|
Volume 270,
Number 14,
Issue of April 7, 1995 pp. 8298-8310
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Action of
Interleukin-2 Receptor Subunits Defines a New Type of Signaling
Mechanism for Hematopoietin Receptors in Hepatic Cells and Fibroblasts (*)
(Received for publication, October 18, 1994; and in revised form, January 17, 1995)
Karen K.
Morella
(1),
Chun-fai
Lai
(1),
Satoru
Kumaki
(2),
Noriko
Kumaki
(2), (§),
Yanping
Wang
(1), (3),
Eric M.
Bluman
(1),
Bruce
A.
Witthuhn
(4),
James N.
Ihle
(4),
Judith
Giri
(2),
David
P.
Gearing
(5),
David
Cosman
(2),
Steven F.
Ziegler
(6),
David
J.
Tweardy
(7),
Susana P.
Campos
(1), (3),
Heinz
Baumann
(1)(¶)From the
(1)Department of Molecular and Cellular
Biology, Roswell Park Cancer Institute, Buffalo, New York 14263,
(2)Immunex Corporation, Seattle, Washington 98101,
(3)Children's Hospital of Buffalo, Division of
Endocrinology, Buffalo, New York 14222,
(4)St. Jude Children's Research Hospital,
Memphis, Tennessee 38101-0318,
(5)Systemix, Palo Alto, California 94304,
(6)Darwin Molecular Corp., Bothell, Washington
98021, and the
(7)Pittsburgh Cancer Institute, Pittsburgh,
Pennsylvania 15213
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The gene regulatory functions of the human IL-2 receptor (IL-2R)
were reconstituted in transiently transfected hepatoma cells. The
combination of IL-2R and - mediated a strong stimulation via
the cytokine response element of the  -acid
glycoprotein gene and the hematopoietin receptor response element, but
none via the IL-6 response element or the sis-inducible
element. IL-2R enhanced 10-fold the sensitivity of the
IL-2R  complex to respond to IL-2 or IL-15, but did not
modify the specificity or the magnitude of maximal gene regulation. A
homodimerizing chimeric receptor G-CSFR-IL-2R could mimic the
IL-2R action. The IL-2R-mediated gene regulation was similar to that
seen with receptors for IL-4 and IL-7, but differed from that for IL-6
type cytokines, thrombopoietin, erythropoietin, and growth hormone. The
activation of STAT proteins by the IL-2R was assessed in transfected
L-cells and COS-1 cells. Although IL-2R subunits were highly expressed
in these cells, no STAT protein activation was detectable. Transient
overexpression of JAK3 was unable to change the signaling specificity
of the hematopoietin receptors in rat hepatoma, L-, and COS cells, but
established a prominent activation of the IL-6 response elements by the
IL-2R and IL-4R in HepG2 cells. The data support the model that the
IL-2R and related hematopoietin receptors produce at least two separate
signals which control gene expression.
INTRODUCTION
Hematopoietin receptors are members of a gene family
characterized by common structural motifs in their extracellular and,
in some cases, also in their intracellular
domains(1, 2) . Several groups of receptors within
this family have been identified based on the shared use of signaling
subunits. The groups include those depending on the IL-2R ( )(receptors for IL-2, -4, -7, -9, -13, and
-15)(3, 4, 5, 6) , the IL-3R
(receptors for IL-3, -5, and GM-CSF)(2) , and gp130 (receptors
for IL-6, IL-11, LIF, oncostatin M, and CNTF)(7, 8) .
Homodimeric hematopoietin receptors include those for
G-CSF(9, 10) , EPO(11) ,
prolactin(12) , growth hormone(13) , and probably
thrombopoietin(14, 15) . Each hematopoietin
receptor has been associated with control of proliferation of
hematopoietic cells. A modulating effect on transcription of early
growth response genes, such as c-fos, c-jun, junB, and c-myc, has been demonstrated for several of
these
receptors(10, 16, 17, 18, 19, 20) .
However, the function of hematopoietin receptors, whose expression has
been maintained during the course of cell differentiation, appears to
involve the transcriptional control of differentiated genes such as
neuropeptide genes by LIF and CNTF in neuronal
cells(21, 22) , genes for myeloperoxidase, elastase,
and G-CSFR by G-CSF in
granulocytes(18, 23, 24, 25) ,
cytokine genes by IL-2, IL-15, and IL-12 in NK
cells(24, 25, 26) , or acute phase plasma
protein genes by IL-6-type cytokines in hepatic cells(27) . A
major unanswered question is whether the regulation of proliferation
and of differentiated gene expression by a given hematopoietin receptor
is mediated by identical or distinct signal-transducing mechanisms. The intracellular initiation of signal transduction by
ligand-occupied hematopoietin receptors involves an immediate
phosphorylation of the receptor cytoplasmic domain concomitant with the
activation of receptor-associated protein tyrosine kinases. These
protein tyrosine kinases, depending upon the cell type, include members
of the Janus kinase family (JAK/Tyk) (28, 29) and src-related protein tyrosine
kinases(30, 31, 32, 33) . The change
in the phosphorylation state of the receptor promotes the binding of
the STAT (signal transducer and activation of transcription) proteins
to the receptor(28, 29) . One of the consequences of
protein tyrosine kinase action is the phosphorylation of the
receptor-recruited STAT protein(s) that lead to the STAT protein
dimerization and activation of DNA binding activity (34) . STAT
protein complexes binding to the sis-inducible element (SIE)
of the c-fos gene, termed SIF, for example, has been
recognized to be a common target of growth factors and hematopoietin
receptor signals(35) . Components of the DNA-bound complexes
include dimers of STAT-1, primarily activated by IFN (36) ,
STAT-3 (or APFR) (34, 37, 38) activated by
IL-6-type cytokine, STAT-5 activated by prolactin(39) , and
IL-4 STAT (or STAT-6) activated by IL-4(40, 41) . Structure/function analyses of hematopoietin receptor subunits
suggest that distinct subregions of the cytoplasmic domains of the
signaling receptor subunits control specific cell responses, such as
the regulation of early growth response genes by IL-2R (20, 42) and IL-3R (as part of the
GM-CSFR)(17) , and differentiated genes in monocytic,
neuroblastoma, and hepatic cells by gp130, LIFR, and G-CSFR (7, 9, 10, 43) . To assess the
complexity of intracellular signaling pathways which are activated by
various hematopoietin receptor types and which control expression of
differentiated genes, we developed tissue culture systems in which
receptor-specific gene regulatory functions were
reconstituted(44, 45) . By applying this experimental
approach, we have established a sensitive assay system for defining
common signaling mechanisms utilized by seemingly related receptor
structures. In this study, we used rat and human hepatoma, L-, and COS
cells for probing the interaction of IL-2R and representative members
of the other hematopoietin receptor groups with the intracellular
signal transduction machinery.
EXPERIMENTAL PROCEDURES
Cells and Cell TreatmentsReceptor functions
were determined in rat hepatoma H-35 cells (subclonal line of clone
T-7-18; (46) ), human HepG2 cells(47) , COS-1
cells and mouse L(tk ) cells. The cells were cultured
in Dulbecco's modified Eagle's medium (H-35 and L-cells) or
minimal essential medium (HepG2 and COS-1 cells) containing 10% fetal
calf serum, penicillin, streptomycin, and gentamycin. For comparison of
SIF activation, we used CTLL-2 cells which were cultured in RPMI
containing 10% fetal calf serum supplemented with 250 units/ml IL-2.
The cells were transferred to IL-2-free medium 16 h prior to
restimulation with IL-2. Dr. William Carlson, RPCI, provided highly
enriched fractions ( 97%) of human NK cells (CD56 CD3 ) prepared from peripheral blood leukocytes
as described(26, 48) . All cytokine treatments
occurred in serum-free minimal essential medium. Purified human
recombinant cytokines were used at the following concentrations except
where otherwise indicated: 100 ng/ml IL-2 (Cetus Corp.), IL-15, G-CSF,
LIF (Immunex Corp.), IL-6 (Genetics Institute), and growth hormone
(Genentech); 40 units/ml of Epo (Amgen); 10 ng of IFN (Genentech)
and 0.5 ng/ml IL-1 (Immunex Corp.). Ligand-independent activation
of G-CSFR-gp130 (49) was achieved by 0.5 mM suramin
(provided by Dr. G. Strassmann, Otsuka America Pharmaceutical).
IL-2R function was inhibited by adding 1 µg/ml anti-TAC
(= anti-IL-2R ) (provided by Dr. Steven Greenberg, RPCI) to
the assay medium containing the cytokines. Control cultures received
nonspecific immunoglobulins.
Receptor and JAK3 Expression VectorsThe
expression vectors used in this study are summarized in Table 1,
and several of these have been described before: human G-CSFR (isoform
D7 or 130-amino acid residue full-length cytoplasmic
domain(50) ), G-CSFR with truncated cytoplasmic domains to 96,
56, 27, and 1 (= cyto) amino acid residues(10) ,
IL-2R (51) , IL-2R ( )(52) ,
IL-2R ( cyto)(4) , IL-4R(53) ,
IL-7R(54) , and murine EpoR(55) . The chimeric receptor
constructs contained the extracellular domain of G-CSFR and the
transmembrane and cytoplasmic domains of the following receptors:
full-length or 150-amino acid residues of human LIFR (G-CSFR-LIFR and
G-CSFR-LIFR(150))(43) , gp130 (G-CSFR-gp130)(43) ,
c-mpl (G-CSFR-MPL)(56) , and IL-2R
(G-CSFR-IL-2R ). G-CSFR-IL-2R was constructed as
follows. The polymerase chain reaction primer pair, (5`)
GCTGAATTCCTGGGAAGGACACC and (3`) TATGCGGCCGCTACACCAAGTGAGTTGG, was used
to synthesize the transmembrane and cytoplasmic domain of the human
IL-2R (51) . The fragment was digested with EcoRI
and NotI, ligated with
Asp -EcoRI-digested fragment encoding the
extracellular domain of G-CSFR, and then inserted into
pCD302(53) . The expression vectors for human
IL-2R (57) , rabbit GHR (provided by Dr. W. I. Wood,
Genentech), and mouse JAK3 (58) were constructed by inserting
the blunt-ended full-length cDNA into the SmaI site of
pCD(59) .
CAT Reporter Gene ConstructsCytokine response was
defined by the stimulation of the CAT gene constructs listed in Table 1. The CAT gene constructs with the AGP gene-derived
elements included pAGP(3 DRE)-GRE-CAT (containing 3 copies of
the 142-base pair distal regulatory elements linked to the promoter
region -120 to +20 of the rat AGP gene; (66) ), p(4
CytRE)-SV-CAT and p(4 IL-1RE)-SV-CAT (containing 4
tandem copies of the region AB (=CytRE or 1-62 of the DRE)
and IL-1RE (1-36 of the DRE), respectively, 5` to the minimal
SV40 promoter in pSV-CAT; (60) ). The IL-6 signal-specific
reporter gene constructs were pHX(5 IL-6RE)-CAT containing 5
tandem copies of the IL-6RE of the rat hemopexin gene in the Bgl2 site of pCAT promoter vector (Promega)(61) ;
pHP(5 IL-6RE)-CAT containing 5 tandem copies of the B-element
core sequence of the rat haptoglobin gene (62) 5`-GATCCGTGGTTACTGGAACAGTA-3` into the Bgl2 site
of pCAT, and p FB(350)-CAT containing 350 base pairs of the
5`-flanking region of the rat -fibrinogen gene in
pOCAT(63) . For testing the signaling by nonhepatic receptors,
we also included p(4 SIE)-CAT (containing 4 tandem copies of
the high affinity SIEm67 5`-GATCCATTTCCCGTAAATCA-3` (35) in the Bgl2 site of pCAT); ( )and pHRRE-CAT (containing 8
tandem copies of the modified IL-6RE/APRE sequence,
5`-GATCCATCCTTCTGGGAATTCTGATCA-3` in the Bgl2 site of pCAT
vector.
TransfectionH-35, L-, and COS-1 cells were
transfected as described previously (45) by using the
DEAE-dextran method (64) and HepG2 cells by the calcium
phosphate method(65) . For CAT gene expression analysis, the
cells were transfected with plasmid DNA mixtures (10 µg in 1 ml per
10-cm dish), consisting of 6.6 µg of CAT plasmid, 1 µg of
receptor expression vectors, and, where required, supplemented with
pCD-JAK3 or empty expression vectors. pIE-MUP (1.3 µg) served as an
internal transfection marker(66) . After a 16-h recovery
period, the transfected cell culture was subdivided into a 6-well
cluster plate, and, 24 h later, the subcultures were treated with
cytokines for 24 h. The CAT activities in cell extracts were determined
and normalized to the amount of the major urinary proteins derived from
pIE-MUP (44, 66) and the values expressed relative to
the untreated control cultures (defined as 1.0).For analyzing
receptor expression and SIF activation, L- and COS-1 cells in 15-cm
diameter culture dishes were transfected with 30 µg of receptor
expression vector in 3 ml. The transfected cultures were subdivided
and, after a 24-h recovery, maintained for an additional 16 h in
serum-free medium. Cytokine treatments were then carried out for 15 min
(except where indicated).
Gel Mobility Shift Assay (GMSA)Whole cell,
cytosolic, and nuclear extracts were prepared according to the
procedure of Sadowski et al.(35) . The double-stranded
SIEm67 oligonucleotide was labeled by fill-in reaction using Klenow
fragment of polymerase and [ P]dCTP. Whole
cell extracts (5 µl) or nuclear proteins (10 µg) were
preincubated in a 20-µl reaction volume with 5 µg of
poly(dI-dC) for 15 min on ice followed by the addition of labeled probe
(20,000 cpm), and the binding reaction continued for 15 min at room
temperature. Ten µl of the reaction mixture were loaded onto a 4%
polyacrylamide gel in 0.5 Tris borate EDTA buffer. In all GMSA
experiments, a binding reaction with nuclear extracts from H-35 cells
treated for 15 min with IL-6 was included as an internal standard. The
radioactive pattern was visualized by autoradiography.
Analysis of Receptor Expression in L- and COS-1
CellsRNA was extracted from cells 40-48 h after
transfection (67) . Twenty µg of total cell RNA were
separated on formaldehyde-containing agarose gel, transferred to
nitrocellulose membrane, and hybridized to P-labeled cDNA
encoding IL-2R , IL-2R , or JAK3(58) , a 1-kilobase
Asp -EcoRI cDNA fragment encoding the
extracellular domain of G-CSFR(45) .To identify the
expression of the chimeric G-CSFR protein, transfected cells were
washed three times with phosphate-buffered saline, scraped off the
dish, and collected by centrifugation. Cells were solubilized in lysis
buffer (10 cells per 100 µl) containing 50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.5 mM Na VO , 1 mM phenylmethylsulfonyl
fluoride, 1 mM EDTA, 10 µg of aprotinin, and 10 µg of
leupeptin. After 20 min on ice, the extracts were centrifuged for 10
min at 25,000 g. The supernatants were pretreated with
20 µl of Protein G-Sepharose beads (Pharmacia Biotech Inc.) for 1 h
and then reacted for 16 h with 5 µl of rabbit anti-human G-CSFR
serum(33) . The immune complexes were collected on Protein
G-Sepharose beads and eluted by washing four times with lysis buffer.
After solubilization by boiling in SDS sample buffer, proteins were
separated on a 6% SDS-polyacrylamide gel and electroblotted onto
Immobilon membrane (Millipore). The membrane was incubated for 6 h with
sheep anti-human G-CSFR. This sheep antiserum was generated in
collaboration with Greystone Therapeutics, Inc. by intranodal injection
of maltose binding protein fused to the extracellular domain of human
G-CSFR (residues 48 to 316). The membrane was then treated with rabbit
anti-goat immunoglobulin followed by alkaline phosphatase-conjugated
goat anti-rabbit immunoglobulin (Bio-Rad). The Western blot was
developed with a 5-bromo-4-chloro-3-indolyl phosphate p-toluidine/p-nitro blue tetrazolium chloride
reaction (Bio-Rad).
RESULTS
IL-2R Regulates Transcription in H-35 CellsThe
IL-2R subunit contains in its cytoplasmic domain the conserved
sequence motifs box 1 and box 2 which are required for generating a
proliferative signal and activating of immediate early growth response
genes(68, 69, 70) . Since the
signal-transducing subunits of the IL-6-type cytokine receptors, G-CSFR
and c-mpl, which also contain the box 1 and box 2 motifs, are
capable of activating transcription via the cytokine response element
(=CytRE) of the AGP gene in transfected hepatoma
cells(45) , we wondered whether the IL-2R could similarly
recruit this hepatic signal transduction machinery. Rat hepatoma H-35
cells do not respond to IL-2 or IL-15 individually or in combination
(data not shown). We therefore transfected into these cells various
combinations of expression vectors for IL-2R subunits along with the
cytokine-responsive reporter gene construct pAGP(3 DRE)GRE-CAT.
The IL-2R action in the transfected cells was assessed by treatments
with its two ligands, IL-2 or IL-15(71) , and compared to the
response elicited by the endogenous IL-6R (Fig. 1).
Figure 1:
Reconstitution of IL-2R function in
H-35 cells. Expression vectors for the IL-2R subunits (indicated at the top) were transfected together with pAGP(3
DRE)-GRE-CAT into H-35 cells. Four subcultures of each transfection
were treated with medium alone (Control) or medium containing
either IL-2, IL-15, or IL-6. CAT activity was quantitated and expressed
relative to the control in each experimental series (number above the autoradiogram).
The three
IL-2R subunits individually did not reconstitute an IL-2 response.
Although the combination of IL-2R and - or IL-2R and
- has been described to reconstitute IL-2 binding
activity(52) , no regulation of the reporter gene was achieved.
The combination of IL-2R and - , however, produced an
20-fold stimulation of CAT activity. Inclusion of IL-2R did
not detectably improve the magnitude of regulation. In several
independent experiments, we observed that the maximal IL-2 response was
consistently one-half of the IL-6 response (see Fig. 1and Fig. 5below) and that there was no discernible difference in the
response to IL-2 and IL-15 (Fig. 1).
Figure 5:
IL-2 regulation of various cytokine
response elements. The combinations of IL-2R , - , and -
were co-transfected with the CAT reporter gene constructs indicated at
the bottom into H-35 cells. The -fold stimulation of the CAT
activity by IL-2, IL-6, and IL-1 was determined. Mean and S.D. of
three separate experiments are shown.
The regulation via the
AGP gene elements is not specific to hematopoietin receptors and is
also accomplished by various other cytokines and hormones such as IL-1,
tumor necrosis factor, insulin, and hepatocyte growth
factor(72, 73) . Therefore, we developed an
alternative response element that was specific to hematopoietin
receptor signals and that could be used to compare the activities of
different hematopoietin receptors. Oligonucleotides representing
modified IL-6RE/APFR (60, 74) sequences were
synthesized, multimerized, incorporated into CAT reporter gene
constructs, and tested for regulation by co-expressed hematopoietin
receptors. We selected one construct that was highly responsive to the
signal of hematopoietin receptors which contained at least an
equivalent of the box 1 motif (e.g. G-CSFR(27)). The sequence was termed ``hematopoietin receptor response
element'' (HRRE). Cells co-transfected with IL-2R subunits and
HRRE-CAT construct yielded a 300-fold stimulation of CAT gene
expression by IL-2 that was similar to that achieved by IL-6 (Fig. 2A). The regulation of HRRE differed from that of
AGP-CytRE by not being responsive to either IL-1 or insulin. The
magnitude of IL-2 stimulation of HRRE was somewhat variable from
experiment to experiment, probably due to the relatively low basal
activity of the HRRE-CAT construct in untreated cells. Nevertheless,
the IL-2R activity appeared to be similar to that of the functionally
related IL-7R and other members of the hematopoietin receptor family
such as GHR, EPOR, LIFR, and G-CSFR (Fig. 2B). An
exception was the relatively low regulation mediated by IL-4R.
Furthermore, GHR was unique among the transfected hematopoietin
receptors in that it consistently produced an elevated basal expression
of the CAT reporter gene suggesting a ligand-independent signaling
reaction. Taken together, the results indicate that IL-2R is capable of
exerting a prominent cytokine- and hematopoietin-receptor signal in the
heterologous hepatoma cells which are comparable to those elicited by
other members of the hematopoietin receptor family including the
resident IL-6R.
Figure 2:
Regulation of pHRRE-CAT gene by
hematopoietin receptors in H-35 cells. In two separate experimental
series (A and B), H-35 cells were transfected with
pHRRE-CAT and the mixture of expression vectors for IL-2R , - ,
and - (A) or with pHRRE-CAT and the receptor expression
vectors indicated at the top in B. Subcultures of
each transfected cell culture were treated with the cytokines listed at
the bottom. CAT activity was determined in 10-fold serially
diluted extracts and calculated relative to the control culture in each
experimental group (values given above the autoradiographic
image).
Relative Contribution of IL-2R Subunits to
SignalingTo define the relative contribution of the IL-2R
subunits to the reconstituted IL-2 response, H-35 cells were
transfected with various combinations of receptor subunits, together
with either the CytRE- or HRRE-containing CAT reporter gene constructs,
and then challenged with increasing concentrations of IL-2 (Fig. 3A). The combination of IL-2R and - was
necessary to achieve gene regulation. The dose response was identical
for both reporter gene constructs. With IL-2R present, the IL-2
sensitivity of the transfected cells increased 10-fold. However,
the maximal magnitude of stimulation showed only a minor enhancement.
When the transfected H-35 cells were treated with IL-15 instead of
IL-2, an identical 10-fold improvement of the responsiveness was
observed as a function of the IL-2R subunit (data not shown). The
role of the IL-2R subunit to the action of IL-2R and -
complex was also assessed by treating the transfected H-35 cells with
anti-Tac (anti-IL-2R antibodies) (Fig. 3B). In the
presence of the receptor antibody, the dose response for IL-2, as well
as for IL-15, indicated an approximately 10-fold reduced sensitivity.
These data support the model that IL-2R in hepatic cells, like in
other systems(52, 57) , confers an enhanced ligand
binding onto IL-2R.
Figure 3:
A,
dose response of IL-2R action. H-35 cells were transfected with pAGP(4
CytRE)-SV-CAT (top panel) or pHRRE-CAT (bottom
panel) together with the expression vectors for the indicated
IL-2R subunits. Cultures were divided into seven subcultures which were
then treated with the IL-2 concentrations listed on the abscissa. The change in CAT activity relative to the control
culture (0 nM IL-2) was calculated. B, effect of
anti-IL-2R on IL-2R function. H-35 cells were transfected with
expression vectors for IL-2R , - , and - and pHRRE-CAT.
The cultures were divided into two sets of 10 subcultures. One set was
treated with serially diluted IL-15 (5 duplicates) and the other with
IL-2. In each set, one of each duplicate received 1 µg/ml
nonspecific immunoglobulin, and the other 1 µg/ml anti-TAC (anti-IL-2R ). After 24 h, the increase of CAT activity
relative to the control cultures was
determined.
The Cytoplasmic Domain of IL-2R Is Sufficient for
RegulationEarlier studies of IL-2R action in fibroblasts and
hematopoietic cells indicated that signal transduction required the
cytoplasmic domains of both the and
subunits(20, 52, 69, 70) . We
determined the significance of the cytoplasmic domain of the two
subunits indirectly by using either IL-2R or IL-2R lacking
its cytoplasmic domain (IL-2R ( cyto) or
IL-2R ( cyto))(4) . In a separate experiment (data not
shown), we verified by mRNA analysis that the vectors were expressed in
H-35 cells. Neither the combination of the truncated IL-2R with
full-length IL-2R nor the truncated IL-2R with full-length
IL-2R reconstituted CAT reporter gene activation, even at IL-2
concentrations as high as 5 µg/ml ( Fig. 1and data not
shown).To assess whether the cytoplasmic domains of IL-2R and
- initiated signaling independently of each other, we transfected
chimeric receptors consisting of the extracellular domain of G-CSFR and
the transmembrane and intracellular domain of either IL-2R or
- . The chimeric receptors were predicted to function as
ligand-induced homodimers. Like the bona fide IL-2R ( Fig. 1and 2A), the G-CSFR-IL-2R chimera proved to
be as active in regulating AGP-CAT (Fig. 4A) and
HRRE-CAT (Fig. 4B). G-CSFR-IL2R was ineffective on
AGP-CAT (Fig. 4A) and HRRE-CAT (data not shown) and did
not significantly enhance the magnitude of stimulation achieved by
G-CSFR-IL-2R (Fig. 4A and data not shown).
Figure 4:
Activity of the G-CSFR-IL-2R chimeras. The
receptor expression vectors, combined with the CAT gene constructs
listed at the top in A or HRRE-CAT in B, were
transfected into H-35 cells. Subcultures were treated with the
cytokines listed at the bottom, and the CAT activity was
quantitated relative to the control
cultures.
The IL-2R Signals Do Not Act on IL-6RE or
SIEPrevious characterizations of IL-6-type cytokine receptors
and G-CSFR indicated that the strong activation of gene expression via
IL-6REs of several APP genes was characteristic for cytoplasmic
receptor domains that included a box 3 sequence
motif(43, 45) . To determine whether the IL-2R action
on hepatic cells also included an IL-6-type signal, the IL-2R subunits
, , and were transfected into H-35 cells together with
CAT reporter gene constructs containing IL-6REs of three separate APP
genes, or, for comparison, the AGP cytokine response elements, HRRE and
SIE (Fig. 5). The activity of IL-2R regulation of these elements
was determined relative to the response achieved by the appropriate
endogenous receptors. However, whereas the signaling activity of the
IL-2R was clearly evident with the CytRE of the AGP gene, no response
was recorded through the IL-6REs and the SIE. Similarly, the chimeric
G-CSFR-IL-2R acted prominently on CytRE and HRRE, but not
detectably on IL-6RE and SIE (see Fig. 4B and data not
shown).The gene element specificity of the signals derived from the
IL-2R or G-CSFR-IL-2R was not restricted to H-35 cells.
Transfection of the same reporter gene constructs and receptor
expression vectors into human HepG2 cells yielded essentially the same
pattern of regulation except that the numerical values for the
magnitudes of cytokine responses were not as high as in H-35 cells
(data not shown; see also Fig. 11below).
Figure 11:
Action of JAK3. A, effect of
JAK3 on receptor action in HepG2 cells. HepG2 cells were transfected
with a mixture containing the plasmid DNAs indicated at the top. The reporter gene was pHP(5 IL-6RE)-CAT. The
subcultures were treated with the cytokines as indicated at the bottom. In each experimental set, the CAT activities were
normalized to the internal major urinary protein marker and expressed
relative to untreated control culture that did not receive JAK3. B, dose response of JAK3. Two sets each of HepG2 and H-35
cells were transfected with a DNA mixture containing increasing amounts
of pCD-JAK3 and constant amounts of expression vector for IL-2R ,
IL-2R , IL-4R, and IL-7R or EPOR alone. The reporter construct for
all was pHP(5 IL-6RE)-CAT. Subcultures of each set were treated
with IL-2, IL-4, IL-7, EPO, or IL-6, and the -fold stimulation of CAT
activity was taken as an indicator for the action of the appropriate
receptor listed at the left.
IL-2R Does Not Activate SIF in Transfected
CellsSignal initiation by several hematopoietin receptors has
been linked to the activation of STAT
proteins(28, 29) . These proteins avidly bind to SIE,
or sequence-similar oligonucleotides, and are recognized on GMSA as
multiple complexes which have been termed, among others, SIF-A, -B, and
-C(35) . Since IL-2R is functional in transfected H-35 cells,
we asked whether IL-2R has similar SIF-inducing activity. Detection of
STAT protein activation by transiently transfected receptors was,
however, not technically feasible in H-35 cells primarily because of
the low transfection efficiency of these cells and thus low level
expression of receptor protein(45) . Moreover, stably
transfected H-35 cell lines proved to be difficult to establish, and
receptor expression in almost all selected lines was lost during
extended culture periods. Therefore, we resorted to the use of L-cells
and COS-1 cells which, like hepatoma cells, not only responded to IL-6
and LIF by a robust activation of SIF, but also permitted high level
expression of transiently transfected receptor. The switch to
nonhepatic cells demanded, however, that we demonstrate in these cells
at least qualitatively similar receptor functions as defined in
hepatoma cells. A correlation of receptor protein expression with SIF
activation and CAT gene regulation in the same transfected
cell culture was possible in L-cells, because these cells regulated the
same IL-6RE and HRRE-CAT reporter gene constructs as H-35 cells, albeit
at a much lower magnitude of stimulation. COS-1 cells yielded a 10-fold
higher expression of transfected receptor than L-cells but could not be
used for determining gene regulation because all our CAT reporter gene
constructs contained SV40 promoter sequences which caused high
constitutive expression in COS-1 cells.The salient features of the
receptor assay developed for L-cells are shown in Fig. 6. In
this example, we used progressively truncated G-CSFR to demonstrate (a) the relevance of three box motifs in the cytoplasmic
domain for signaling and (b) the relationship of receptor
expression, SIF activation, and CAT gene regulation. All transfected
plasmids were expressed as detected by analysis of mRNA (Northern blot)
and protein (Western blot). The box 3 motif containing G-CSFR 130 and
96 yielded a prominent activation of SIF-A with a minor one of SIF-B.
In contrast, G-CSFR(56) , lacking box 3 motif, was only
minimally effective. The transfected receptor activated the same SIF
forms as the endogenous IL-6R and IL-11R, and these were clearly
different from SIF-C activated by IFN (Fig. 6). Although
the relative electrophoretic mobilities of the SIF complex of L-cells
were indistinguishable from those of IL-6-treated H-35 cells, the
composition of SIF activities was not identical. In H-35 cells, the
immediate response to all IL-6-type cytokine receptors was a strong
stimulation of all three SIF forms with only SIF-A being maintained
during subsequent hours. The ability of G-CSFR forms to
activate SIFs appeared to correlate with the ability to regulate the
IL-6RE-CAT construct (Fig. 6, bottom panel).
Figure 6:
Functional analysis of G-CSFR in L-cells.
Six cultures of L-cells in 15-cm dishes were transfected with 3 ml of a
solution of DNA-DEAE-dextran mixture consisting of 10 µg of pHP(5
IL-6RE) CAT and 30 µg of expression vector for G-CSFR forms
listed at the top. After 16 h, each cell culture was released
by trypsin and divided into one culture in a 15-cm dish (for Northern
and Western blot and GMSA) and 2 cultures in 3.5-cm dishes (for CAT
activity). Twenty-four h later, the cells in the 15-cm dishes were
changed to serum-free medium, and, after 16 h, cells were treated for
15 min with serum-free medium containing G-CSF. The cells were scraped
off the dish, and one-third of the cell suspension was removed for RNA
extraction, one-third for immunoprecipitation and Western blot
analysis, and the remainder for GMSA. Aliquots of 20 µg of total
cellular RNA were analyzed by Northern blot hybridization to P-labeled cDNA encoding the extracellular domain of
G-CSFR. Equal loading of RNA is demonstrated by the ethidium bromide
staining of the 18 S rRNA band (top panels). The cells for
Western blot analysis were lysed, and the supernatant fraction after
centrifugation was subjected to immunoprecipitation with rabbit
anti-human G-CSFR. The precipitates were separated and processed for
Western blotting. For GMSA, 5 µl of whole cell extract was reacted
with P-labeled SIE. Nuclear extract of IL-6-treated H-35
cells served as a standard (Std). For comparison, the
activation of SIF in control L-cells treated with serum-free medium
alone (control) or containing IL-6, IL-11, or IFN- is illustrated.
The autoradiogram of SIF complex as formed by extract of
G-CSFR-transfected cells was exposed for 3 days. The autoradiogram of
the complex by the H-35 standard and untreated L-cells was exposed for
6 h. The two cultures in 3.5-cm dishes were treated for 24 h with or
without G-CSF, and the CAT activity was determined. The relative change
in CAT activity is indicated above the
autoradiogram.
IL-2
did not increase SIF activity in nontransfected L-cells (Fig. 7A). Although transfection of either the
combination of IL-2R , - , and - or G-CSFR-IL-2R
reconstituted an IL-2 regulation of co-transfected HRRE-CAT construct (Fig. 7B, bottom panel), no IL-2-inducible
protein binding to either SIE or HRRE was detectable (Fig. 7B, middle panel). The expression of the
transfected receptor was demonstrated in the case of G-CSFR-IL-2R (Fig. 7B, top panel).
Figure 7:
Action of IL-2R in L-cells. A,
response of untransfected L-cells. Cells in 10-cm dishes were treated
for 15 min with medium alone or containing IL-6, LIF, or IL-2. Whole
cell extracts were subjected to GMSA. Positions of SIF-A, -B, and -C
were compared to the standard consisting of nuclear protein extracted
from IL-6-treated H-35 cells. The autoradiogram was exposed for 16 h. B, two separate cultures of L-cells in 15-cm dishes were
transfected with 3 ml of DNA-DEAE-dextran solution containing pHRRE-CAT
(10 µg) and either a mixture of IL-2R , - , - (10
µg each) or G-CSFR-IL-2R (30 µg). The cultures were
divided into two 10-cm dishes and two 3.5-cm dishes. The 10-cm dishes
were treated for 15 min with either medium alone or IL-2 or G-CSF.
Whole cell extracts were prepared. One-fourth of the cells transfected
with G-CSFR was removed prior to extraction and subjected to Western
blot analysis. Duplicate aliquots of 5 µl of cell extract were used
for GMSA using either P-labeled SIE or HRRE as probe.
Extract of IL-6-treated H-35 cells was included at the left as
standard. The autoradiogram was exposed for 5 days. Cells in 3.5-cm
dishes were treated for 24 h as indicated at the bottom, and
the CAT activity was determined. Relative change is listed above the
autoradiogram.
The failure to detect
SIF activation by IL-2R in L-cells may be attributed to either one or
both of the following: (a) insufficient expression of the
receptor subunits or (b) lack of signal transducing components (i.e. JAK3 and its target STAT proteins) that are utilized by
IL-2R to produce SIF activity in
lymphocytes(58, 75, 76, 77) . To
assess the influence of receptor levels, we transfected the IL-2R forms
into COS-1 cells which yielded high expression of the plasmids as
determined by mRNA (Fig. 8A) and protein analysis (Fig. 8B). COS-1 cells that received either the
combination of IL-2R , - , and - (Fig. 9A, lanes 3 and 4) or G-CSFR-IL-2R (Fig. 9B) failed to show any receptor-inducible SIF
activity. Similarly negative was the transfected G-CSFR-IL-2R (Fig. 9B, lane 13). COS-1 cells were able to
utilize transfected receptor forms to activate SIF as demonstrated by
the example of G-CSFR-gp130 (Fig. 9A, lanes
7-11), G-CSFR-LIFR (Fig. 9B, lane
20), or G-CSFR (lane 21). The response elicited by these
receptors was compared to the response derived from the endogenous IL-6 (lane 12) or LIF receptor (lane 5). Surprisingly,
hematopoietin receptors, such as G-CSFR-MPL (lane 14), EPOR (lane 17), and GHR (lane 19), all of which, like
IL-2R, were unable to stimulate expression of IL-6RE-CAT constructs,
did nevertheless activate SIF. These data suggest that receptor action
on gene expression (HRRE or IL-6RE) in either hepatoma or L-cells does
not strictly correlate with the ability of the same receptor to connect
with the SIF activation pathway as measured in L-cells and COS cells.
Figure 8:
Expression of transfected receptors in
COS-1 cells. COS-1 cells in 15-cm dishes were transfected with
expression vector for the indicated receptors. A, total cell
RNA was extracted, and 20-µg aliquots were analyzed by Northern
blot hybridization. Autoradiograms were exposed for 24 h. B,
cells were lysed, and the chimeric receptors were immunoprecipitated
with rabbit anti-human G-CSFR. The extract from nontransfected COS-1
cells served as a control. The precipitates were subjected to
electrophoresis on a 6% SDS gel. The proteins were analyzed by Western
blotting using sheep anti-human G-CSFR. The receptors migrated with an
apparent molecular size of 120 to 100,000.
Figure 9:
Activation of SIF by transfected
receptors. COS-1 cells were transfected in two separate experiments (A and B), with the expression vectors for the
receptors indicated at the bottom. Subcultures were treated
for 15 min with the listed cytokines or suramin (in A, lanes 7-10, the G-CSFR concentration in ng/ml). Whole
cell extracts were prepared and analyzed by GMSA using SIE as a probe.
The SIF pattern of H-35 cells treated with IL-6 served as standard (Std). The autoradiograms were exposed for 3
days.
JAK3 Reconstitutes an IL-6 Signal and SIF Activation by
IL-2R in HepG2 CellsWe determined gene regulatory activities of
IL-2R in nonlymphoid cell lines which are known to be devoid of an
endogenous IL-2R response. The fact that transfected IL-2 mediated an
HRRE signal equal to other hematopoietin receptors indicated that this
cell response was not dependent on cell-type-restricted signaling
molecules. However, the failure to detect an IL-6RE activation by IL-2R
in hepatic cells and a SIF activation in L-cells and COS-1 cells may be
explained by the absence of the signal communication pathway that is
specific to naturally IL-2-responsive cells, such as the pathway
involving leukocyte-restricted protein tyrosine kinase
JAK3(58, 75, 76, 77) .To assess
the potential of IL-2R to regulate SIF activity, we subjected
IL-2-deprived CTLL-2 cell cultures to an IL-2 restimulation (Fig. 10A). A transient activation of a SIF pattern was
detected (lane 6) that consisted of two binding complexes
co-migrating with SIF-A and SIF-B of either IL-6-treated H-35 cells (lane 1) or L-cells (lane 3).
Figure 10:
A,
stimulation of SIF in CTLL-2 cells by IL-2. A culture of CTLL-2 cells
was maintained 16 h in RPMI containing 0.5% fetal calf serum without
IL-2. The cells (75 10 ) were centrifuged, and the
pellet was resuspended in 15 ml of serum-free minimal essential medium
and divided into 3 equal aliquots. To two cultures, IL-2 was added,
and, after 15 min at 37 °C, the control (lane 5) and one
IL-2-treated culture (lane 6) were extracted. The second
IL-2-treated culture (lane 7) was extracted after 2 h. Whole
cell extracts were subjected to GMSA using SIE as probe. The standard
was a nuclear extract of IL-6-treated H-35 cells (lane 1),
and, for comparison, whole cell extracts of control L-cells (lane
2) or L-cells treated for 15 min with IL-6 (lane 3) or
IFN- (lane 4) were included. The autoradiogram was
exposed for 24 h. B, expression of JAK3 mRNA. A polyadenylated
RNA fraction (10 µg) from CTLL-2, L-, and H-35 cells was subjected
to Northern blot analysis using P-labeled mouse JAK3 cDNA
as probe. The autoradiogram is shown in the upper panel. The
mRNA band and the position of the rRNA markers are indicated. The lower panel shows the ethidium bromide staining pattern of the
gel-separated RNAs.
The fact that SIF
activities are induced in CTLL-2 cells by IL-2 suggests that these
cells do have a signaling pathway involving STAT proteins and that this
pathway does not exist in L-cells and COS-1 cells and probably also in
hepatoma cells (see Fig. 12below). JAK3 and/or its target STAT
proteins appeared as a mostly likely constituent of such a lymphoid
cell-restricted SIF regulatory
pathway(58, 75, 76) . We determined JAK3 mRNA
in L-, H-35, and CTLL-2 cells by Northern blot analysis (Fig. 10B) and, as expected, observed a prominent JAK3
mRNA signal in CTLL-2 cells. However, both L-cells and H-35 cells also
revealed a hybridizing band, albeit at a much lower relative level. The
result in Fig. 10suggested that an insufficient amount of JAK3
relative to the overexpressed IL-2R subunits might be one reason for
the lack of STAT activation in L-cells and COS-1 cells. To correct this
presumed unfavorable ratio, we prepared an expression vector for JAK3,
co-transfected that along with IL-2R subunits into each of the test
cells used in this study, and determined its influence on the receptor
action, i.e. on gene regulation and SIF activation.
Figure 12:
Reconstitution of SIF activation by JAK3.
L-, COS-1, and HepG2 cells were similarly transfected with the plasmid
DNAs containing the expression vector indicated at the top.
Subcultures in 6-cm diameter Petri dishes (L- and COS-1 cells) or
6-well cluster plates (HepG2 cells) were treated for 15 min with the
cytokines listed above the panels. Whole cell extracts were subjected
to GMSA using SIE as probe. For comparison of the electrophoretic
pattern of IL-2- and IL-4-inducible SIFs, normal human NK cells were
included in the analysis. The autoradiograms for the lanes containing
the transfected cell extracts were exposed for 3 days. The standards
consisting of extracts from cytokine-treated, but not transfected,
cells were exposed for 6 h. The lanes with control and
IL-4-treated NK cell extract were exposed for 3 days, and the lane of IL-2-treated cells for 8 h. The position of the SIF-A, -B, and
-C (defined by the pattern of the IL-6 treatment) is indicated at the left. The IL-2- and IL-4-induced bands are marked by open
arrowheads at the right.
When we
included JAK3 into the H-35 cell assays as shown in Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5, we
did not observe an appreciable change in qualitative pattern of CAT
gene regulation by any of transfected or endogenous hematopoietin
receptors. In particular, we could not detect any activation of IL-6RE
CAT constructs by either IL-2R, IL-4R, or IL-7R (data not shown; see
also Fig. 11B). However, JAK3 enhanced approximately 2-
to 10-fold the basal and maximally 2-fold the cytokine-stimulated
expression of the HRRE and CytRE CAT constructs in those cells that
received IL-2 and - , or the combination of IL-2R with
either IL-4R or IL-7R (data not shown). The action of the chimeric
receptors G-CSFR-IL-2R and G-CSFR-IL-2R (individually or in
combination), as well as of G-CSFR-MPL, IL-6-type cytokine receptors,
G-CSFR, EPOR, and GHR was unaffected by JAK3. A different result was
obtained when the effects of overexpressed JAK3 on gene regulation was
determined in HepG2 cells (Fig. 11). Similar to the findings in
H-35 cells, JAK3 was ineffective in modulating the action of IL-6-type
cytokine receptors, G-CSFR-MPL, EPOR, and GHR. In combination with the
functional receptors that included the IL-2R subunit, JAK3
elevated signaling toward HRRE and CytRE. Surprising, however, was that
in the presence of JAK3 both the IL-2R  complex and
IL-4R, but not IL-7R, gained the ability to activate CAT gene
constructs containing the IL-6RE (Fig. 11A) or SIE
(data not shown). The magnitude of stimulation was in the range of that
mediated by IL-6R. Although JAK3 did not elicit an IL-6 signal with
either G-CSFR-IL-2R or G-CSFR-IL-2R , with both chimeric
receptors combined, JAK3 again mediated a prominent IL-6RE regulation (Fig. 11A). Dose-response analyses indicated that
maximal IL-6RE regulatory action of both IL-2R and IL-4R was achieved
with a ratio of 0.2 µg of JAK3 expression vector versus 1
µg of receptor expression vector (Fig. 11B). Higher
relative amounts of JAK3 expression vector in the transfection mixture
did not enhance or diminish receptor action. The comparison also
revealed that the JAK3-dependent signaling was more effective with
IL-4R than IL-2R (Fig. 11B) and that the relative
activity of the two receptors was reversed and then compared to the
HRRE signal (see Fig. 2B). The finding that JAK3
established an IL-6-type response by IL-2R and IL-4R in HepG2 cells
suggested that an additional productive signal pathway via JAK3 has
been reconstituted. To identify whether the action of JAK3 was also
necessary for the activation of STAT proteins in L-cells and COS-1
cells, a combination of expression vectors for JAK3, IL-2R, and IL-4R
was transfected into these cells, and the cytokine effect on SIF
activities was measured. Neither receptor reconstituted a SIF activity
in L-cells (Fig. 12). By contrast, in COS-1 cells, we observed
an IL-4-, but not an IL-2-mediated SIF stimulation. The response to the
two cytokines was, however, not detectably modified by the
co-transfected JAK3. In both cell types, we established by mRNA
analysis that the JAK3 expression vector was highly active (data not
shown). From these results, we concluded that in L-cells and COS-1
cells the failure of reconstituting an IL-2R response on STAT protein
was probably not due to lack of JAK3 but due to the absence of
JAK3-regulated STAT proteins. Based on the observations that
prominent IL-6-type gene regulation correlated with SIF activation (Fig. 6) and that JAK3 introduced this type of gene regulation
through IL-2R and IL-4R in HepG2 cells (Fig. 11), we expected
that JAK3 will also reconstitute SIF activation in HepG2 cells.
Therefore, we applied the transient transfection protocol established
for receptor analysis in L-cells to HepG2 cells. Although based on mRNA
analysis the relative level of receptor expression per transfected cell
culture was approximately 15 times lower in HepG2 cells than L-cells
(data not shown), we could nevertheless reconstitute a JAK3-sensitive
STAT protein activation by both the IL-2R and IL-4R (Fig. 12).
The induced SIF complex co-migrated with SIF-B and -C and yielded an
electrophoretic pattern comparable to that activated by the same
cytokines in human NK-cells. Taken together (Fig. 13), we
conclude that: (a) HepG2 cells do express the STAT proteins
that are substrates of JAK3; (b) these STAT proteins may serve
as mediators of the IL-6 signal; (c) the specificity of gene
regulation by hematopoietin receptors is controlled by the receptor
subunit complex, receptor-associated kinase(s), STAT proteins, and gene
elements; and (d) reconstitution of the receptor signaling
pathways in heterologous cell systems permit dissection of the
complexity and specificity of the signal transduction pathways leading
to the control of gene expression.
Figure 13:
A summary of cell responses activated by
hematopoietin receptors. The diagram lists the receptor forms with the
subunit combinations believed to be necessary for signaling action. The
position of the box 1, 2, and 3 motifs (LIFR contains 2 copies of the
box 3 motif but no functional box 1) and the two IL-4 STAT binding
sites in IL-4R are marked by bars. The IL-6R and LIFR
represent endogenous receptors, the others are those transfected in
this study. Below the diagrams, the qualitative responses elicited by
the receptors are listed. The regulation of specific gene elements by
the receptors has been determined in hepatoma cells. The activation of
STAT proteins, which are detectable as SIFs, is identified in L- and
COS-1 cells (the specific forms of STAT proteins involved in the SIF
complexes have not yet been determined). The ability of the receptor to
activate the JAK3-specific pathway is defined in HepG2 cells. Wherever
we could not detect a positive action (less than 10% of maximal
response), no entry has been made.
DISCUSSION
The various types of hematopoietin receptors are often
expressed in cells of widely different phenotypes; their unique
cellular contexts thus preclude a direct comparison of receptor action.
Recognizing the structural relationship among hematopoietin receptors,
some common signaling mechanisms have been
suspected(2, 28, 29) . We reasoned that the
regulation of differentiated genes in one given cell type will provide
defining features of receptor signals which are more readily assessed
than the proliferative cell response activated by the same receptors in
hematopoietic cells. Our study has demonstrated that transient
expression of IL-2R and - subunits in hepatic cells
reconstitutes IL-2- and IL-15-specific gene activation (Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5); a
process that is, in part, shared among other members of the
hematopoietin receptor family (Fig. 13). The similarity in the
cell response, e.g. HRRE regulation, suggests that each of the
hematopoietin receptors, regardless of its cellular origin, might
utilize the same signal transduction mechanism in the test cells and
that this mechanism might also be operative in other, nonhepatic cell
types. The reconstitution of IL-2R signaling function in the
heterologous cell systems permitted us to define the contribution of
lymphoid-specific JAK3 and its substrate STAT proteins in regulating
expression of differentiated genes (Fig. 6Fig. 7Fig. 8Fig. 9Fig. 10Fig. 11Fig. 12).
The fact that we gained a JAK3-dependent regulatory action on IL-6RE,
while maintaining essentially unchanged the HRRE and CytRE regulation,
strongly suggests that two separate IL-2R signals exist. One signal
pathway is independent of JAK3, is targeted to HRRE and CytRE, and is
not detectably correlated with SIF activation; the other signal
requires JAK3 and appropriate substrate STAT proteins and leads to gene
activation via IL-6RE. Our results present new aspects of
hematopoietin receptor function; that is, the control of differentiated
genes. Since the characterization of the receptors occurred in a
heterologous cell system, the question arises as to the physiologic
relevance of the potential receptor function in the homologous cell
system, i.e. IL-2R action in lymphoid cells. The fact that the
proliferation signal produced by IL-2R could, in part, be correlated
with the control of immediate early growth response
genes(16, 20, 42) suggests that gene
regulatory mechanisms in lymphoid cells exist and that these may
involve pathways analogous to those uncovered in transfected hepatic
cells. An IL-2R signaling mechanism similar to that in hepatic cells
seems even more likely to be found in differentiated lymphocytes, such
as in NK cells in which the monocyte-derived IL-15 does not exert a
proliferative response but stimulates the expression of several
cytokine genes(26) . The ease of gene transfection and the
prominence of specific gene regulation in hepatic cells offer the great
advantage of transient genetic manipulation and facilitate dissection
of signaling pathways linking the receptor with the regulation of
specific gene elements. Clearly, hepatic or fibroblastic cells cannot
fully substitute for lymphoid cells because of their cell type-specific
differences in make-up of signal transducing molecules and in the set
of target genes controlled by the signals. However, these differences
render our assay system even more attractive for studying hematopoietin
receptors because the specific function of the cell-type restricted
signaling factor(s) can be defined by complementation. The broadening
of the IL-2R signal specificity by JAK3 in HepG2 cells is a case in
point ( Fig. 11and Fig. 12). One shortcoming of
hepatoma cells is that the isolation of stably transfected lines is
difficult and unpredictable and, therefore, makes these cells, unlike
lymphoid cells(69, 70) , unsuitable for analyzing the
proliferative response, if any, elicited by the introduced receptor. To
define the overlap of proliferation and gene control with respect to
the signaling pathways, we will have to rely on comparison of data
derived from multiple systems. The fact that transfected IL-2R and
other nonhepatic receptors mediated transcriptional activation of
specific gene constructs ( Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5and
10; (45) ) indicated an effective interaction of these
receptors with the signal transduction mechanism in the heterologous
system. Although the responses appeared receptor-specific, the results
do not unequivocally prove that the action of the introduced receptor
subunits was fully accountable for the observed regulation, because
hepatoma cells, like most other cells, possess a set of hematopoietin
receptor subunits, some of which may potentially contribute to or
interfere with the transfected receptor action. We showed (Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5)
that the combination of human IL-2R and - is necessary to
elicit a HRRE signal in our cell system. The same subunit requirements
were noted for proliferative response and control of early response
genes in pre-B-cells(68, 69, 70) . The
importance of the cytoplasmic domain of the two subunits for the
hepatic action was inferred from experiments involving IL-2R subunits
with truncated cytoplasmic domains (Fig. 1) and G-CSFR-IL-2R
chimeras (Fig. 2). The cytoplasmic domain of IL-2R in the
artificial context of the G-CSFR-mediated dimer performs essentially
the same signaling event as the   complex. A related
observation was made by Nelson et al.(70) who
demonstrated that similar proliferative signals were generated by the
normal   complex and the chimeric construct
c-kit-IL-2R in BAF cells. Interestingly, this
c-kit-IL-2R -restricted regulation was cell type-specific
because it was not reproducible in CTLL-2 cells. The combined data
suggest that the subunit acts as a critical determinant in
initiating signal transduction both in hematopoietic and hepatic cells.
The functional relevance of specific regions in the subunit
cytoplasmic domain has been documented by the identification of the
structural elements which are critical for signaling in hematopoietic
cells and fibroblasts(16, 68, 78) . However,
every IL-2R reconstitution experiment using wild-type subunits
indicated that the IL-2R subunit is also essential for signaling.
Furthermore, the same obligatory function of the IL-2R was
observed in reconstituting active IL-4R and IL-7R (Fig. 2; (5) and (6) ). Although the IL-2R
dimer appears to be a functional entity (Fig. 4; (70) ),
it remains unclear whether the IL-2R subunit, as an artificial
homodimer, has only limited signaling specificity (restricted to HRRE)
or whether it has redundant IL-2R function. The complementation
experiment (Fig. 11) suggests, however, that the IL-2R
cytoplasmic domain is required for JAK3-dependent signal and is not
dispensable by IL-2R dimerization. The IL-2R signaling activity
to HRRE, as well as the much lower activity of IL-4R, could not be
correlated with the activation of STAT proteins as defined by binding
to SIE (Fig. 7, Fig. 9, and Fig. 12). Since CTLL-2
cells (Fig. 10A) and NK cells (Fig. 12) showed
an IL-2-responsive STAT activation, we concluded that SIF activation
was not involved in signaling to HRRE and that the STAT-inducing
factors operating in lymphocytes are not present in our test cells.
JAK3 was the logical candidate factor for the cell type-restricted
activity of the IL-2R action on
SIF(58, 76, 77, 78, 79, 80) .
The lymphoid-specific STAT activation may not be solely determined by
JAK3 expression (JAK3 mRNA was detectable in L-cells and H-35 cells; Fig. 10A), but also by JAK3-specific substrates, i.e. STAT proteins. Attempts to reconstitute the missing SIF
activation and IL-6RE regulation in our cell systems by overexpressing
JAK3 indicated that the combination of JAK3 and JAK3-activated STAT
proteins contributes to the functional specificity. The results from
H-35 cells (Fig. 11B) and L- and COS-1 cells (Fig. 12) suggest that these cells, even when supplemented with
JAK3, are unable to signal since the appropriate STAT proteins are
missing. However, HepG2 cells seem to contain STAT proteins that serve
as substrates for JAK3, but appear to be deficient in JAK3, explaining
the prominent complementation of IL-2R action by JAK3 ( Fig. 11and Fig. 12). We have not identified the STAT
proteins that constitute the IL-2R-inducible SIF seen in Fig. 10A and Fig. 12. Since the IL-4R receptor
proved to be the most prominent activator of IL-6RE in the presence of
JAK3, we assume that the recently described IL-4 STAT (41) is
participating in this regulation. The presence of that factor in the
hepatic cells is not surprising, since Hou et al.(41) detected by mRNA analysis high level expression of
IL-4 STAT in the liver. The IL-4R contains two box 3-related sequences
that serve as binding sites for IL-4 STAT (41; indicated in Fig. 13). Because the IL-2R enables signaling of the IL-4R
by JAK3, one possible explanation which is in agreement with the
analysis of receptor subunit-associated kinases (75, 76, 77) is that the IL-2R subunit
provides JAK3 kinase to the receptor signaling reaction leading to the
phosphorylation of IL-4 STAT or any other STAT protein bound to IL-4R (40, 41) . If so, the same IL-2R function is
expected to be a part of the signaling by IL-2R ( 
complex) and IL-7R. The contribution of IL-2R appears not only to
include presentation of STAT proteins, but also the interaction with
JAK1 by its membrane proximal region(58, 79) . It
remains to be shown whether the JAK1-specific pathway that is
considered to be general to hematopoietin receptors (28, 29) is mediating the HRRE signal via a yet to be
detected STAT protein. The working model of IL-2R providing
JAK3 and the IL-2R , the STAT proteins, and probably JAK1 to the
signaling reaction also seems to apply to the heterodimeric form of the
G-CSFR-IL-2R  (Fig. 13). Indeed, this
experimental system will allow us to define the precise cytoplasmic
domains in each chimeric subunit that provides the respective function
for the JAK3-dependent STAT activation leading to IL-6RE induction in
HepG2 cells. This study focuses on the ability of hematopoietin
receptors to control gene expression. The comparison of the specificity
by which these receptors control the proliferative response in
nonhepatic cells reveals common traits in signaling. Like the
regulation of CytRE in hepatoma cells(45) , box 1 and 2 motifs
are required in the signaling subunit for generating the proliferative
signal by IL-2R(16, 69, 70) ,
GM-CSFR(17, 81) ,
EPOR(19, 55, 82, 83) ,
PRLR(84) ,
gp130(7, 80, 85, 86) , and
G-CSF(9, 10, 18) . Analysis of the GHR
indicated, however, that a proliferative signal was already achieved
with just the box 1 motif present(87, 88) . In several
of these cases, JAK2 has been implied as being a potential mediator of
the proliferative signal. It remains to be shown which of the signaling
pathways characterized in the present studies (Fig. 13) is also
part of the growth regulation and activation of an immediate gene
growth response. A larger challenge will be to identify the molecular
mechanisms that determine the specificity by which the hematopoietin
receptors accomplish their tasks in the different cell types.
FOOTNOTES
- *
- This work was supported by National Institutes of
Health Grant CA26122, American Chemical Society Grant DHP-111B, and
Grant 2709 of the Women's and Children's Health Research
Foundation. The costs of publication of this article were defrayed in
part by the payment of page charges. This article must therefore by
hereby marked ``advertisement'' in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
- §
- Permanent address: Dept. of Ophthalmology,
School of Medicine, Tohoku University, Sendai 980, Japan.
- ¶
- To whom correspondence and reprint requests
should be addressed. Tel.: 716-845-4587; Fax: 716-845-8389.
- (
) - The abbreviations used are: IL-, interleukin;
AGP,
 -acid glycoprotein; APP, acute phase protein;
CAT, chloramphenicol acetyltransferase; DRE, distal regulatory element;
EPO, erythropoietin; G-CSF, granulocyte-colony stimulatory factor; GH,
growth hormone; GMSA, gel mobility shift assay; GRE, glucocorticoid
response element; HP, haptoglobin; HRRE, hematopoietin receptor
response element; CytRE, cytokine response element; JAK, Janus kinase;
LIF, leukemia inhibitory factor; IFN, interferon; -R, receptor; PRL,
prolactin; SIE, sis-inducible element; SIF, sis-inducible factor; STAT, signal transducer and activator of
transcription.
- (
) - Ziegler, S. F., Morella, K. K.,
Anderson, D., Kumaki, N., Leonard, W. J., Cosman, D., and Baumann,
H.(1995) Eur. J. Immunol., in press.
- (
) - C.-F. Lai, S. Immenschuh, D. P. Gearing, S. F.
Ziegler, and H. Baumann, submitted for publication.
ACKNOWLEDGEMENTS
We thank Dr. W. I. Wood for providing GHR cDNA; Dr. G.
Strassmann for suramin; Drs. M. Caligiuiri and W. Carlson for IL-2 and
NK cells; Dr. P. Schendel, Genetics Institute, for IL-11; Dr. G. H. W.
Wong, Genentech, for murine IFN- ; and Marcia Held for secretarial
assistance.
REFERENCES
- Bazan, J. F. (1990) Proc. Natl. Acad. Sci. U. S. A. 80, 6934-6938
- Miyajima, A., Kitamura, T., Harada, N., Yokota, T. & Arai, K. (1992) Annu. Rev. Immunol. 10, 295-331
[CrossRef][Medline]
[Order article via Infotrieve]
- Leonard, W. J., Noguchi, M., Russell, S. M. & McBride, O. W. (1994) Immunol. Rev. 138, 61-86
[CrossRef][Medline]
[Order article via Infotrieve]
- Noguchi, M., Adelstein, S., Cao, X. & Leonard, W. J. (1993) J. Biol. Chem. 268, 13601-13608
[Abstract/Free Full Text]
- Kondo, M., Takeshita, T., Ishii, N., Nakamura, M., Watanabe, S., Arai, K. & Sugamura, K. (1993) Science 262, 1874-1877
[Abstract/Free Full Text]
- Russell, S. M., Keegan, A. D., Harada, N., Nakamura, Y., Noguchi, M., Leland, P., Friedmann, M. C., Miyajima, A., Puri, R., Paul, W. E. & Leonard, W. J. (1994) Science 262, 1880-1883
- Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukama, K., Yamanishi, K., Taga, T. & Kishimoto, T. (1993) Science 260, 1808-1810
[Abstract/Free Full Text]
- Stahl, N. & Yancopoulos, G. D. (1993) Cell 74, 587-590
[CrossRef][Medline]
[Order article via Infotrieve]
- Fukunaga, R., Ishizaka-Ikeda, E., Pan, C. X., Seto, Y. & Nagata, S. (1991) EMBO J. 10, 2855-2865
[Medline]
[Order article via Infotrieve]
- Ziegler, S. F., Bird, T. A., Morella, K. K., Mosley, D., Gearing, D. & Baumann, H. (1993) Mol. Cell. Biol. 13, 2384-2390
[Abstract/Free Full Text]
- Watowich, S. S., Yoshimura, A., Longmore, G. D., Hilton, D. J., Yoshimura, Y. & Lodish, H. F. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2140-2144
[Abstract/Free Full Text]
- Ultsch, M. & de Vos, A. M. (1993) J. Mol. Biol. 231, 1133-1136
[CrossRef][Medline]
[Order article via Infotrieve]
- de Vos, A. M., Ultsch, M. & Kossiakoff, A. A. (1992) Science 255, 306-312
[Abstract/Free Full Text]
- de Sauvage, F. J., Hass, P. E., Spencer, S. D., Malloy, B. E., Gurney, A. L., Spencer, S. A., Darbonne, W. C., Henzel, W. J., Wong, S. C., Kuang, W.-J., Oles, K. J., Hultgren, B., Solberg, L. A., Jr., Goeddel, D. V. & Eaton, D. L. (1994) Nature 369, 533-538
[CrossRef][Medline]
[Order article via Infotrieve]
- Lok, S., Kaushansky, K., Holly, R. D., Kuijper, J. L., Lofton-Day, C. E., Oort, P. J., Grant, F. J., Heipel, M. D., Burkhead, S. K., Kramer, J. M., Bell, L. A., Sprecher, C. A., Blumberg, H., Johnson, R., Prunkard, D., Ching, A. F. T., Mathewes, S. L., Bailey, M. C., Forstrom, J. W., Buddle, M. M., Osborn, S. G., Evans, S. J., Sheppard, P. O., Presnell, S. R., O'Hara, P. J., Hagen, F. S., Roth, G. J. & Foster, D. C. (1994) Nature 369, 565-568
[CrossRef][Medline]
[Order article via Infotrieve]
- Shibuya, H., Yoneyama, M., Ninomiya-Tsuji, J., Matsumoto, K. & Taniguchi, T. (1992) Cell 70, 57-67
[CrossRef][Medline]
[Order article via Infotrieve]
- Sato, N., Salamaki, K., Terada, N., Arai, K. & Miyajima, A. (1993) EMBO J. 12, 4181-4189
[Medline]
[Order article via Infotrieve]
- Fukunaga, R., Ishizaka-Ikeda, E. & Nagata, S. (1993) Cell 74, 1079-1087
[CrossRef][Medline]
[Order article via Infotrieve]
- Miura, O., Cleveland, J. L. & Ihle, J. N. (1993) Mol. Cell. Biol. 13, 1788-1795
[Abstract/Free Full Text]
- Minami, Y., Oishi, I., Liu, Z.-J., Nakagawa, S., Miyazaki, T. & Taniguchi, T. (1994) J. Immunol. 152, 5680-5690
[Abstract]
- Rao, M. S., Symes, A., Malik, N., Sohyab, M., Fink, J. S. & Landis, S. C. (1992) Neuroreport 3, 865-868
[Medline]
[Order article via Infotrieve]
- Rao, M. S., Tyrrell, S., Landis, S. C. & Patterson, P. H. (1992) Dev. Biol. 150, 281-293
[CrossRef][Medline]
[Order article via Infotrieve]
- Steinman, R. A. & Tweardy, D. J. (1994) Blood 83, 119-127
[Abstract/Free Full Text]
- Bancroft, G. J. (1994) Curr. Opin. Immunol. 5, 503-510
- Tripp, C. S., Wolf, S. F. & Unanue, E. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3725-3729
[Abstract/Free Full Text]
- Carson, W. E., Giri, J. G., Lindemann, M. J., Linett, M. C., Ahdieh, M., Anderson, D., Eisenmann, J., Grabstein, K. & Caligiuri, M. A. (1994) J. Exp. Med. 180, 1395-1403
[Abstract/Free Full Text]
- Baumann, H., Marinkovic-Pajovic, S., Won, K.-A., Jones, V. E., Campos, S. P., Jahreis, G. P. & Morella, K. K. (1992) Polyfunctional Cytokines: IL-6 and LIF , Vol. 167, pp. 100-124, The Ciba Foundation Symposium, Wiley, Chichester, UK
- Darnell, J. E., Jr., Kerr, I. M. & Stark, G. R. (1994) Science 264, 1415-1421
[Abstract/Free Full Text]
- Ihle, J. N., Witthuhn, B. A., Quelle, F. W., Yamamoto, K., Thierfelder, W. E., Kreider, B. & Silvennoinen, O. (1994) Trends Biochem. Sci. 19, 222-227
[CrossRef][Medline]
[Order article via Infotrieve]
- Hatakeyama, M., Mori, H., Doi, T. & Taniguchi, T. (1989) Cell 59, 837-845
[CrossRef][Medline]
[Order article via Infotrieve]
- Torrigoe, T., Saragovi, H. V. & Reed, J. C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2674-2678
[Abstract/Free Full Text]
- Ernst, M., Gearing, D. P. & Dunn, A. R. (1994) EMBO J. 13, 1574-1584
[Medline]
[Order article via Infotrieve]
- Corey, S. J., Burkhardt, A. L., Bolen, J. B., Geahlen, R. L., Tkatch, L. S. & Tweardy, D. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4683-4687
[Abstract/Free Full Text]
- Shuai, K., Horvath, C. M., Tsai-Huang, L. H., Qureshi, S., Cowburn, D. & Darnell, J. E., Jr. (1994) Cell 76, 821-827
[CrossRef][Medline]
[Order article via Infotrieve]
- Sadowski, H. B., Shuai, K., Darnell, J. E., Jr. & Gilman, M. Z. (1993) Science 261, 1739-1744
[Abstract/Free Full Text]
- Fu, X.-Y., Schindler, C., Improta, T., Albersold, R. H. & Darnell, J. E., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7840-7843
[Abstract/Free Full Text]
- Zhong, Z., Wen, Z. & Darnell, J. E., Jr. (1994) Science 264, 95-98
[Abstract/Free Full Text]
- Akira, S., Nishio, Y., Inoue, M., Wang, X.-J., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M. & Kishimoto, T. (1994) Cell 77, 63-71
[CrossRef][Medline]
[Order article via Infotrieve]
- Wakao, H., Gouilleux, F. & Groner, B. (1994) EMBO J. 13, 2182-2191
[Medline]
[Order article via Infotrieve]
- Kotanides, H. & Reich, N. C. (1993) Science 262, 1265-1267
[Abstract/Free Full Text]
- Hou, J., Schindler, U., Henzel, W. J., Ho, T. C., Brasseur, M. & McKnight, S. L. (1994) Science 265, 1701-1706
[Abstract/Free Full Text]
- Asao, H., Takeshita, T., Ishii, N., Kumaki, S., Nakamura, M. & Sugamura, K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4127-4131
[Abstract/Free Full Text]
- Baumann, H., Symes, A. J., Comeau, M. R., Morella, K. K., Wang, Y., Friend, D., Ziegler, S. F., Fink, J. S. & Gearing, D. (1994) Mol. Cell. Biol. 14, 138-146
[Abstract/Free Full Text]
- Baumann, H., Ziegler, S. F., Mosley, B., Morella, K. K., Pajovic, S. & Gearing, D. P. (1993) J. Biol. Chem. 268, 8414-8417
[Abstract/Free Full Text]
- Baumann, H., Gearing, D. & Ziegler, S. F. (1994) J. Biol. Chem. 269, 16297-16304
[Abstract/Free Full Text]
- Baumann, H., Prowse, K. R., Marinkovic, S., Won, K.-A. & Jahreis, G. P. (1989) Ann. N. Y. Acad. Sci. 557, 280-297
[Medline]
[Order article via Infotrieve]
- Knowles, B. B., Howe, C. C. & Aden, D. P. (1980) Science 209, 497-499
[Abstract/Free Full Text]
- Matos, M., Schnier, G., Beecher, M. S., Ashman, L., Williams, D. & Caligiuri, M. A. (1993) J. Exp. Med. 178, 1079-1084
[Abstract/Free Full Text]
- Baumann, H. & Strassmann, G. (1993) J. Immunol. 151, 1456-1462
[Abstract]
- Larsen, A., Davis, T., Curtis, B. M., Gimpel, S., Sims, J. E., Cosman, D., Park, L., Sorensen, E., Mach, C. J. & Smith, C. A. (1990) J. Exp. Med. 172, 1559-1570
[Abstract/Free Full Text]
- Hatakeyama, M., Tsudo, M., Minamoto, S., Kono, T., Doi, T., Miyata, T., Miyasaka, M. & Taniguchi, T. (1989) Science 244, 551-556
[Abstract/Free Full Text]
- Takeshita, T., Asao, H., Ohtani, K., Ishii, N., Kumaki, S., Tanaka, N., Munakata, H., Nakamura, M. & Sugamura, K. (1992) Science 257, 379-382
[Abstract/Free Full Text]
- Mosley, B., Beckmann, M. P., March, C. J., Idzerda, R. L., Gimpel, S. D., Vanden Bos, T., Friend, D., Alpert, A., Anderson, D., Jackson, J., Wignall, J. M., Smith, C., Gallis, B., Sims, J. E., Urdal, D., Widmer, M. B., Cosman, D. & Park, L. S. (1989) Cell 59, 335-348
[CrossRef][Medline]
[Order article via Infotrieve]
- Goodwin, R. G., Friend, D., Ziegler, S. F., Jerzy, R., Falk, B. A., Gimpel, S., Cosman, D., Dower, S. K., March, C. J., Namen, A. E. & Park, L. S. (1990) Cell 60, 941-951
[CrossRef][Medline]
[Order article via Infotrieve]
- Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, D. & Ihle, J. N. (1993) Cell 74, 227-236
[CrossRef][Medline]
[Order article via Infotrieve]
- Vigon, I., Florindo, C., Fichelson, S., Guenet, J.-L., Mattei, M. G., Souyri, M., Cosman, D. & Gisselbrecht, S. (1993) Oncogene 8, 2607-2615
[Medline]
[Order article via Infotrieve]
- Leonard, W. J., Pepper, J. M., Crabtree, G. R., Rudikoff, S., Pumphrey, J., Robb, R. J., Soetlik, P. B., Pfeffer, N., Waldmann, T. A. & Greene, W. C. (1984) Nature 311, 626-631
[CrossRef][Medline]
[Order article via Infotrieve]
- Witthuhn, B. A., Silvennoinen, O., Miura, O., Lal, K. S., Cwik, C., Liu, E. T. & Ihle, J. N. (1994) Nature 370, 153-157
[CrossRef][Medline]
[Order article via Infotrieve]
- Pruitt, S. C. (1988) Gene (Amst.) 66, 121-134
[CrossRef][Medline]
[Order article via Infotrieve]
- Won, K.-A. & Baumann, H. (1990) Mol. Cell. Biol. 10, 3965-3978
[Abstract/Free Full Text]
- Immenschuh, S., Nagae, Y., Satoh, H., Baumann, H. & Muller-Eberhard, U. (1994) J. Biol. Chem. 269, 12654-12661
[Abstract/Free Full Text]
- Marinkovic, S. & Baumann, H. (1990) Mol. Cell. Biol. 10, 1573-1583
[Abstract/Free Full Text]
- Baumann, H., Jahreis, G. P. & Morella, K. K. (1990) J. Biol. Chem. 265, 22275-22281
[Abstract/Free Full Text]
- Lopata, M. A., Cleveland, D. W. & Sollner-Webb, H. (1984) Nucleic Acids Res. 12, 5707-5717
[Abstract/Free Full Text]
- Graham, F. L. & Van der Eb, A. J. (1973) Virology 52, 456-461
[CrossRef][Medline]
[Order article via Infotrieve]
- Prowse, K. R. & Baumann, H. (1988) Mol. Cell. Biol. 8, 42-51
[Abstract/Free Full Text]
- Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. (1979) Biochemistry 18, 5294-5299
[CrossRef][Medline]
[Order article via Infotrieve]
- Hatakeyama, M., Mori, M., Doi, T. & Taniguchi, T. (1989) Cell 59, 837-845
- Nakamura, Y., Russell, S. M., Mess, S. A., Friedmann, M., Erdos, M., Francois, C., Jacques, Y., Adelstein, S. & Leonard, W. J. (1994) Nature 369, 330-333
[CrossRef][Medline]
[Order article via Infotrieve]
- Nelson, B. H., Lord, J. D. & Greenberg, P. D. (1994) Nature 369, 333-336
[CrossRef][Medline]
[Order article via Infotrieve]
- Giri, J. G., Ahdieh, M., Eisenmann, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D. & Anderson, D. (1994) EMBO J. 13, 2822-2830
[Medline]
[Order article via Infotrieve]
- Baumann, H., Morella, K. K. & Wong, G. H. W. (1993) J. Immunol. 151, 4248-4257
[Abstract]
- Campos, S. P., Wang, Y., Koj, A. & Baumann, H. (1994) Cytokine, 6, 485-492
[CrossRef][Medline]
[Order article via Infotrieve]
- Hattori, M., Abraham, L. J., Northemann, W. & Fey, G. H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 2364-2368
[Abstract/Free Full Text]
- Kawamura, M., McVicar, D. W., Johnston, J. A., Blake, T. B., Chen, Y.-Q., Lal, B. K., Lloyd, A. R., Kelvin, D. J., Staples, J. E., Ortaldo, J. R. & O'Shea, J. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6374-6378
[Abstract/Free Full Text]
- Johnston, J. A., Kawamura, M., Kirken, R. A., Chen, Y.-Q., Blake, T. B., Shibuya, K., Ortaldo, J. R., McVicar, D. W. & O'Shea, J. J. (1994) Nature 370, 151-153
[CrossRef][Medline]
[Order article via Infotrieve]
- Kirken, R. A., Rui, H., Malabarba, M. G. & Farrar, W. L. (1994) J. Biol. Chem. 269, 19136-19141
[Abstract/Free Full Text]
- Goldsmith, M. A., Xu, W., Amaral, M. C., Kuczek, E. S. & Greene, W. C. (1994) J. Biol. Chem. 269, 14698-14704
[Abstract/Free Full Text]
- Tanaka, N., Asao, H., Ohibo, K., Ishii, N., Takeshita, T., Nakamura, M., Sasaki, H. & Sugamura, K. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7271-7275
[Abstract/Free Full Text]
- Lütticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T., Kishimoto, T., Barbieri, G., Pellegrini, S., Sendtner, M., Heinrich, P. C. & Horn, F. (1994) Science 263, 89-92
[Abstract/Free Full Text]
- Quelle, F. W., Sata, N., Witthuhn, B. A., Inhorn, R. C., Eder, M., Miyajima, A., Griffin, J. D. & Ihle, J. N. (1994) Mol. Cell. Biol. 14, 4335-4341
[Abstract/Free Full Text]
- D'Andrea, A. D., Yoshimura, A., Youssoufian, H., Zon, L. I., Koo, J. W. & Lodish, H. F. (1991) Mol. Cell. Biol. 11, 1980-1987
[Abstract/Free Full Text]
- Quelle, D. E. & Wojchowski, D. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4801-4805
[Abstract/Free Full Text]
- Rui, H., Kirken, R. A. & Farrar, W. L. (1994) J. Biol. Chem. 269, 5364-5368
[Abstract/Free Full Text]
- Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Barbieri, G., Pellegrini, S., Ihle, J. N. & Yancopoulos, G. D. (1994) Science 263, 92-95
[Abstract/Free Full Text]
- Narazaki, M., Witthuhn, B. A., Yoshida, D., Silvennoinen, O., Yasukawa, K., Ihle, J. N., Kishimoto, T. & Taga, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2285-2289
[Abstract/Free Full Text]
- Colosi, P., Wong, K., Leong, S. R. & Wood, W. I. (1993) J. Biol. Chem. 268, 12617-12623
[Abstract/Free Full Text]
- Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A., Silvennoinen, O., Ihle, J. N. & Carter-Su, C. (1993) Cell 74, 237-244
[CrossRef][Medline]
[Order article via Infotrieve]
- Gearing, D. P., Ziegler, S. F., Comeau, M. R., Friend, D., Thoma, B., Cosman, D., Park, L. & Mosley, B. (1994) Proc. Natl. Acad. Sci. U. S. A., 91, 1119-1123
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Wetzler, M. T. Brady, E. Tracy, Z.-R. Li, K. A. Donohue, K. L. O'Loughlin, Y. Cheng, A. Mortazavi, A. A. McDonald, P. Kunapuli, et al.
Arsenic Trioxide Affects Signal Transducer and Activator of Transcription Proteins through Alteration of Protein Tyrosine Kinase Phosphorylation.
Clin. Cancer Res.,
November 15, 2006;
12(22):
6817 - 6825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Baumann, P. Kunapuli, E. Tracy, and J. K. Cowell
The Oncogenic Fusion Protein-tyrosine Kinase ZNF198/Fibroblast Growth Factor Receptor-1 Has Signaling Function Comparable with Interleukin-6 Cytokine Receptors
J. Biol. Chem.,
April 25, 2003;
278(18):
16198 - 16208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Isaksen, H. Baumann, B. Zhou, S. Nivollet, A. G. Farr, S. D. Levin, and S. F. Ziegler
Uncoupling of Proliferation and Stat5 Activation in Thymic Stromal Lymphopoietin-Mediated Signal Transduction
J. Immunol.,
April 1, 2002;
168(7):
3288 - 3294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Eckenberg, T. Rose, J.-L. Moreau, R. Weil, F. Gesbert, S. Dubois, D. Tello, M. Bossus, H. Gras, A. Tartar, et al.
The First {alpha} Helix of Interleukin (IL)-2 Folds as a Homotetramer, Acts as an Agonist of the IL-2 Receptor {beta} Chain, and Induces Lymphokine-activated Killer Cells
J. Exp. Med.,
February 7, 2000;
191(3):
529 - 540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E. Isaksen, H. Baumann, P. A. Trobridge, A. G. Farr, S. D. Levin, and S. F. Ziegler
Requirement for Stat5 in Thymic Stromal Lymphopoietin-Mediated Signal Transduction
J. Immunol.,
December 1, 1999;
163(11):
5971 - 5977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kim, T. S. Hawley, R. G. Hawley, and H. Baumann
Protein Tyrosine Phosphatase 2 (SHP-2) Moderates Signaling by gp130 but Is Not Required for the Induction of Acute-Phase Plasma Protein Genes in Hepatic Cells
Mol. Cell. Biol.,
March 1, 1998;
18(3):
1525 - 1533.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. W.W. Y. Wang, S. C. Chua Jr., J. P. Morgenstern, R. L. Leibel, H. Baumann, and L. A. Tartaglia
Constitutive and impaired signaling of leptin receptors containing the Gln right-arrow Pro extracellular domain fatty mutation
PNAS,
September 30, 1997;
94(20):
10657 - 10662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. Kuropatwinski, C. De Imus, D. Gearing, H. Baumann, and B. Mosley
Influence of Subunit Combinations on Signaling by Receptors for Oncostatin M, Leukemia Inhibitory Factor, and Interleukin-6
J. Biol. Chem.,
June 13, 1997;
272(24):
15135 - 15144.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kim and H. Baumann
The Carboxyl-terminal Region of STAT3 Controls Gene Induction by the Mouse Haptoglobin Promoter
J. Biol. Chem.,
June 6, 1997;
272(23):
14571 - 14579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. White, K. K. Kuropatwinski, R. Devos, H. Baumann, and L. A. Tartaglia
Leptin Receptor (OB-R) Signaling. CYTOPLASMIC DOMAIN MUTATIONAL ANALYSIS AND EVIDENCE FOR RECEPTOR HOMO-OLIGOMERIZATION
J. Biol. Chem.,
February 14, 1997;
272(7):
4065 - 4071.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Woodcock, C. J. Bagley, B. Zacharakis, and A. F. Lopez
A Single Tyrosine Residue in the Membrane-proximal Domain of the Granulocyte-Macrophage Colony-stimulating Factor, Interleukin (IL)-3, and IL-5 Receptor Common beta -Chain Is Necessary and Sufficient for High Affinity Binding and Signaling by All Three Ligands
J. Biol. Chem.,
October 18, 1996;
271(42):
25999 - 26006.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-F. Lai, J. Ripperger, K. K. Morella, J. Jurlander, T. S. Hawley, W. E. Carson, T. Kordula, M. A. Caligiuri, R. G. Hawley, G. H. Fey, et al.
Receptors for Interleukin (IL)-10 and IL-6-type Cytokines Use Similar Signaling Mechanisms for Inducing Transcription through IL-6 Response Elements
J. Biol. Chem.,
June 14, 1996;
271(24):
13968 - 13975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fourcin, S. Chevalier, C. Guillet, O. Robledo, J. Froger, A. Pouplard-Barthelaix, and H. Gascan
gp130 Transducing Receptor Cross-linking Is Sufficient to Induce Interleukin-6 Type Responses
J. Biol. Chem.,
May 17, 1996;
271(20):
11756 - 11760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zhang, M. Sun, D. Samols, and I. Kushner
STAT3 Participates in Transcriptional Activation of the C-reactive Protein Gene by Interleukin-6
J. Biol. Chem.,
April 19, 1996;
271(16):
9503 - 9509.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kordula, J. Ripperger, K. K. Morella, J. Travis, and H. Baumann
Two Separate Signal Transducer and Activator of Transcription Proteins Regulate Transcription of the Serine Proteinase Inhibitor-3 Gene in Hepatic Cells
J. Biol. Chem.,
March 22, 1996;
271(12):
6752 - 6757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-F. Lai, J. Ripperger, K. K. Morella, Y. Wang, D. P. Gearing, N. D. Horseman, S. P. Campos, G. H. Fey, and H. Baumann
STAT3 and STAT5B Are Targets of Two Different Signal Pathways Activated by Hematopoietin Receptors and Control Transcription via Separate Cytokine Response Elements
J. Biol. Chem.,
October 6, 1995;
270(40):
23254 - 23257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-F. Lai, J. Ripperger, K. K. Morella, Y. Wang, D. P. Gearing, G. H. Fey, and H. Baumann
Separate Signaling Mechanisms Are Involved in the Control of STAT Protein Activation and Gene Regulation via the Interleukin 6 Response Element by the Box 3 Motif of gp130
J. Biol. Chem.,
June 23, 1995;
270(25):
14847 - 14850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, O. Robledo, E. Kinzie, F. Blanchard, C. Richards, A. Miyajima, and H. Baumann
Receptor Subunit-specific Action of Oncostatin M in Hepatic Cells and Its Modulation by Leukemia Inhibitory Factor
J. Biol. Chem.,
August 11, 2000;
275(33):
25273 - 25285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Baumann, Y. Wang, C. D. Richards, C. A. Jones, T. A. Black, and K. W. Gross
Endotoxin-induced Renal Inflammatory Response. ONCOSTATIN M AS A MAJOR MEDIATOR OF SUPPRESSED RENIN EXPRESSION
J. Biol. Chem.,
July 14, 2000;
275(29):
22014 - 22019.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|