|
|
|
|||||||
|
|||||||||
(Received for publication, August 2,
1994; and in revised form, January 23, 1995) From the
We report the purification of the unstable aconitase enzyme from
melon seeds and the NH Aconitase, also known as citrate (isocitrate) hydrolyase or
aconitate hydratase (EC 4.2.1.3) is an enzyme containing an Fe-S
cluster that catalyzes the reversible isomerization of citrate to
isocitrate via cis-aconitate in the tricarboxylic acid cycle. This enzyme is found in two cellular compartments(1) . The
mitochondrial aconitase is implicated in the Krebs cycle. The
physiological role of the cytoplasmic aconitase is not well
characterized and seems to be different between plants and mammals. In animals, study of the mitochondrial aconitase has increased our
knowledge of the Fe-S cluster(2, 3, 4) . The
Fe-S cluster is implicated in the dehydration and hydration steps
during the enzymatic reaction. The labile iron (Fe Several
studies have partially identified the amino acids of the IRE-BP and the
nucleotides of the IRE (iron-responsive element, the stem-loop
structure implicated in the binding of the IRE-BP) involved in the
interaction(16, 17, 18) . Aconitase has
been less well studied in plants. Nevertheless, the mitochondrial
aconitase has been purified from potatoes (19) and structural
data obtained using the EXAFS (extended X ray absorption fine
structure) technique have shown that the Fe-S cluster is different from
the one observed in animals(20) . In plants, cytoplasmic
aconitase and mitochondrial aconitase show similar characteristics and
cannot be differentiated(21) . On the other hand, in animals,
the two aconitases are easily separated by ion exchange chromatography (22) and are encoded by two different genes (23, 24) . Recent results, showing that plant
aconitase is inhibited by H We report here the first isolation and
characterization of a plant aconitase gene.
Figure 1:
Purification of
aconitase from melon seeds. Samples from the different steps of C.
melo aconitase purification were separated by electrophoresis on a
10-15% gradient SDS-polyacrylamide gel and visualized by silver
staining. Lane 1, molecular size markers (Bio-Rad); lane2, crude extract (0.5 µg); lane3,
extract after ion-exchange chromatography using Q Fast Flow (0.5
µg); lane4, extract after affinity
chromatography using Yellow 86 (0.5 µg); lanes 5 and 6, extract after hydrophobic interaction chromatography using
Phenyl 5PW: fraction I (0.08 µg, lane5) and
fraction II (0.08 µg, lane6); lanes7 and 8, extract after ion exchange
chromatography using Mono Q: fraction I (0.06 µg, lane7) and fraction II (0.06 µg, lane8).
The cDNA clone was shown to be incomplete since the
NH In order to obtain a complete plant cDNA
encoding the aconitase enzyme, a cDNA library constructed from A.
thaliana pod RNA was screened under heterologous conditions with a
2.2-kb EcoRI fragment from the longest melon cDNA. After
hybridizing in 30% formamide at 42 °C followed by washing twice in
2
Figure 2:
Homology alignment of the
NH
The mapping of
these genomic clones by Southern blot analysis using the four EcoRI cDNA fragments (0.2, 0.8, 1.6, and 0.6 kb) showed the 3`
end of the gene was absent as the 0.6-kb probe did not hybridize to the
clones. To obtain the missing 3` extremity of the aconitase gene, we
have screened a new genomic library (EMBL3) using the 0.6-kb probe. One
clone was isolated after screening 2
Figure 3:
Genomic organization of A. thaliana aconitase. A, partial restriction map of the
genomic clones isolated by screening the
In order to assess the complexity of the gene
encoding the aconitase enzyme in A. thaliana, Southern blot
analysis was carried out on genomic DNA isolated from two ecotypes of A. thaliana (Columbia and C24) and digested with several
restriction enzymes. Filters were hybridized with the three EcoRI cDNA fragments (0.8, 1.6, and 0.6 kb) as a probe (Fig. 4). The physical map obtained is identical to the one
observed for the genomic clones, suggesting the presence of a unique
gene in A. thaliana.
Figure 4:
Southern blot analysis of A. thaliana genomic DNA for aconitase gene. Genomic DNA was isolated from two
ecotypes C24 (C24) and Columbia (Col) of A.
thaliana leaves and digested with the following restriction
enzymes: PvuII (Pv), EcoRI (E), BamHI (B), HindIII (H), PstI (Ps), SspI (Ss), and XbaI (X). Five µg of digested DNA was
fractionated on a 0.8% agarose gel and blotted onto Hybond-N
Among the 31 sequenced clones containing an uncoded 5` terminal cap
G residue, 14 clones stopped at position +1, 7 at position
-2, 4 at position -4, 5 at position -9, and one at
position +9. So, the precise mapping of the transcription start
site has revealed five putative sites with one preferentially used that
we have positioned at +1. We have also observed five clones
without the additional G residue (one clone at position +14, 3
clones at position +20, and 1 clone at position +29). These
clones most probably arise from the premature stopping of the reverse
transcriptase. Finally, another clone without the additional G residue
positioned at -49 was obtained. This clone is not an amplified
DNA genomic fragment since a longer size would be expected due to the
introns. Thus, the possibility that a second promoter exists cannot yet
be ruled out. The promoter region shows a classical TATA box
positioned at -32, which is in agreement with the position given
by Joshi(42) , i.e. 32 ± 7 bp from the
transcriptional start site. Moreover, multiple transcriptional start
sites are often observed in housekeeping genes(43) . The
first ATG occurs at position +91 relative to the transcriptional
start site. This ATG may be the initiation codon because the
surrounding sequences resemble the consensus sequence
TAACAATGGCT(38) . There is continuous open reading frame from
the transcriptional start site to the first methionine. It may be
possible that this sequence encodes a mitochondrial leader peptide.
However, an aspartic residue is found at position 25 and a glutamic
residue at position 14. Acidic residues are normally absent from the
mitochondrial transit peptide (44) , but there is not a strict
consensus sequence(45) .
Figure 5:
Northern blot analysis of aconitase
expression in A. thaliana and B. napus organs. Total
RNA (50 µg/lane) from A. thaliana 6-day seedlings (lane1), leaf (lane2), stem (lane3), young flower before anthesis (lane4), mature flower (lane5), immature
pod (lane6), mature seed (lane7),
and from B. napus leaf (lane8), pistil (lane9), and anther (lane10) were electrophoresed in a denaturing 1.5%
agarose-formaldehyde gel and blotted onto Hybond-N
Figure 6:
There are only two previous reports of purification of plant
aconitase. The first characterization of plant aconitase, from potato
mitochondria, was made by Verniquet et al.(19) . The
second (50) revealed three aconitase isoforms isolated from
etiolated pumpkin cotyledons. The subcellular distribution of these
purified aconitase isoforms was not clearly determined. Brouquisse et al.(21) found no difference between cytosolic and
mitochondrial aconitase in plants. On the other hand, in animals the
mitochondrial and cytosolic aconitases have different isoelectric
points and are encoded by two different
genes(22, 23) . In yeast, the mitochondrial and the
cytoplasmic aconitases are encoded by a single gene(51) . After
disruption of the yeast mitochondrial aconitase gene, no aconitase
activity is detected in crude extracts. A single gene encoding two
proteins with different subcellular locations has been described for
yeast fumarase(52) , for yeast invertase(53) , and for
yeast histidine and valine tRNA(54, 55) . In
plants, more work must be done to demonstrate if mitochondrial and
cytoplasmic aconitases are encoded by a single or two distinct genes.
Such a situation where a single gene encodes two transcripts has been
observed in plants for petunia chalcone isomerase (56) and for
zeins in maize seeds(57) . During this study, we have
compared the molecular weight and the pI values of plant aconitase with
aconitase of different species and noted that they share similar
characteristics with the mammalian IRE-BP(58, 59) .
Two peaks of aconitase activity were detected during the purification
of aconitase from melon seeds, resembling the situation described by
Neupert et al.(58) , who found that purified human
placental IRE-BP had two major bands of 95 and 100 kDa. Purified cow
liver IRE-BP is composed of one or two bands on SDS-PAGE; the number of
bands is dependent on the reducing agent concentration(60) .
The heterogeneity observed for human placenta IRE-BP is localized on a
NH The high degree of similarity observed between plant
aconitase and IRE-BP is surprising. Until now IRE-BP activity has been
detected in mammals, fishes, flies, and frogs but has not been reported
in yeast, bacteria, and plants(61) . However, the IRE probes
used in these gel retardation assays were from human ferritin messenger
and from human transferrin receptor messenger. These two messengers are
implicated in iron metabolism and are post-transcriptionally regulated
by the IRE-BP (9, 10, 11) . In plant ferritin
messengers, no IRE was found by homology with mammals
IRE(62, 63, 64) . It is possible that plant
aconitase is also implicated in a post-transcriptional regulation
because it shares a high homology with mammalian IRE-BP. In order to
show this, it is necessary to find out if IRE-like structures are
present in plant messengers. IRE-BPs are considered to be a new
class of RNA-binding proteins because there is no significant homology
between the IRE-BP and the RNA recognition motif identified in other
RNA-binding proteins(65) . In the A. thaliana aconitase, we have observed a sequence (DLVIDYSVQV) similar to the
one recently reported by Basilion et al.(16) (DLVIDH-IQV, corresponding to amino acids
121-130 in human IRE-BP). This sequence cross-links to the IRE.
Nevertheless, it is necessary to identify other contact points between
IRE and IRE-BP in order to understand the complete interaction. We
are interested in finding out if plant cytosolic aconitase is involved
in a post-transcriptional regulation in an analogous fashion to the
mammalian IRE-BP and if the plant mitochondrial and cytosolic
aconitases are encoded by a single gene. This article is
dedicated to the memory of Dr. Jean-Louis Peyret, whose tragic death
was a great loss to all of us. The nucleotide sequence(s) reported
in this paper has been submitted to the GenBank(TM)/EMBL Data Bank
with accession number(s)
X82839[GenBank]-X82841[GenBank].
Volume 270,
Number 14,
Issue of April 7, 1995 pp. 8131-8137
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
PLANT ACONITASE SHOW SIGNIFICANT HOMOLOGY WITH MAMMALIAN
IRON-RESPONSIVE ELEMENT-BINDING PROTEIN (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-terminal amino acid sequence
determination. Antibodies raised against this protein enabled the first
isolation and characterization of cDNA encoding aconitase in plants. A
full-length cDNA clone of 3210 base pairs was isolated from a library
of cDNA clones derived from immature pods of Arabidopsis
thaliana. The amino acid sequence deduced from the open reading
frame includes the sequence obtained by direct sequencing of the
NH terminus of the purified enzyme. Genomic clones of the
aconitase gene were isolated, and comparison of the cDNA and genomic
sequences reveals that the coding sequence is divided among 20 exons.
There are five putative sites for transcription initiation. The
aconitase gene is constitutively expressed, but at a low level, during
most developmental stages, with a dramatic increase during seed and
pollen maturation and during germination. Surprisingly, plant
aconitases have reasonably high homology to binding proteins for
iron-responsive elements from mammalian species, opening the
possibility that a similar type of translational regulation occurs in
plants.
),
spontaneously lost by oxidation during purification, is involved in the
binding of the substrate(5, 6) . Recently, Rouault et al.(7) have found as much as 56% homology between
porcine heart aconitase and iron-responsive element-binding protein
(IRE-BP). (
)The IRE-BP is an RNA-binding protein that plays
a regulatory role in the iron metabolism. Kaptain et al.(8) have demonstrated that IRE-BP also has an aconitase
activity. Thus in animals, cytoplasmic aconitase has a dual function:
(i) an IRE-BP activity involved in the post-transcriptional regulation
of iron metabolism(9, 10, 11) , and (ii) an
aconitase activity whose physiological role is not well understood.
These two activities are mutually exclusive. When the cluster is in the
4Fe-4S state, the protein has the aconitase activity but not the IRE-BP
function. Alternatively, when the cluster is in the 3Fe-4S state, the
cytoplasmic aconitase has the IRE-BP function but not the aconitase
activity. However, the mechanism involved in the transition between the
two forms is not understood although several models have been proposed (12, 13, 14, 15) .O(19) and
that no activity is detected in glyoxysomes(25) , have led the
authors to propose that plant cytoplasmic aconitase participates in the
glyoxylate cycle.
Enzyme Assay
Aconitase activity was assayed as
described by Kennedy et al.(26) . One unit is given as
1 nmol of cis-aconitate formed in 1 min with 
= 3.6 cm
mM.Purification of Aconitase from Melon Seeds
Seeds
from melon (Cucumis melo, cantaloupe charentais variety) were
obtained from Tezier (Valence, France). All purification steps were
carried out at 4 °C. A 100-g sample was disintegrated in a Waring
blender (5 min, high speed) and the aconitase was extracted in a 20
mM imidazole HCl buffer, pH 7.5 (buffer I), with continuous
and gentle stirring for 1 h. The insoluble material was removed by
centrifugation (17,000 
g, 30 min), and the supernatant
was filtered through a Miracloth filter (Behring Diagnostics). Column
chromatography was performed using a Waters model 650E advanced protein
purification system. The crude extract was loaded onto a Q-Sepharose
fast flow column (2.6 7 cm, Pharmacia Biotech Inc.) at a flow
rate of 60 ml/h and washed with buffer I until the absorbance at 280 nm
was zero. The aconitase was eluted with buffer I containing 200 mM sodium acetate at a flow rate of 120 ml/h. Fractions containing
aconitase activity were pooled and desalted on PD10 columns (Pharmacia)
with buffer I. The active sample was applied to a Reactive Yellow 86
column (1.6 25 cm, Sigma; previously equilibrated with buffer
I) at a flow rate of 30 ml/h and washed with buffer I until an
absorbance of zero at 280 nm was reached. Aconitase was eluted with a
linear gradient of sodium acetate (0-500 mM) in buffer I
at a flow rate of 30 ml/h. Fractions containing aconitase activity were
pooled, adjusted to 1.2 M with ammonium sulfate in buffer I,
and applied to a Protein Pack HIC Phenyl 5PW column (Waters) previously
equilibrated with the same buffer and washed until the absorbance at
280 nm was zero. Aconitase was eluted with a decreasing linear gradient
of ammonium sulfate (1.2-0 M) at a flow rate of 60 ml/h.
Fractions containing aconitase activity were pooled, desalted on PD10
columns (Pharmacia) with buffer I, loaded on a Mono Q HR 5/5 column
(Pharmacia) previously equilibrated with buffer I, and washed until the
absorbance at 280 nm was zero. Aconitase was eluted with a linear
gradient of sodium acetate (0-300 mM) in buffer I at a
flow rate of 30 ml/h.Protein Characterization
Protein concentration of
samples were routinely determined using the dye binding
assay(27) . The Pharmacia Phast system was used for protein
characterization, and SDS-PAGE was carried out on a discontinuous
10-15% polyacrylamide gel. Protein bands were stained using the
silver staining kit from Pharmacia.Immunological Techniques
Antiserum to melon seed
aconitase was raised in by injecting a rabbit three times with 10
µg of the purified protein in Freund's adjuvant (complete
adjuvant in the first immunization, incomplete adjuvant in the second
and third immunizations 40 and 70 days after the first one).NH
Purified aconitase enzyme was fractionated by
electrophoresis on a 10% (w/v) SDS-polyacrylamide gel (28) and
blotted onto a polyvinyl difluoride membrane (Bio-Rad). The membrane
was stained with Coomassie Blue, and the region of the membrane
containing the aconitase protein was excised and sequenced in an
Applied Biosynthesis Sequencer using the reaction described by
Hewick(29) .-terminal Amino Acid
SequencingIsolation and Sequencing of cDNAs
Polyclonal
antibodies raised against the aconitase enzyme were used to screen a
ZAP cDNA library from C. melo mature fruit (cantaloupe,
charentais variety) using goat anti-rabbit alkaline
phosphatase-conjugated second antibody (Sigma) following the method
described by Sambrook et al.(30) . DNA probes were
made from clones that were positive in the initial screening, and these
were used to screen a ZAP cDNA library from Arabidopsis
thaliana immature pods in order to recover full-length clones.
Library screening was carried out using Hybond-N
filters (Amersham Corp.). The heterologous hybridization was
conducted according to Sambrook et al.(30) . Plaques
that hybridized to the probes were purified and in vivo excision was used to obtain Bluescript plasmids (Stratagene). Both
DNA strands of the plasmids were sequenced using the Sequenase version
2.0 sequencing kit (U. S. Biochemical Corp.). The sequences of the
whole plasmid inserts was obtained using a combination of subclones,
exonuclease deletion, and oligonucleotide primers. Sequence analysis
was carried out using the Mac Vector computer program (Eastman Kodak).Genomic Southern Blot Analysis
Genomic DNA was
isolated from young A. thaliana leaves as described by
Dellaporta et al.(31) . Approximately 5 µg of DNA
was digested with the appropriate restriction enzyme, and the fragments
were fractionated by electrophoresis on a 0.8% (w/v) agarose gel. These
were blotted by capillary transfer onto Hybond-N membrane (Amersham) and hybridized with DNA probes labeled using
the random priming method (32) . Hybridization was carried out
following the method described by Sambrook et
al.(30) .Northern Blot Analysis
Total RNA was isolated from
tissues of both A. thaliana and Brassica napus using
Qiagen columns. Poly(A) RNA was isolated with the
PolyATract® mRNA isolation system kit (Promega). Approximately 50
µg of total RNA or 5 µg of poly(A) RNA were
fractionated by electrophoresis on a 1.2% (w/v) agarose gel containing
1.2 M formaldehyde and blotted by capillary transfer onto
Hybond-N membrane (Amersham). DNA probes were labeled
using the random priming method(32) . Filters were hybridized
according to Sambrook et al.(30) .Isolation and Sequencing of Genomic Clones
Two
genomic libraries were screened to obtain clones encompassing the
complete gene encoding the aconitase enzyme. These were an EMBL3
genomic library (Clontech) constructed with A. thaliana (Columbia ecotype) DNA partially digested with MboI
restriction enzyme, and a Dash II genomic library constructed with A. thaliana (C24 ecotype) DNA partially digested with HindIII restriction enzyme. The A. thaliana cDNA
clone encoding the aconitase enzyme was used as a probe. Phage plating
and plaque lifts were carried out according to a protocol from
Amersham. Phage purification was carried out with Qiagen columns.
Prehybridization, hybridization, and washes were made as described for
Southern blot analysis. DNA sequencing using a combination of subclones
was carried out as described under ``Isolation and Sequencing of
cDNA.''Cloning and Sequencing of the 5` End of the mRNA
A
modified protocol called SLIC (single strand ligation to
single-stranded cDNA) of the RACE (rapid amplification of cDNA ends)
technique initially described by Dumas et al.(33) was
used to amplify the 5` end of aconitase mRNA with the 5`Amplifinder
RACE kit (Clontech). Oligonucleotide 19,
GCTGGAACTCAAGCTCCATGTTTGCCTGCA, positioned at +524 on cDNA
sequence was used to synthesize the first strand cDNA. At the 3` end of
the first strand cDNA, the oligonucleotide anchor of the kit was
ligated with T4 RNA ligase. Two PCR reactions were necessary to amplify
the 5` end of the cDNA. In the first PCR, oligonucleotide 16,
CAAGCAAGATCAACAACAGCAGGAACACCA, positioned at +375 on the cDNA
sequence, and the oligonucleotide complementary to the anchor
oligonucleotide were used. The amplification reaction was precipitated
with EtOH and resuspended in 10 µl of sterile HO. Two
µl of this solution was used as template for the second PCR
reaction where oligonucleotide 14, CACAGTTACGTATGGCCGA, positioned at
+230 on cDNA sequence, and the oligonucleotide complementary of
the anchor oligonucleotide were used. The PCR conditions for both
reactions were as follows: denaturation of DNA, 5 min at 94 °C, and
then 35 cycles composed of a denaturation step (1 min at 94 °C), an
annealing step (1 min at 50 °C), and a polymerization step (2 min
at 72 °C); after the 35th cycle, an elongation step (7 min at 72
°C) was used. PCR products were cloned in pGEM-T vector (Promega).
Potential clones of the 5` end of the mRNA were selected by digestion
with BglII restriction enzyme (a BglII site was
positioned at +48 on cDNA sequence). Thirty-seven selected clones
were sequenced using oligonucleotide 12, CGATCCTGGGATCGTTCA, positioned
at +175 in the cDNA sequence.Transgenic Plants
A HindIII-BglII fragment of 1339 bp containing the
putative promoter was cloned in the binary vector pBi 101-1 (34) at the restriction sites HindIII-BamHI
to obtain pBios 170. This resulting binary vector carrying the
-glucuronidase fusion was introduced in the Agrobacterium
tumefaciens C 58`3 strain (35) by heat shock using the
protocol described by Holsters et al.(36) . A.
thaliana root explants were transformed with DNA and regenerated
as described by Valvekens et al.(37) . Primary
transformants were grown in a greenhouse (22 °C, 16-h photoperiod)
on soil irrigated with mineral nutrients. The expression of the
-glucuronidase gene was detected in different plant organs by
histochemical test using the protocol described by Jefferson et
al.(34) .
Purification, Identification, and
NH
Aconitase from melon seeds was purified by
chromatographic method (see ``Experimental Procedures''). Two
peaks of aconitase activity were eluted from HIC phenyl 5PW hydrophobic
interaction columns at 0.7 and 0.9 M ammonium sulfate,
respectively. These two aconitase proteins were then purified to
homogeneity by anion exchange chromatography on a Mono-Q column at
similar sodium acetate concentrations (approximately 220 mM).
The proteins were analyzed by SDS-PAGE and visualized by silver
staining at each purification step (Fig. 1). The results of a
typical purification are summarized in Table 1. The apparent
molecular weight of the two aconitase proteins determined by SDS-PAGE
is close to 98,000 (Fig. 1, lanes7 and 8). In native conditions, their molecular masses are around
100 kDa, suggesting a monomeric structure (data not shown). The two
forms both contain a prominent pI 5.2 species when analyzed by
isoelectric focusing (data not shown). The two purified proteins have
also identical NH-terminal Sequence of Melon Seed
Aconitase-terminal sequences:
NH-Ser-Ser-Met-Ala-Ala-Glu-Asn-Pro-Phe-Lys-Glu-Asn-Leu-Thr.
Isolation of cDNA Clones Encoding Aconitase
Enzyme
Polyclonal antibodies were raised to the purified
proteins as described under ``Experimental Procedures.''
Twenty-one clones were selected from a melon fruit ZAP cDNA
library after screening 4 10
plaques with the
polyclonal antibodies. The inserts in these clones ranged from 2.3 to
2.6 kb; they cross-hybridized and shared a common restriction pattern
(data not shown). The sequence of the longest cDNA 5` end is 60%
homologous to both human IRE-BP and Escherichia coli aconitase.-terminal sequence obtained by Edman degradation was not
found in the predicted amino acid sequence from the cDNA. This result
is not surprising since a 98-kDa protein is expected to be encoded by a
cDNA almost 3 kb long. In order to obtain a full-length cDNA, the fruit
melon cDNA library was screened twice with a 300-bp DraI
fragment present only in the longest cDNA. Seven new clones were
isolated, but they appeared to be identical to the longest clone
previously isolated. SSC at 42 °C for 30 min, seven positive clones were
isolated (three clones of 3.2 kb and four clones of 2.3 kb). No
difference was observed between clones of the same size after
restriction, hybridization, and partial sequencing. The longest cDNA
clone of 3210 bp was completely sequenced. The NH-terminal
sequence obtained by Edman sequencing of the melon aconitase matched
the amino acid sequence predicted by the A. thaliana cDNA
sequenced, suggesting that the A. thaliana cDNA encodes the
aconitase enzyme. Fig. 2shows the homology between the
NH-terminal amino acid sequence obtained from melon seed
aconitase, potato mitochondrial aconitase, ()and the
sequence deduced from the A. thaliana cDNA. The sequence of
the cDNA contains an open reading frame that encodes 923 amino acid
residues, with a predicted molecular mass of 98,490 Da and a pI value
of 6.0. Three consensus polyadenylation sites AAUAAA (38) at
nucleotides 2809, 2940, and 3026 are present in the 3`-untranslated
region of 441 bp. No stop codon was found at the 5` end of the gene,
and in order to define the complete transcribed sequence we have
isolated the A. thaliana gene encoding the aconitase enzyme
from a library of genomic fragments.
-terminal sequence of aconitase from different plant
species. The three-letter code for amino acids is used
throughout. Residues common to the three plant species are boxed. Sequences shown are A. thaliana (protein
sequence predicted from A. thaliana cDNA sequence), C.
melo (protein sequence obtained from melon seed aconitase), and Solanum tuberosum (protein sequence obtained from potato
mitochondrial aconitase).
Organization of A. thaliana Aconitase Gene
The A. thaliana cDNA was used as a probe to screen an A.
thaliana genomic Dash library. Six clones were isolated after
screening 2 10 plaques. All these clones appeared
to be identical by restriction endonuclease mapping. 10 plaques.
Restriction analysis of this clone and Southern blot mapping enabled
the completion of the physical map of the aconitase gene of A.
thaliana (Fig. 3). The genomic clones were sequenced (6760
bp). A comparison between the genomic and the cDNA sequences of the A. thaliana aconitase shows that this gene is divided into 20
exons (Fig. 3). Table 2indicates the exon and intron
sizes and the intron-exon junction position. The exon-intron borders
match the criteria for consensus sequences of splice junctions, the
GT/AG rule(39) . A recent study shows that in plants there is
no conserved sequence for branch point selection for lariat formation
and that in dicotyledonous plants the introns are AT-rich(40) .
The introns of the A. thaliana aconitase gene are in agreement
with these observations. The three polyadenylation signals AATAAA
observed after cDNA analysis are localized at positions 5068, 5199, and
5285, respectively.
Dash and the EMBL3
libraries with the full-length cDNA. B, BamHI; E, EcoRI; H, HindIII; Ps, PstI; Pv, PvuII; X, XbaI. B, diagram of the gene structure (exons are
represented by filled boxes; introns are represented by opened boxes; 5`-noncoding region is represented by box
with diagonal lines; 3`-noncoding region is represented by box
with horizontal lines). C, partial restriction map of the
predicted cDNA.
membrane. The membrane was hybridized with EcoRI
fragments of A. thaliana cDNA.
Mapping of the Transcription Start
Extended
5` cDNAs end were cloned by the RACE technique (see ``Experimental
Procedures''). When the second PCR was performed using
oligonucleotide 14, two bands of around 300 and 350 bp in length were
observed on a 1.5% agarose gel stained with ethidium bromide (data not
shown). After cloning these two DNA fragments in a pGEM-T vector, 37
clones were recovered and sequenced. For 31 sequenced clones, an extra
G residue was observed at the 5` ends that is not present on the
genomic sequence, implying that the extra G comes from the 5` cap.
Hirzmann et al.(41) reported that a G can be reverse
transcribed into a 3` terminal C residue, which will give rise to an
uncoded G residue in a complementary strand sequence pattern.
Furthermore, sequence ladders with an uncoded 5` terminal cap G residue
give a direct proof of their complete messenger RNA molecule origin. Expression of the Aconitase Enzyme in Different
Tissues
Total RNA was isolated from a range of different A.
thaliana and B. napus tissues. Northern blot analysis was
carried out with the EcoRI cDNA fragments as probes (Fig. 5). The aconitase gene is constitutively expressed with a
strong expression in seedlings and flowers of A. thaliana. To
examine more fully the expression of the aconitase gene in flowers, we
have extracted RNA from pistils and anthers of B. napus;
highest expression is found in the anthers (Fig. 5, lane10). A 1339-bp HindIII-BglII genomic
fragment containing the putative TATA box was cloned into a
-glucuronidase expression vector in order to study the potential
promoter activity of the 5` flanking region. Results obtained on
primary transformants are shown in Fig. 6. -Glucuronidase
activity is observed in leaves and roots (data not shown). A strong
activity is observed in anthers that is restricted to the pollen grains (Fig. 6, A and B). During seed maturation
-glucuronidase activity is observed in the developing albumen and
in embryonic tissues. In mature seeds the activity is high in
cotyledons and in the axis and lower in the root (data not shown).
Therefore, the 1339-bp HindIII-BglII promoter
fragment mimics the expression of the aconitase gene observed by
Northern blots.
membrane. The membrane was hybridized with the aconitase cDNA
clone.
-Glucuronidase expression in A.
thaliana primary transformant organs. A 1339-bp
5`-HindIII/BglII promoter fragment of the A. thaliana aconitase gene was subcloned into a
-glucuronidase expression vector. -Glucuronidase-expressing
cells are indicated by their blue color. PanelA is a light microscopic view of a mature flower. PanelB shows a microscopic view of a mature
anther.
Structural Relationship between IRE-BP and Aconitase in
Different Species
The predicted protein sequences of plant
aconitase (C. melo and A. thaliana) were compared
with the protein sequences of mammalian, yeast, and E. coli aconitase extracted from GenBank using the PC Gene clustal program
(IntelliGenetics). The 23 amino acid residues forming the active site (46, 47, 48, 49) are all conserved
in A. thaliana aconitase. Table 3shows that plant
aconitases are highly conserved with a similarity between C. melo and A. thaliana of 92%. Strikingly, plant aconitase is
more related to IRE-BP, with a sequence conservation of more than 70%,
than it is to mammalian mitochondrial aconitase with a similarity of
43%.
-terminal fragment obtained by proteolysis but not
necessarily in the first amino acid residues(59) . A similar
situation may occur here for the two aconitase enzymes isolated from
melon seeds. However, we cannot exclude other kinds of modifications
like proteolysis, post-translational modification, or nonenzymatic
deamidation.
))
The A. thaliana cDNA and genomic libraries
were generously provided by Dr. Jérome Giraudat
(INRA, Versailles, France) and Dr. Georges Picard (BIOMOVE, CNRS,
Clermont-Ferrand, France), respectively. We are grateful to Professor
Roland Douce (CENG, Grenoble, France) for helpful discussions, critical
reading of the manuscript, and for communicating results obtained on
potato aconitase prior to publication. We thank Catherine Gueguen for
helping in the production of polyclonal antibodies,
Gaëlle Baudot and Denise Garcia for helping in the A. thaliana aconitase gene expression studies, and Dr. Bernard
Henrissat (CERMAV, CNRS, Grenoble, France) for analyzing the sequence
homologies between the aconitase of different species. We acknowledge
Dr. Marie Eliane Drake for suggestions to the manuscript. We thank Dr.
Pete Isaac for his great help in reviewing the English version of this
paper.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J.-F. Briat, K. Ravet, N. Arnaud, C. Duc, J. Boucherez, B. Touraine, F. Cellier, and F. Gaymard New insights into ferritin synthesis and function highlight a link between iron homeostasis and oxidative stress in plants Ann. Bot., May 29, 2009; (2009) mcp128v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Carrari, A. Nunes-Nesi, Y. Gibon, A. Lytovchenko, M. E. Loureiro, and A. R. Fernie Reduced Expression of Aconitase Results in an Enhanced Rate of Photosynthesis and Marked Shifts in Carbon Partitioning in Illuminated Leaves of Wild Species Tomato Plant Physiology, November 1, 2003; 133(3): 1322 - 1335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Gourley, S. B. Parker, B. J. Jones, K. B. Zumbrennen, and E. A. Leibold Cytosolic Aconitase and Ferritin Are Regulated by Iron in Caenorhabditis elegans J. Biol. Chem., January 24, 2003; 278(5): 3227 - 3234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. H. Millar, L. J. Sweetlove, P. Giege, and C. J. Leaver Analysis of the Arabidopsis Mitochondrial Proteome Plant Physiology, December 1, 2001; 127(4): 1711 - 1727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Navarre, D. Wendehenne, J. Durner, R. Noad, and D. F. Klessig Nitric Oxide Modulates the Activity of Tobacco Aconitase Plant Physiology, February 1, 2000; 122(2): 573 - 582. [Abstract] [Full Text]
|
|
|
|
|
|
J. Saas, K. Ziegelbauer, A. von Haeseler, B. Fast, and M. Boshart A Developmentally Regulated Aconitase Related to Iron-regulatory Protein-1 Is Localized in the Cytoplasm and in the Mitochondrion of Trypanosoma brucei J. Biol. Chem., January 28, 2000; 275(4): 2745 - 2755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Murphy, W. R. Eisinger, J. E. Shaff, L. V. Kochian, and L. Taiz Early Copper-Induced Leakage of K+ from Arabidopsis Seedlings Is Mediated by Ion Channels and Coupled to Citrate Efflux Plant Physiology, December 1, 1999; 121(4): 1375 - 1382. [Abstract] [Full Text]
|
|
|
|
|
|
Céc. Bouton, M. Raveau, and J.-C. Drapier Modulation of Iron Regulatory Protein Functions J. Biol. Chem., January 26, 1996; 271(4): 2300 - 2306. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |