Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morella, K. K.
Right arrow Articles by Baumann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morella, K. K.
Right arrow Articles by Baumann, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 14, Issue of April 7, 1995 pp. 8298-8310
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Action of Interleukin-2 Receptor Subunits Defines a New Type of Signaling Mechanism for Hematopoietin Receptors in Hepatic Cells and Fibroblasts (*)

(Received for publication, October 18, 1994; and in revised form, January 17, 1995)

Karen K. Morella (1) Chun-fai Lai (1) Satoru Kumaki (2) Noriko Kumaki (2)(§) Yanping Wang (1) (3) Eric M. Bluman (1) Bruce A. Witthuhn (4) James N. Ihle (4) Judith Giri (2) David P. Gearing (5) David Cosman (2) Steven F. Ziegler (6) David J. Tweardy (7) Susana P. Campos (1) (3) Heinz Baumann (1)(¶)

From the  (1)Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York 14263, (2)Immunex Corporation, Seattle, Washington 98101, (3)Children's Hospital of Buffalo, Division of Endocrinology, Buffalo, New York 14222, (4)St. Jude Children's Research Hospital, Memphis, Tennessee 38101-0318, (5)Systemix, Palo Alto, California 94304, (6)Darwin Molecular Corp., Bothell, Washington 98021, and the (7)Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15213

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The gene regulatory functions of the human IL-2 receptor (IL-2R) were reconstituted in transiently transfected hepatoma cells. The combination of IL-2Rbeta and - mediated a strong stimulation via the cytokine response element of the alpha(1)-acid glycoprotein gene and the hematopoietin receptor response element, but none via the IL-6 response element or the sis-inducible element. IL-2Ralpha enhanced 10-fold the sensitivity of the IL-2Rbetabullet complex to respond to IL-2 or IL-15, but did not modify the specificity or the magnitude of maximal gene regulation. A homodimerizing chimeric receptor G-CSFR-IL-2Rbeta could mimic the IL-2R action. The IL-2R-mediated gene regulation was similar to that seen with receptors for IL-4 and IL-7, but differed from that for IL-6 type cytokines, thrombopoietin, erythropoietin, and growth hormone. The activation of STAT proteins by the IL-2R was assessed in transfected L-cells and COS-1 cells. Although IL-2R subunits were highly expressed in these cells, no STAT protein activation was detectable. Transient overexpression of JAK3 was unable to change the signaling specificity of the hematopoietin receptors in rat hepatoma, L-, and COS cells, but established a prominent activation of the IL-6 response elements by the IL-2R and IL-4R in HepG2 cells. The data support the model that the IL-2R and related hematopoietin receptors produce at least two separate signals which control gene expression.


INTRODUCTION

Hematopoietin receptors are members of a gene family characterized by common structural motifs in their extracellular and, in some cases, also in their intracellular domains(1, 2) . Several groups of receptors within this family have been identified based on the shared use of signaling subunits. The groups include those depending on the IL-2R (^1)(receptors for IL-2, -4, -7, -9, -13, and -15)(3, 4, 5, 6) , the IL-3Rbeta (receptors for IL-3, -5, and GM-CSF)(2) , and gp130 (receptors for IL-6, IL-11, LIF, oncostatin M, and CNTF)(7, 8) . Homodimeric hematopoietin receptors include those for G-CSF(9, 10) , EPO(11) , prolactin(12) , growth hormone(13) , and probably thrombopoietin(14, 15) .

Each hematopoietin receptor has been associated with control of proliferation of hematopoietic cells. A modulating effect on transcription of early growth response genes, such as c-fos, c-jun, junB, and c-myc, has been demonstrated for several of these receptors(10, 16, 17, 18, 19, 20) . However, the function of hematopoietin receptors, whose expression has been maintained during the course of cell differentiation, appears to involve the transcriptional control of differentiated genes such as neuropeptide genes by LIF and CNTF in neuronal cells(21, 22) , genes for myeloperoxidase, elastase, and G-CSFR by G-CSF in granulocytes(18, 23, 24, 25) , cytokine genes by IL-2, IL-15, and IL-12 in NK cells(24, 25, 26) , or acute phase plasma protein genes by IL-6-type cytokines in hepatic cells(27) . A major unanswered question is whether the regulation of proliferation and of differentiated gene expression by a given hematopoietin receptor is mediated by identical or distinct signal-transducing mechanisms.

The intracellular initiation of signal transduction by ligand-occupied hematopoietin receptors involves an immediate phosphorylation of the receptor cytoplasmic domain concomitant with the activation of receptor-associated protein tyrosine kinases. These protein tyrosine kinases, depending upon the cell type, include members of the Janus kinase family (JAK/Tyk) (28, 29) and src-related protein tyrosine kinases(30, 31, 32, 33) . The change in the phosphorylation state of the receptor promotes the binding of the STAT (signal transducer and activation of transcription) proteins to the receptor(28, 29) . One of the consequences of protein tyrosine kinase action is the phosphorylation of the receptor-recruited STAT protein(s) that lead to the STAT protein dimerization and activation of DNA binding activity (34) . STAT protein complexes binding to the sis-inducible element (SIE) of the c-fos gene, termed SIF, for example, has been recognized to be a common target of growth factors and hematopoietin receptor signals(35) . Components of the DNA-bound complexes include dimers of STAT-1, primarily activated by IFN(36) , STAT-3 (or APFR) (34, 37, 38) activated by IL-6-type cytokine, STAT-5 activated by prolactin(39) , and IL-4 STAT (or STAT-6) activated by IL-4(40, 41) .

Structure/function analyses of hematopoietin receptor subunits suggest that distinct subregions of the cytoplasmic domains of the signaling receptor subunits control specific cell responses, such as the regulation of early growth response genes by IL-2Rbeta (20, 42) and IL-3Rbeta (as part of the GM-CSFR)(17) , and differentiated genes in monocytic, neuroblastoma, and hepatic cells by gp130, LIFR, and G-CSFR (7, 9, 10, 43) . To assess the complexity of intracellular signaling pathways which are activated by various hematopoietin receptor types and which control expression of differentiated genes, we developed tissue culture systems in which receptor-specific gene regulatory functions were reconstituted(44, 45) . By applying this experimental approach, we have established a sensitive assay system for defining common signaling mechanisms utilized by seemingly related receptor structures. In this study, we used rat and human hepatoma, L-, and COS cells for probing the interaction of IL-2R and representative members of the other hematopoietin receptor groups with the intracellular signal transduction machinery.


EXPERIMENTAL PROCEDURES

Cells and Cell Treatments

Receptor functions were determined in rat hepatoma H-35 cells (subclonal line of clone T-7-18; (46) ), human HepG2 cells(47) , COS-1 cells and mouse L(tk) cells. The cells were cultured in Dulbecco's modified Eagle's medium (H-35 and L-cells) or minimal essential medium (HepG2 and COS-1 cells) containing 10% fetal calf serum, penicillin, streptomycin, and gentamycin. For comparison of SIF activation, we used CTLL-2 cells which were cultured in RPMI containing 10% fetal calf serum supplemented with 250 units/ml IL-2. The cells were transferred to IL-2-free medium 16 h prior to restimulation with IL-2. Dr. William Carlson, RPCI, provided highly enriched fractions (geq97%) of human NK cells (CD56 CD3) prepared from peripheral blood leukocytes as described(26, 48) . All cytokine treatments occurred in serum-free minimal essential medium. Purified human recombinant cytokines were used at the following concentrations except where otherwise indicated: 100 ng/ml IL-2 (Cetus Corp.), IL-15, G-CSF, LIF (Immunex Corp.), IL-6 (Genetics Institute), and growth hormone (Genentech); 40 units/ml of Epo (Amgen); 10 ng of IFN (Genentech) and 0.5 ng/ml IL-1beta (Immunex Corp.). Ligand-independent activation of G-CSFR-gp130 (49) was achieved by 0.5 mM suramin (provided by Dr. G. Strassmann, Otsuka America Pharmaceutical). IL-2Ralpha function was inhibited by adding 1 µg/ml anti-TAC (= anti-IL-2Ralpha) (provided by Dr. Steven Greenberg, RPCI) to the assay medium containing the cytokines. Control cultures received nonspecific immunoglobulins.

Receptor and JAK3 Expression Vectors

The expression vectors used in this study are summarized in Table 1, and several of these have been described before: human G-CSFR (isoform D7 or 130-amino acid residue full-length cytoplasmic domain(50) ), G-CSFR with truncated cytoplasmic domains to 96, 56, 27, and 1 (=Deltacyto) amino acid residues(10) , IL-2Rbeta(51) , IL-2R(^2)(52) , IL-2R(Deltacyto)(4) , IL-4R(53) , IL-7R(54) , and murine EpoR(55) . The chimeric receptor constructs contained the extracellular domain of G-CSFR and the transmembrane and cytoplasmic domains of the following receptors: full-length or 150-amino acid residues of human LIFR (G-CSFR-LIFR and G-CSFR-LIFR(150))(43) , gp130 (G-CSFR-gp130)(43) , c-mpl (G-CSFR-MPL)(56) , and IL-2R (G-CSFR-IL-2R).^2 G-CSFR-IL-2Rbeta was constructed as follows. The polymerase chain reaction primer pair, (5`) GCTGAATTCCTGGGAAGGACACC and (3`) TATGCGGCCGCTACACCAAGTGAGTTGG, was used to synthesize the transmembrane and cytoplasmic domain of the human IL-2Rbeta(51) . The fragment was digested with EcoRI and NotI, ligated with Asp-EcoRI-digested fragment encoding the extracellular domain of G-CSFR, and then inserted into pCD302(53) . The expression vectors for human IL-2Ralpha(57) , rabbit GHR (provided by Dr. W. I. Wood, Genentech), and mouse JAK3 (58) were constructed by inserting the blunt-ended full-length cDNA into the SmaI site of pCD(59) .



CAT Reporter Gene Constructs

Cytokine response was defined by the stimulation of the CAT gene constructs listed in Table 1. The CAT gene constructs with the AGP gene-derived elements included pAGP(3 times DRE)-GRE-CAT (containing 3 copies of the 142-base pair distal regulatory elements linked to the promoter region -120 to +20 of the rat AGP gene; (66) ), p(4 times CytRE)-SV-CAT and p(4 times IL-1RE)-SV-CAT (containing 4 tandem copies of the region AB (=CytRE or 1-62 of the DRE) and IL-1RE (1-36 of the DRE), respectively, 5` to the minimal SV40 promoter in pSV-CAT; (60) ). The IL-6 signal-specific reporter gene constructs were pHX(5 times IL-6RE)-CAT containing 5 tandem copies of the IL-6RE of the rat hemopexin gene in the Bgl2 site of pCAT promoter vector (Promega)(61) ; pHP(5 times IL-6RE)-CAT containing 5 tandem copies of the B-element core sequence of the rat haptoglobin gene (62) 5`-GATCCGTGGTTACTGGAACAGTA-3` into the Bgl2 site of pCAT, and pbetaFB(350)-CAT containing 350 base pairs of the 5`-flanking region of the rat beta-fibrinogen gene in pOCAT(63) . For testing the signaling by nonhepatic receptors, we also included p(4 times SIE)-CAT (containing 4 tandem copies of the high affinity SIEm67 5`-GATCCATTTCCCGTAAATCA-3` (35) in the Bgl2 site of pCAT); (^3)and pHRRE-CAT (containing 8 tandem copies of the modified IL-6RE/APRE sequence, 5`-GATCCATCCTTCTGGGAATTCTGATCA-3` in the Bgl2 site of pCAT vector.^3

Transfection

H-35, L-, and COS-1 cells were transfected as described previously (45) by using the DEAE-dextran method (64) and HepG2 cells by the calcium phosphate method(65) . For CAT gene expression analysis, the cells were transfected with plasmid DNA mixtures (10 µg in 1 ml per 10-cm dish), consisting of 6.6 µg of CAT plasmid, 1 µg of receptor expression vectors, and, where required, supplemented with pCD-JAK3 or empty expression vectors. pIE-MUP (1.3 µg) served as an internal transfection marker(66) . After a 16-h recovery period, the transfected cell culture was subdivided into a 6-well cluster plate, and, 24 h later, the subcultures were treated with cytokines for 24 h. The CAT activities in cell extracts were determined and normalized to the amount of the major urinary proteins derived from pIE-MUP (44, 66) and the values expressed relative to the untreated control cultures (defined as 1.0).

For analyzing receptor expression and SIF activation, L- and COS-1 cells in 15-cm diameter culture dishes were transfected with 30 µg of receptor expression vector in 3 ml. The transfected cultures were subdivided and, after a 24-h recovery, maintained for an additional 16 h in serum-free medium. Cytokine treatments were then carried out for 15 min (except where indicated).

Gel Mobility Shift Assay (GMSA)

Whole cell, cytosolic, and nuclear extracts were prepared according to the procedure of Sadowski et al.(35) . The double-stranded SIEm67 oligonucleotide was labeled by fill-in reaction using Klenow fragment of polymerase alpha and [P]dCTP. Whole cell extracts (5 µl) or nuclear proteins (10 µg) were preincubated in a 20-µl reaction volume with 5 µg of poly(dI-dC) for 15 min on ice followed by the addition of labeled probe (20,000 cpm), and the binding reaction continued for 15 min at room temperature. Ten µl of the reaction mixture were loaded onto a 4% polyacrylamide gel in 0.5 times Tris borate EDTA buffer. In all GMSA experiments, a binding reaction with nuclear extracts from H-35 cells treated for 15 min with IL-6 was included as an internal standard. The radioactive pattern was visualized by autoradiography.

Analysis of Receptor Expression in L- and COS-1 Cells

RNA was extracted from cells 40-48 h after transfection (67) . Twenty µg of total cell RNA were separated on formaldehyde-containing agarose gel, transferred to nitrocellulose membrane, and hybridized to P-labeled cDNA encoding IL-2Rbeta, IL-2R, or JAK3(58) , a 1-kilobase Asp-EcoRI cDNA fragment encoding the extracellular domain of G-CSFR(45) .

To identify the expression of the chimeric G-CSFR protein, transfected cells were washed three times with phosphate-buffered saline, scraped off the dish, and collected by centrifugation. Cells were solubilized in lysis buffer (10^6 cells per 100 µl) containing 50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.5 mM Na(3)VO(4), 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 10 µg of aprotinin, and 10 µg of leupeptin. After 20 min on ice, the extracts were centrifuged for 10 min at 25,000 times g. The supernatants were pretreated with 20 µl of Protein G-Sepharose beads (Pharmacia Biotech Inc.) for 1 h and then reacted for 16 h with 5 µl of rabbit anti-human G-CSFR serum(33) . The immune complexes were collected on Protein G-Sepharose beads and eluted by washing four times with lysis buffer. After solubilization by boiling in SDS sample buffer, proteins were separated on a 6% SDS-polyacrylamide gel and electroblotted onto Immobilon membrane (Millipore). The membrane was incubated for 6 h with sheep anti-human G-CSFR. This sheep antiserum was generated in collaboration with Greystone Therapeutics, Inc. by intranodal injection of maltose binding protein fused to the extracellular domain of human G-CSFR (residues 48 to 316). The membrane was then treated with rabbit anti-goat immunoglobulin followed by alkaline phosphatase-conjugated goat anti-rabbit immunoglobulin (Bio-Rad). The Western blot was developed with a 5-bromo-4-chloro-3-indolyl phosphate p-toluidine/p-nitro blue tetrazolium chloride reaction (Bio-Rad).


RESULTS

IL-2R Regulates Transcription in H-35 Cells

The IL-2Rbeta subunit contains in its cytoplasmic domain the conserved sequence motifs box 1 and box 2 which are required for generating a proliferative signal and activating of immediate early growth response genes(68, 69, 70) . Since the signal-transducing subunits of the IL-6-type cytokine receptors, G-CSFR and c-mpl, which also contain the box 1 and box 2 motifs, are capable of activating transcription via the cytokine response element (=CytRE) of the AGP gene in transfected hepatoma cells(45) , we wondered whether the IL-2R could similarly recruit this hepatic signal transduction machinery. Rat hepatoma H-35 cells do not respond to IL-2 or IL-15 individually or in combination (data not shown). We therefore transfected into these cells various combinations of expression vectors for IL-2R subunits along with the cytokine-responsive reporter gene construct pAGP(3 times DRE)GRE-CAT. The IL-2R action in the transfected cells was assessed by treatments with its two ligands, IL-2 or IL-15(71) , and compared to the response elicited by the endogenous IL-6R (Fig. 1).


Figure 1: Reconstitution of IL-2R function in H-35 cells. Expression vectors for the IL-2R subunits (indicated at the top) were transfected together with pAGP(3 times DRE)-GRE-CAT into H-35 cells. Four subcultures of each transfection were treated with medium alone (Control) or medium containing either IL-2, IL-15, or IL-6. CAT activity was quantitated and expressed relative to the control in each experimental series (number above the autoradiogram).



The three IL-2R subunits individually did not reconstitute an IL-2 response. Although the combination of IL-2Ralpha and -beta or IL-2Ralpha and - has been described to reconstitute IL-2 binding activity(52) , no regulation of the reporter gene was achieved. The combination of IL-2Rbeta and -, however, produced an 20-fold stimulation of CAT activity. Inclusion of IL-2Ralpha did not detectably improve the magnitude of regulation. In several independent experiments, we observed that the maximal IL-2 response was consistently one-half of the IL-6 response (see Fig. 1and Fig. 5below) and that there was no discernible difference in the response to IL-2 and IL-15 (Fig. 1).


Figure 5: IL-2 regulation of various cytokine response elements. The combinations of IL-2Ralpha, -beta, and - were co-transfected with the CAT reporter gene constructs indicated at the bottom into H-35 cells. The -fold stimulation of the CAT activity by IL-2, IL-6, and IL-1beta was determined. Mean and S.D. of three separate experiments are shown.



The regulation via the AGP gene elements is not specific to hematopoietin receptors and is also accomplished by various other cytokines and hormones such as IL-1, tumor necrosis factor, insulin, and hepatocyte growth factor(72, 73) . Therefore, we developed an alternative response element that was specific to hematopoietin receptor signals and that could be used to compare the activities of different hematopoietin receptors. Oligonucleotides representing modified IL-6RE/APFR (60, 74) sequences were synthesized, multimerized, incorporated into CAT reporter gene constructs, and tested for regulation by co-expressed hematopoietin receptors. We selected one construct that was highly responsive to the signal of hematopoietin receptors which contained at least an equivalent of the box 1 motif (e.g. G-CSFR(27)).^3 The sequence was termed ``hematopoietin receptor response element'' (HRRE).

Cells co-transfected with IL-2R subunits and HRRE-CAT construct yielded a 300-fold stimulation of CAT gene expression by IL-2 that was similar to that achieved by IL-6 (Fig. 2A). The regulation of HRRE differed from that of AGP-CytRE by not being responsive to either IL-1 or insulin. The magnitude of IL-2 stimulation of HRRE was somewhat variable from experiment to experiment, probably due to the relatively low basal activity of the HRRE-CAT construct in untreated cells. Nevertheless, the IL-2R activity appeared to be similar to that of the functionally related IL-7R and other members of the hematopoietin receptor family such as GHR, EPOR, LIFR, and G-CSFR (Fig. 2B). An exception was the relatively low regulation mediated by IL-4R. Furthermore, GHR was unique among the transfected hematopoietin receptors in that it consistently produced an elevated basal expression of the CAT reporter gene suggesting a ligand-independent signaling reaction. Taken together, the results indicate that IL-2R is capable of exerting a prominent cytokine- and hematopoietin-receptor signal in the heterologous hepatoma cells which are comparable to those elicited by other members of the hematopoietin receptor family including the resident IL-6R.


Figure 2: Regulation of pHRRE-CAT gene by hematopoietin receptors in H-35 cells. In two separate experimental series (A and B), H-35 cells were transfected with pHRRE-CAT and the mixture of expression vectors for IL-2Ralpha, -beta, and - (A) or with pHRRE-CAT and the receptor expression vectors indicated at the top in B. Subcultures of each transfected cell culture were treated with the cytokines listed at the bottom. CAT activity was determined in 10-fold serially diluted extracts and calculated relative to the control culture in each experimental group (values given above the autoradiographic image).



Relative Contribution of IL-2R Subunits to Signaling

To define the relative contribution of the IL-2R subunits to the reconstituted IL-2 response, H-35 cells were transfected with various combinations of receptor subunits, together with either the CytRE- or HRRE-containing CAT reporter gene constructs, and then challenged with increasing concentrations of IL-2 (Fig. 3A). The combination of IL-2Rbeta and - was necessary to achieve gene regulation. The dose response was identical for both reporter gene constructs. With IL-2Ralpha present, the IL-2 sensitivity of the transfected cells increased 10-fold. However, the maximal magnitude of stimulation showed only a minor enhancement. When the transfected H-35 cells were treated with IL-15 instead of IL-2, an identical 10-fold improvement of the responsiveness was observed as a function of the IL-2Ralpha subunit (data not shown). The role of the IL-2Ralpha subunit to the action of IL-2Rbeta and - complex was also assessed by treating the transfected H-35 cells with anti-Tac (anti-IL-2Ralpha antibodies) (Fig. 3B). In the presence of the receptor antibody, the dose response for IL-2, as well as for IL-15, indicated an approximately 10-fold reduced sensitivity. These data support the model that IL-2Ralpha in hepatic cells, like in other systems(52, 57) , confers an enhanced ligand binding onto IL-2R.


Figure 3: A, dose response of IL-2R action. H-35 cells were transfected with pAGP(4 times CytRE)-SV-CAT (top panel) or pHRRE-CAT (bottom panel) together with the expression vectors for the indicated IL-2R subunits. Cultures were divided into seven subcultures which were then treated with the IL-2 concentrations listed on the abscissa. The change in CAT activity relative to the control culture (0 nM IL-2) was calculated. B, effect of anti-IL-2Ralpha on IL-2R function. H-35 cells were transfected with expression vectors for IL-2Ralpha, -beta, and - and pHRRE-CAT. The cultures were divided into two sets of 10 subcultures. One set was treated with serially diluted IL-15 (5 duplicates) and the other with IL-2. In each set, one of each duplicate received 1 µg/ml nonspecific immunoglobulin, and the other 1 µg/ml anti-TAC (anti-IL-2Ralpha). After 24 h, the increase of CAT activity relative to the control cultures was determined.



The Cytoplasmic Domain of IL-2Rbeta Is Sufficient for Regulation

Earlier studies of IL-2R action in fibroblasts and hematopoietic cells indicated that signal transduction required the cytoplasmic domains of both the beta and subunits(20, 52, 69, 70) . We determined the significance of the cytoplasmic domain of the two subunits indirectly by using either IL-2Rbeta or IL-2R lacking its cytoplasmic domain (IL-2Rbeta(Deltacyto) or IL-2R(Deltacyto))(4) . In a separate experiment (data not shown), we verified by mRNA analysis that the vectors were expressed in H-35 cells. Neither the combination of the truncated IL-2Rbeta with full-length IL-2R nor the truncated IL-2R with full-length IL-2Rbeta reconstituted CAT reporter gene activation, even at IL-2 concentrations as high as 5 µg/ml ( Fig. 1and data not shown).

To assess whether the cytoplasmic domains of IL-2Rbeta and - initiated signaling independently of each other, we transfected chimeric receptors consisting of the extracellular domain of G-CSFR and the transmembrane and intracellular domain of either IL-2Rbeta or -. The chimeric receptors were predicted to function as ligand-induced homodimers. Like the bona fide IL-2R ( Fig. 1and 2A), the G-CSFR-IL-2Rbeta chimera proved to be as active in regulating AGP-CAT (Fig. 4A) and HRRE-CAT (Fig. 4B). G-CSFR-IL2R was ineffective on AGP-CAT (Fig. 4A) and HRRE-CAT (data not shown) and did not significantly enhance the magnitude of stimulation achieved by G-CSFR-IL-2Rbeta (Fig. 4A and data not shown).


Figure 4: Activity of the G-CSFR-IL-2R chimeras. The receptor expression vectors, combined with the CAT gene constructs listed at the top in A or HRRE-CAT in B, were transfected into H-35 cells. Subcultures were treated with the cytokines listed at the bottom, and the CAT activity was quantitated relative to the control cultures.



The IL-2R Signals Do Not Act on IL-6RE or SIE

Previous characterizations of IL-6-type cytokine receptors and G-CSFR indicated that the strong activation of gene expression via IL-6REs of several APP genes was characteristic for cytoplasmic receptor domains that included a box 3 sequence motif(43, 45) . To determine whether the IL-2R action on hepatic cells also included an IL-6-type signal, the IL-2R subunits alpha, beta, and were transfected into H-35 cells together with CAT reporter gene constructs containing IL-6REs of three separate APP genes, or, for comparison, the AGP cytokine response elements, HRRE and SIE (Fig. 5). The activity of IL-2R regulation of these elements was determined relative to the response achieved by the appropriate endogenous receptors. However, whereas the signaling activity of the IL-2R was clearly evident with the CytRE of the AGP gene, no response was recorded through the IL-6REs and the SIE. Similarly, the chimeric G-CSFR-IL-2Rbeta acted prominently on CytRE and HRRE, but not detectably on IL-6RE and SIE (see Fig. 4B and data not shown).

The gene element specificity of the signals derived from the IL-2R or G-CSFR-IL-2Rbeta was not restricted to H-35 cells. Transfection of the same reporter gene constructs and receptor expression vectors into human HepG2 cells yielded essentially the same pattern of regulation except that the numerical values for the magnitudes of cytokine responses were not as high as in H-35 cells (data not shown; see also Fig. 11below).


Figure 11: Action of JAK3. A, effect of JAK3 on receptor action in HepG2 cells. HepG2 cells were transfected with a mixture containing the plasmid DNAs indicated at the top. The reporter gene was pHP(5 times IL-6RE)-CAT. The subcultures were treated with the cytokines as indicated at the bottom. In each experimental set, the CAT activities were normalized to the internal major urinary protein marker and expressed relative to untreated control culture that did not receive JAK3. B, dose response of JAK3. Two sets each of HepG2 and H-35 cells were transfected with a DNA mixture containing increasing amounts of pCD-JAK3 and constant amounts of expression vector for IL-2Rbeta, IL-2R, IL-4R, and IL-7R or EPOR alone. The reporter construct for all was pHP(5 times IL-6RE)-CAT. Subcultures of each set were treated with IL-2, IL-4, IL-7, EPO, or IL-6, and the -fold stimulation of CAT activity was taken as an indicator for the action of the appropriate receptor listed at the left.



IL-2R Does Not Activate SIF in Transfected Cells

Signal initiation by several hematopoietin receptors has been linked to the activation of STAT proteins(28, 29) . These proteins avidly bind to SIE, or sequence-similar oligonucleotides, and are recognized on GMSA as multiple complexes which have been termed, among others, SIF-A, -B, and -C(35) . Since IL-2R is functional in transfected H-35 cells, we asked whether IL-2R has similar SIF-inducing activity. Detection of STAT protein activation by transiently transfected receptors was, however, not technically feasible in H-35 cells primarily because of the low transfection efficiency of these cells and thus low level expression of receptor protein(45) . Moreover, stably transfected H-35 cell lines proved to be difficult to establish, and receptor expression in almost all selected lines was lost during extended culture periods. Therefore, we resorted to the use of L-cells and COS-1 cells which, like hepatoma cells, not only responded to IL-6 and LIF by a robust activation of SIF, but also permitted high level expression of transiently transfected receptor. The switch to nonhepatic cells demanded, however, that we demonstrate in these cells at least qualitatively similar receptor functions as defined in hepatoma cells. A correlation of receptor protein expression with SIF activation and CAT gene regulation in the same transfected cell culture was possible in L-cells, because these cells regulated the same IL-6RE and HRRE-CAT reporter gene constructs as H-35 cells, albeit at a much lower magnitude of stimulation. COS-1 cells yielded a 10-fold higher expression of transfected receptor than L-cells but could not be used for determining gene regulation because all our CAT reporter gene constructs contained SV40 promoter sequences which caused high constitutive expression in COS-1 cells.

The salient features of the receptor assay developed for L-cells are shown in Fig. 6. In this example, we used progressively truncated G-CSFR to demonstrate (a) the relevance of three box motifs in the cytoplasmic domain for signaling and (b) the relationship of receptor expression, SIF activation, and CAT gene regulation. All transfected plasmids were expressed as detected by analysis of mRNA (Northern blot) and protein (Western blot). The box 3 motif containing G-CSFR 130 and 96 yielded a prominent activation of SIF-A with a minor one of SIF-B. In contrast, G-CSFR(56) , lacking box 3 motif, was only minimally effective. The transfected receptor activated the same SIF forms as the endogenous IL-6R and IL-11R, and these were clearly different from SIF-C activated by IFN (Fig. 6). Although the relative electrophoretic mobilities of the SIF complex of L-cells were indistinguishable from those of IL-6-treated H-35 cells, the composition of SIF activities was not identical. In H-35 cells, the immediate response to all IL-6-type cytokine receptors was a strong stimulation of all three SIF forms with only SIF-A being maintained during subsequent hours.^3 The ability of G-CSFR forms to activate SIFs appeared to correlate with the ability to regulate the IL-6RE-CAT construct (Fig. 6, bottom panel).


Figure 6: Functional analysis of G-CSFR in L-cells. Six cultures of L-cells in 15-cm dishes were transfected with 3 ml of a solution of DNA-DEAE-dextran mixture consisting of 10 µg of pHP(5 times IL-6RE) CAT and 30 µg of expression vector for G-CSFR forms listed at the top. After 16 h, each cell culture was released by trypsin and divided into one culture in a 15-cm dish (for Northern and Western blot and GMSA) and 2 cultures in 3.5-cm dishes (for CAT activity). Twenty-four h later, the cells in the 15-cm dishes were changed to serum-free medium, and, after 16 h, cells were treated for 15 min with serum-free medium containing G-CSF. The cells were scraped off the dish, and one-third of the cell suspension was removed for RNA extraction, one-third for immunoprecipitation and Western blot analysis, and the remainder for GMSA. Aliquots of 20 µg of total cellular RNA were analyzed by Northern blot hybridization to P-labeled cDNA encoding the extracellular domain of G-CSFR. Equal loading of RNA is demonstrated by the ethidium bromide staining of the 18 S rRNA band (top panels). The cells for Western blot analysis were lysed, and the supernatant fraction after centrifugation was subjected to immunoprecipitation with rabbit anti-human G-CSFR. The precipitates were separated and processed for Western blotting. For GMSA, 5 µl of whole cell extract was reacted with P-labeled SIE. Nuclear extract of IL-6-treated H-35 cells served as a standard (Std). For comparison, the activation of SIF in control L-cells treated with serum-free medium alone (control) or containing IL-6, IL-11, or IFN- is illustrated. The autoradiogram of SIF complex as formed by extract of G-CSFR-transfected cells was exposed for 3 days. The autoradiogram of the complex by the H-35 standard and untreated L-cells was exposed for 6 h. The two cultures in 3.5-cm dishes were treated for 24 h with or without G-CSF, and the CAT activity was determined. The relative change in CAT activity is indicated above the autoradiogram.



IL-2 did not increase SIF activity in nontransfected L-cells (Fig. 7A). Although transfection of either the combination of IL-2Ralpha, -beta, and - or G-CSFR-IL-2Rbeta reconstituted an IL-2 regulation of co-transfected HRRE-CAT construct (Fig. 7B, bottom panel), no IL-2-inducible protein binding to either SIE or HRRE was detectable (Fig. 7B, middle panel). The expression of the transfected receptor was demonstrated in the case of G-CSFR-IL-2Rbeta (Fig. 7B, top panel).


Figure 7: Action of IL-2R in L-cells. A, response of untransfected L-cells. Cells in 10-cm dishes were treated for 15 min with medium alone or containing IL-6, LIF, or IL-2. Whole cell extracts were subjected to GMSA. Positions of SIF-A, -B, and -C were compared to the standard consisting of nuclear protein extracted from IL-6-treated H-35 cells. The autoradiogram was exposed for 16 h. B, two separate cultures of L-cells in 15-cm dishes were transfected with 3 ml of DNA-DEAE-dextran solution containing pHRRE-CAT (10 µg) and either a mixture of IL-2Ralpha, -beta, - (10 µg each) or G-CSFR-IL-2Rbeta (30 µg). The cultures were divided into two 10-cm dishes and two 3.5-cm dishes. The 10-cm dishes were treated for 15 min with either medium alone or IL-2 or G-CSF. Whole cell extracts were prepared. One-fourth of the cells transfected with G-CSFR was removed prior to extraction and subjected to Western blot analysis. Duplicate aliquots of 5 µl of cell extract were used for GMSA using either P-labeled SIE or HRRE as probe. Extract of IL-6-treated H-35 cells was included at the left as standard. The autoradiogram was exposed for 5 days. Cells in 3.5-cm dishes were treated for 24 h as indicated at the bottom, and the CAT activity was determined. Relative change is listed above the autoradiogram.



The failure to detect SIF activation by IL-2R in L-cells may be attributed to either one or both of the following: (a) insufficient expression of the receptor subunits or (b) lack of signal transducing components (i.e. JAK3 and its target STAT proteins) that are utilized by IL-2R to produce SIF activity in lymphocytes(58, 75, 76, 77) .

To assess the influence of receptor levels, we transfected the IL-2R forms into COS-1 cells which yielded high expression of the plasmids as determined by mRNA (Fig. 8A) and protein analysis (Fig. 8B). COS-1 cells that received either the combination of IL-2Ralpha, -beta, and - (Fig. 9A, lanes 3 and 4) or G-CSFR-IL-2Rbeta (Fig. 9B) failed to show any receptor-inducible SIF activity. Similarly negative was the transfected G-CSFR-IL-2Rbeta (Fig. 9B, lane 13). COS-1 cells were able to utilize transfected receptor forms to activate SIF as demonstrated by the example of G-CSFR-gp130 (Fig. 9A, lanes 7-11), G-CSFR-LIFR (Fig. 9B, lane 20), or G-CSFR (lane 21). The response elicited by these receptors was compared to the response derived from the endogenous IL-6 (lane 12) or LIF receptor (lane 5). Surprisingly, hematopoietin receptors, such as G-CSFR-MPL (lane 14), EPOR (lane 17), and GHR (lane 19), all of which, like IL-2R, were unable to stimulate expression of IL-6RE-CAT constructs, did nevertheless activate SIF. These data suggest that receptor action on gene expression (HRRE or IL-6RE) in either hepatoma or L-cells does not strictly correlate with the ability of the same receptor to connect with the SIF activation pathway as measured in L-cells and COS cells.


Figure 8: Expression of transfected receptors in COS-1 cells. COS-1 cells in 15-cm dishes were transfected with expression vector for the indicated receptors. A, total cell RNA was extracted, and 20-µg aliquots were analyzed by Northern blot hybridization. Autoradiograms were exposed for 24 h. B, cells were lysed, and the chimeric receptors were immunoprecipitated with rabbit anti-human G-CSFR. The extract from nontransfected COS-1 cells served as a control. The precipitates were subjected to electrophoresis on a 6% SDS gel. The proteins were analyzed by Western blotting using sheep anti-human G-CSFR. The receptors migrated with an apparent molecular size of 120 to 100,000.




Figure 9: Activation of SIF by transfected receptors. COS-1 cells were transfected in two separate experiments (A and B), with the expression vectors for the receptors indicated at the bottom. Subcultures were treated for 15 min with the listed cytokines or suramin (in A, lanes 7-10, the G-CSFR concentration in ng/ml). Whole cell extracts were prepared and analyzed by GMSA using SIE as a probe. The SIF pattern of H-35 cells treated with IL-6 served as standard (Std). The autoradiograms were exposed for 3 days.



JAK3 Reconstitutes an IL-6 Signal and SIF Activation by IL-2R in HepG2 Cells

We determined gene regulatory activities of IL-2R in nonlymphoid cell lines which are known to be devoid of an endogenous IL-2R response. The fact that transfected IL-2 mediated an HRRE signal equal to other hematopoietin receptors indicated that this cell response was not dependent on cell-type-restricted signaling molecules. However, the failure to detect an IL-6RE activation by IL-2R in hepatic cells and a SIF activation in L-cells and COS-1 cells may be explained by the absence of the signal communication pathway that is specific to naturally IL-2-responsive cells, such as the pathway involving leukocyte-restricted protein tyrosine kinase JAK3(58, 75, 76, 77) .

To assess the potential of IL-2R to regulate SIF activity, we subjected IL-2-deprived CTLL-2 cell cultures to an IL-2 restimulation (Fig. 10A). A transient activation of a SIF pattern was detected (lane 6) that consisted of two binding complexes co-migrating with SIF-A and SIF-B of either IL-6-treated H-35 cells (lane 1) or L-cells (lane 3).


Figure 10: A, stimulation of SIF in CTLL-2 cells by IL-2. A culture of CTLL-2 cells was maintained 16 h in RPMI containing 0.5% fetal calf serum without IL-2. The cells (75 times 10^2) were centrifuged, and the pellet was resuspended in 15 ml of serum-free minimal essential medium and divided into 3 equal aliquots. To two cultures, IL-2 was added, and, after 15 min at 37 °C, the control (lane 5) and one IL-2-treated culture (lane 6) were extracted. The second IL-2-treated culture (lane 7) was extracted after 2 h. Whole cell extracts were subjected to GMSA using SIE as probe. The standard was a nuclear extract of IL-6-treated H-35 cells (lane 1), and, for comparison, whole cell extracts of control L-cells (lane 2) or L-cells treated for 15 min with IL-6 (lane 3) or IFN- (lane 4) were included. The autoradiogram was exposed for 24 h. B, expression of JAK3 mRNA. A polyadenylated RNA fraction (10 µg) from CTLL-2, L-, and H-35 cells was subjected to Northern blot analysis using P-labeled mouse JAK3 cDNA as probe. The autoradiogram is shown in the upper panel. The mRNA band and the position of the rRNA markers are indicated. The lower panel shows the ethidium bromide staining pattern of the gel-separated RNAs.



The fact that SIF activities are induced in CTLL-2 cells by IL-2 suggests that these cells do have a signaling pathway involving STAT proteins and that this pathway does not exist in L-cells and COS-1 cells and probably also in hepatoma cells (see Fig. 12below). JAK3 and/or its target STAT proteins appeared as a mostly likely constituent of such a lymphoid cell-restricted SIF regulatory pathway(58, 75, 76) . We determined JAK3 mRNA in L-, H-35, and CTLL-2 cells by Northern blot analysis (Fig. 10B) and, as expected, observed a prominent JAK3 mRNA signal in CTLL-2 cells. However, both L-cells and H-35 cells also revealed a hybridizing band, albeit at a much lower relative level. The result in Fig. 10suggested that an insufficient amount of JAK3 relative to the overexpressed IL-2R subunits might be one reason for the lack of STAT activation in L-cells and COS-1 cells. To correct this presumed unfavorable ratio, we prepared an expression vector for JAK3, co-transfected that along with IL-2R subunits into each of the test cells used in this study, and determined its influence on the receptor action, i.e. on gene regulation and SIF activation.


Figure 12: Reconstitution of SIF activation by JAK3. L-, COS-1, and HepG2 cells were similarly transfected with the plasmid DNAs containing the expression vector indicated at the top. Subcultures in 6-cm diameter Petri dishes (L- and COS-1 cells) or 6-well cluster plates (HepG2 cells) were treated for 15 min with the cytokines listed above the panels. Whole cell extracts were subjected to GMSA using SIE as probe. For comparison of the electrophoretic pattern of IL-2- and IL-4-inducible SIFs, normal human NK cells were included in the analysis. The autoradiograms for the lanes containing the transfected cell extracts were exposed for 3 days. The standards consisting of extracts from cytokine-treated, but not transfected, cells were exposed for 6 h. The lanes with control and IL-4-treated NK cell extract were exposed for 3 days, and the lane of IL-2-treated cells for 8 h. The position of the SIF-A, -B, and -C (defined by the pattern of the IL-6 treatment) is indicated at the left. The IL-2- and IL-4-induced bands are marked by open arrowheads at the right.



When we included JAK3 into the H-35 cell assays as shown in Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5, we did not observe an appreciable change in qualitative pattern of CAT gene regulation by any of transfected or endogenous hematopoietin receptors. In particular, we could not detect any activation of IL-6RE CAT constructs by either IL-2R, IL-4R, or IL-7R (data not shown; see also Fig. 11B). However, JAK3 enhanced approximately 2- to 10-fold the basal and maximally 2-fold the cytokine-stimulated expression of the HRRE and CytRE CAT constructs in those cells that received IL-2beta and -, or the combination of IL-2R with either IL-4R or IL-7R (data not shown). The action of the chimeric receptors G-CSFR-IL-2Rbeta and G-CSFR-IL-2R (individually or in combination), as well as of G-CSFR-MPL, IL-6-type cytokine receptors, G-CSFR, EPOR, and GHR was unaffected by JAK3.

A different result was obtained when the effects of overexpressed JAK3 on gene regulation was determined in HepG2 cells (Fig. 11). Similar to the findings in H-35 cells, JAK3 was ineffective in modulating the action of IL-6-type cytokine receptors, G-CSFR-MPL, EPOR, and GHR. In combination with the functional receptors that included the IL-2R subunit, JAK3 elevated signaling toward HRRE and CytRE. Surprising, however, was that in the presence of JAK3 both the IL-2Rbetabullet complex and IL-4R, but not IL-7R, gained the ability to activate CAT gene constructs containing the IL-6RE (Fig. 11A) or SIE (data not shown). The magnitude of stimulation was in the range of that mediated by IL-6R. Although JAK3 did not elicit an IL-6 signal with either G-CSFR-IL-2Rbeta or G-CSFR-IL-2R, with both chimeric receptors combined, JAK3 again mediated a prominent IL-6RE regulation (Fig. 11A).

Dose-response analyses indicated that maximal IL-6RE regulatory action of both IL-2R and IL-4R was achieved with a ratio of 0.2 µg of JAK3 expression vector versus 1 µg of receptor expression vector (Fig. 11B). Higher relative amounts of JAK3 expression vector in the transfection mixture did not enhance or diminish receptor action. The comparison also revealed that the JAK3-dependent signaling was more effective with IL-4R than IL-2R (Fig. 11B) and that the relative activity of the two receptors was reversed and then compared to the HRRE signal (see Fig. 2B). The finding that JAK3 established an IL-6-type response by IL-2R and IL-4R in HepG2 cells suggested that an additional productive signal pathway via JAK3 has been reconstituted.

To identify whether the action of JAK3 was also necessary for the activation of STAT proteins in L-cells and COS-1 cells, a combination of expression vectors for JAK3, IL-2R, and IL-4R was transfected into these cells, and the cytokine effect on SIF activities was measured. Neither receptor reconstituted a SIF activity in L-cells (Fig. 12). By contrast, in COS-1 cells, we observed an IL-4-, but not an IL-2-mediated SIF stimulation. The response to the two cytokines was, however, not detectably modified by the co-transfected JAK3. In both cell types, we established by mRNA analysis that the JAK3 expression vector was highly active (data not shown). From these results, we concluded that in L-cells and COS-1 cells the failure of reconstituting an IL-2R response on STAT protein was probably not due to lack of JAK3 but due to the absence of JAK3-regulated STAT proteins.

Based on the observations that prominent IL-6-type gene regulation correlated with SIF activation (Fig. 6) and that JAK3 introduced this type of gene regulation through IL-2R and IL-4R in HepG2 cells (Fig. 11), we expected that JAK3 will also reconstitute SIF activation in HepG2 cells. Therefore, we applied the transient transfection protocol established for receptor analysis in L-cells to HepG2 cells. Although based on mRNA analysis the relative level of receptor expression per transfected cell culture was approximately 15 times lower in HepG2 cells than L-cells (data not shown), we could nevertheless reconstitute a JAK3-sensitive STAT protein activation by both the IL-2R and IL-4R (Fig. 12). The induced SIF complex co-migrated with SIF-B and -C and yielded an electrophoretic pattern comparable to that activated by the same cytokines in human NK-cells. Taken together (Fig. 13), we conclude that: (a) HepG2 cells do express the STAT proteins that are substrates of JAK3; (b) these STAT proteins may serve as mediators of the IL-6 signal; (c) the specificity of gene regulation by hematopoietin receptors is controlled by the receptor subunit complex, receptor-associated kinase(s), STAT proteins, and gene elements; and (d) reconstitution of the receptor signaling pathways in heterologous cell systems permit dissection of the complexity and specificity of the signal transduction pathways leading to the control of gene expression.


Figure 13: A summary of cell responses activated by hematopoietin receptors. The diagram lists the receptor forms with the subunit combinations believed to be necessary for signaling action. The position of the box 1, 2, and 3 motifs (LIFR contains 2 copies of the box 3 motif but no functional box 1) and the two IL-4 STAT binding sites in IL-4R are marked by bars. The IL-6R and LIFR represent endogenous receptors, the others are those transfected in this study. Below the diagrams, the qualitative responses elicited by the receptors are listed. The regulation of specific gene elements by the receptors has been determined in hepatoma cells. The activation of STAT proteins, which are detectable as SIFs, is identified in L- and COS-1 cells (the specific forms of STAT proteins involved in the SIF complexes have not yet been determined). The ability of the receptor to activate the JAK3-specific pathway is defined in HepG2 cells. Wherever we could not detect a positive action (less than 10% of maximal response), no entry has been made.




DISCUSSION

The various types of hematopoietin receptors are often expressed in cells of widely different phenotypes; their unique cellular contexts thus preclude a direct comparison of receptor action. Recognizing the structural relationship among hematopoietin receptors, some common signaling mechanisms have been suspected(2, 28, 29) . We reasoned that the regulation of differentiated genes in one given cell type will provide defining features of receptor signals which are more readily assessed than the proliferative cell response activated by the same receptors in hematopoietic cells.

Our study has demonstrated that transient expression of IL-2Rbeta and - subunits in hepatic cells reconstitutes IL-2- and IL-15-specific gene activation (Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5); a process that is, in part, shared among other members of the hematopoietin receptor family (Fig. 13). The similarity in the cell response, e.g. HRRE regulation, suggests that each of the hematopoietin receptors, regardless of its cellular origin, might utilize the same signal transduction mechanism in the test cells and that this mechanism might also be operative in other, nonhepatic cell types. The reconstitution of IL-2R signaling function in the heterologous cell systems permitted us to define the contribution of lymphoid-specific JAK3 and its substrate STAT proteins in regulating expression of differentiated genes (Fig. 6Fig. 7Fig. 8Fig. 9Fig. 10Fig. 11Fig. 12). The fact that we gained a JAK3-dependent regulatory action on IL-6RE, while maintaining essentially unchanged the HRRE and CytRE regulation, strongly suggests that two separate IL-2R signals exist. One signal pathway is independent of JAK3, is targeted to HRRE and CytRE, and is not detectably correlated with SIF activation; the other signal requires JAK3 and appropriate substrate STAT proteins and leads to gene activation via IL-6RE.

Our results present new aspects of hematopoietin receptor function; that is, the control of differentiated genes. Since the characterization of the receptors occurred in a heterologous cell system, the question arises as to the physiologic relevance of the potential receptor function in the homologous cell system, i.e. IL-2R action in lymphoid cells. The fact that the proliferation signal produced by IL-2R could, in part, be correlated with the control of immediate early growth response genes(16, 20, 42) suggests that gene regulatory mechanisms in lymphoid cells exist and that these may involve pathways analogous to those uncovered in transfected hepatic cells. An IL-2R signaling mechanism similar to that in hepatic cells seems even more likely to be found in differentiated lymphocytes, such as in NK cells in which the monocyte-derived IL-15 does not exert a proliferative response but stimulates the expression of several cytokine genes(26) .

The ease of gene transfection and the prominence of specific gene regulation in hepatic cells offer the great advantage of transient genetic manipulation and facilitate dissection of signaling pathways linking the receptor with the regulation of specific gene elements. Clearly, hepatic or fibroblastic cells cannot fully substitute for lymphoid cells because of their cell type-specific differences in make-up of signal transducing molecules and in the set of target genes controlled by the signals. However, these differences render our assay system even more attractive for studying hematopoietin receptors because the specific function of the cell-type restricted signaling factor(s) can be defined by complementation. The broadening of the IL-2R signal specificity by JAK3 in HepG2 cells is a case in point ( Fig. 11and Fig. 12).

One shortcoming of hepatoma cells is that the isolation of stably transfected lines is difficult and unpredictable and, therefore, makes these cells, unlike lymphoid cells(69, 70) , unsuitable for analyzing the proliferative response, if any, elicited by the introduced receptor. To define the overlap of proliferation and gene control with respect to the signaling pathways, we will have to rely on comparison of data derived from multiple systems.

The fact that transfected IL-2R and other nonhepatic receptors mediated transcriptional activation of specific gene constructs ( Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5and 10; (45) ) indicated an effective interaction of these receptors with the signal transduction mechanism in the heterologous system. Although the responses appeared receptor-specific, the results do not unequivocally prove that the action of the introduced receptor subunits was fully accountable for the observed regulation, because hepatoma cells, like most other cells, possess a set of hematopoietin receptor subunits, some of which may potentially contribute to or interfere with the transfected receptor action.

We showed (Fig. 1Fig. 2Fig. 3Fig. 4Fig. 5) that the combination of human IL-2Rbeta and - is necessary to elicit a HRRE signal in our cell system. The same subunit requirements were noted for proliferative response and control of early response genes in pre-B-cells(68, 69, 70) . The importance of the cytoplasmic domain of the two subunits for the hepatic action was inferred from experiments involving IL-2R subunits with truncated cytoplasmic domains (Fig. 1) and G-CSFR-IL-2R chimeras (Fig. 2). The cytoplasmic domain of IL-2Rbeta in the artificial context of the G-CSFR-mediated dimer performs essentially the same signaling event as the betabullet complex. A related observation was made by Nelson et al.(70) who demonstrated that similar proliferative signals were generated by the normal betabullet complex and the chimeric construct c-kit-IL-2Rbeta in BAF cells. Interestingly, this c-kit-IL-2Rbeta-restricted regulation was cell type-specific because it was not reproducible in CTLL-2 cells. The combined data suggest that the beta subunit acts as a critical determinant in initiating signal transduction both in hematopoietic and hepatic cells. The functional relevance of specific regions in the beta subunit cytoplasmic domain has been documented by the identification of the structural elements which are critical for signaling in hematopoietic cells and fibroblasts(16, 68, 78) . However, every IL-2R reconstitution experiment using wild-type subunits indicated that the IL-2R subunit is also essential for signaling. Furthermore, the same obligatory function of the IL-2R was observed in reconstituting active IL-4R and IL-7R (Fig. 2; (5) and (6) ).^2 Although the IL-2Rbeta dimer appears to be a functional entity (Fig. 4; (70) ), it remains unclear whether the IL-2Rbeta subunit, as an artificial homodimer, has only limited signaling specificity (restricted to HRRE) or whether it has redundant IL-2R function. The complementation experiment (Fig. 11) suggests, however, that the IL-2R cytoplasmic domain is required for JAK3-dependent signal and is not dispensable by IL-2Rbeta dimerization.

The IL-2R signaling activity to HRRE, as well as the much lower activity of IL-4R, could not be correlated with the activation of STAT proteins as defined by binding to SIE (Fig. 7, Fig. 9, and Fig. 12). Since CTLL-2 cells (Fig. 10A) and NK cells (Fig. 12) showed an IL-2-responsive STAT activation, we concluded that SIF activation was not involved in signaling to HRRE and that the STAT-inducing factors operating in lymphocytes are not present in our test cells. JAK3 was the logical candidate factor for the cell type-restricted activity of the IL-2R action on SIF(58, 76, 77, 78, 79, 80) . The lymphoid-specific STAT activation may not be solely determined by JAK3 expression (JAK3 mRNA was detectable in L-cells and H-35 cells; Fig. 10A), but also by JAK3-specific substrates, i.e. STAT proteins. Attempts to reconstitute the missing SIF activation and IL-6RE regulation in our cell systems by overexpressing JAK3 indicated that the combination of JAK3 and JAK3-activated STAT proteins contributes to the functional specificity. The results from H-35 cells (Fig. 11B) and L- and COS-1 cells (Fig. 12) suggest that these cells, even when supplemented with JAK3, are unable to signal since the appropriate STAT proteins are missing. However, HepG2 cells seem to contain STAT proteins that serve as substrates for JAK3, but appear to be deficient in JAK3, explaining the prominent complementation of IL-2R action by JAK3 ( Fig. 11and Fig. 12).

We have not identified the STAT proteins that constitute the IL-2R-inducible SIF seen in Fig. 10A and Fig. 12. Since the IL-4R receptor proved to be the most prominent activator of IL-6RE in the presence of JAK3, we assume that the recently described IL-4 STAT (41) is participating in this regulation. The presence of that factor in the hepatic cells is not surprising, since Hou et al.(41) detected by mRNA analysis high level expression of IL-4 STAT in the liver. The IL-4R contains two box 3-related sequences that serve as binding sites for IL-4 STAT (41; indicated in Fig. 13). Because the IL-2R enables signaling of the IL-4R by JAK3, one possible explanation which is in agreement with the analysis of receptor subunit-associated kinases (75, 76, 77) is that the IL-2R subunit provides JAK3 kinase to the receptor signaling reaction leading to the phosphorylation of IL-4 STAT or any other STAT protein bound to IL-4R (40, 41) . If so, the same IL-2R function is expected to be a part of the signaling by IL-2R (betabullet complex) and IL-7R. The contribution of IL-2Rbeta appears not only to include presentation of STAT proteins, but also the interaction with JAK1 by its membrane proximal region(58, 79) . It remains to be shown whether the JAK1-specific pathway that is considered to be general to hematopoietin receptors (28, 29) is mediating the HRRE signal via a yet to be detected STAT protein.

The working model of IL-2R providing JAK3 and the IL-2Rbeta, the STAT proteins, and probably JAK1 to the signaling reaction also seems to apply to the heterodimeric form of the G-CSFR-IL-2Rbetabullet (Fig. 13). Indeed, this experimental system will allow us to define the precise cytoplasmic domains in each chimeric subunit that provides the respective function for the JAK3-dependent STAT activation leading to IL-6RE induction in HepG2 cells.

This study focuses on the ability of hematopoietin receptors to control gene expression. The comparison of the specificity by which these receptors control the proliferative response in nonhepatic cells reveals common traits in signaling. Like the regulation of CytRE in hepatoma cells(45) , box 1 and 2 motifs are required in the signaling subunit for generating the proliferative signal by IL-2R(16, 69, 70) , GM-CSFR(17, 81) , EPOR(19, 55, 82, 83) , PRLR(84) , gp130(7, 80, 85, 86) , and G-CSF(9, 10, 18) . Analysis of the GHR indicated, however, that a proliferative signal was already achieved with just the box 1 motif present(87, 88) . In several of these cases, JAK2 has been implied as being a potential mediator of the proliferative signal. It remains to be shown which of the signaling pathways characterized in the present studies (Fig. 13) is also part of the growth regulation and activation of an immediate gene growth response. A larger challenge will be to identify the molecular mechanisms that determine the specificity by which the hematopoietin receptors accomplish their tasks in the different cell types.


FOOTNOTES

*
This work was supported by National Institutes of Health Grant CA26122, American Chemical Society Grant DHP-111B, and Grant 2709 of the Women's and Children's Health Research Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Permanent address: Dept. of Ophthalmology, School of Medicine, Tohoku University, Sendai 980, Japan.

To whom correspondence and reprint requests should be addressed. Tel.: 716-845-4587; Fax: 716-845-8389.

(^1)
The abbreviations used are: IL-, interleukin; AGP, alpha(1)-acid glycoprotein; APP, acute phase protein; CAT, chloramphenicol acetyltransferase; DRE, distal regulatory element; EPO, erythropoietin; G-CSF, granulocyte-colony stimulatory factor; GH, growth hormone; GMSA, gel mobility shift assay; GRE, glucocorticoid response element; HP, haptoglobin; HRRE, hematopoietin receptor response element; CytRE, cytokine response element; JAK, Janus kinase; LIF, leukemia inhibitory factor; IFN, interferon; -R, receptor; PRL, prolactin; SIE, sis-inducible element; SIF, sis-inducible factor; STAT, signal transducer and activator of transcription.

(^2)
Ziegler, S. F., Morella, K. K., Anderson, D., Kumaki, N., Leonard, W. J., Cosman, D., and Baumann, H.(1995) Eur. J. Immunol., in press.

(^3)
C.-F. Lai, S. Immenschuh, D. P. Gearing, S. F. Ziegler, and H. Baumann, submitted for publication.


ACKNOWLEDGEMENTS

We thank Dr. W. I. Wood for providing GHR cDNA; Dr. G. Strassmann for suramin; Drs. M. Caligiuiri and W. Carlson for IL-2 and NK cells; Dr. P. Schendel, Genetics Institute, for IL-11; Dr. G. H. W. Wong, Genentech, for murine IFN-; and Marcia Held for secretarial assistance.


REFERENCES

  1. Bazan, J. F. (1990) Proc. Natl. Acad. Sci. U. S. A. 80, 6934-6938
  2. Miyajima, A., Kitamura, T., Harada, N., Yokota, T. & Arai, K. (1992) Annu. Rev. Immunol. 10, 295-331 [CrossRef][Medline] [Order article via Infotrieve]
  3. Leonard, W. J., Noguchi, M., Russell, S. M. & McBride, O. W. (1994) Immunol. Rev. 138, 61-86 [CrossRef][Medline] [Order article via Infotrieve]
  4. Noguchi, M., Adelstein, S., Cao, X. & Leonard, W. J. (1993) J. Biol. Chem. 268, 13601-13608 [Abstract/Free Full Text]
  5. Kondo, M., Takeshita, T., Ishii, N., Nakamura, M., Watanabe, S., Arai, K. & Sugamura, K. (1993) Science 262, 1874-1877 [Abstract/Free Full Text]
  6. Russell, S. M., Keegan, A. D., Harada, N., Nakamura, Y., Noguchi, M., Leland, P., Friedmann, M. C., Miyajima, A., Puri, R., Paul, W. E. & Leonard, W. J. (1994) Science 262, 1880-1883
  7. Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukama, K., Yamanishi, K., Taga, T. & Kishimoto, T. (1993) Science 260, 1808-1810 [Abstract/Free Full Text]
  8. Stahl, N. & Yancopoulos, G. D. (1993) Cell 74, 587-590 [CrossRef][Medline] [Order article via Infotrieve]
  9. Fukunaga, R., Ishizaka-Ikeda, E., Pan, C. X., Seto, Y. & Nagata, S. (1991) EMBO J. 10, 2855-2865 [Medline] [Order article via Infotrieve]
  10. Ziegler, S. F., Bird, T. A., Morella, K. K., Mosley, D., Gearing, D. & Baumann, H. (1993) Mol. Cell. Biol. 13, 2384-2390 [Abstract/Free Full Text]
  11. Watowich, S. S., Yoshimura, A., Longmore, G. D., Hilton, D. J., Yoshimura, Y. & Lodish, H. F. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2140-2144 [Abstract/Free Full Text]
  12. Ultsch, M. & de Vos, A. M. (1993) J. Mol. Biol. 231, 1133-1136 [CrossRef][Medline] [Order article via Infotrieve]
  13. de Vos, A. M., Ultsch, M. & Kossiakoff, A. A. (1992) Science 255, 306-312 [Abstract/Free Full Text]
  14. de Sauvage, F. J., Hass, P. E., Spencer, S. D., Malloy, B. E., Gurney, A. L., Spencer, S. A., Darbonne, W. C., Henzel, W. J., Wong, S. C., Kuang, W.-J., Oles, K. J., Hultgren, B., Solberg, L. A., Jr., Goeddel, D. V. & Eaton, D. L. (1994) Nature 369, 533-538 [CrossRef][Medline] [Order article via Infotrieve]
  15. Lok, S., Kaushansky, K., Holly, R. D., Kuijper, J. L., Lofton-Day, C. E., Oort, P. J., Grant, F. J., Heipel, M. D., Burkhead, S. K., Kramer, J. M., Bell, L. A., Sprecher, C. A., Blumberg, H., Johnson, R., Prunkard, D., Ching, A. F. T., Mathewes, S. L., Bailey, M. C., Forstrom, J. W., Buddle, M. M., Osborn, S. G., Evans, S. J., Sheppard, P. O., Presnell, S. R., O'Hara, P. J., Hagen, F. S., Roth, G. J. & Foster, D. C. (1994) Nature 369, 565-568 [CrossRef][Medline] [Order article via Infotrieve]
  16. Shibuya, H., Yoneyama, M., Ninomiya-Tsuji, J., Matsumoto, K. & Taniguchi, T. (1992) Cell 70, 57-67 [CrossRef][Medline] [Order article via Infotrieve]
  17. Sato, N., Salamaki, K., Terada, N., Arai, K. & Miyajima, A. (1993) EMBO J. 12, 4181-4189 [Medline] [Order article via Infotrieve]
  18. Fukunaga, R., Ishizaka-Ikeda, E. & Nagata, S. (1993) Cell 74, 1079-1087 [CrossRef][Medline] [Order article via Infotrieve]
  19. Miura, O., Cleveland, J. L. & Ihle, J. N. (1993) Mol. Cell. Biol. 13, 1788-1795 [Abstract/Free Full Text]
  20. Minami, Y., Oishi, I., Liu, Z.-J., Nakagawa, S., Miyazaki, T. & Taniguchi, T. (1994) J. Immunol. 152, 5680-5690 [Abstract]
  21. Rao, M. S., Symes, A., Malik, N., Sohyab, M., Fink, J. S. & Landis, S. C. (1992) Neuroreport 3, 865-868 [Medline] [Order article via Infotrieve]
  22. Rao, M. S., Tyrrell, S., Landis, S. C. & Patterson, P. H. (1992) Dev. Biol. 150, 281-293 [CrossRef][Medline] [Order article via Infotrieve]
  23. Steinman, R. A. & Tweardy, D. J. (1994) Blood 83, 119-127 [Abstract/Free Full Text]
  24. Bancroft, G. J. (1994) Curr. Opin. Immunol. 5, 503-510
  25. Tripp, C. S., Wolf, S. F. & Unanue, E. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3725-3729 [Abstract/Free Full Text]
  26. Carson, W. E., Giri, J. G., Lindemann, M. J., Linett, M. C., Ahdieh, M., Anderson, D., Eisenmann, J., Grabstein, K. & Caligiuri, M. A. (1994) J. Exp. Med. 180, 1395-1403 [Abstract/Free Full Text]
  27. Baumann, H., Marinkovic-Pajovic, S., Won, K.-A., Jones, V. E., Campos, S. P., Jahreis, G. P. & Morella, K. K. (1992) Polyfunctional Cytokines: IL-6 and LIF , Vol. 167, pp. 100-124, The Ciba Foundation Symposium, Wiley, Chichester, UK
  28. Darnell, J. E., Jr., Kerr, I. M. & Stark, G. R. (1994) Science 264, 1415-1421 [Abstract/Free Full Text]
  29. Ihle, J. N., Witthuhn, B. A., Quelle, F. W., Yamamoto, K., Thierfelder, W. E., Kreider, B. & Silvennoinen, O. (1994) Trends Biochem. Sci. 19, 222-227 [CrossRef][Medline] [Order article via Infotrieve]
  30. Hatakeyama, M., Mori, H., Doi, T. & Taniguchi, T. (1989) Cell 59, 837-845 [CrossRef][Medline] [Order article via Infotrieve]
  31. Torrigoe, T., Saragovi, H. V. & Reed, J. C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2674-2678 [Abstract/Free Full Text]
  32. Ernst, M., Gearing, D. P. & Dunn, A. R. (1994) EMBO J. 13, 1574-1584 [Medline] [Order article via Infotrieve]
  33. Corey, S. J., Burkhardt, A. L., Bolen, J. B., Geahlen, R. L., Tkatch, L. S. & Tweardy, D. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4683-4687 [Abstract/Free Full Text]
  34. Shuai, K., Horvath, C. M., Tsai-Huang, L. H., Qureshi, S., Cowburn, D. & Darnell, J. E., Jr. (1994) Cell 76, 821-827 [CrossRef][Medline] [Order article via Infotrieve]
  35. Sadowski, H. B., Shuai, K., Darnell, J. E., Jr. & Gilman, M. Z. (1993) Science 261, 1739-1744 [Abstract/Free Full Text]
  36. Fu, X.-Y., Schindler, C., Improta, T., Albersold, R. H. & Darnell, J. E., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7840-7843 [Abstract/Free Full Text]
  37. Zhong, Z., Wen, Z. & Darnell, J. E., Jr. (1994) Science 264, 95-98 [Abstract/Free Full Text]
  38. Akira, S., Nishio, Y., Inoue, M., Wang, X.-J., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M. & Kishimoto, T. (1994) Cell 77, 63-71 [CrossRef][Medline] [Order article via Infotrieve]
  39. Wakao, H., Gouilleux, F. & Groner, B. (1994) EMBO J. 13, 2182-2191 [Medline] [Order article via Infotrieve]
  40. Kotanides, H. & Reich, N. C. (1993) Science 262, 1265-1267 [Abstract/Free Full Text]
  41. Hou, J., Schindler, U., Henzel, W. J., Ho, T. C., Brasseur, M. & McKnight, S. L. (1994) Science 265, 1701-1706 [Abstract/Free Full Text]
  42. Asao, H., Takeshita, T., Ishii, N., Kumaki, S., Nakamura, M. & Sugamura, K. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 4127-4131 [Abstract/Free Full Text]
  43. Baumann, H., Symes, A. J., Comeau, M. R., Morella, K. K., Wang, Y., Friend, D., Ziegler, S. F., Fink, J. S. & Gearing, D. (1994) Mol. Cell. Biol. 14, 138-146 [Abstract/Free Full Text]
  44. Baumann, H., Ziegler, S. F., Mosley, B., Morella, K. K., Pajovic, S. & Gearing, D. P. (1993) J. Biol. Chem. 268, 8414-8417 [Abstract/Free Full Text]
  45. Baumann, H., Gearing, D. & Ziegler, S. F. (1994) J. Biol. Chem. 269, 16297-16304 [Abstract/Free Full Text]
  46. Baumann, H., Prowse, K. R., Marinkovic, S., Won, K.-A. & Jahreis, G. P. (1989) Ann. N. Y. Acad. Sci. 557, 280-297 [Medline] [Order article via Infotrieve]
  47. Knowles, B. B., Howe, C. C. & Aden, D. P. (1980) Science 209, 497-499 [Abstract/Free Full Text]
  48. Matos, M., Schnier, G., Beecher, M. S., Ashman, L., Williams, D. & Caligiuri, M. A. (1993) J. Exp. Med. 178, 1079-1084 [Abstract/Free Full Text]
  49. Baumann, H. & Strassmann, G. (1993) J. Immunol. 151, 1456-1462 [Abstract]
  50. Larsen, A., Davis, T., Curtis, B. M., Gimpel, S., Sims, J. E., Cosman, D., Park, L., Sorensen, E., Mach, C. J. & Smith, C. A. (1990) J. Exp. Med. 172, 1559-1570 [Abstract/Free Full Text]
  51. Hatakeyama, M., Tsudo, M., Minamoto, S., Kono, T., Doi, T., Miyata, T., Miyasaka, M. & Taniguchi, T. (1989) Science 244, 551-556 [Abstract/Free Full Text]
  52. Takeshita, T., Asao, H., Ohtani, K., Ishii, N., Kumaki, S., Tanaka, N., Munakata, H., Nakamura, M. & Sugamura, K. (1992) Science 257, 379-382 [Abstract/Free Full Text]
  53. Mosley, B., Beckmann, M. P., March, C. J., Idzerda, R. L., Gimpel, S. D., Vanden Bos, T., Friend, D., Alpert, A., Anderson, D., Jackson, J., Wignall, J. M., Smith, C., Gallis, B., Sims, J. E., Urdal, D., Widmer, M. B., Cosman, D. & Park, L. S. (1989) Cell 59, 335-348 [CrossRef][Medline] [Order article via Infotrieve]
  54. Goodwin, R. G., Friend, D., Ziegler, S. F., Jerzy, R., Falk, B. A., Gimpel, S., Cosman, D., Dower, S. K., March, C. J., Namen, A. E. & Park, L. S. (1990) Cell 60, 941-951 [CrossRef][Medline] [Order article via Infotrieve]
  55. Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, D. & Ihle, J. N. (1993) Cell 74, 227-236 [CrossRef][Medline] [Order article via Infotrieve]
  56. Vigon, I., Florindo, C., Fichelson, S., Guenet, J.-L., Mattei, M. G., Souyri, M., Cosman, D. & Gisselbrecht, S. (1993) Oncogene 8, 2607-2615 [Medline] [Order article via Infotrieve]
  57. Leonard, W. J., Pepper, J. M., Crabtree, G. R., Rudikoff, S., Pumphrey, J., Robb, R. J., Soetlik, P. B., Pfeffer, N., Waldmann, T. A. & Greene, W. C. (1984) Nature 311, 626-631 [CrossRef][Medline] [Order article via Infotrieve]
  58. Witthuhn, B. A., Silvennoinen, O., Miura, O., Lal, K. S., Cwik, C., Liu, E. T. & Ihle, J. N. (1994) Nature 370, 153-157 [CrossRef][Medline] [Order article via Infotrieve]
  59. Pruitt, S. C. (1988) Gene (Amst.) 66, 121-134 [CrossRef][Medline] [Order article via Infotrieve]
  60. Won, K.-A. & Baumann, H. (1990) Mol. Cell. Biol. 10, 3965-3978 [Abstract/Free Full Text]
  61. Immenschuh, S., Nagae, Y., Satoh, H., Baumann, H. & Muller-Eberhard, U. (1994) J. Biol. Chem. 269, 12654-12661 [Abstract/Free Full Text]
  62. Marinkovic, S. & Baumann, H. (1990) Mol. Cell. Biol. 10, 1573-1583 [Abstract/Free Full Text]
  63. Baumann, H., Jahreis, G. P. & Morella, K. K. (1990) J. Biol. Chem. 265, 22275-22281 [Abstract/Free Full Text]
  64. Lopata, M. A., Cleveland, D. W. & Sollner-Webb, H. (1984) Nucleic Acids Res. 12, 5707-5717 [Abstract/Free Full Text]
  65. Graham, F. L. & Van der Eb, A. J. (1973) Virology 52, 456-461 [CrossRef][Medline] [Order article via Infotrieve]
  66. Prowse, K. R. & Baumann, H. (1988) Mol. Cell. Biol. 8, 42-51 [Abstract/Free Full Text]
  67. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. (1979) Biochemistry 18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  68. Hatakeyama, M., Mori, M., Doi, T. & Taniguchi, T. (1989) Cell 59, 837-845
  69. Nakamura, Y., Russell, S. M., Mess, S. A., Friedmann, M., Erdos, M., Francois, C., Jacques, Y., Adelstein, S. & Leonard, W. J. (1994) Nature 369, 330-333 [CrossRef][Medline] [Order article via Infotrieve]
  70. Nelson, B. H., Lord, J. D. & Greenberg, P. D. (1994) Nature 369, 333-336 [CrossRef][Medline] [Order article via Infotrieve]
  71. Giri, J. G., Ahdieh, M., Eisenmann, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D. & Anderson, D. (1994) EMBO J. 13, 2822-2830 [Medline] [Order article via Infotrieve]
  72. Baumann, H., Morella, K. K. & Wong, G. H. W. (1993) J. Immunol. 151, 4248-4257 [Abstract]
  73. Campos, S. P., Wang, Y., Koj, A. & Baumann, H. (1994) Cytokine, 6, 485-492 [CrossRef][Medline] [Order article via Infotrieve]
  74. Hattori, M., Abraham, L. J., Northemann, W. & Fey, G. H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 2364-2368 [Abstract/Free Full Text]
  75. Kawamura, M., McVicar, D. W., Johnston, J. A., Blake, T. B., Chen, Y.-Q., Lal, B. K., Lloyd, A. R., Kelvin, D. J., Staples, J. E., Ortaldo, J. R. & O'Shea, J. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6374-6378 [Abstract/Free Full Text]
  76. Johnston, J. A., Kawamura, M., Kirken, R. A., Chen, Y.-Q., Blake, T. B., Shibuya, K., Ortaldo, J. R., McVicar, D. W. & O'Shea, J. J. (1994) Nature 370, 151-153 [CrossRef][Medline] [Order article via Infotrieve]
  77. Kirken, R. A., Rui, H., Malabarba, M. G. & Farrar, W. L. (1994) J. Biol. Chem. 269, 19136-19141 [Abstract/Free Full Text]
  78. Goldsmith, M. A., Xu, W., Amaral, M. C., Kuczek, E. S. & Greene, W. C. (1994) J. Biol. Chem. 269, 14698-14704 [Abstract/Free Full Text]
  79. Tanaka, N., Asao, H., Ohibo, K., Ishii, N., Takeshita, T., Nakamura, M., Sasaki, H. & Sugamura, K. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7271-7275 [Abstract/Free Full Text]
  80. Lütticken, C., Wegenka, U. M., Yuan, J., Buschmann, J., Schindler, C., Ziemiecki, A., Harpur, A. G., Wilks, A. F., Yasukawa, K., Taga, T., Kishimoto, T., Barbieri, G., Pellegrini, S., Sendtner, M., Heinrich, P. C. & Horn, F. (1994) Science 263, 89-92 [Abstract/Free Full Text]
  81. Quelle, F. W., Sata, N., Witthuhn, B. A., Inhorn, R. C., Eder, M., Miyajima, A., Griffin, J. D. & Ihle, J. N. (1994) Mol. Cell. Biol. 14, 4335-4341 [Abstract/Free Full Text]
  82. D'Andrea, A. D., Yoshimura, A., Youssoufian, H., Zon, L. I., Koo, J. W. & Lodish, H. F. (1991) Mol. Cell. Biol. 11, 1980-1987 [Abstract/Free Full Text]
  83. Quelle, D. E. & Wojchowski, D. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4801-4805 [Abstract/Free Full Text]
  84. Rui, H., Kirken, R. A. & Farrar, W. L. (1994) J. Biol. Chem. 269, 5364-5368 [Abstract/Free Full Text]
  85. Stahl, N., Boulton, T. G., Farruggella, T., Ip, N. Y., Davis, S., Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Barbieri, G., Pellegrini, S., Ihle, J. N. & Yancopoulos, G. D. (1994) Science 263, 92-95 [Abstract/Free Full Text]
  86. Narazaki, M., Witthuhn, B. A., Yoshida, D., Silvennoinen, O., Yasukawa, K., Ihle, J. N., Kishimoto, T. & Taga, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2285-2289 [Abstract/Free Full Text]
  87. Colosi, P., Wong, K., Leong, S. R. & Wood, W. I. (1993) J. Biol. Chem. 268, 12617-12623 [Abstract/Free Full Text]
  88. Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A., Silvennoinen, O., Ihle, J. N. & Carter-Su, C. (1993) Cell 74, 237-244 [CrossRef][Medline] [Order article via Infotrieve]
  89. Gearing, D. P., Ziegler, S. F., Comeau, M. R., Friend, D., Thoma, B., Cosman, D., Park, L. & Mosley, B. (1994) Proc. Natl. Acad. Sci. U. S. A., 91, 1119-1123 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M. Wetzler, M. T. Brady, E. Tracy, Z.-R. Li, K. A. Donohue, K. L. O'Loughlin, Y. Cheng, A. Mortazavi, A. A. McDonald, P. Kunapuli, et al.
Arsenic Trioxide Affects Signal Transducer and Activator of Transcription Proteins through Alteration of Protein Tyrosine Kinase Phosphorylation.
Clin. Cancer Res., November 15, 2006; 12(22): 6817 - 6825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Baumann, P. Kunapuli, E. Tracy, and J. K. Cowell
The Oncogenic Fusion Protein-tyrosine Kinase ZNF198/Fibroblast Growth Factor Receptor-1 Has Signaling Function Comparable with Interleukin-6 Cytokine Receptors
J. Biol. Chem., April 25, 2003; 278(18): 16198 - 16208.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. E. Isaksen, H. Baumann, B. Zhou, S. Nivollet, A. G. Farr, S. D. Levin, and S. F. Ziegler
Uncoupling of Proliferation and Stat5 Activation in Thymic Stromal Lymphopoietin-Mediated Signal Transduction
J. Immunol., April 1, 2002; 168(7): 3288 - 3294.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Eckenberg, T. Rose, J.-L. Moreau, R. Weil, F. Gesbert, S. Dubois, D. Tello, M. Bossus, H. Gras, A. Tartar, et al.
The First {alpha} Helix of Interleukin (IL)-2 Folds as a Homotetramer, Acts as an Agonist of the IL-2 Receptor {beta} Chain, and Induces Lymphokine-activated Killer Cells
J. Exp. Med., February 7, 2000; 191(3): 529 - 540.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. E. Isaksen, H. Baumann, P. A. Trobridge, A. G. Farr, S. D. Levin, and S. F. Ziegler
Requirement for Stat5 in Thymic Stromal Lymphopoietin-Mediated Signal Transduction
J. Immunol., December 1, 1999; 163(11): 5971 - 5977.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Kim, T. S. Hawley, R. G. Hawley, and H. Baumann
Protein Tyrosine Phosphatase 2 (SHP-2) Moderates Signaling by gp130 but Is Not Required for the Induction of Acute-Phase Plasma Protein Genes in Hepatic Cells
Mol. Cell. Biol., March 1, 1998; 18(3): 1525 - 1533.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. W.W. Y. Wang, S. C. Chua Jr., J. P. Morgenstern, R. L. Leibel, H. Baumann, and L. A. Tartaglia
Constitutive and impaired signaling of leptin receptors containing the Gln right-arrow Pro extracellular domain fatty mutation
PNAS, September 30, 1997; 94(20): 10657 - 10662.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. K. Kuropatwinski, C. De Imus, D. Gearing, H. Baumann, and B. Mosley
Influence of Subunit Combinations on Signaling by Receptors for Oncostatin M, Leukemia Inhibitory Factor, and Interleukin-6
J. Biol. Chem., June 13, 1997; 272(24): 15135 - 15144.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kim and H. Baumann
The Carboxyl-terminal Region of STAT3 Controls Gene Induction by the Mouse Haptoglobin Promoter
J. Biol. Chem., June 6, 1997; 272(23): 14571 - 14579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. W. White, K. K. Kuropatwinski, R. Devos, H. Baumann, and L. A. Tartaglia
Leptin Receptor (OB-R) Signaling. CYTOPLASMIC DOMAIN MUTATIONAL ANALYSIS AND EVIDENCE FOR RECEPTOR HOMO-OLIGOMERIZATION
J. Biol. Chem., February 14, 1997; 272(7): 4065 - 4071.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Woodcock, C. J. Bagley, B. Zacharakis, and A. F. Lopez
A Single Tyrosine Residue in the Membrane-proximal Domain of the Granulocyte-Macrophage Colony-stimulating Factor, Interleukin (IL)-3, and IL-5 Receptor Common beta -Chain Is Necessary and Sufficient for High Affinity Binding and Signaling by All Three Ligands
J. Biol. Chem., October 18, 1996; 271(42): 25999 - 26006.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-F. Lai, J. Ripperger, K. K. Morella, J. Jurlander, T. S. Hawley, W. E. Carson, T. Kordula, M. A. Caligiuri, R. G. Hawley, G. H. Fey, et al.
Receptors for Interleukin (IL)-10 and IL-6-type Cytokines Use Similar Signaling Mechanisms for Inducing Transcription through IL-6 Response Elements
J. Biol. Chem., June 14, 1996; 271(24): 13968 - 13975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fourcin, S. Chevalier, C. Guillet, O. Robledo, J. Froger, A. Pouplard-Barthelaix, and H. Gascan
gp130 Transducing Receptor Cross-linking Is Sufficient to Induce Interleukin-6 Type Responses
J. Biol. Chem., May 17, 1996; 271(20): 11756 - 11760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Zhang, M. Sun, D. Samols, and I. Kushner
STAT3 Participates in Transcriptional Activation of the C-reactive Protein Gene by Interleukin-6
J. Biol. Chem., April 19, 1996; 271(16): 9503 - 9509.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kordula, J. Ripperger, K. K. Morella, J. Travis, and H. Baumann
Two Separate Signal Transducer and Activator of Transcription Proteins Regulate Transcription of the Serine Proteinase Inhibitor-3 Gene in Hepatic Cells
J. Biol. Chem., March 22, 1996; 271(12): 6752 - 6757.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-F. Lai, J. Ripperger, K. K. Morella, Y. Wang, D. P. Gearing, N. D. Horseman, S. P. Campos, G. H. Fey, and H. Baumann
STAT3 and STAT5B Are Targets of Two Different Signal Pathways Activated by Hematopoietin Receptors and Control Transcription via Separate Cytokine Response Elements
J. Biol. Chem., October 6, 1995; 270(40): 23254 - 23257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-F. Lai, J. Ripperger, K. K. Morella, Y. Wang, D. P. Gearing, G. H. Fey, and H. Baumann
Separate Signaling Mechanisms Are Involved in the Control of STAT Protein Activation and Gene Regulation via the Interleukin 6 Response Element by the Box 3 Motif of gp130
J. Biol. Chem., June 23, 1995; 270(25): 14847 - 14850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, O. Robledo, E. Kinzie, F. Blanchard, C. Richards, A. Miyajima, and H. Baumann
Receptor Subunit-specific Action of Oncostatin M in Hepatic Cells and Its Modulation by Leukemia Inhibitory Factor
J. Biol. Chem., August 11, 2000; 275(33): 25273 - 25285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Baumann, Y. Wang, C. D. Richards, C. A. Jones, T. A. Black, and K. W. Gross
Endotoxin-induced Renal Inflammatory Response. ONCOSTATIN M AS A MAJOR MEDIATOR OF SUPPRESSED RENIN EXPRESSION
J. Biol. Chem., July 14, 2000; 275(29): 22014 - 22019.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morella, K. K.
Right arrow Articles by Baumann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morella, K. K.
Right arrow Articles by Baumann, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement