proteins. Only when we added nuclear extract, even as small an amount as 2.5 µg, did a band appear from 0.0625 unit of Sp1 protein migrating at the same position as C3A. This suggests that an Sp1-like protein probably contributes to the C3A binding complex.

Since Sp1 bound the 112-bp DNA fragment only in the presence of nuclear extract and did not bind in the presence of added zinc, we tested the heat sensitivity of the extract for Sp1 potentiation. Boiling the PC12 extracts dramatically decreased the formation of all complexes on the probe, since, compared to half as much native extract (lane 2, Fig. 4E), 4.5 µg of boiled extract (lane 3, Fig. 4E) showed much weaker, but the same bands only in an overexposed autoradiograph (data not shown). A densitometric analysis of the results in Fig. 4E indicates that, in 4.5 µg of boiled extract, the C3A complex potentiated by Sp1 protein (0.125 unit) is only equal to 53.13% of the C3A in half as much native extract, while 0.0625 unit of Sp1 protein is able to intensify the C3A in 2.25 µg of nuclear extracts 8-fold (Fig. 4D). This suggests that the binding of Sp1 protein to the 112-bp probe required the presence of heat-sensitive factors in nuclear extracts.

To clarify the relationship of this Sp1-like protein with the C2 and C3 doublets which were both competed by Sp1 oligonucleotides, we precipitated the Sp1-like protein from nuclear extracts with Sp1 antibody before testing extracts in gel shift experiments. As seen in Fig. 4F (lanes 3 and 4), prior precipitation of nuclear extracts with anti-Sp1 antibody prevented formation of both C2 and C3 duplexes. This result is similar to the Sp1 oligonucleotide competition experiments. This may suggest that Sp1-like protein and other factors access the 112-bp DNA in a mutually dependent way, or Sp1-like protein forms a complex with the other factors and they were co-precipitated by antibody-protein A-Sepharose.

Sequence analysis of the 112-bp fragment indicates that there are several GC-rich motifs: a GSG sequence which is recognized by immediate early gene family members including NGFI-A (32, 33, 34) and two successive Sp1 sites. One Sp1 site has a GGCGGG core sequence and overlaps the 3` end of GSG motif, and the other Sp1 site has a GGAGGG sequence (Fig. 5). To examine whether these motifs are the targets recognized by proteins involved in the DNA interactions as seen in gel shift experiments, we labeled either the sense or the antisense strand of the 112-bp fragment and examined the sequence protected from digestion with DNase I by PC12 nuclear extracts. The cluster of GC-rich motifs spanning almost 28 bp, on the antisense strand, was protected (Fig. 6). This evidence supports the idea that Sp1 factors are involved in the interaction with the NMDAR1 promoter. Since Sp1 protein is reported to protect a short sequence less than 10 bp (35, 36) , other factors must join this interaction which is consistent with the multiple retarded bands appearing in gel shift results.

Figure 5: Sequence of DNA probe used in gel mobility shift. The putative motifs are indicated, and the distal transcription start site is represented with an arrow.


Figure 6: DNA footprinting analysis of the 112-bp NMDAR1 promoter fragment. The end of the antisense strand was filled in by Klenow enzyme with [alpha-P]dCTP. After incubating the fragment with 35 µg of PC12 extracts or bovine serum albumin as a control, increasing amounts of DNase I from 0.04 to 0.06 unit for PC12 extract and 0.1 to 0.4 for control were added to the reactions. The solid bar represents the PC12 extracts, and the open triangle represents the amount of DNase I. A G + A ladder of the probe was fractionated on the same gel and is shown in the left lane. The next three lanes are the bovine serum albumin control lanes.


DISCUSSION

NMDA receptors play many important roles in neurons of the central nervous system. Their neuronal location has been substantiated by ligand autoradiography (37, 38) and most recently confirmed by in situ detection of their subunit mRNAs and immunohistochemical detection of their proteins(5, 6, 7, 12, 13) . Cell type-specific and developmentally regulated expression of genes is controlled mainly at the transcriptional level(39, 40) . It was somewhat surprising therefore when our initial characterization of the NMDAR1 gene promoter showed that it had characteristics of housekeeping genes, that is, the proximal region was GC-rich and had no TATA or CAAT box motifs. This type of promoter is characteristic of many genes that are constitutively expressed in a nonspecific manner(41) . However, it has been shown more recently that several genes which lack TATA and CAAT boxes in their promoters have limited tissue distribution and their expression may be regulated(42, 43, 44, 45) . The NMDAR1 gene is in this latter category in that its expression is limited to neuronal cells, it is differentially regulated during development, and its expression is subject to pharmacological manipulation(14, 15, 19, 22) . In order to understand how the NMDAR1 gene promoter controls expression of this gene, we have previously cloned and characterized the 5` region of this gene(24) . In this report, we describe the generation and testing of reporter gene constructs which delineate the promoter region required for cell type-specific expression and attempt to define sequence motifs important in this expression.

It has recently been reported that PC12 cells contain messages for NMDAR1 and NMDAR2 family members(46, 55, 56, 57) . We have confirmed this result and have shown that PC12 cells utilize the same transcription start sites on the NMDAR1 gene as does rat brain. This suggests that PC12 cells have transcription machinery comparable to rat brain neurons, and, therefore, the regulation of the NMDAR1 gene may be similar.

It is interesting to note the differential utilization of the two major transcription start sites of the NMDAR1 gene. In PC12 cells, the distal one is primarily used while in rat brain the proximal one is favored. This may be explained by the fact that mRNA from PC12 cells is representative of a more discrete cell lineage with a characteristic transcription system while mRNA from rat brain represents the sum total of many different neuronal cells, each possibly containing different cohorts of transcriptional proteins. Recently, using both Northern blotting and in situ immunohistochemistry, several investigators have observed that NMDAR1 message is developmentally and postnatally up-regulated in most brain regions suggesting that differentiation of neurons is accompanied by expression of the NMDAR1 gene(14, 15) . We and others did not see any significant change in endogenous NMDAR1 message after treatment of PC12 cells with nerve growth factor for up to 9 days(46) . (^2)These observations do not exclude the possibility that other neurotrophic factors may play a role in the up-regulation of NMDAR1 gene message, an area we are currently exploring.

Using reporter gene technology, we showed that a basal promoter activity of the NMDAR1 gene is associated with a proximal fragment (from nucleotides -356 to -1 relative to the first nucleotide of the start codon) of the NMDAR1 gene. The observed activity in PC12 cells was slightly greater than with the SV40 promoter, while this activity in either HeLa or C6 glioma cells was at least 10-fold less than the SV40 promoter, suggesting a predominant expression in the PC12 cell line. In particular, a 112-bp 5` portion of the 356-bp fragment (-356/-245) seemed to contain sequences important for activity. When this 112 bp was included in the reporter construct, activity was 35 times greater than the next shorter deletion construct (pNRL356 versus pNRL239). Our knowledge of factors controlling neuronal-specific gene expression is still limited. Relatively few transcription factors have been identified which are either exclusively or preferentially expressed in neuronal cells to regulate neuronal genes (47, 48) or are expressed in non-neuronal cells to suppress neuronal gene expression(49) . In scanning the NMDAR1 promoter region for consensus motifs of transcription factors, we found the sequence TATTTATAGA (-804/-795) which is close to the consensus binding site for myocyte enhancer factor 2C (MEF 2C)(50) . This gene expresses specific splice variants in the central nervous system(51) .

In the 5` portion of the 356-bp fragment, we previously identified a GSG binding motif which is the consensus for a family of immediate early genes (24 and Fig. 5). Members of this family can be induced in neurons by neurotrophic factors like nerve growth factor or neurotransmitters like glutamate and may therefore participate in central nervous system gene regulation(32, 33, 34) . In addition, there are two Sp1 sites, the 5` one overlapping the 3` end of the GSG motif and the 3` one spanning -288/-283 with the sequence GGGAGG. The latter Sp1 site has been shown to be a low affinity site(52) . In many TATA box-less genes, Sp1 sites exist in the vicinity of the core promoter and function like general transcriptional cis element factors assisting in the formation of a preinitiation complex(39, 41) . In the present study, putative, functional Sp1 sites in the NMDAR1 gene promoter were confirmed by both gel shift and DNA footprinting experiments. However, Sp1 binding activity was detected in HeLa and C6 glioma cell extracts, but only PC12 cells had high levels of reporter gene activity. A similar situation occurs with the myeloid-specific CD11b promoter which contains an Sp1 and a myeloid-specific factor PU.1 (53) . Although an Sp1 site was recognized by HeLa cell extracts in vitro, in vivo footprinting showed that only myeloid cells bind Sp1 suggesting that Sp1 factors may interact with PU.1 to control cell-type expression. Another example is that of the neuronal/muscle-specific expression of rat Na/K-ATPase alpha2 subunit gene which is controlled by the interaction of one E-box binding factor and an Sp1 factor(52) .

In the NMDAR1 promoter, an Sp1-like protein may cooperate with GSG binding proteins to control gene expression. This is supported by the following evidence. The construct pNRL356 produced about 35-fold more activity in PC12 cells than the next shorter construct pNRL239 (Fig. 3). The additional 112 bp of sequence (-356/-245) in pNRL356 contains a GSG and two Sp1 sites which are protected from DNase digestion by nuclear extracts (Fig. 6). Gel mobility shift experiments with the labeled 112-bp fragment revealed four complexes, C2A + B and C3A + B, which were specifically competed by Sp1 consensus oligonucleotides and were abolished by prior immunoprecipitation of nuclear extracts with Sp1 antibody. One of these complexes (C3A) could be supershifted by Sp1 antibody (Fig. 4, B and C). An explanation for this may rest on protein-protein interactions in complex formation and the time of antibody addition in each experiment. Prior removal of Sp1-like proteins by immunoprecipitation of nuclear extracts before initiation of complex formation may prevent formation of these four complexes. However, an Sp1-like protein may be accessible to antibody only in the C3A complex and either masked by other proteins or in an altered conformation in the remaining complexes. In the latter gel mobility shift assays, the Sp1 antibody is added after initiation of complex formation, and, therefore, potential interaction of transcription factors with each other and DNA has already occurred. Interestingly, purified Sp1 protein did not form any complex with this fragment but did so only in the presence of PC12 nuclear extract (Fig. 4D). Increasing amounts of purified Sp1 protein potentiated the formation of the same C3A complex which is supershifted by Sp1 antibody. The C3B complex also may increase slightly in these experiments. However, this increase may be due to shadowing from the more predominant C3A band or aberrant retardation of C3A complex in the C3B location. These results suggest that Sp1 binding is crucial for the formation of C2 and C3 complexes, and Sp1 protein may require the presence or binding of other transcription factors before it can interact with the promoter. We are presently investigating the protein composition of the other complexes. Pecorino et al.(54) observed that a neuronal GC box binding factor from murine brain enhances the expression of plasminogen activator in vitro. This activity shares the same recognition sites as Sp1 in the proximal promoter but cannot be retarded by Sp1 antibody in gel shift experiments. Thus, Sp1-like factors or GC box binding factors may have a role in neuronal-specific gene expression. We cannot rule out the possibility that neuronal-specific factors may recognize general transcription factors like Sp1 and control expression indirectly.

Using DNA footprinting, we confirmed that in the NMDAR1 basal promoter a previously identified sequence, CGCCCCCGC, was bound by nuclear proteins (24 and Fig. 4A). This sequence matches perfectly the consensus of GSG or Egr motifs which are recognized by most members in a zinc finger protein family including NGFI-A (also named Egr-1, krox 24, Zif/268, TIS 8), NGFI-C, krox-20/Egr-2, and ERG-3(32, 33, 34) . The variations in reporter activity caused by additional sequences 5` of nucleotide -356 suggest the existence of some other regulatory elements. For example, near the 5` end of pNRL919, which has maximal reporter activity, is a MEF2C site (-804/-795). Originally described by Leifer et al.(51) , MEF2C is a muscle-specific transcription factor and is highly expressed during development. However, it is also expressed in the central nervous system.

The characteristics of the promoter we have described for the NMDAR1 gene may be important in conferring a more general expression throughout the brain albeit in a neuronal-specific pattern. The possibility of a requirement for several transcription factors (Sp1-like and neuronal-specific?) interacting to control widespread neuronal expression of NMDAR1 gene is an attractive hypothesis which will require more testing.

FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence and reprint requests should be addressed: Gerontology Research Center, NIA, National Institutes of Health, 4940 Eastern Ave., Baltimore, MD 21224.

(^1)
The abbreviations used are: NMDAR1, N-methyl-D-aspartate receptor 1 subunit; bp, base pair(s); kb, kilobase(s).

(^2)
G. Bai and J. W. Kusiak, unpublished data.

ACKNOWLEDGEMENTS

We thank the Aluminum Association for support during the course of these studies and Drs. John A. Izzo, Walter Horton, and Nikki Holbrook for helpful discussions.

REFERENCES

  1. Nicoll, R. A., Kauer, J. A., and Malenka, R. C. (1988) Neuron 1, 97-103 [CrossRef][Medline] [Order article via Infotrieve]
  2. Collingridge, G. L., and Singer, W. (1990) Trends Pharmacol. Sci. 11, 290-296 [CrossRef][Medline] [Order article via Infotrieve]
  3. Meldrum, B., and Garthwaite, J. (1990) Trends Pharmacol. Sci. 11, 379-387 [CrossRef][Medline] [Order article via Infotrieve]
  4. Choi, D. W. (1988) Neuron 1, 623-634 [CrossRef][Medline] [Order article via Infotrieve]
  5. Monyer, H., Sprengel, R., Schoepfer, R., Herb, A., Higuchi, M., Lomeli, H., Burnashev, N., Sakmann, B., and Seeburg, P. H. (1992) Science 256, 1217-1221 [Abstract/Free Full Text]
  6. Moriyoshi, K., Masu, M., Ishii, T., Shigemoto, R., Mizuno, N., and Nakanishi, S. (1991) Nature 354, 31-37 [CrossRef][Medline] [Order article via Infotrieve]
  7. Kutsuwada, T., Kashiwabuchi, N., Mori, H., Sakimura, K., Kushiya, E., Araki, K., Meguro, H., Masaki, H., Kumanishi, T., Arakawa, M., and Mishina, M. (1992) Nature 358, 36-41 [CrossRef][Medline] [Order article via Infotrieve]
  8. Hollmann, M., Boulter, J., Maron, C., Beasley, L., Sullivan, J., Pecht, G., and Heinemann, S. (1993) Neuron 10, 943-954 [CrossRef][Medline] [Order article via Infotrieve]
  9. Durand, G. M., Gregor, P., Zheng, X., Bennett, M. V., Uhl, G. R., and Zukin, R. S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9359-9363 [Abstract/Free Full Text]
  10. Sugihara, H., Moriyoshi, K., Ishii, T., Masu, M., and Nakanishi, S. (1992) Biochem. Biophys. Res. Commun. 185, 826-832 [CrossRef][Medline] [Order article via Infotrieve]
  11. Ishii, T., Moriyoshi, K., Sugihara, H., Sakurada, K., Kadotani, H., Yokoi, M., Akazawa, C., Shigemoto, R., Mizuno, N., Masu, M., and Nakanishi, S. (1993) J. Biol. Chem. 268, 2836-2843 [Abstract/Free Full Text]
  12. Brose, N., Gasic, G. P., Vetter, D. E., Sullivan, J. M., and Heinemann, S. F. (1993) J. Biol. Chem. 268, 22663-22671 [Abstract/Free Full Text]
  13. Petralia, R. S., Yokotani, N., and Wenthold, R. J. (1994) J. Neurosci. 14, 667-696 [Abstract]
  14. Franklin, S. O., Elliott, K., Zhu, Y. S., Wahlestedt, C., and Inturrisi, C. E. (1993) Brain Res. Mol. Brain Res. 19, 93-100 [Medline] [Order article via Infotrieve]
  15. Monyer, H., Burnashev, N., Laurie, D. J., Sakmann, B., and Seeburg, P. H. (1994) Neuron 12, 529-540 [CrossRef][Medline] [Order article via Infotrieve]
  16. Bayer, S. A. (1980) J. Comp. Neurol. 190, 87-114 [CrossRef][Medline] [Order article via Infotrieve]
  17. Ray, W. J., and Gottlieb, D. I. (1993) Biochem. Biophys. Res. Commun. 197, 1475-1482 [CrossRef][Medline] [Order article via Infotrieve]
  18. Wenk, G. L., Walker, L. C., Price, D. L., and Cork, L. C. (1991) Neurobiol. Aging 12, 93-8 [CrossRef][Medline] [Order article via Infotrieve]
  19. Lesch, K. P., Aulakh, C. S., Wolozin, B. L., Hill, J. L., and Murphy, D. L. (1992) Eur. J. Pharmacol. 227, 109-111 [CrossRef][Medline] [Order article via Infotrieve]
  20. Pratt, G. D., Kokaia, M., Bengzon, J., Kokaia, Z., Fritschy, J. M., Mohler, H., and Lindvall, O. (1993) Neuroscience 57, 307-318 [CrossRef][Medline] [Order article via Infotrieve]
  21. Gass, P., Muelhardt, C., Sommer, C., Becker, C. M., and Kiessling, M. (1993) J. Cereb. Blood Flow Metab. 13, 337-341 [Medline] [Order article via Infotrieve]
  22. Brann, D. W., Zamorano, P. L., Chorich, L. P., and Mahesh, V. B. (1993) Neuroendocrinology 58, 666-672 [Medline] [Order article via Infotrieve]
  23. Ishida, N., Matsui, M., Mitsui, Y., and Mishina, M. (1994) Neurosci. Lett. 166, 211-215 [CrossRef][Medline] [Order article via Infotrieve]
  24. Bai, G., and Kusiak, J. W. (1993) Biochim. Biophys. Acta 1152, 197-200 [Medline] [Order article via Infotrieve]
  25. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  27. Bai, G., and Weiss, B. (1991) J. Cell. Physiol. 149, 414-421 [CrossRef][Medline] [Order article via Infotrieve]
  28. Muller, S. R., Sullivan, P. D., Clegg, D. O., and Feinstein, S. C. (1990) DNA Cell Biol. 9, 221-229 [Medline] [Order article via Infotrieve]
  29. Bai, G., Stuebing, E. W., Parker, H. R., Harlow, P., and Nemer, M. (1993) Mol. Cell. Biol. 13, 993-1001 [Abstract/Free Full Text]
  30. Abmayr, S. M., and Workman, J. L. (1990) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds) pp. 12.1.1.-12.1.19, John Wiley & Sons, New York
  31. Dynan, W. S., and Tjian, R. (1983) Cell 35, 79-87 [CrossRef][Medline] [Order article via Infotrieve]
  32. Crosby, S. D., Puetz, J. J., Simburger, K. S., Fahrner, T. J., and Milbrandt, J. (1991) Mol. Cell. Biol. 11, 3835-3841 [Abstract/Free Full Text]
  33. Patwardhan, S., Gashler, A., Siegel, M. G., Chang, L. C., Joseph, L. J., Shows, T. B., Le, B. M., and Sukhatme, V. P. (1991) Oncogene 6, 917-928 [Medline] [Order article via Infotrieve]
  34. Day, M. L., Fahrner, T. J., Aykent, S., and Milbrandt, J. (1990) J. Biol. Chem. 265, 15253-15260 [Abstract/Free Full Text]
  35. Rhodes, D., and Klug, A. (1986) Cell 46, 123-132 [CrossRef][Medline] [Order article via Infotrieve]
  36. Briggs, M. R., Kadonaga, J. T., Bell, S. P., and Tjian, R. (1986) Science 234, 47-52 [Abstract/Free Full Text]
  37. Monaghan, D. T., Yao, D., and Cotman, C. W. (1985) Brain Res. 340, 378-383 [CrossRef][Medline] [Order article via Infotrieve]
  38. Subramaniam, S., and McGonigle, P. (1991) J. Pharmacol. Exp. Ther. 256, 811-819 [Abstract/Free Full Text]
  39. Mitchell, P. J., and Tjian, R. (1989) Science 245, 371-378 [Abstract/Free Full Text]
  40. Darnell, J. J. (1982) Nature 297, 365-371 [CrossRef][Medline] [Order article via Infotrieve]
  41. Dynan, W. S. (1986) Trends Genet. 2, 196-197 [CrossRef]
  42. Sommer, B., Poustka, A., Spurr, N. K., and Seeburg, P. H. (1990) DNA Cell Biol. 9, 561-568 [Medline] [Order article via Infotrieve]
  43. Matter, S. L., Hernandez, M. C., Roztocil, T., Ballivet, M., and Matter, J. M. (1992) EMBO J. 11, 4529-4538 [Medline] [Order article via Infotrieve]
  44. Minowa, T., Minowa, M. T., and Mouradian, M. M. (1992) Biochemistry 31, 8389-8396 [CrossRef][Medline] [Order article via Infotrieve]
  45. Gandelman, K. Y., Harmon, S., Todd, R. D., and O'Malley, K. L. (1991) J. Neurochem 56, 1024-1029 [CrossRef][Medline] [Order article via Infotrieve]
  46. Sucher, N. J., Brose, N., Deitcher, D. L., Awobuluyi, M., Gasic, G. P., Bading, H., Cepko, C. L., Greenberg, M. E., Jahn, R., Heinemann, S. F., and Lipton, S. A. (1993) J. Biol. Chem. 268, 22299-22304 [Abstract/Free Full Text]
  47. He, X., Treacy, M. N., Simmons, D. M., Ingraham, H. A., Swanson, L. W., and Rosenfeld, M. G. (1989) Nature 340, 35-41 [CrossRef][Medline] [Order article via Infotrieve]
  48. Motejlek, K., Hauselmann, R., Leitgeb, S., and Luscher, B. (1994) J. Biol. Chem. 269, 15265-15273 [Abstract/Free Full Text]
  49. Li, L., Suzuki, T., Mori, N., and Greengard, P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1460-1464 [Abstract/Free Full Text]
  50. Yu, Y. T., Breitbart, R. E., Smoot, L. B., Lee, Y., Mahdavi, V., and Nadal, G. B. (1992) Genes & Dev. 6, 1783-1798
  51. Leifer, D., Krainc, D., Yu, Y. T., McDermott, J., Breitbart, R. E., Heng, J., Neve, R. L., Kosofsky, B., Nadal, G. B., and Lipton, S. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1546-1550 [Abstract/Free Full Text]
  52. Ikeda, K., Nagano, K., and Kawakami, K. (1993) Eur. J. Biochem. 218, 195-204 [Medline] [Order article via Infotrieve]
  53. Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., and Tenen, D. G. (1993) J. Biol. Chem. 268, 8230-8239 [Abstract/Free Full Text]
  54. Pecorino, L. T., Darrow, A. L., and Strickland, S. (1991) Mol. Cell. Biol. 11, 3139-3147 [Abstract/Free Full Text]
  55. Awobuluyi, M., Chi, C. L., Leclerc, C. L., and Sucher, N. J. (1994) Soc. Neurosci. 20, 237
  56. Schatten, L. J., Zhong, J., and Molinoff, P. B. (1994) Soc. Neurosci. 20, 495
  57. Casado, M., López-Guajardo, A., Mellström, B., Naranjo, J. R., and Lerma, J. (1994) Soc. Neurosci. 20, 495
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Gascon, R. Deogracias, M. Sobrado, J. M. Roda, J. Renart, A. Rodriguez-Pena, and M. Diaz-Guerra
Transcription of the NR1 Subunit of the N-Methyl-D-aspartate Receptor Is Down-regulated by Excitotoxic Stimulation and Cerebral Ischemia
J. Biol. Chem., October 14, 2005; 280(41): 35018 - 35027.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Ma, L. Song, G. E. Radoi, and N. L. Harrison
Transcriptional Regulation of the Mouse Gene Encoding the {alpha}-4 Subunit of the GABAA Receptor
J. Biol. Chem., September 24, 2004; 279(39): 40451 - 40461.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Liu, P. W. Hoffman, W. Lu, and G. Bai
NF-{kappa}B Site Interacts with Sp Factors and Up-regulates the NR1 Promoter during Neuronal Differentiation
J. Biol. Chem., April 23, 2004; 279(17): 17449 - 17458.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Liu, Z. Zhuang, P. W. Hoffman, and G. Bai
Functional Analysis of the Rat N-Methyl-D-aspartate Receptor 2A Promoter: MULTIPLE TRANSCRIPTION START POINTS, POSITIVE REGULATION BY Sp FACTORS, AND TRANSLATIONAL REGULATION
J. Biol. Chem., July 11, 2003; 278(29): 26423 - 26434.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Mao, A. M. Moerman, and S. W. Barger
Neuronal kappa B-binding Factors Consist of Sp1-related Proteins. FUNCTIONAL IMPLICATIONS FOR AUTOREGULATION OF N-METHYL-D-ASPARTATE RECEPTOR-1 EXPRESSION
J. Biol. Chem., November 15, 2002; 277(47): 44911 - 44919.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Naraba, C. Yokoyama, N. Tago, M. Murakami, I. Kudo, M. Fueki, S. Oh-ishi, and T. Tanabe
Transcriptional Regulation of the Membrane-associated Prostaglandin E2 Synthase Gene. ESSENTIAL ROLE OF THE TRANSCRIPTION FACTOR Egr-1
J. Biol. Chem., August 2, 2002; 277(32): 28601 - 28608.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
O. Chiba-Falek and R. L. Nussbaum
Effect of allelic variation at the NACP-Rep1 repeat upstream of the {alpha}-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system
Hum. Mol. Genet., December 1, 2001; 10(26): 3101 - 3109.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
R. Dingledine, K. Borges, D. Bowie, and S. F. Traynelis
The Glutamate Receptor Ion Channels
Pharmacol. Rev., March 1, 1999; 51(1): 7 - 62.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Krainc, G. Bai, S.-i. Okamoto, M. Carles, J. W. Kusiak, R. N. Brent, and S. A. Lipton
Synergistic Activation of the N-Methyl-D-aspartate Receptor Subunit 1 Promoter by Myocyte Enhancer Factor 2C and Sp1
J. Biol. Chem., October 2, 1998; 273(40): 26218 - 26224.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
S. J. Myers, J. Peters, Y. Huang, M. B. Comer, F. Barthel, and R. Dingledine
Transcriptional Regulation of the GluR2 Gene: Neural-Specific Expression, Multiple Promoters, and Regulatory Elements
J. Neurosci., September 1, 1998; 18(17): 6723 - 6739.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Bai, D. D. Norton, M. S. Prenger, and J. W. Kusiak
Single-stranded DNA-binding Proteins and Neuron-restrictive Silencer Factor Participate in Cell-specific Transcriptional Control of the NMDAR1 Gene
J. Biol. Chem., January 9, 1998; 273(2): 1086 - 1091.