Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 14, Issue of April 7, 1995 pp. 7957-7962
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Comparison of the DNA Binding Specificity and Function of v-ErbA and Thyroid Hormone Receptor 1 (*)

(Received for publication, December 9, 1994; and in revised form, January 26, 1995)

José S. Subauste Ronald J. Koenig (§)

From the Division of Endocrinology and Metabolism, University of Michigan Medical Center, Ann Arbor, Michigan 48109-0678

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The oncoprotein v-ErbA is a mutated version of thyroid hormone receptor alpha1. Although the basis for the oncogenic action of v-ErbA is unknown, expression of this protein is known to inhibit thyroid hormone and retinoic acid induction of target genes. The DNA binding domain of v-ErbA differs from that of thyroid hormone receptor alpha1 in two amino acids felt to be crucial for determining the specificity of DNA binding. However, the DNA binding properties of v-ErbA have not been examined independent of a comparison of binding to already known thyroid hormone response elements. In the current studies a non-biased strategy was used to select from a pool of random DNA those sequences that bind v-ErbA with high affinity. The highest affinity binding sequence was identified as the decamer 5`-T(A/G)AGGTCACG, which is closely related to the optimal thyroid hormone receptor alpha1 binding sequence, TAAGGTCA. Transfection studies demonstrate that among equal thyroid hormone responsive elements, those that contain the optimal v-ErbA consensus will be repressed by v-ErbA in preference to those that do not. These studies indicate that v-ErbA and thyroid hormone receptor alpha1 regulate overlapping sets of response elements, and that all sequences that are highly responsive to thyroid hormone are not necessarily responsive to v-ErbA.


INTRODUCTION

The avian erythroblastosis virus causes acute erythroleukemia and fibrosarcomas in chickens. Its genome contains two oncogenes designated v-erbA and v-erbB(1, 2) . The v-erbB product is a truncated form of the epidermal growth factor receptor. The v-ErbA protein is a mutated form of the thyroid hormone receptor alpha1 (TRalpha1) (^1)and belongs to the large family of zinc finger transcription factors which includes the receptors for steroids, vitamin D, and retinoic acid (RAR)(2, 3) . v-ErbA has little to no transforming capacity of its own in vivo but cooperates with the transforming properties of a variety of tyrosine kinase-encoding oncogenes, including v-ErbB and sarcoma oncogenes, as well as with the Ha-Ras oncogene(4, 5) . v-ErbA blocks spontaneous cell differentiation and allows tolerance to a wide variation in the pH and ionic strength of culture media(4, 5) .

A comparison of the amino acid sequence of the chicken TRalpha1 and v-ErbA proteins reveals that v-ErbA has undergone 13 single amino acid mutations(6) . Two of these are located in the P and D boxes of the DNA binding domain, regions that are crucial for determining the DNA sequence specificity of protein binding(6, 7) . Additional mutations, including a 9-amino acid deletion, are found in the carboxyl-terminal domain. As a consequence of these mutations, v-ErbA expressed in mammalian cells is unable to bind thyroid hormone (T(3))(6, 8) . In mammalian and avian cells v-ErbA acts as a constitutive dominant repressor of transcription regulated by TR and RAR, suggesting that these activities may be central to its oncogenic activity(9, 10, 11, 12) . However, the actual mechanisms underlying v-ErbA's oncogenic action are unknown, as are the key target genes for v-ErbA induced oncogenesis.

There is evidence to suggest that the DNA recognition sequences of v-ErbA and TRalpha1 are related although not necessarily identical(9, 10) . Therefore the goal of the present work was to identify the optimal DNA sequence for v-ErbA binding and to study its function as a v-ErbA response element. A non-biased approach was taken similar to that employed by Blackwell et al.(13) , to study the DNA binding of c-Myc. By using random DNA pool selection, competition DNA binding assays, DNA footprinting, mutational analysis, and transient transfections, we were able to identify the optimal v-ErbA binding site as the decamer 5`-T(A/G)AGGTCACG.


MATERIALS AND METHODS

Production and Purification of v-ErbA

The v-erbA cDNA was ligated in-frame into the Escherichia coli expression vector pMAL (New England Biolabs) to produce a fusion protein consisting of maltose binding protein (MBP) followed by the recognition sequence for the protease factor Xa, fused to v-ErbA. Expression and purification of recombinant v-ErbA were performed according to the vendor's protocol. Briefly, E. coli strain XL1 was transformed with the expression plasmid. Expression of the MBP-v-ErbA fusion protein was induced with isopropylthio-beta-D-galactoside, and the recombinant fusion protein was purified by amylose affinity chromatography. Purity was confirmed by SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie Blue staining, which revealed only a single band of 86 kDa, consistent with the expected combined masses of MBP (42 kDa) plus v-ErbA (44 kDa) (data not shown). Incubation with factor Xa was then performed to release v-ErbA from MBP. The cleaved MBP was not removed, since control studies indicated it does not bind DNA. The final products were shown by SDS-PAGE to be of the appropriate size.

Random DNA Pool Construction

Oligonucleotide primers A (5`-TCCGAATTCCTACAG) and B (5`-AGACGGATCCATTGCA) were synthesized. A pool of oligonucleotides of 49 nucleotides in length was synthesized containing the primer A sequence at the 5` end, an internal random sequence of 18 nucleotides (for each nucleotide addition the oligonucleotide synthesizer was programmed to add equal amounts of all 4 bases simultaneously), and the reverse complement of primer B at the 3` end. This internally random sequence oligonucleotide pool was converted to double stranded DNA by annealing with primer B and filling-in with a Klenow reaction. The double stranded pool was purified by PAGE.

Electrophoretic Mobility Shift Assays (EMSA)

Protein-DNA binding reactions were performed in 35 µl of 20 mM HEPES, pH 7.8, 20% glycerol, 1.4 µg of poly(dIbulletdC), 1 mM dithiothreitol, 50 mM KCl (in the later steps of the selection process, up to 400 mM KCl was employed), 0.1% Nonidet P-40, P-labeled DNA, and E. coli expressed v-ErbA. The amounts of v-ErbA and P-labeled DNA are specified in subsequent sections. Reactions were incubated at room temperature for 45 min prior to electrophoresis. Electrophoresis was carried out on 0.25 times TBE (22 mM Tris base, 22 mM boric acid, 0.5 mM EDTA), 6% polyacrylamide gels (29:1, acrylamide:bisacrylamide) at room temperature. Wet gels were exposed to film for 24 h at 4 °C during the selection process. For all other EMSAs, gels were fixed in 30% methanol, 10% acetic acid; dried and exposed to film with an intensifying screen for 12-36 h at -70 °C.

Selection Process

The random pool of double stranded DNA was end-labeled with [-P]ATP by T4 polynucleotide kinase. An EMSA was performed with 40,000 cpm of P-labeled random DNA pool plus 40 ng of non-radiolabeled random DNA pool and 5 µg of v-ErbA. In the initial round of selection we expected the DNA-v-ErbA complex to be undectectable. Therefore we constructed a 52-bp fragment containing the hexamer AGGTCA as a marker. The location of the marker DNA-v-ErbA complex was used as a reference to identify the portion of the gel to excise in the random DNA pool-v-ErbA lane. The DNA was eluted into 0.1% SDS, 0.5 M NH(4)OAc, 1 mM EDTA, ethanol precipitated, and amplified by the polymerase chain reaction using primers A and B. Cycling conditions included 1 min each of denaturation at 94 °C, annealing at 56 °C, and extension at 72 °C for 30 cycles. The products were purified by PAGE and the selection process was repeated. For subsequent selections 40,000 cpm of P-labeled DNA pool without non-radiolabeled DNA were used in the protein-DNA incubations.

Eight rounds of selection were performed in total. In the third EMSA a v-ErbA-P-labeled DNA complex could be visualized. In the first 2 rounds, the protein-DNA incubations used 50 mM KCl, and in the first 6 rounds 5 µg of v-ErbA was employed. To select for higher affinity binding sites, rounds 3-5 and 6-8 were performed with 150 and 400 mM KCl, respectively, and the amount of v-ErbA was reduced to 500 ng for rounds 7 and 8. The selected v-ErbA-binding DNA pool was ligated into the BamHI site of the plasmid vector pUTKAT3(14) . Individual bacterial clones were isolated and used to generate plasmid DNA. The sequences of all clones were determined by the dideoxynucleotide method using vector primers. Polymerase chain reaction with primers A and B was used to amplify the contained 49-bp sequences, which were purified by PAGE and used in the studies described below.

Competition Assays

Five clones were randomly chosen, end-labeled with P and used in an EMSA to test for v-ErbA monomer binding. The clone showing the strongest protein-DNA complex (clone 5) was chosen as the standard for further studies. The sequence of the random 18-mer within clone 5 is CCCAGTCTAAGGTCACGG. Next the affinity of v-ErbA for all clones was assessed with a competition EMSA. To accomplish this, 20,000 cpm of P-labeled clone 5 DNA was incubated with 50 ng of v-ErbA plus graded doses of non-radiolabeled DNA from each clone. The amount of this competitor DNA required to reduce the intensity of the standard P-labeled clone 5 DNA-v-ErbA complex by 50% (C, measured by densitometry of autoradiograms) was taken as a measure of relative affinity. Competition assays were performed at least twice for all clones.

DNA Footprinting Analysis

Footprinting was performed with v-ErbA on clone 5 using methylation interference to identify critical guanine residues and uracil interference to identify critical thymine residues. Labeling of the DNA and footprinting protocols were as described previously(15, 16) .

Mutational Analysis

The consensus sequence of the highest affinity clones was subjected to mutagenesis. A series of mutant oligonucleotides was made changing 1-2 bp at a time scanning across the consensus sequence. These were used in a C EMSA analysis with clone 5 as a probe. The data were used in conjuction with the footprinting data to assess which bases are most important for protein-DNA binding.

Transient Transfections

JEG-3 cells were grown in 90% Eagle's minimum essential medium plus 10% fetal bovine serum and were transfected using standard calcium phosphate precipitation(17) . TRalpha1 and v-ErbA were expressed from the vectors pCDM (17) and pRSV(18) , respectively. Transfections included 100 ng of pCDMTRalpha1, 3 µg of pRSV-v-erbA (or vector) plus an additional 3 µg of pCDM as ``filler'' plasmid. Potential v-ErbA response elements were ligated into pUTKAT3 at a BamHI site 5` to the basal herpes simplex virus thymidine kinase promoter driving expression of chloramphenicol acetyltransferase (CAT). The top strand sequences of the putative v-ErbA response elements are as follows (top strands excluding BamHI compatible overhangs): RT3, TAAGGTCACGTAAGGTCAC; and 6DR, AGCAGGTCATAGCAGGTCAG. Reporter plasmids were transfected at a dose of 4 µg/60-mm Petri dish.

Co-transfections included 1 µg of a human growth hormone (GH) expressing vector (pTKGH) per 60-mm Petri dish to control for transfection efficiency. Cells were transfected in the presence of 10% charcoal stripped fetal bovine serum and 100 nM dexamethasone. Cells were cultured ± 10 nM T(3) for 2 days prior to harvest. CAT and hGH assays were performed as described previously(17) . v-ErbA suppression of CAT reporter gene expression was calculated as CAT/hGH for cells cultured with v-ErbA divided by CAT/hGH for cells cultured without v-ErbA in either the presence or absence of T(3). Results are presented as the mean ± S.E. for four independent transfections per assay condition.


RESULTS

Selection of High Affinity v-ErbA Monomer-binding DNA Pool

The random DNA selection strategy lead to the isolation of a DNA pool that bound v-ErbA with high affinity (Fig. 1). This v-ErbA monomer-binding DNA pool was subcloned and 17 different clones were analyzed. Ten of these clones contained the 9-bp sequence T(A/G)AGGTCAC ( Table 1and Table 2). Also a guanine at position 10 was found in 5 of these 10 clones. Those clones with the perfect decamer sequence had the highest affinities with C values of 0.8 ± 0.1 ng. Clones containing the 9-bp consensus but without a guanine at position 10 showed modestly inferior binding with C values of 1.3 ± 0.17 ng. All other clones had substantially lower affinities, with C values ranging from 1.8 to greater than 4 ng. Neither the position nor orientation of the decamer within the 18-bp random sequences was conserved, nor was there conservation of sequence outside the decamer.


Figure 1: EMSA selection of a DNA pool that binds v-ErbA monomers. DNA pools were end-labeled with [-P]ATP, incubated with recombinant v-ErbA or buffer, and subjected to PAGE. The v-ErbA-DNA complex is invisible following incubation with the random pool DNA (lane 2), but is clearly seen following 6 rounds of selection (lanes 3 and 4, indicated by the arrow). v-ErbA-DNA binding was performed in the presence of 50 mM KCl except in lane 4, where 400 mM was used to select for higher affinity protein-DNA interactions.







A faint slower migrating complex also was seen in the EMSAs ( Fig. 2and Fig. 3). The exact nature of this complex is not known. The band was supershifted by a specific v-ErbA antibody (gift of M. Privalsky; data not shown), indicating that it contains v-ErbA. The band was not affected by an anti-MBP antibody and did not co-migrate with an MBP-v-ErbA fusion protein-DNA complex, indicating that the band does not contain MBP or MBP-v-ErbA fusion protein. Footprinting studies were not possible due to the faint nature of the protein-DNA complex. This faint band was not present when the probe size was decreased to 20 bp. Overall the data suggest the faint band may be a v-ErbA homodimer that requires weak and perhaps relatively nonspecific interactions with other sequences in the 49-bp probe.


Figure 2: Affinity of v-ErbA for individual clones analyzed by competition EMSA. P-Labeled clone 5 was incubated with 50 ng of recombinant v-ErbA plus various amounts of non-radiolabeled competitor DNAs, and protein-DNA complexes were analyzed by EMSA. The v-ErbA-DNA monomer complexes are indicated by the arrow. The dose of competitor DNA that competes 50% of the v-ErbA-P-labeled clone 5 complex (C) was determined by densitometry and used as a measure of relative affinity. A competition assay using both a high affinity clone (clone 5; C of 0.7 ng) and a low affinity clone (clone 35; C of 3.4 ng) is shown. A faint slower migrating complex (indicated by the asterisk) was seen in these EMSA studies, and may represent a v-ErbA homodimer interacting weakly with other sequences in the 49-bp probe.




Figure 3: Effect of mutations in the sequence TGAGGTCACG on the binding of v-ErbA analyzed by competition EMSA. P-Labeled clone 5 was incubated with 50 ng of recombinant v-ErbA plus the indicated amounts of non-radiolabeled competitor DNAs. Competitors were synthetic 20-bp oligonucleotides; the top strand sequences are shown, except that all also contain GATCT at the 5` end and CGATC at the 3` end. The first competitor contains the optimal decamer TGAGGTCACG, and it shows 50% competition at 0.1 ng (A). All other competitors contain mutations, shown with lower case letters in the sequence (B-D). Mutant competitors are weaker than the consensus, thus confirming assignment of the optimal sequence. The asterisk denotes a faint slower migrating complex as described in Fig. 2.



Mutational Analysis

To confirm that the nucleotides immediately 5` and 3` to the idealized AGGTCA hexamer are important in v-ErbA binding, a series of mutant oligonucleotides was synthesized and their affinities were tested by EMSA competition (Fig. 3). The oligonucleotide containing the optimal decamer sequence TGAGGTCACG had a C of 0.1 ng. Mutation of the first, second, or fourth plus fifth base pairs decreased the affinity of v-ErbA binding significantly, resulting in C values of 0.45, 0.9, and >16 ng, respectively. Furthermore, mutating the dinucleotide at positions 9 and 10 from CG to AT also decreased the affinity, resulting in a C of 0.35 ng. In contrast, changing the second nucleotide from guanine to adenine did not affect the affinity, confirming that either purine is optimal at that position.

In the case of TRalpha1, mutating the two nucleotides immediately 5` to the hexamer AGGTCA from TA to GC decreased the affinity of the site for TRalpha1 5-fold(15) . However, mutations of the two nucleotides immediately 3` of the AGGTCA did not affect the affinity for TRalpha1 (data not shown).

DNA Footprinting

Footprinting was performed using clone 5 containing the conserved sequence TAAGGTCACG. Methylation interference was employed to identify critical guanine residues and uracil interference was used to identify critical thymine residues. As shown in Fig. 4, when the guanine at position 4, 5, 7, or 9 from either strand in the decamer sequence was methylated, v-ErbA binding was impaired. In a similar way, loss of the thymine 5-methyl group by changing the bottom strand thymine to uracil at position 8 within the decamer interfered with v-ErbA binding. No evidence of methylation sensitivity was noted outside the conserved decamer.


Figure 4: Combined guanine methylation interference and uracil interference footprinting of v-ErbA monomer binding to clone 5. A, the DNA strand of clone 5 containing the sequence TAAGGTCACG was arbritrarily designated the top strand. F and F represent the free DNAs cleaved either at guanines alone or guanines plus uracils, respectively. B represents v-ErbA-bound DNA cleaved at guanines plus uracils. Footprinted bases are indicated by closed circles. B, the DNA sequence of clone 5 is indicated, with footprinted bases designated by closed circles.



Transient Transfection Studies

The natural ligand for v-ErbA has not been identified (or does not exist) and this oncoprotein behaves as a transcriptional repressor in mammalian cells. Therefore, to test the function of potential v-ErbA response elements we examined their ability to direct v-ErbA repression of T(3)-dependent CAT expression mediated by TRalpha1. In particular we were interested in determining whether the decamer TAAGGTCACG is a stronger v-ErbA response element than the idealized hexamer AGGTCA. Since it had previously been shown that the optimal spacing for T(3) response elements (TREs) is a direct repeat with a 4-bp spacer (DR+4) (19, 20) , we constructed oligonucleotides that contained a DR+4 of AGGTCA (6DR) or of TAAGGTCACG (RT3) (in the latter case the last 2 nucleotides, CG, of the 5` half-site and the first 2 nucleotides, TA, of the 3` half-site function as the 4-bp spacer, since the sequence is a decamer rather than an hexamer). These oligonucleotides were ligated into pUTKAT3 and tested for T(3) induction. (Cotransfection with TRalpha1 was required to generate a T(3) response, consistent with prior studies and the known very low level of endogenous TRs in JEG-3 cells(21) ). As shown in Fig. 5, these two sequences are similarly strong TREs. However, as predicted by the DNA binding data, v-ErbA was a much stronger repressor of T(3) induction from RT3 than from 6DR. Specifically, v-ErbA suppressed T(3) mediated CAT activity on RT3 to 58 ± 2% of that observed in the absence of v-ErbA, but was without effect on 6DR (95 ± 7% of that observed in the absence of v-ErbA; n = 4 for both). In addition, in the absence of T(3) v-ErbA suppressed base-line CAT activity a modest but reproducible 15% on RT3 but did not suppress CAT activity on 6DR. Taken together these data demonstrate that not only does v-ErbA bind to the sequence T(A/G)AGGTCACG with higher affinity than to AGGTCA, but also the decamer is more potent as a functional v-ErbA half-site.


Figure 5: A DR+4 of the decamer TAAGGTCACG is a more potent v-ErbA response element than a DR+4 of the idealized hexamer AGGTCA in a transient transfection assay. JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of either a DR+4 of TAAGGTCACG (RT3) or a DR+4 of AGGTCA (6DR), along with the internal control plasmid pTKGH. All cells also received the expression vector for TRalpha1 ± v-ErbA (or empty vector). Cells were cultured for 2 days in the presence or absence of 10 nM T(3) and then cell lysates were analyzed for CAT activity and medium for hGH. v-ErbA suppression is defined as CAT/hGH for cells cultured with v-ErbA divided by CAT/hGH for cells cultured without v-ErbA.



v-ErbA also caused 60% suppression of T(3)-mediated CAT activity when a single copy of the optimal decamer was used as a monomer T(3) response element (data not shown). However, the hexamer AGGTCA used as a single site is not T(3) responsive (15) , and therefore cannot be tested for v-ErbA suppression.


DISCUSSION

v-ErbA potentiates the ability of a variety of transmembrane oncoproteins to transform erythroblasts and fibroblasts(4, 5) . In animal cells v-ErbA behaves as a repressor of transcriptional activation regulated by TR and RAR(9, 10, 22) . v-ErbA arrests the expression of at least three erythroid genes: carbonic anhydrase II, erythrocyte anion transporter (band 3), and -aminolevulinate synthase. However, the block in erythroid differentiation is not related to the suppression of any of these three genes(23) . Although evidence suggests that the oncogenic function of v-ErbA correlates with its ability to interfere with RAR action on a synthetic palindromic retinoic acid response element (RARE)(22, 24) , naturally occurring RAREs appear to be direct repeats, not palindromes(25, 26, 27, 28) . Despite major advances in our understanding of v-ErbA function, the genetic targets that account for its oncogenic action remain unknown. Thus, it is not clear if this oncogenic function is based on suppression of RAR or TR function, or if it is mediated through uncharacterized v-ErbA specific responsive genes.

v-ErbA is closely related to its cellular counterpart TRalpha1. In the DNA binding domain, these proteins differ in two amino acids located in the P and D boxes, regions known to be crucial for DNA specific recognition(6, 7) . The importance of the unique P box serine in v-ErbA has been addressed by mutating it to glycine as is found in TRalpha1 (S61G)(22, 29) . v-ErbA carrying this S61G mutation is unable to effect erythroid neoplasia. This result is consistent with the notion that this serine is crucial to the oncogenic function of v-ErbA, and suggests that this oncogenic function requires different DNA binding properties than are found in TRalpha1. However, interpretation of these data is somewhat complicated by the observation that a v-ErbA in which both the P and D box amino acids are mutated to those found in TRalpha1 (S61G, T78K) has partial restoration of its transforming properties relative to the S61G mutant(30) . Nevertheless, these studies suggest that v-ErbA and TRalpha1 have distinct DNA binding properties, and that these differences play a role in the function of v-ErbA. Thus, characterization of the optimal binding sites for v-ErbA should provide insight into the mechanism of its oncogenic action, and might suggest potential target genes for this oncoprotein. With this as a rationale, we utilized a non-biased random DNA selection strategy to identify the optimal DNA binding site for v-ErbA as the decamer T(A/G)AGGTCACG.

It is not completely understood which regions of the v-ErbA protein account for its specific high affinity interaction with this 10-bp DNA sequence. It has been suggested for several members of the erbA superfamily, including v-ErbA, that the P box is responsible for the recognition of the hexamer AGGTCA. There also is evidence that the A and T boxes located 3` to the zinc fingers are important in DNA-protein interaction(31, 32) . In particular, the A box is critical for recognition of the 5` end of the core DNA motif for the orphan receptor NGFI-B/nur 77(31) . By analogy the A box in v-ErbA could determine the specific recognition of the two nucleotides T(A/G) at the 5` end of the v-ErbA consensus site. It also has been shown that amino acid sequences outside the DNA binding domain of v-ErbA play a role in half-site specificity. Thus, the specific recognition for thymine at position 4 of the hexamer AGGTCA is determined by two amino-terminal amino acids, His-12 and Cys-32, interacting with Ser-61 in the P box of the DNA binding domain(33, 34) .

A comparison of the optimal DNA binding sites of v-ErbA and TRalpha1 (15) shows that they are highly related but not identical (T(A/G)AGGTCACG versus TAAGGTCA, respectively). In general v-ErbA appears to have a stricter specificity for binding at the 3` end of the recognition sequence, and TRalpha1 at the 5` end. This is true not only based upon the sequences selected from the random pools and their mutagenesis, but is supported by the footprinting data. Thus, v-ErbA but not TRalpha1 shows footprints on the bottom strand opposite the top strand eight and ninth nucleotides (AC) of the recognition sequence. In contrast, TRalpha1 (15) but not v-ErbA shows footprints of the top strand thymine at position 1 and the bottom strand thymine at position 2.

These results suggest that v-ErbA should bind to and repress certain TREs more than others. Previous data support this concept in that it was shown that TRalpha1 can bind to the hexamer AGGACA whereas v-ErbA cannot(33) . Consistent with this binding data, v-ErbA was not able to repress T(3) induction from a TRE comprised of two copies of the AGGACA hexamer(33) . However, TREs containing the sequence AGGACA are functionally weak relative to those containing AGGTCA. We find that TRalpha1 is 6 times more potent in activating CAT expression on a reporter containing a thymine than on a reporter containing an adenine at position 4 of the hexamer (TRE's, TAAGGTCACGTAAGGTCACG versus TAAGG ACACGTAAGGACACG; data not shown). Thus, TREs comprised of the hexamer AGGACA are weak T(3) inducers but even weaker at allowing v-ErbA suppression.

In contrast with the above, the random selection strategy allowed us to identify two sequences that are essentially equally strong as TREs, yet v-ErbA differs dramatically in its ability to inhibit the T(3) response on these two elements. Furthermore, this function of v-ErbA correlates directly with its relative binding affinities for these DNA sequences. This suggests that among equally T(3) responsive genes, some will be repressed by v-ErbA substantially more than others. Thus, one can use DNA sequence to begin to predict which genes are likely to be repressed by v-ErbA to the greatest degree. In addition, one may speculate that cells may contain an endogenous repressor with activity similar to v-ErbA, and that this, too, might regulate a specific subset of TREs based upon sequence. In this regard it is interesting to note that the orphan receptors COUP-TF (35) and ARP-1 (36) share identical P boxes with v-ErbA. Furthermore, COUP-TF has been shown to repress T(3) action(37) , although a detailed analysis of its DNA binding specificity and function has not been reported.

In conclusion, our results indicate that the optimal binding site for v-ErbA is the decamer T(A/G)AGGTCACG. This sequence binds v-ErbA with higher affinity and also gives stronger suppression of TRalpha1 mediated activation than does the hexamer AGGTCA. Despite the amino acid differences in the P and D boxes, the optimal binding sites for TRalpha1 and v-ErbA are very similar. The identification of new, naturally occurring v-ErbA binding sites will be an essential component of understanding its oncogenic action.


FOOTNOTES

*
This work was supported by National Institutes of Health Grant DK44155. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Div. of Endocrinology and Metabolism, University of Michigan Medical Center, 5560 MSRB-II, 1150 West Medical Center Dr., Ann Arbor, MI 48109-0678. Tel.: 313-763-3056; Fax: 313-936-6684.

(^1)
The abbreviations used are: TR, thyroid hormone receptor; CAT, chloramphenicol acetyltransferase; GH, growth hormone; EMSA, electrophoretic mobility shift assay; MBP, maltose binding protein; PAGE, polyacrylamide gel electrophoresis; RAR, retinoic acid receptor; RARE, retinoic acid response element; T(3), thyroid hormone (3,5,3`-triiodothyronine); bp, base pair(s).


ACKNOWLEDGEMENTS

We thank M. Privalsky for providing the v-ErbA antiserum and R. Evans for providing the v-erbA cDNA and the Rous sarcoma virus expression vector. We thank David Olson, Ron Katz, and Eric Beninghof for advice and technical assistance.


REFERENCES

  1. Graf, T., and Beug, H. (1983) Cell 34, 7-9 [CrossRef][Medline] [Order article via Infotrieve]
  2. Debuire, B., Henry, C., Benaissa, M., Biserte, G., Claverie, J. M., Saule, S., Martin, P., and Stehelin, D. (1984) Science 224, 1456-1459 [Abstract/Free Full Text]
  3. Evans, R. M. (1988) Science 240, 889-895 [Abstract/Free Full Text]
  4. Gandrillon, O., Jurdic, P., Benchaibi, M., Xiao, J., Ghysdael, J., and Samarut J. (1987) Cell 49, 687-697 [CrossRef][Medline] [Order article via Infotrieve]
  5. Kahn, P., Frykberg, L., Brady, C., Stanley, I., Beug, H., Vennstrom, B., and Graf, T. (1986) Cell 45, 349-356 [CrossRef][Medline] [Order article via Infotrieve]
  6. Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H., and Vennstrom, B. (1986) Nature 324, 635-640 [CrossRef][Medline] [Order article via Infotrieve]
  7. Umesono, K., and Evans, R. M. (1989) Cell 57, 1139-1146 [CrossRef][Medline] [Order article via Infotrieve]
  8. Munoz, A., Zenke, M., Gehring, U., Sap, J., Beug, H., and Vennstrom, B. (1988) EMBO J. 7, 155-159 [Medline] [Order article via Infotrieve]
  9. Damm, K., Thompson, C. C., and Evans, R. M. (1989) Nature 339, 593-597 [CrossRef][Medline] [Order article via Infotrieve]
  10. Sap, J., Munoz, A., Schmitt, J., Stunnenberg, H., and Vennstrom, B. (1989) Nature 340, 242-244 [CrossRef][Medline] [Order article via Infotrieve]
  11. Sharif, M., and Privalsky, M. L. (1991) Cell 66, 885-893 [CrossRef][Medline] [Order article via Infotrieve]
  12. Schroeder, C., Gibson, L., and Beug, H. (1992) Oncogene 7, 203-216 [Medline] [Order article via Infotrieve]
  13. Blackwell, T. K., Kretzner, L., Blackwood, E. M., Eisenman, R. N., and Weintraub, H. (1990) Science 250, 1149-1151 [Abstract/Free Full Text]
  14. Moore, D. D., and Prost, E. (1986) Gene (Amst.) 45, 107-111 [CrossRef][Medline] [Order article via Infotrieve]
  15. Katz, R. W., and Koenig, R. J. (1993) J. Biol. Chem. 268, 19392-19397 [Abstract/Free Full Text]
  16. Subauste, J. S., Katz, R. W., and Koenig, R. J. (1994) J. Biol. Chem. 269, 30232-30237 [Abstract/Free Full Text]
  17. Koenig, R. J., Warne, R. L., Brent, G. A., Harney, J. W., Larsen, P. R., and Moore, D. D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5031-5035 [Abstract/Free Full Text]
  18. Thompson, C. C., and Evans, R. M. (1989) Biochemistry 86, 3494-3498
  19. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  20. Naar, A. M., Boutin, J., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 65, 1267-1279 [CrossRef][Medline] [Order article via Infotrieve]
  21. Koenig, R. J., Lazar, M. A., Hodin, R. A., Brent, G. A., Larsen, P. R., Chin, W. W., and Moore, D. D. (1989) Nature 337, 659-661 [CrossRef][Medline] [Order article via Infotrieve]
  22. Desbois, C., Aubert, D., Legrand, C., Pain, B., and Samarut, J. (1991) Cell 67, 731-740 [CrossRef][Medline] [Order article via Infotrieve]
  23. Fuerstenberg, S., Leitner, I., Schroeder, C., Schwarz, H., and Vennström, B. (1992) EMBO J. 11, 3355-3365 [Medline] [Order article via Infotrieve]
  24. Sande, S., Sharif, M., Chen, H., and Privalsky, M. (1993) Virology 67, 1067-1074
  25. de Thé, H., del Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H., and Dejean, A. (1990) Nature 343, 177-180 [CrossRef][Medline] [Order article via Infotrieve]
  26. Vasios, G. W., Gold, J. D., Petkovich, M., Chambon, P., and Gudas, L. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 9099-9103 [Abstract/Free Full Text]
  27. Hoffmann, B., Lehmann, J. M., Zhang, Z., Hermann, T., Husmann, M., Graupner, G., and Pfahl, M. (1990) Mol. Endocrinol. 4, 1727-1736 [Abstract/Free Full Text]
  28. Harding, P. P., and Duester, G. (1992) J. Biol. Chem. 267, 14145-14150 [Abstract/Free Full Text]
  29. Bonde, B. G., Sharif, M., and Privalsky, M. L. (1991) J. Virol. 65, 2037-2046 [Abstract/Free Full Text]
  30. Hall, B. L., Bonde, B. G., Judelson, C., and Privalsky, M. L. (1992) Cell Growth & Differ. 3, 207-216
  31. Wilson, T. E., Paulsen, R. E., Padgett, K. A., and Milbrandt, J. (1992) Science 256, 107-110 [Abstract/Free Full Text]
  32. Zechel, C., Shen, X.-Q., Chambon, P., and Gronemeyer, H. (1994) EMBO J. 13, 1414-1424 [Medline] [Order article via Infotrieve]
  33. Chen, H., Smit-McBride, Z., Lewis, S., Sharif, M., and Privalsky, M. L. (1993) Mol. Cell. Biol. 13, 2366-2376 [Abstract/Free Full Text]
  34. Smit-McBride, Z., and Privalsky, M. L. (1994) Mol. Endocrinol. 8, 819-828 [Abstract/Free Full Text]
  35. Wang, L., Tsai, S. Y., Cook, R. G., Beattie, W. G., Tsai, M., and O'Malley, B. W. (1989) Nature 340, 163-166 [CrossRef][Medline] [Order article via Infotrieve]
  36. Ladias, J. A. A., and Karathanasis, S. K. (1991) Science 251, 561-565 [Abstract/Free Full Text]
  37. Cooney, A. J., Leng, X., Tsai, S. Y., O'Malley, B. W., and Tsai, M. (1993) J. Biol. Chem. 268, 4152-4160 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. J. DeLong, G. M. C. Bonamy, E. N. Fink, and L. A. Allison
Nuclear Export of the Oncoprotein v-ErbA Is Mediated by Acquisition of a Viral Nuclear Export Sequence
J. Biol. Chem., April 9, 2004; 279(15): 15356 - 15367.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. S. Subauste and R. J. Koenig
Characterization of the DNA-Binding and Dominant Negative Activity of v-erbA Homodimers
Mol. Endocrinol., September 1, 1998; 12(9): 1380 - 1392.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y.-Z. Yang, M. Burgos-Trinidad, Y. Wu, and R. J. Koenig
Thyroid Hormone Receptor Variant alpha 2. ROLE OF THE NINTH HEPTAD IN DNA BINDING, HETERODIMERIZATION WITH RETINOID X RECEPTORS, AND DOMINANT NEGATIVE ACTIVITY
J. Biol. Chem., November 8, 1996; 271(45): 28235 - 28242.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Judelson and M. L. Privalsky
DNA Recognition by Normal and Oncogenic Thyroid Hormone Receptors
J. Biol. Chem., May 3, 1996; 271(18): 10800 - 10805.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Shen and J. S. Subauste
Dimerization Interfaces of v-ErbA Homodimers and Heterodimers with Retinoid X Receptor alpha
J. Biol. Chem., December 22, 2000; 275(52): 41018 - 41027.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement