Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peyret, P.
Right arrow Articles by Alric, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peyret, P.
Right arrow Articles by Alric, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 14, Issue of April 7, 1995 pp. 8131-8137
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Structure, Genomic Organization, and Expression of the Arabidopsis thaliana Aconitase Gene
PLANT ACONITASE SHOW SIGNIFICANT HOMOLOGY WITH MAMMALIAN IRON-RESPONSIVE ELEMENT-BINDING PROTEIN (*)

(Received for publication, August 2, 1994; and in revised form, January 23, 1995)

Pierre Peyret (§) Pascual Perez (¶) Monique Alric (**)

From the Laboratoire Biocem Groupe Limagrain, 24, avenue des Landais, 63170 Aubière, France

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We report the purification of the unstable aconitase enzyme from melon seeds and the NH(2)-terminal amino acid sequence determination. Antibodies raised against this protein enabled the first isolation and characterization of cDNA encoding aconitase in plants. A full-length cDNA clone of 3210 base pairs was isolated from a library of cDNA clones derived from immature pods of Arabidopsis thaliana. The amino acid sequence deduced from the open reading frame includes the sequence obtained by direct sequencing of the NH(2) terminus of the purified enzyme. Genomic clones of the aconitase gene were isolated, and comparison of the cDNA and genomic sequences reveals that the coding sequence is divided among 20 exons. There are five putative sites for transcription initiation. The aconitase gene is constitutively expressed, but at a low level, during most developmental stages, with a dramatic increase during seed and pollen maturation and during germination. Surprisingly, plant aconitases have reasonably high homology to binding proteins for iron-responsive elements from mammalian species, opening the possibility that a similar type of translational regulation occurs in plants.


INTRODUCTION

Aconitase, also known as citrate (isocitrate) hydrolyase or aconitate hydratase (EC 4.2.1.3) is an enzyme containing an Fe-S cluster that catalyzes the reversible isomerization of citrate to isocitrate via cis-aconitate in the tricarboxylic acid cycle.

This enzyme is found in two cellular compartments(1) . The mitochondrial aconitase is implicated in the Krebs cycle. The physiological role of the cytoplasmic aconitase is not well characterized and seems to be different between plants and mammals.

In animals, study of the mitochondrial aconitase has increased our knowledge of the Fe-S cluster(2, 3, 4) . The Fe-S cluster is implicated in the dehydration and hydration steps during the enzymatic reaction. The labile iron (Fe(a)), spontaneously lost by oxidation during purification, is involved in the binding of the substrate(5, 6) . Recently, Rouault et al.(7) have found as much as 56% homology between porcine heart aconitase and iron-responsive element-binding protein (IRE-BP). (^1)The IRE-BP is an RNA-binding protein that plays a regulatory role in the iron metabolism. Kaptain et al.(8) have demonstrated that IRE-BP also has an aconitase activity. Thus in animals, cytoplasmic aconitase has a dual function: (i) an IRE-BP activity involved in the post-transcriptional regulation of iron metabolism(9, 10, 11) , and (ii) an aconitase activity whose physiological role is not well understood. These two activities are mutually exclusive. When the cluster is in the 4Fe-4S state, the protein has the aconitase activity but not the IRE-BP function. Alternatively, when the cluster is in the 3Fe-4S state, the cytoplasmic aconitase has the IRE-BP function but not the aconitase activity. However, the mechanism involved in the transition between the two forms is not understood although several models have been proposed (12, 13, 14, 15) .

Several studies have partially identified the amino acids of the IRE-BP and the nucleotides of the IRE (iron-responsive element, the stem-loop structure implicated in the binding of the IRE-BP) involved in the interaction(16, 17, 18) .

Aconitase has been less well studied in plants. Nevertheless, the mitochondrial aconitase has been purified from potatoes (19) and structural data obtained using the EXAFS (extended X ray absorption fine structure) technique have shown that the Fe-S cluster is different from the one observed in animals(20) .

In plants, cytoplasmic aconitase and mitochondrial aconitase show similar characteristics and cannot be differentiated(21) . On the other hand, in animals, the two aconitases are easily separated by ion exchange chromatography (22) and are encoded by two different genes (23, 24) . Recent results, showing that plant aconitase is inhibited by H(2)O(2)(19) and that no activity is detected in glyoxysomes(25) , have led the authors to propose that plant cytoplasmic aconitase participates in the glyoxylate cycle.

We report here the first isolation and characterization of a plant aconitase gene.


EXPERIMENTAL PROCEDURES

Enzyme Assay

Aconitase activity was assayed as described by Kennedy et al.(26) . One unit is given as 1 nmol of cis-aconitate formed in 1 min with = 3.6 cm mM.

Purification of Aconitase from Melon Seeds

Seeds from melon (Cucumis melo, cantaloupe charentais variety) were obtained from Tezier (Valence, France). All purification steps were carried out at 4 °C. A 100-g sample was disintegrated in a Waring blender (5 min, high speed) and the aconitase was extracted in a 20 mM imidazole HCl buffer, pH 7.5 (buffer I), with continuous and gentle stirring for 1 h. The insoluble material was removed by centrifugation (17,000 times g, 30 min), and the supernatant was filtered through a Miracloth filter (Behring Diagnostics). Column chromatography was performed using a Waters model 650E advanced protein purification system. The crude extract was loaded onto a Q-Sepharose fast flow column (2.6 times 7 cm, Pharmacia Biotech Inc.) at a flow rate of 60 ml/h and washed with buffer I until the absorbance at 280 nm was zero. The aconitase was eluted with buffer I containing 200 mM sodium acetate at a flow rate of 120 ml/h. Fractions containing aconitase activity were pooled and desalted on PD10 columns (Pharmacia) with buffer I. The active sample was applied to a Reactive Yellow 86 column (1.6 times 25 cm, Sigma; previously equilibrated with buffer I) at a flow rate of 30 ml/h and washed with buffer I until an absorbance of zero at 280 nm was reached. Aconitase was eluted with a linear gradient of sodium acetate (0-500 mM) in buffer I at a flow rate of 30 ml/h. Fractions containing aconitase activity were pooled, adjusted to 1.2 M with ammonium sulfate in buffer I, and applied to a Protein Pack HIC Phenyl 5PW column (Waters) previously equilibrated with the same buffer and washed until the absorbance at 280 nm was zero. Aconitase was eluted with a decreasing linear gradient of ammonium sulfate (1.2-0 M) at a flow rate of 60 ml/h. Fractions containing aconitase activity were pooled, desalted on PD10 columns (Pharmacia) with buffer I, loaded on a Mono Q HR 5/5 column (Pharmacia) previously equilibrated with buffer I, and washed until the absorbance at 280 nm was zero. Aconitase was eluted with a linear gradient of sodium acetate (0-300 mM) in buffer I at a flow rate of 30 ml/h.

Protein Characterization

Protein concentration of samples were routinely determined using the dye binding assay(27) . The Pharmacia Phast system was used for protein characterization, and SDS-PAGE was carried out on a discontinuous 10-15% polyacrylamide gel. Protein bands were stained using the silver staining kit from Pharmacia.

Immunological Techniques

Antiserum to melon seed aconitase was raised in by injecting a rabbit three times with 10 µg of the purified protein in Freund's adjuvant (complete adjuvant in the first immunization, incomplete adjuvant in the second and third immunizations 40 and 70 days after the first one).

NH(2)-terminal Amino Acid Sequencing

Purified aconitase enzyme was fractionated by electrophoresis on a 10% (w/v) SDS-polyacrylamide gel (28) and blotted onto a polyvinyl difluoride membrane (Bio-Rad). The membrane was stained with Coomassie Blue, and the region of the membrane containing the aconitase protein was excised and sequenced in an Applied Biosynthesis Sequencer using the reaction described by Hewick(29) .

Isolation and Sequencing of cDNAs

Polyclonal antibodies raised against the aconitase enzyme were used to screen a ZAP cDNA library from C. melo mature fruit (cantaloupe, charentais variety) using goat anti-rabbit alkaline phosphatase-conjugated second antibody (Sigma) following the method described by Sambrook et al.(30) . DNA probes were made from clones that were positive in the initial screening, and these were used to screen a ZAP cDNA library from Arabidopsis thaliana immature pods in order to recover full-length clones. Library screening was carried out using Hybond-N filters (Amersham Corp.). The heterologous hybridization was conducted according to Sambrook et al.(30) . Plaques that hybridized to the probes were purified and in vivo excision was used to obtain Bluescript plasmids (Stratagene). Both DNA strands of the plasmids were sequenced using the Sequenase version 2.0 sequencing kit (U. S. Biochemical Corp.). The sequences of the whole plasmid inserts was obtained using a combination of subclones, exonuclease deletion, and oligonucleotide primers. Sequence analysis was carried out using the Mac Vector computer program (Eastman Kodak).

Genomic Southern Blot Analysis

Genomic DNA was isolated from young A. thaliana leaves as described by Dellaporta et al.(31) . Approximately 5 µg of DNA was digested with the appropriate restriction enzyme, and the fragments were fractionated by electrophoresis on a 0.8% (w/v) agarose gel. These were blotted by capillary transfer onto Hybond-N membrane (Amersham) and hybridized with DNA probes labeled using the random priming method (32) . Hybridization was carried out following the method described by Sambrook et al.(30) .

Northern Blot Analysis

Total RNA was isolated from tissues of both A. thaliana and Brassica napus using Qiagen columns. Poly(A) RNA was isolated with the PolyATract® mRNA isolation system kit (Promega). Approximately 50 µg of total RNA or 5 µg of poly(A) RNA were fractionated by electrophoresis on a 1.2% (w/v) agarose gel containing 1.2 M formaldehyde and blotted by capillary transfer onto Hybond-N membrane (Amersham). DNA probes were labeled using the random priming method(32) . Filters were hybridized according to Sambrook et al.(30) .

Isolation and Sequencing of Genomic Clones

Two genomic libraries were screened to obtain clones encompassing the complete gene encoding the aconitase enzyme. These were an EMBL3 genomic library (Clontech) constructed with A. thaliana (Columbia ecotype) DNA partially digested with MboI restriction enzyme, and a Dash II genomic library constructed with A. thaliana (C24 ecotype) DNA partially digested with HindIII restriction enzyme. The A. thaliana cDNA clone encoding the aconitase enzyme was used as a probe. Phage plating and plaque lifts were carried out according to a protocol from Amersham. Phage purification was carried out with Qiagen columns. Prehybridization, hybridization, and washes were made as described for Southern blot analysis. DNA sequencing using a combination of subclones was carried out as described under ``Isolation and Sequencing of cDNA.''

Cloning and Sequencing of the 5` End of the mRNA

A modified protocol called SLIC (single strand ligation to single-stranded cDNA) of the RACE (rapid amplification of cDNA ends) technique initially described by Dumas et al.(33) was used to amplify the 5` end of aconitase mRNA with the 5`Amplifinder RACE kit (Clontech). Oligonucleotide 19, GCTGGAACTCAAGCTCCATGTTTGCCTGCA, positioned at +524 on cDNA sequence was used to synthesize the first strand cDNA. At the 3` end of the first strand cDNA, the oligonucleotide anchor of the kit was ligated with T4 RNA ligase. Two PCR reactions were necessary to amplify the 5` end of the cDNA. In the first PCR, oligonucleotide 16, CAAGCAAGATCAACAACAGCAGGAACACCA, positioned at +375 on the cDNA sequence, and the oligonucleotide complementary to the anchor oligonucleotide were used. The amplification reaction was precipitated with EtOH and resuspended in 10 µl of sterile H(2)O. Two µl of this solution was used as template for the second PCR reaction where oligonucleotide 14, CACAGTTACGTATGGCCGA, positioned at +230 on cDNA sequence, and the oligonucleotide complementary of the anchor oligonucleotide were used. The PCR conditions for both reactions were as follows: denaturation of DNA, 5 min at 94 °C, and then 35 cycles composed of a denaturation step (1 min at 94 °C), an annealing step (1 min at 50 °C), and a polymerization step (2 min at 72 °C); after the 35th cycle, an elongation step (7 min at 72 °C) was used. PCR products were cloned in pGEM-T vector (Promega). Potential clones of the 5` end of the mRNA were selected by digestion with BglII restriction enzyme (a BglII site was positioned at +48 on cDNA sequence). Thirty-seven selected clones were sequenced using oligonucleotide 12, CGATCCTGGGATCGTTCA, positioned at +175 in the cDNA sequence.

Transgenic Plants

A HindIII-BglII fragment of 1339 bp containing the putative promoter was cloned in the binary vector pBi 101-1 (34) at the restriction sites HindIII-BamHI to obtain pBios 170. This resulting binary vector carrying the beta-glucuronidase fusion was introduced in the Agrobacterium tumefaciens C 58`3 strain (35) by heat shock using the protocol described by Holsters et al.(36) . A. thaliana root explants were transformed with DNA and regenerated as described by Valvekens et al.(37) . Primary transformants were grown in a greenhouse (22 °C, 16-h photoperiod) on soil irrigated with mineral nutrients. The expression of the beta-glucuronidase gene was detected in different plant organs by histochemical test using the protocol described by Jefferson et al.(34) .


RESULTS

Purification, Identification, and NH(2)-terminal Sequence of Melon Seed Aconitase

Aconitase from melon seeds was purified by chromatographic method (see ``Experimental Procedures''). Two peaks of aconitase activity were eluted from HIC phenyl 5PW hydrophobic interaction columns at 0.7 and 0.9 M ammonium sulfate, respectively. These two aconitase proteins were then purified to homogeneity by anion exchange chromatography on a Mono-Q column at similar sodium acetate concentrations (approximately 220 mM). The proteins were analyzed by SDS-PAGE and visualized by silver staining at each purification step (Fig. 1). The results of a typical purification are summarized in Table 1. The apparent molecular weight of the two aconitase proteins determined by SDS-PAGE is close to 98,000 (Fig. 1, lanes7 and 8). In native conditions, their molecular masses are around 100 kDa, suggesting a monomeric structure (data not shown). The two forms both contain a prominent pI 5.2 species when analyzed by isoelectric focusing (data not shown). The two purified proteins have also identical NH(2)-terminal sequences: NH(2)-Ser-Ser-Met-Ala-Ala-Glu-Asn-Pro-Phe-Lys-Glu-Asn-Leu-Thr.


Figure 1: Purification of aconitase from melon seeds. Samples from the different steps of C. melo aconitase purification were separated by electrophoresis on a 10-15% gradient SDS-polyacrylamide gel and visualized by silver staining. Lane 1, molecular size markers (Bio-Rad); lane2, crude extract (0.5 µg); lane3, extract after ion-exchange chromatography using Q Fast Flow (0.5 µg); lane4, extract after affinity chromatography using Yellow 86 (0.5 µg); lanes 5 and 6, extract after hydrophobic interaction chromatography using Phenyl 5PW: fraction I (0.08 µg, lane5) and fraction II (0.08 µg, lane6); lanes7 and 8, extract after ion exchange chromatography using Mono Q: fraction I (0.06 µg, lane7) and fraction II (0.06 µg, lane8).





Isolation of cDNA Clones Encoding Aconitase Enzyme

Polyclonal antibodies were raised to the purified proteins as described under ``Experimental Procedures.'' Twenty-one clones were selected from a melon fruit ZAP cDNA library after screening 4 times 10^5 plaques with the polyclonal antibodies. The inserts in these clones ranged from 2.3 to 2.6 kb; they cross-hybridized and shared a common restriction pattern (data not shown). The sequence of the longest cDNA 5` end is 60% homologous to both human IRE-BP and Escherichia coli aconitase.

The cDNA clone was shown to be incomplete since the NH(2)-terminal sequence obtained by Edman degradation was not found in the predicted amino acid sequence from the cDNA. This result is not surprising since a 98-kDa protein is expected to be encoded by a cDNA almost 3 kb long. In order to obtain a full-length cDNA, the fruit melon cDNA library was screened twice with a 300-bp DraI fragment present only in the longest cDNA. Seven new clones were isolated, but they appeared to be identical to the longest clone previously isolated.

In order to obtain a complete plant cDNA encoding the aconitase enzyme, a cDNA library constructed from A. thaliana pod RNA was screened under heterologous conditions with a 2.2-kb EcoRI fragment from the longest melon cDNA. After hybridizing in 30% formamide at 42 °C followed by washing twice in 2 times SSC at 42 °C for 30 min, seven positive clones were isolated (three clones of 3.2 kb and four clones of 2.3 kb). No difference was observed between clones of the same size after restriction, hybridization, and partial sequencing. The longest cDNA clone of 3210 bp was completely sequenced. The NH(2)-terminal sequence obtained by Edman sequencing of the melon aconitase matched the amino acid sequence predicted by the A. thaliana cDNA sequenced, suggesting that the A. thaliana cDNA encodes the aconitase enzyme. Fig. 2shows the homology between the NH(2)-terminal amino acid sequence obtained from melon seed aconitase, potato mitochondrial aconitase, (^2)and the sequence deduced from the A. thaliana cDNA. The sequence of the cDNA contains an open reading frame that encodes 923 amino acid residues, with a predicted molecular mass of 98,490 Da and a pI value of 6.0. Three consensus polyadenylation sites AAUAAA (38) at nucleotides 2809, 2940, and 3026 are present in the 3`-untranslated region of 441 bp. No stop codon was found at the 5` end of the gene, and in order to define the complete transcribed sequence we have isolated the A. thaliana gene encoding the aconitase enzyme from a library of genomic fragments.


Figure 2: Homology alignment of the NH(2)-terminal sequence of aconitase from different plant species. The three-letter code for amino acids is used throughout. Residues common to the three plant species are boxed. Sequences shown are A. thaliana (protein sequence predicted from A. thaliana cDNA sequence), C. melo (protein sequence obtained from melon seed aconitase), and Solanum tuberosum (protein sequence obtained from potato mitochondrial aconitase).



Organization of A. thaliana Aconitase Gene

The A. thaliana cDNA was used as a probe to screen an A. thaliana genomic Dash library. Six clones were isolated after screening 2 times 10^5 plaques. All these clones appeared to be identical by restriction endonuclease mapping.

The mapping of these genomic clones by Southern blot analysis using the four EcoRI cDNA fragments (0.2, 0.8, 1.6, and 0.6 kb) showed the 3` end of the gene was absent as the 0.6-kb probe did not hybridize to the clones.

To obtain the missing 3` extremity of the aconitase gene, we have screened a new genomic library (EMBL3) using the 0.6-kb probe. One clone was isolated after screening 2 times 10^5 plaques. Restriction analysis of this clone and Southern blot mapping enabled the completion of the physical map of the aconitase gene of A. thaliana (Fig. 3). The genomic clones were sequenced (6760 bp). A comparison between the genomic and the cDNA sequences of the A. thaliana aconitase shows that this gene is divided into 20 exons (Fig. 3). Table 2indicates the exon and intron sizes and the intron-exon junction position. The exon-intron borders match the criteria for consensus sequences of splice junctions, the GT/AG rule(39) . A recent study shows that in plants there is no conserved sequence for branch point selection for lariat formation and that in dicotyledonous plants the introns are AT-rich(40) . The introns of the A. thaliana aconitase gene are in agreement with these observations. The three polyadenylation signals AATAAA observed after cDNA analysis are localized at positions 5068, 5199, and 5285, respectively.


Figure 3: Genomic organization of A. thaliana aconitase. A, partial restriction map of the genomic clones isolated by screening the Dash and the EMBL3 libraries with the full-length cDNA. B, BamHI; E, EcoRI; H, HindIII; Ps, PstI; Pv, PvuII; X, XbaI. B, diagram of the gene structure (exons are represented by filled boxes; introns are represented by opened boxes; 5`-noncoding region is represented by box with diagonal lines; 3`-noncoding region is represented by box with horizontal lines). C, partial restriction map of the predicted cDNA.





In order to assess the complexity of the gene encoding the aconitase enzyme in A. thaliana, Southern blot analysis was carried out on genomic DNA isolated from two ecotypes of A. thaliana (Columbia and C24) and digested with several restriction enzymes. Filters were hybridized with the three EcoRI cDNA fragments (0.8, 1.6, and 0.6 kb) as a probe (Fig. 4). The physical map obtained is identical to the one observed for the genomic clones, suggesting the presence of a unique gene in A. thaliana.


Figure 4: Southern blot analysis of A. thaliana genomic DNA for aconitase gene. Genomic DNA was isolated from two ecotypes C24 (C24) and Columbia (Col) of A. thaliana leaves and digested with the following restriction enzymes: PvuII (Pv), EcoRI (E), BamHI (B), HindIII (H), PstI (Ps), SspI (Ss), and XbaI (X). Five µg of digested DNA was fractionated on a 0.8% agarose gel and blotted onto Hybond-N membrane. The membrane was hybridized with EcoRI fragments of A. thaliana cDNA.



Mapping of the Transcription Start

Extended 5` cDNAs end were cloned by the RACE technique (see ``Experimental Procedures''). When the second PCR was performed using oligonucleotide 14, two bands of around 300 and 350 bp in length were observed on a 1.5% agarose gel stained with ethidium bromide (data not shown). After cloning these two DNA fragments in a pGEM-T vector, 37 clones were recovered and sequenced. For 31 sequenced clones, an extra G residue was observed at the 5` ends that is not present on the genomic sequence, implying that the extra G comes from the 5` cap. Hirzmann et al.(41) reported that a G can be reverse transcribed into a 3` terminal C residue, which will give rise to an uncoded G residue in a complementary strand sequence pattern. Furthermore, sequence ladders with an uncoded 5` terminal cap G residue give a direct proof of their complete messenger RNA molecule origin.

Among the 31 sequenced clones containing an uncoded 5` terminal cap G residue, 14 clones stopped at position +1, 7 at position -2, 4 at position -4, 5 at position -9, and one at position +9. So, the precise mapping of the transcription start site has revealed five putative sites with one preferentially used that we have positioned at +1. We have also observed five clones without the additional G residue (one clone at position +14, 3 clones at position +20, and 1 clone at position +29). These clones most probably arise from the premature stopping of the reverse transcriptase. Finally, another clone without the additional G residue positioned at -49 was obtained. This clone is not an amplified DNA genomic fragment since a longer size would be expected due to the introns. Thus, the possibility that a second promoter exists cannot yet be ruled out.

The promoter region shows a classical TATA box positioned at -32, which is in agreement with the position given by Joshi(42) , i.e. 32 ± 7 bp from the transcriptional start site. Moreover, multiple transcriptional start sites are often observed in housekeeping genes(43) .

The first ATG occurs at position +91 relative to the transcriptional start site. This ATG may be the initiation codon because the surrounding sequences resemble the consensus sequence TAACAATGGCT(38) . There is continuous open reading frame from the transcriptional start site to the first methionine. It may be possible that this sequence encodes a mitochondrial leader peptide. However, an aspartic residue is found at position 25 and a glutamic residue at position 14. Acidic residues are normally absent from the mitochondrial transit peptide (44) , but there is not a strict consensus sequence(45) .

Expression of the Aconitase Enzyme in Different Tissues

Total RNA was isolated from a range of different A. thaliana and B. napus tissues. Northern blot analysis was carried out with the EcoRI cDNA fragments as probes (Fig. 5). The aconitase gene is constitutively expressed with a strong expression in seedlings and flowers of A. thaliana. To examine more fully the expression of the aconitase gene in flowers, we have extracted RNA from pistils and anthers of B. napus; highest expression is found in the anthers (Fig. 5, lane10). A 1339-bp HindIII-BglII genomic fragment containing the putative TATA box was cloned into a beta-glucuronidase expression vector in order to study the potential promoter activity of the 5` flanking region. Results obtained on primary transformants are shown in Fig. 6. beta-Glucuronidase activity is observed in leaves and roots (data not shown). A strong activity is observed in anthers that is restricted to the pollen grains (Fig. 6, A and B). During seed maturation beta-glucuronidase activity is observed in the developing albumen and in embryonic tissues. In mature seeds the activity is high in cotyledons and in the axis and lower in the root (data not shown). Therefore, the 1339-bp HindIII-BglII promoter fragment mimics the expression of the aconitase gene observed by Northern blots.


Figure 5: Northern blot analysis of aconitase expression in A. thaliana and B. napus organs. Total RNA (50 µg/lane) from A. thaliana 6-day seedlings (lane1), leaf (lane2), stem (lane3), young flower before anthesis (lane4), mature flower (lane5), immature pod (lane6), mature seed (lane7), and from B. napus leaf (lane8), pistil (lane9), and anther (lane10) were electrophoresed in a denaturing 1.5% agarose-formaldehyde gel and blotted onto Hybond-N membrane. The membrane was hybridized with the aconitase cDNA clone.




Figure 6: beta-Glucuronidase expression in A. thaliana primary transformant organs. A 1339-bp 5`-HindIII/BglII promoter fragment of the A. thaliana aconitase gene was subcloned into a beta-glucuronidase expression vector. beta-Glucuronidase-expressing cells are indicated by their blue color. PanelA is a light microscopic view of a mature flower. PanelB shows a microscopic view of a mature anther.



Structural Relationship between IRE-BP and Aconitase in Different Species

The predicted protein sequences of plant aconitase (C. melo and A. thaliana) were compared with the protein sequences of mammalian, yeast, and E. coli aconitase extracted from GenBank using the PC Gene clustal program (IntelliGenetics). The 23 amino acid residues forming the active site (46, 47, 48, 49) are all conserved in A. thaliana aconitase. Table 3shows that plant aconitases are highly conserved with a similarity between C. melo and A. thaliana of 92%. Strikingly, plant aconitase is more related to IRE-BP, with a sequence conservation of more than 70%, than it is to mammalian mitochondrial aconitase with a similarity of 43%.




DISCUSSION

There are only two previous reports of purification of plant aconitase. The first characterization of plant aconitase, from potato mitochondria, was made by Verniquet et al.(19) . The second (50) revealed three aconitase isoforms isolated from etiolated pumpkin cotyledons. The subcellular distribution of these purified aconitase isoforms was not clearly determined. Brouquisse et al.(21) found no difference between cytosolic and mitochondrial aconitase in plants. On the other hand, in animals the mitochondrial and cytosolic aconitases have different isoelectric points and are encoded by two different genes(22, 23) . In yeast, the mitochondrial and the cytoplasmic aconitases are encoded by a single gene(51) . After disruption of the yeast mitochondrial aconitase gene, no aconitase activity is detected in crude extracts. A single gene encoding two proteins with different subcellular locations has been described for yeast fumarase(52) , for yeast invertase(53) , and for yeast histidine and valine tRNA(54, 55) .

In plants, more work must be done to demonstrate if mitochondrial and cytoplasmic aconitases are encoded by a single or two distinct genes. Such a situation where a single gene encodes two transcripts has been observed in plants for petunia chalcone isomerase (56) and for zeins in maize seeds(57) .

During this study, we have compared the molecular weight and the pI values of plant aconitase with aconitase of different species and noted that they share similar characteristics with the mammalian IRE-BP(58, 59) . Two peaks of aconitase activity were detected during the purification of aconitase from melon seeds, resembling the situation described by Neupert et al.(58) , who found that purified human placental IRE-BP had two major bands of 95 and 100 kDa. Purified cow liver IRE-BP is composed of one or two bands on SDS-PAGE; the number of bands is dependent on the reducing agent concentration(60) . The heterogeneity observed for human placenta IRE-BP is localized on a NH(2)-terminal fragment obtained by proteolysis but not necessarily in the first amino acid residues(59) . A similar situation may occur here for the two aconitase enzymes isolated from melon seeds. However, we cannot exclude other kinds of modifications like proteolysis, post-translational modification, or nonenzymatic deamidation.

The high degree of similarity observed between plant aconitase and IRE-BP is surprising. Until now IRE-BP activity has been detected in mammals, fishes, flies, and frogs but has not been reported in yeast, bacteria, and plants(61) . However, the IRE probes used in these gel retardation assays were from human ferritin messenger and from human transferrin receptor messenger. These two messengers are implicated in iron metabolism and are post-transcriptionally regulated by the IRE-BP (9, 10, 11) . In plant ferritin messengers, no IRE was found by homology with mammals IRE(62, 63, 64) . It is possible that plant aconitase is also implicated in a post-transcriptional regulation because it shares a high homology with mammalian IRE-BP. In order to show this, it is necessary to find out if IRE-like structures are present in plant messengers.

IRE-BPs are considered to be a new class of RNA-binding proteins because there is no significant homology between the IRE-BP and the RNA recognition motif identified in other RNA-binding proteins(65) . In the A. thaliana aconitase, we have observed a sequence (DLVIDYSVQV) similar to the one recently reported by Basilion et al.(16) (DLVIDH-IQV, corresponding to amino acids 121-130 in human IRE-BP). This sequence cross-links to the IRE. Nevertheless, it is necessary to identify other contact points between IRE and IRE-BP in order to understand the complete interaction.

We are interested in finding out if plant cytosolic aconitase is involved in a post-transcriptional regulation in an analogous fashion to the mammalian IRE-BP and if the plant mitochondrial and cytosolic aconitases are encoded by a single gene.


FOOTNOTES

*
This work was supported by grants from the Eureka European Program. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This article is dedicated to the memory of Dr. Jean-Louis Peyret, whose tragic death was a great loss to all of us.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) X82839[GenBank]-X82841[GenBank].

§
Allocataire of the Ministère de la Recherche et de l'Enseignement Supérieur (France). Present address: Laboratoire de Biologie comparée des protistes, Laboratoire de Protistologie molèculaire et cellulaire des Parasites opportunistes, CNRS 1944, Université Blaise Pascal, 63177 Aubière cedex, France.

To whom correspondence may be addressed. Tel.: 73-42-79-77; Fax: 73-27-57-36.

**
Present address: LTNA, Faculté de Médecine et de Pharmacie, 63001 Clermont-Ferrand, France. Tel.: 73-60-80-58; Fax: 73-27-56-24.

(^1)
The abbreviations used are: IRE-BP, iron-responsive element-binding protein; IRE, iron-responsive element; PAGE, polyacrylamide gel electrophoresis; RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; bp, base pair(s); kb, kilobase pair(s).

(^2)
R. Douce, personal communication.


ACKNOWLEDGEMENTS

The A. thaliana cDNA and genomic libraries were generously provided by Dr. Jérome Giraudat (INRA, Versailles, France) and Dr. Georges Picard (BIOMOVE, CNRS, Clermont-Ferrand, France), respectively. We are grateful to Professor Roland Douce (CENG, Grenoble, France) for helpful discussions, critical reading of the manuscript, and for communicating results obtained on potato aconitase prior to publication. We thank Catherine Gueguen for helping in the production of polyclonal antibodies, Gaëlle Baudot and Denise Garcia for helping in the A. thaliana aconitase gene expression studies, and Dr. Bernard Henrissat (CERMAV, CNRS, Grenoble, France) for analyzing the sequence homologies between the aconitase of different species. We acknowledge Dr. Marie Eliane Drake for suggestions to the manuscript. We thank Dr. Pete Isaac for his great help in reviewing the English version of this paper.


REFERENCES

  1. Pickworth Glusker, J. (1971) in The Enzymes (Boyer, P. D., ed) Vol. 5, pp. 413-439, Academic Press, Orlando, FL
  2. Beinert, H., and Kennedy, M. C. (1989) Eur. J. Biochem. 186, 5-15 [Medline] [Order article via Infotrieve]
  3. Ruzicka, F. J., and Beinert, H. (1978) J. Biol. Chem. 253, 2514-2517 [Abstract/Free Full Text]
  4. Kennedy, M. C., Rauner, R., and Gawron, O. (1972) Biochem. Biophys. Res. Commun. 47, 740-745 [Medline] [Order article via Infotrieve]
  5. Kennedy, M. C., Werst, M., Telser, J., Emptage, M. H., Beinert, H., and Hoffman, B. M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8854-8858 [Abstract/Free Full Text]
  6. Telser J., Emptage, M. H., Merkle, H., Kennedy, M. C., Beinert, H., and Hoffman, B. M. (1986) J. Biol. Chem. 261, 4840-4846 [Abstract/Free Full Text]
  7. Rouault, T. A., Stout, C. D., Kaptain, S., Harford, J. B., and Klausner, R. D. (1991) Cell 64, 881-883 [CrossRef][Medline] [Order article via Infotrieve]
  8. Kaptain, S., Downey, W. E., Tang, C., Philpott, C., Haile, D., Orloff, D. G., Harford, J. B., Rouault, T. A., and Klausner, R. D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10109-10113 [Abstract/Free Full Text]
  9. Aisen, P., (1980) Annu. Rev. Biochem. 49, 357-393 [CrossRef][Medline] [Order article via Infotrieve]
  10. Seligman, P. A., Klausner, R. D., and Huebers, H. A. (1987) in The Molecular Basis of Blood Diseases (Stamatoyannopoulos, G., Nienhuis, A. W., Leder, P., and Majerus, P. W., eds) pp. 219-244, W. B. Saunders Co., Philadelphia
  11. Klausner, R. D., and Rouault, T. A. (1993) Mol. Biol. Cell 4, 1-5 [Medline] [Order article via Infotrieve]
  12. Lin, J. J., Daniels-McQueen, S., Patino, M. M., Gaffield, L., Walden, W. E., and Trach, R. E. (1990) Science 247, 74-77 [Abstract/Free Full Text]
  13. Lin, J. J., Patino, M. M., Gaffield, L., Walden, W. E., Smith, A., and Trach, R. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 6068-6071 [Abstract/Free Full Text]
  14. Klausner, R. D., Rouault, T. A., and Harford, J. B. (1993) Cell 72, 19-28 [CrossRef][Medline] [Order article via Infotrieve]
  15. Drapier, J. C., Hirling, H., Wietzerbin, J., Kaldy, P., and Kuhn, L. C. (1993) EMBO J. 12, 3643-3649 [Medline] [Order article via Infotrieve]
  16. Basilion, J. P., Rouault, T. A., Massinople, C. M., Klausner, R. D., and Burgess, W. H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 574-578 [Abstract/Free Full Text]
  17. Hirling, H., Henderson, B. R., and Kuhn, L. C. (1994) EMBO J. 13, 453-461 [Medline] [Order article via Infotrieve]
  18. Philpott, C. C., Haile, D., Rouault, T. A., and Klausner, R. D. (1993) J. Biol. Chem. 268, 17655-17658 [Abstract/Free Full Text]
  19. Verniquet, F., Gaillard, J., Neuburger, M., and Douce, R. (1991) Biochem. J. 276, 643-648
  20. Jordanov, J., Courtois-Verniquet, F., Neuburger, M., and Douce, R. (1992) J. Biol. Chem. 267, 16775-16778 [Abstract/Free Full Text]
  21. Brouquisse, R., Nishimura, M., Gaillard, J., and Douce, R. (1987) Plant Physiol. 84, 1402-1407 [Abstract/Free Full Text]
  22. Eanes, R. Z., and Kun, E. (1971) Biochim. Biophys. Acta 227, 204-210 [Medline] [Order article via Infotrieve]
  23. Slaughter, C. A., Povey, S., Carrit, B., Solomon, E., and Bobrow, M. (1978) Cytogenet. Cell. Genet. 22, 223-225 [Medline] [Order article via Infotrieve]
  24. Povey, S., Slaughter, C. A., and Wilson, D. E. (1976) Ann. Hum. Genet. 39, 413-422 [Medline] [Order article via Infotrieve]
  25. Courtois-Verniquet, F., and Douce, R. (1993) Biochem. J. 294, 103-107
  26. Kennedy, M. C., Emptage, M. H., Dreyer, J. L., and Beinert, H. (1983) J. Biol. Chem. 258, 11098-11105 [Abstract/Free Full Text]
  27. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  28. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  29. Hewick, R. M., Hunkapoller, M. W., Hood, L. E., and Dreyer, W. J. (1981) J. Biol. Chem. 256, 7990-7997 [Abstract/Free Full Text]
  30. Sambrook, J., Fritsch, E., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor NY
  31. Dellaporta, S. L., Wood, J., and Hicks, J. B. (1983) Plant Mol. Biol. Reporter 1, 19-21
  32. Feinberg, A. P., and Volgelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  33. Dumas, J. B., Edwards, M., Delort, J., and Mallet, J. (1991) Nucleic Acids Res. 19, 5227-5232 [Abstract/Free Full Text]
  34. Jefferson, R. A., Kavanagh, T. A., and Bevan, M. W. (1987) EMBO J. 6, 3901-3907 [Medline] [Order article via Infotrieve]
  35. Dale, P. J., Marks, M. S., Brown, M. M., Woolston, C. J., Gunn, H. V., Mullineaux, P. M., Lewis, D. M., Kemp, J. M., Chen, D. F., Gilmour, D. M., and Flavell, R. B. (1989) Plant Sci. 63, 237-245 [CrossRef]
  36. Holsters, M., DE Waele, D., Depicker, A., Messens, E., Van Montagu, M., and Schell, J. (1978) Mol. Gen. Genet. 163, 181-187 [CrossRef][Medline] [Order article via Infotrieve]
  37. Valvekens, D., Van Montagu, M., and Van Lijsebettens, M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5536-5540 [Abstract/Free Full Text]
  38. Joshi, C. P. (1987) Nucleic Acids Res. 15, 9627-9640 [Abstract/Free Full Text]
  39. Breathnach, R., Benoist, C., O'hare, K., Gannon, F., and Chambon, P. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 4853-4857 [Abstract/Free Full Text]
  40. Goodall, G. J., Kiss, T., and Filipowicz, W. (1991) Oxford Surv. Plant Mol. Cell Biol. 7, 255-296
  41. Hirzmann, J., Luo, D., Hahnen, J., and Hobom, G. (1993) Nucleic Acids Res. 21, 3597-3598 [Free Full Text]
  42. Joshi, C. P. (1987) Nucleic Acids Res. 15, 6643-6653 [Abstract/Free Full Text]
  43. Konecki, D. S., Wang, Y., Trefz, F. K., Lichter-Konecki, U., and Woo, S. L. C. (1992) Biochemistry 31, 8363-8368 [CrossRef][Medline] [Order article via Infotrieve]
  44. Hendrick, J. P., Hodges, P. E., and Rosenberg, L. E. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 4056-4060 [Abstract/Free Full Text]
  45. Verner, K., and Schatz, G. (1988) Science 241, 1307-1313 [Abstract/Free Full Text]
  46. Lauble, H., Kennedy, M. C., Beinert, H., and Stout, C. D. (1992) Biochemistry 31, 2735-2748 [CrossRef][Medline] [Order article via Infotrieve]
  47. Robbins, A. H., and Stout, C. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3639-3643 [Abstract/Free Full Text]
  48. Robbins, A. H., and Stout, C. D. (1989) ProteinsStruct. Funct. Genet. 5, 289-312 [CrossRef][Medline] [Order article via Infotrieve]
  49. Zheng, L., Kennedy, M. C., Beinert, H., and Zalkin, H. (1992) J. Biol. Chem. 267, 7895-7903 [Abstract/Free Full Text]
  50. De Bellis, L., Tsugeki, R., Alpi, A., and Nishimura, M. (1993) Physiol. Plant. 88, 485-492 [CrossRef]
  51. Gangloff, S. P., Marguet, D., and Lauquin, G. J. M. (1990) Mol. Cell. Biol. 10, 3551-3561 [Abstract/Free Full Text]
  52. Wu, M., and Tzagoloff, A. (1987) J. Biol. Chem. 262, 12275-12282 [Abstract/Free Full Text]
  53. Carlson, M., and Botstein, D. (1982) Cell 28, 145-154 [CrossRef][Medline] [Order article via Infotrieve]
  54. Natsoulis, G., Hilger, F., and Fink, G. R. (1986) Cell 46, 235-243 [CrossRef][Medline] [Order article via Infotrieve]
  55. Chatton, B., Walter, P., Ebel, J. P., Lacroute, F., and Fasiolo, F. (1988) J. Biol. Chem. 263, 52-57 [Abstract/Free Full Text]
  56. Van Tunen, A. J., Mur, L. A., Brouns, G. S., Rienstra, J. D., Koes, R. E., and Mol, J. N. M. (1990) Plant Cell 2, 393-401 [Abstract/Free Full Text]
  57. Quattrochio, F., Tolk, M. A., Coraggio, I., Mol, J. N. M., Viotti A., and Koes, R. E. (1990) Plant Mol. Biol. 15, 81-93 [CrossRef][Medline] [Order article via Infotrieve]
  58. Neupert, B., Thompson, N. A., Meyer, C., and Kuhn, L. C. (1990) Nucleic Acids Res. 18, 51-55 [Abstract/Free Full Text]
  59. Hirling, H., Emery-Goodman, A., Thompson, N., Neupert, B., Seiser, C., and Kuhn, L. C. (1992) Nucleic Acids Res. 20, 33-39 [Abstract/Free Full Text]
  60. Kennedy, M. C., Mende-Mueller, L., Blondin, G. A., and Beinert, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11730-11734 [Abstract/Free Full Text]
  61. Rothenberger, S., Mullner, E. W., and Kuln, L. C. (1990) Nucleic Acids Res. 18, 1175-1179 [Abstract/Free Full Text]
  62. Lobreaux, S., and Briat, J. F. (1991) Biochem. J. 274, 601-606
  63. Lescure, A. M., Proudhon, D., Pesey, H., Ragland, M., Theil, E. C., and Briat, J. F. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8222-8226 [Abstract/Free Full Text]
  64. Spence, M. J., Henzl, M. T., and Lammers, P. J. (1991) Plant Mol. Biol. 17, 499-504 [CrossRef][Medline] [Order article via Infotrieve]
  65. Yu, Y., Radisky, E., and Leibold, E. A. (1992) J. Biol. Chem. 267, 19005-19010 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
ANN BOT (LOND)Home page
J.-F. Briat, K. Ravet, N. Arnaud, C. Duc, J. Boucherez, B. Touraine, F. Cellier, and F. Gaymard
New insights into ferritin synthesis and function highlight a link between iron homeostasis and oxidative stress in plants
Ann. Bot., May 29, 2009; (2009) mcp128v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
F. Carrari, A. Nunes-Nesi, Y. Gibon, A. Lytovchenko, M. E. Loureiro, and A. R. Fernie
Reduced Expression of Aconitase Results in an Enhanced Rate of Photosynthesis and Marked Shifts in Carbon Partitioning in Illuminated Leaves of Wild Species Tomato
Plant Physiology, November 1, 2003; 133(3): 1322 - 1335.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. L. Gourley, S. B. Parker, B. J. Jones, K. B. Zumbrennen, and E. A. Leibold
Cytosolic Aconitase and Ferritin Are Regulated by Iron in Caenorhabditis elegans
J. Biol. Chem., January 24, 2003; 278(5): 3227 - 3234.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. H. Millar, L. J. Sweetlove, P. Giege, and C. J. Leaver
Analysis of the Arabidopsis Mitochondrial Proteome
Plant Physiology, December 1, 2001; 127(4): 1711 - 1727.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
D. A. Navarre, D. Wendehenne, J. Durner, R. Noad, and D. F. Klessig
Nitric Oxide Modulates the Activity of Tobacco Aconitase
Plant Physiology, February 1, 2000; 122(2): 573 - 582.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Saas, K. Ziegelbauer, A. von Haeseler, B. Fast, and M. Boshart
A Developmentally Regulated Aconitase Related to Iron-regulatory Protein-1 Is Localized in the Cytoplasm and in the Mitochondrion of Trypanosoma brucei
J. Biol. Chem., January 28, 2000; 275(4): 2745 - 2755.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. S. Murphy, W. R. Eisinger, J. E. Shaff, L. V. Kochian, and L. Taiz
Early Copper-Induced Leakage of K+ from Arabidopsis Seedlings Is Mediated by Ion Channels and Coupled to Citrate Efflux
Plant Physiology, December 1, 1999; 121(4): 1375 - 1382.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Céc. Bouton, M. Raveau, and J.-C. Drapier
Modulation of Iron Regulatory Protein Functions
J. Biol. Chem., January 26, 1996; 271(4): 2300 - 2306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peyret, P.
Right arrow Articles by Alric, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peyret, P.
Right arrow Articles by Alric, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement