![]()
|
|
||||||||
From the
The formation of higher order protein
Many DNA transactions involve the formation of nucleoprotein
structures containing multiple proteins and DNA sites. These complexes
have been shown to include not only the DNA molecule and relevant
sequence-specific DNA-binding proteins, but in some cases also require
nonspecific DNA-binding proteins which serve as accessory factors in
these reactions. The exact functions of such
``architectural'' proteins probably vary between experimental
systems, but in most instances studied thus far they have been shown to
stimulate complex formation by bending or wrapping the DNA strands into
specific configurations such that other proteins can interact
productively to carry out the reaction
(1, 2, 3, 4, 5) .
One of the
best examples of such an assembly factor is the prokaryotic protein HU.
This abundant heterodimeric protein binds DNA nonspecifically in
vitro and is thought to be associated with the bacterial nucleoid
in vivo (6, 7, 8, 9) . HU
stimulates replication from oriC (10, 11) and
facilitates the assembly of intermediates in several different types of
specialized recombination reactions
(12, 13, 14) . In Hin-mediated DNA inversion, HU
stimulates construction of the invertasome (see Fig. 1),
particularly when two of the three sites which synapse together are
separated by less than 100 bp
Despite the large number of
in vitro studies performed on HMG1/2, their biological roles
in vivo remain to be demonstrated. As the first step in an
attempt to characterize these roles genetically, we have identified
functional equivalents of HMG1/2 in yeast by using the Hin-mediated DNA
inversion reaction as an assay for DNA bending or wrapping activity. In
this work, we show that the two yeast proteins detected by this method
are the non-histone proteins (NHP) 6A and NHP6B which had previously
been isolated on the basis of solubility and amino acid sequence
similarity to mammalian HMG proteins
(30) . The DNA binding and
bending abilities of NHP6A/B are investigated, as well as their effects
on DNA supercoiling and on the phenotypes of bacterial mutants lacking
general nucleoid-associated proteins.
Construction of NHP6A/B plasmids was as follows:
the NHP6A and NHP6B genes were obtained by polymerase chain reaction of
genomic Saccharomyces cerevisiae DNA (gift of E. Bensen and G.
Payne) with NdeI and BamHI sites engineered at the 5`
and 3` ends, respectively. The polymerase chain reaction products were
digested with NdeI and BamHI and were ligated into
pET11a (Novagen) to create pRJ1228 (NHP6A) and pRJ1229 (NHP6B)
containing the NHP6A/B genes under the control of the T7 promoter. The
NdeI- BamHI fragment from pRJ1228 was then inserted
into the BamHI site of a pBR322 derivative containing the
lacP UV5 promoter between the EcoRI and
BamHI sites by ligating the BamHI sites first,
filling in the remaining BamHI and NdeI ends with T4
DNA polymerase and dNTPs, and ligating the blunt ends together to
create pRJ1226, containing NHP6A under the control of the lac promoter. This plasmid was then cut with SspI and
BamHI to excise the lacP-NHP6A region which was
ligated between the BclI and ScaI sites on pRJ823
(pACYC184 lacI
Whole cell and nuclear extracts were selectively
extracted with 30%, 60%, and 90% saturated ammonium sulfate (removed by
overnight dialysis against buffer A: 10 m
M Tris-HCl (pH 8.0),
10% glycerol, 0.1 m
M EDTA, and 50 m
M NaCl) or with 2%
followed by 10% trichloroacetic acid (removed by washing the pellet
with acetone, lyophilization, and resuspension in buffer A). Activity
in the cleavage assay was first seen at this stage of the purification
and only in the 60-90% ammonium sulfate and 2-10%
trichloroacetic acid precipitates. These were then loaded onto a
heparin-agarose column equilibrated in buffer A and eluted in a linear
salt gradient from 50 m
M to 1
M NaCl. The activity
eluted from the column with 0.4-0.5
M NaCl. Fractions
were pooled, dialyzed against buffer A, and loaded onto an FPLC Mono Q
column (Pharmacia Biotech) in the same buffer. The flow-through
fractions were then loaded onto a HR5/10 reverse-phase FPLC column
(Pharmacia) and eluted with a continuous gradient from 0 to 100%
acetonitrile. Fractions containing NHP6A and NHP6B eluted at 27% and
30% acetonitrile, respectively. Acetonitrile was removed by
lyophilization, and pellets were resuspended in buffer A. Amino acid
composition analysis and N-terminal sequencing of active fractions
identified each peak unambiguously as NHP6A/B. All protein
concentrations were determined by Bradford (Pierce) assays, using
bovine serum albumin as the standard, adjusted for each protein by
values obtained by quantitative amino acid analysis.
Recombinant
NHP6A and NHP6B were produced in E. coli strain RJ1878
containing pRJ1228 and pRJ1229, respectively. Protein expression was
induced by addition of 1 m
M IPTG at OD
In vivo assays were done in
E. coli strains CAG4000 (wild-type) and RJ1975
( hupAhupB) containing plasmid substrate pRJ1227. Plasmid DNA
was isolated from 5-ml cultures of CAG4000, RJ1975, and RJ1975 grown in
the presence of 1 m
M IPTG. Each strain was grown to an
OD
Our primary assay for DNA-wrapping proteins is the formation
of an intermediate structure required for Hin-mediated DNA inversion,
shown in Fig. 1(31) . A dimer of the Hin recombinase
binds to each of the recombination sites, hixL
To
identify yeast proteins which substitute for HU, whole cell and nuclear
extracts from S. cerevisiae were assayed using the Hin
cleavage reaction on a DNA substrate containing 83 bp between
hixL
NHP6A/B each exhibit similar
activity in the cleavage assay compared to HU and HMG1.
Fig. 3
shows the percentage of DNA substrate molecules formed into
invertasome complexes in the presence of varying amounts of the native
yeast proteins. The optimum ratio of protein to DNA in these reactions
is approximately 30-40 protein monomers per plasmid substrate,
although significant stimulation is observed even with ratios of
5-10. Unlike HU and HMG1, however, NHP6A/B also completely
inhibit invertasome formation at higher concentrations. With more than
50 molecules of protein for each DNA substrate, the amounts of cleaved
substrate decrease with increasing protein concentration until even the
basal reaction is inhibited (also seen in Fig. 2 B).
Unlike HU and HMG1/2, the yeast proteins also do not appear to
stimulate the complete inversion reaction under conditions in which the
DNA strands are exchanged and religated after DNA strand cleavage (data
not shown), an observation perhaps explained by the unique DNA binding
characteristics of NHP6A/B (see below).
Like HU and HMG1/2, NHP6A/B can also
efficiently induce DNA circle formation (shown on a 98-bp fragment in
Fig. 5 A). Lane 1 contains the DNA fragment alone, and
lane 2 contains the dimer linear and dimer circular products
formed after addition of ligase. Lane 3 contains the same
reaction as lane 2, but after further incubation with
exonuclease III, which digests all the linear species. Lanes
4-9 and 10-15 contain similar reactions with
titrations of NHP6A and -B, respectively, from protein:DNA ratios of
2.5:1 to 80:1. Reactions in lanes 4-15 were all
incubated with exonuclease III before loading. Monomer circles first
appear at protein:DNA ratios of 5:1, and, with increasing protein
concentrations, high levels of input DNA are converted to the monomer
circle species.
Similar assays were done with NHP6A on DNA fragments
ranging from 50-99 bp (summarized in Fig. 4 B). The
sinusoidal-like pattern of circle production with respect to DNA length
reflects the requirement for an exact alignment of the DNA ends for
ligation and thus is a consequence of the helical repeat. Like HMG1 and
-2, the NHP6 proteins efficiently catalyze the formation of circles as
small as 66 bp. Significantly, NHP6A/B are 5-20 times more
efficient at facilitating circle formation compared to our HU, HMG1, or
HMG2 preparations
(16) . No difference between native and
recombinant proteins in ligation assays was observed. NHP6B showed
similar activity in comparison to NHP6A, although slightly lower levels
of monomer circle were consistently produced by NHP6B.
Integration host factor (IHF) is another
nucleoid-associated protein in E. coli which, like Fis, shows
sequence-specific DNA binding yet also is thought to be involved in
general chromosome topology
(1) . HU partially substitutes for
IHF in model phage
We have used the invertasome, an intermediate structure
necessary for Hin-mediated DNA inversion, as a model nucleoprotein
complex to examine the properties of nonspecific DNA-binding proteins.
When the length of DNA between the recombinational enhancer and one of
the Hin recombinase binding sites is less than
NHP6A
and NHP6B are
NHP6A/B each yield high levels of
invertasome structures comparable to those formed in the presence of
HU, HMG1, and HMG2. Maximum rates of NHP6A/B-stimulated DNA cleavage
are seen with 2-4 pmol of protein per 0.1 pmol of DNA substrate,
which yields an estimate of 112-225 bp per bound protein.
Stimulation is first observed with
Unlike the bacterial and mammalian proteins,
however, the NHP6 proteins start to inhibit the reaction at protein:DNA
molar ratios higher than 50:1. The explanation for this result is
unclear, but may be related to the higher affinity of the yeast
proteins for DNA compared to HU and HMG1 such that high concentrations
of NHP6A/B would inhibit either binding of Hin and Fis or prevent
strand exchange. This may also explain the inability of NHP6A/B to
stimulate the complete inversion reaction in which the Hin recombinase
not only cleaves but exchanges and religates the DNA strands. An
additional turn of twist is necessary for the strand exchange process;
thus, it is possible that the yeast proteins may prevent this event
topologically by binding tightly in their preferred configurations. In
this sense, HU and HMG1 are better suited to the name ``DNA
chaperones''
(5, 57) in that they appear to bind
DNA more dynamically and may be more easily displaced from the
intermediate structure. Further work will be required to determine
whether release of assembly factors normally accompanies strand
exchange in the Hin inversion reaction.
Low concentrations of NHP6A/B, however, yield distinct protein-DNA
complexes in gel-shift experiments and bind nonspecifically to various
DNA fragments with
In addition, by measuring the number of
complexes formed on DNA fragments of different sizes, we were able to
estimate the minimal length of DNA necessary for binding of NHP6A/B.
Three distinct protein-DNA complexes were formed on a 46-bp DNA
fragment, plus a slower migrating smear which appears with high protein
concentrations. Two distinct complexes formed on 34-bp DNA, whereas gel
shifts on 26- and 21-bp DNA fragments yielded only one distinct bound
complex. Therefore, NHP6A/B binding appears to require 14-15 bp,
consistent with the estimate of 14 bp per HMG1 binding site determined
by fluorescence quenching of HMG1 in the presence of DNA
(59) ,
and with DNase 1 footprinting analysis of LEF-1 with its binding site
which also yielded an estimate of 14 bp
(47) .
The pattern of DNA
fragment circularization for different lengths of substrate in the
presence of NHP6A is very similar to the patterns seen with HMG1 and HU
(16) . Significantly, the DNA substrates which did not form
circles in the presence of the HMG proteins because of the requirement
for a complete helical repeat also did not form circles in the presence
of the yeast proteins. Thus, if NHP6A/B are underwinding or overwinding
the DNA, they are either distorting the helix to exactly the same
extent as HMG1/2 and HU or none of the proteins are adding any net
change in twist to the DNA substrates. Fourier analysis of the
periodicity of circularization with respect to DNA length yields a
helical repeat of 10.6-10.7 bp per turn (16 and this work),
consistent with the measured value of linear DNA in vitro (60) .
NHP6A/B are in fact more efficient than HMG1/2 in
the ligation assay, yielding as much as 2-3-fold higher levels of
circles on the optimal substrates in the presence of 10-fold less
protein. In the presence of NHP6A/B, 50-80% of the input fragment
can be converted into monomer circles on the most efficient substrates.
This effect may either be due to the relatively high stability of
NHP6A/B
In
recombination, gel mobility shift, and ligation assays, we have seen no
significant preference of HMG1/2 or NHP6A/B for specific DNA sequences
among many different DNA fragments used. Circular permutation analysis
has revealed no intrinsic bends in the 34-bp or 21-bp DNA fragments
used in gel mobility shift assays.
The Fis protein
is another member of the family of general nucleoid-associated
proteins, although it displays some specificity of binding. Cellular
Fis levels are similar to HU in rapidly growing cells, and Fis has been
shown to play specific roles in recombination, transcription, and
replication reactions
(63) . Under our culturing conditions,
fis mutant cells are filamented to approximately the same
degree as hupAhupB mutants but contain multiple nucleoids that
are more distinct and separated along the length of the cell (data not
shown).
hupAhupB fis mutants exhibit defects much more
extreme than either the hupAhupB or fis mutants
alone. Cells lacking Fis and HU are extremely filamented and contain
multiple and highly dispersed nucleoids, and 9% do not have DNA visible
by 4,6-diamidino-2-phenylindole staining. Again, NHP6A expression in
these cells almost completely restores nucleoid dimensions and cell
size to wild-type levels. Thus, the yeast HMG1 homologue can largely
substitute for both HU and Fis with respect to chromosome maintenance.
These results further suggest that Fis is performing a relatively
nonspecific function in chromosome replication and segregation. This is
distinct from its specialized roles in mediating enhancer function in
site-specific DNA inversion, which is not substituted by NHP6A/B, and
in regulating specific promoter activities. We cannot conclude from
these data whether the role that Fis performs at its specific binding
site in oriC to facilitate chromosome replication
(42, 64) is satisfied by the presence of NHP6A.
Mean cell lengths and nucleoid areas with standard
deviations were quantitated with a digitizer. A minimum of 500 cells
were analyzed for each strain.
We thank Louise Bird and Jan Mellor for their advice
in yeast nuclei preparation and Eric Bensen and Greg Payne for their
donation of genomic DNA. We also acknowledge members of the laboratory
for helpful comments on the manuscript. Amino acid composition analysis
and N-terminal sequencing was performed by Audree Fowler at the UCLA
protein microsequencing facility.
Volume 270,
Number 15,
Issue of April 14, pp. 8744-8754, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CONSEQUENCES FOR NUCLEOPROTEIN COMPLEX ASSEMBLY AND CHROMATIN
CONDENSATION (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
DNA structures often
requires bending of DNA strands between specific sites, a process that
can be facilitated by the action of nonspecific DNA-binding proteins
which serve as assembly factors. A model for this activity is the
formation of the invertasome, an intermediate structure created in the
Hin-mediated site-specific DNA inversion reaction, which is stimulated
by the prokaryotic nucleoid-associated protein HU. Previously, we have
shown that the mammalian HMG1/2 proteins substitute for HU in this
system and display efficient DNA wrapping activity in vitro.
In the present work, we isolate the primary sources of assembly factor
activity in Saccharomyces cerevisiae, as measured by the
ability to stimulate invertasome formation, and show that these are the
previously identified NHP6A/B proteins. NHP6A/B have comparable or
greater activity in DNA binding, bending, and supercoiling with respect
to HU and HMG1 and appear to form more stable protein
DNA
complexes. In addition, expression of NHP6A in mutant Escherichia
coli cells lacking HU and Fis restores normal morphological
appearance to these cells, specifically in nucleoid condensation and
segregation. From these data we predict diverse architectural roles for
NHP6A/B in manipulating chromosome structure and promoting the assembly
of multicomponent protein
DNA complexes.
(
)
in the DNA
substrate
(14) . Given the known ability of HU to bend DNA
(15, 16) , its proposed role in this reaction is to wrap
the short length of DNA helix into a loop such that the Hin recombinase
and the Fis protein can associate into a stable complex. HU also
stimulates formation of the type 1 transpososome, an intermediate
structure necessary for transposition by bacteriophage Mu. Its role in
this system involves catalyzing the assembly of MuA transposase at the
left end of the Mu DNA, perhaps in a manner specific to the spatial
configuration of MuA binding sites in this region
(12, 13, 17) . In addition, HU partially
substitutes for the related but sequence-specific DNA-binding protein
IHF (integration host factor) in phage
excision
(18, 19) . The functional replacement of IHF binding
sites in the attP region of
with either phased A-tracts
or a cAMP receptor protein binding site supports the interpretation of
a primarily structural role for IHF (and HU) in this system
(20) .
Figure 1:
Schematic illustration
of the Hin-mediated DNA inversion reaction. A, plasmid
substrate containing hixL
and hixL
binding sites for Hin recombinase and the recombinational
enhancer which contains two binding sites for the Fis protein. The DNA
between the hix sites containing the enhancer is referred to
as the invertible segment. B, Hin and Fis protein dimers bound
at their respective sites. C, the invertasome complex with
HU/HMG1 assembly factors shown theoretically in the small DNA loop
between hixL and the enhancer. D, the invertasome
complex after DNA strand exchange and ligation by Hin. E,
plasmid substrate after inversion, with proteins removed. The
hixL
and hixL
sites are now
composite.
In mammals, the functional equivalents of HU appear to
be the high mobility group (HMG) proteins 1 and 2, which are also
abundant and thought to be associated with chromatin in vivo (21) . HMG1 and -2 efficiently substitute for HU in
stimulating invertasome formation in the Hin DNA inversion reaction
(16) . The mammalian proteins facilitate invertasome formation
on substrates containing one helical turn less DNA in the loop between
the recombinational enhancer and a hix site (see Fig. 1)
compared to the smallest substrates assembled into invertasomes in the
presence of HU
(16) . HMG1 and -2 have also been shown to be
even more effective than HU in bending DNA as measured by the formation
of small DNA circles in the presence of T4 DNA ligase. Both HMG
proteins facilitate the formation of 66-bp DNA circles, which are one
helical turn shorter than the smallest formed in the presence of HU
(16) . HMG1 can also substitute for HU in promoting the Mu
strand cleavage reaction
(22) and in stimulating
intasome
formation
(19) . A role for HMG1 and HMG2 in transcription has
been implicated in some systems
(23, 24, 25) although the C-terminal acidic tail apparently does not
function as a general transcriptional activator domain
(26) .
HMG1 has also been shown to bind with high affinity to cruciform
structures
(27) , cisplatinated DNA
(28) , and to
associate with histone H1
(29) .
Escherichia coli Strains and
Plasmids
Supercoiling assays and microscopy studies were
performed using the following E. coli strains: CAG4000 (MG1655
lacX74, obtained from C. Gross), RJ1975 (CAG4000
hupA::cm hupB::km), RJ1995 (RJ1975 fis-985), and
RJ1999 (RJ1975 himA83-Tn 10). Genes were disrupted by
P1 transduction using lysates made from NH277
( hupB: km) and NH278 ( hupA: cm)
(provided by P. Higgins), RJ1803 ( fis-985)
(65) , and
N6127 ( himA83-Tn 10, obtained from H. Miller).
Recombinant NHP6A/B protein was produced in RJ1878 (BL21 (DE3)
(Novagen) hupA::cm hupB::km).
excision assays
(66) were performed using RJ3031 (CAG4000 himA83-Tn10
cI857 S7), RJ3030 (RJ1999
cI857 S7), and RJ3030
containing pRJ1227.
), after filling in protruding ends
with T4 DNA polymerase and dNTPs, to create pRJ1227. Expression of
NHP6A under the control of the lac promoter during exponential
growth yielded approximately 5000-10000 molecules of protein per
cell as determined by Western blotting of cell lysates (data not
shown).
Recombination and Ligation Assays
Unless otherwise
noted, all cleavage assays contained pMS551-83, a plasmid substrate
containing hixL1, hixL2, and the Hin recombinational
enhancer in pBR322 with 83 bp between the center of hixL1 and
the center of the proximal Fis binding site in the enhancer, as
described
(14) . In vitro cleavage assays were
performed as described previously
(14) , although in some cases
(Fig. 3), 50 m
M CHAPS was added to the reactions.
Incubations were for 3 min in standard reactions and 0.25 min in
reactions containing CHAPS to measure reaction rates.
Figure 3:
Comparison of invertasome assembly rates
in the presence of HU, HMG1, NHP6A, and NHP6B. Reactions contained
plasmid substrate pMS551-83 and were done in the presence of 50 m
M CHAPS. Percent cleavage reflects the level of invertasome assembly
above background levels (no accessory protein
added).
Ligation
substrates were made by polymerase chain reaction of the set of
recombination substrates containing varying DNA lengths between the
enhancer and hixL1 as described
(16) . Each fragment
was internally labeled with [
-
P]dATP and
digested with EcoRI. Note that the protein:DNA molar ratios
cited previously
(16) were 10-fold lower than the actual
ratios, due to an error in quantitation. Ligation assays were performed
as described previously
(16) .
Proteins
Hin, Fis, HU, and bovine HMG1/2 were
purified as described
(14, 16) . NHP6A/B were isolated
from both whole cell and nuclear extracts from S. cerevisiae BJ1991(MAT
prb1-112 pep4-3 leu2 trp1 ura3-52,
obtained from A. Carmen and M. Grunstein). Whole cell extracts were
prepared by passage of cells twice through a French press in buffer
containing 10 m
M Tris-HCl (pH 7.5), 100 m
M NaCl, 10%
glycerol, 1 m
M dithiothreitol, 10 m
M EDTA, 3 m
M phenylmethylsulfonyl fluoride, and 10 µg/ml each of leupeptin,
antipain, pepstatin, and chymostatin, followed by centrifugation at
30,000
g. Nuclear extracts were prepared using a
modified combination of protocols
(67, 68)
(
)
which involves spheroplast formation by lyticase
(Enzogenetics), osmotic lysis of spheroplasts in a buffered 9% Ficoll
solution, and purification of nuclei by centrifugation through a 30%
Ficoll cushion. Isolated nuclei were incubated in extraction buffer: 10
m
M Tris-HCl (pH 8.0), 0.5% Nonidet P-40, 0.25
M sorbitol, 1 m
M phenylmethylsulfonyl fluoride, containing
0.5
M NaCl on ice for
1 h. Nuclear debris was then
pelleted at 20,000
g for 10 min, and the supernatant
was collected.
=
0.5 for 30 min (NHP6A) or 2 h (NHP6B). The lysis procedure was
essentially as described for HU
(69) , except that the final
supernatant was dialyzed into buffer A overnight. The partially
purified proteins were loaded onto an EconoPak S cartridge (Bio-Rad)
equilibrated in buffer A, washed with 0.35
M NaCl, and eluted
with a linear gradient from 0.35
M to 0.65
M NaCl in
buffer A. Both NHP6A/B proteins eluted at
0.5
M NaCl.
Fractions containing the yeast proteins were dialyzed against buffer A
overnight and then loaded onto a heparin-agarose column (Bio-Rad),
washed with buffer A and 0.3
M NaCl, followed by a linear
gradient from 0.3
M to 0.6
M NaCl in buffer A. Both
NHP6A/B proteins eluted at
0.5
M NaCl, and fractions
contained no other polypeptides visible by Coomassie Blue staining of
SDS-polyacrylamide gels.
Gel Mobility Shift Assays
DNA fragments used in
gel-shift assays were: 46-bp
(GACGTCAATCTTCTTGAAAACCAAGGTTTTTGATAAGATCAGGCCT), 34-bp
(AGCTTACTAGTGCAAATTGTGACCGCATTTTTGA), 26-bp
(ATACTAGTGCAAATTGTGACCGCATT), and 21-bp (CTAGTGCAAATTGTGACCGCA).
20-µl reactions contained 20 m
M HEPES (pH 7.5), 40 m
M NaCl, 10 m
M EDTA, 2 µg of bovine serum albumin, 5%
glycerol, and 0.5
TBE. Proteins in each reaction were incubated
with
1 ng of
P-labeled DNA fragment at 30 °C for
at least 10 min before loading onto the gel, which contained 5%, 8%, or
10% acrylamide (60:1 acrylamide:bis) and 0.5
TBE. Gels were run
at 6-8 V/cm for 2-3 h, fixed, dried, and exposed to x-ray
film (Kodak). No significant differences in relative affinities were
observed in protein
DNA complex formation between DNA fragments of
varying sequences.
Supercoiling Assays
In vitro assays
contained 0.1 pmol of pBR322, 50 m
M Tris-HCl (pH 7.5), 50
m
M KCl, 10 m
M MgCl
, 0.1 m
M EDTA,
0.5 m
M dithiothreitol, and 30 µg/ml bovine serum albumin
per 20-µl reaction. Plasmid DNA was first completely relaxed with
topoisomerase I (Life Technologies, Inc.) for 1 h at 37 °C, then
incubated with varying amounts of protein plus 1 unit of additional
topoisomerase I for 1 h at 37 °C before the addition of 0.5% SDS
and 5 µg of proteinase K. Reactions were further incubated for
15 min before loading onto a 0.7% agarose gel containing
Tris-phosphate-EDTA (TPE) buffer
(70) and electrophoresed at 2
V/cm for approximately 24 h.
of 0.5 from a 1:500 dilution of an overnight culture
(uninduced), and DNA was recovered using a modified alkaline lysis
protocol. DNA obtained was electrophoresed on a 0.7% TPE agarose gel in
the presence of 13 µg/ml chloroquine at 2 V/cm for
24 h.
Microscopy
All E. coli strains described
in Fig. 7, Fig. 8, and were inoculated into LB from
a single colony, grown to early log phase (OD
=
0.3), and fixed as described
(71) . RJ1975
( hupAhupB) and RJ1995 ( hupAhupB fis) strains
contained pRJ823 ( lacI
) with or without pRJ1226
( lacP-NHP6A). All mutant strains were grown in the presence of
200 µ
M IPTG. Cells were visualized using a 100
Oel
objective lens (Zeiss) on a Microphot-FXA microscope (Nikon) and
photographed using 160 tungsten Ektachrome color slide film (Kodak).
Cell lengths, nucleoid areas, and percent anucleate cell levels were
quantitated using an HP9864A digitizer with the Sigmascan analysis
program.
Figure 8:
Distributions of nucleoid area in E.
coli mutants. A, CAG4000 (wild-type); B, RJ1975
( hupAhupB) + pRJ823; C, RJ1975 + pRJ823
+ pRJ1226; D, RJ1995 ( hupAhupB fis) +
pRJ823; E, RJ1995 + pRJ823 + pRJ1226. Plasmids are
as described in Fig. 7 and under ``Experimental Procedures.''
At least 500 cells were measured for each strain. The x axis
interval used in constructing the histograms = 0.05
µm
. The y axis reflects the number of cells in
a given interval.
and
hixL
(Fig. 1, A and B).
Two dimers of the Fis protein bind to the recombinational enhancer,
which associates with the Hin-bound hix sites into a specific
intermediate configuration called the invertasome (Fig. 1 C).
In the presence of ethylene glycol and the absence of magnesium,
invertasome complexes are trapped and do not continue through the
inversion pathway. Under these ``cleavage'' conditions, the
amount of Hin-mediated cutting at the center of one or both of the
hix sites corresponds to the amount of invertasome complex
formed during the reaction. Under standard conditions, however, Hin
then catalyzes DNA strand exchange and ligation
(Fig. 1 D) such that the DNA segment between the hix sites is inverted (Fig. 1 E). On substrates which
contain less than approximately 100 bp between a hix site and
the enhancer, the presence of HU, HMG1, or HMG2 is necessary for
efficient invertasome formation
(14, 16) .
and the recombinational enhancer. Activity
was not seen in initial S30 supernatants, but appeared after either
selective ammonium sulfate or trichloroacetic acid precipitations (as
described under ``Experimental Procedures''). Active
fractions were then sequentially separated on heparin-agarose, Mono Q,
and reverse-phase chromatography columns. Fractions from the last step
of the purification, an HR5/10 reverse-phase FPLC column, are shown in
Fig. 2A after electrophoresis on a denaturing
SDS-polyacrylamide gel and silver staining. In cleavage assays, the
invertasome-stimulating activities corresponded to the fractions
containing protein peaks in lanes 5-8 and lanes
10-14. Amino acid composition analysis and N-terminal
sequencing determined that the first peak contained NHP6A and the
second peak contained NHP6B. These two related proteins are transcribed
from different genes although they are 87% identical and each contains
one ``HMG box,'' a DNA binding motif now found in many
different specific and nonspecific proteins
(21, 32) .
The HMG boxes in NHP6A and NHP6B are 45% and 40% identical with domain
B of HMG1, respectively. Minor bands above the major ones in
Fig. 2A are probably modified forms of the two proteins.
Figure 2:
Purification and identification of
NHP6A/B. A, silver-stained SDS-acrylamide gel containing
successive fractions ( lanes 2-15) from an HR5/10
reverse-phase FPLC column at the final step of NHP6A/B purification
from a whole cell preparation of S. cerevisiae. Lane 1 contains the column load; lanes 5-8 and
10-13 contain NHP6A and NHP6B, respectively. Arrows indicate major forms of NHP6A and NHP6B. B, cleavage
reactions on DNA substrate pMS551-83 in the presence of increasing
amounts of recombinant NHP6A/B, electrophoresed in a 1% agarose gel.
Lane 1 contains 100 ng of HMG1, lane 2 contains no
accessory protein, lanes 3-16 contain 5, 10, 20, 40, 80,
160, or 320 ng of NHP6A ( lanes 3-9) or NHP6B ( lanes
10-16), respectively. Arrows indicate the positions
of open circular plasmid (nicked) ( OC), supercoiled plasmid
(uncut) ( SC), linearized plasmid (single hix site
cut) ( lin), excised vector (two hix sites cut)
( vec), and excised invertible segment (two hix sites
cut) ( inv).
NHP6A and -B Efficiently Substitute for HU in Hin Invertasome
Formation
To obtain large quantities of NHP6A and NHP6B,
recombinant forms of the proteins were expressed under the control of
the T7 promoter in bacteria and then purified to homogeneity by ion
exchange chromatography. The effect of the yeast proteins on formation
of invertasome structures in vitro is clearly seen in Fig.
2 B. Lane 1 contains a cleavage reaction in the presence of 100
ng of HMG1 ( arrows indicate the linearized plasmid (one
hix site cut), vector, and released intervening segment (two
hix sites cut)). The reaction in lane 2 contains no
accessory protein, and lanes 3-9 and 10-16 contain titrations of NHP6A and NHP6B, respectively. High levels
of cleaved DNA substrate are seen in the presence of both proteins. The
modified forms of NHP6A/B seen in Fig. 2 A are not
observed in the bacterial extracts and are apparently not necessary for
the activity of these proteins in our assays because the recombinant
proteins exhibit virtually identical stimulation in cleavage assays
compared to their native counterparts. Unless specified, all
characterization of NHP6A/B shown in this work was done with the
recombinant forms of the proteins.
NHP6A/B Form More Stable Complexes with DNA Fragments
than HU or HMG1
To investigate the relative stability of
NHP6A/B
DNA complexes in comparison to those containing HU or HMG1,
each of these proteins was added to a 46-bp
P-labeled
double-stranded DNA and run in a nondenaturing polyacrylamide gel to
separate the protein-bound DNA from the free DNA fragments. At high
protein concentrations (100-1600 ng/reaction), HU and HMG1 form
nondistinct high molecular weight complexes (Fig. 4 A).
Under the conditions used, HU does not form a ladder of specific
complexes with DNA fragments, in contrast to other reports
(33) . HMG1 appears to bind linear DNA with low affinity in gel
shifts, as has been reported by others
(27, 28) .
Figure 4:
Comparison of DNA binding by HU, HMG1,
NHP6A, and NHP6B in gel mobility shift assays. A, gel shifts
on a 46-bp linear DNA fragment by HU and HMG1. A
P-labeled
46-bp DNA fragment was incubated with buffer alone ( lane 1) or
with increasing amounts of HU ( lanes 2-6) or HMG1
( lanes 7-11). Protein concentrations ranged from 100 ng
to 1600 ng by 2-fold increments. B, gel shifts on a 46-bp
linear DNA fragment by NHP6A and NHP6B. The same fragment as in A was incubated with buffer alone ( lanes 1 and
12), 4-64 ng of NHP6A ( lanes 2-6), or
4-64 ng of NHP6B ( lanes 7-11), increasing by
2-fold increments. C, gel shifts on a 34-bp linear DNA
fragment by NHP6A and NHP6B.
P-labeled 34-bp fragment of a
different DNA sequence from the 46-bp fragment was incubated with
buffer alone ( lane 1), 4-64 ng of NHP6A ( lanes
2-6), or 4-64 ng of NHP6B ( lanes 7-11),
increasing by 2-fold increments.
Complexes of NHP6A/B with DNA are significantly more stable in gel
mobility shift assays as compared to HU or HMG1
(Fig. 4 B). Under the same conditions, protein
DNA
complexes are seen in the presence of only 2-4 ng of NHP6A/B, and
over 50% of the DNA is bound in the presence of 32 ng of NHP6A and 16
ng of NHP6B. From these data, the K
values for NHP6A and NHPB are calculated to be approximately 100
n
M and 40 n
M, respectively, assuming each protein
binds as a monomer. Preliminary glycerol gradient sedimentation
analysis is consistent with a monomeric form of NHP6A in solution,
although the multimeric state when bound to DNA is not known (data not
shown). Three distinct protein-DNA bands are seen in titrations of
NHP6A and NHP6B on a 46-bp DNA fragment (Fig. 4 B), and gel
shifts on a 34-bp fragment yield two distinct bands
(Fig. 4 C). Both proteins bind with almost identical
affinity to the 34-bp fragment as to the 46-bp fragment of a completely
different sequence. NHP6A/B also form one major complex on 21-bp and
26-bp fragments (data not shown). Taken together, these data are
consistent with a minimal binding site of 14-15 bp.
NHP6A and -B Wrap DNA Duplexes
One of the most
direct methods of analyzing the DNA bending activities of proteins
which bind DNA nonspecifically is the ligase-mediated circularization
assay
(15, 16, 34) . A
P-labeled
DNA fragment shorter than the average persistence length of
150 bp
is incubated with a given DNA-binding protein and with T4 DNA ligase.
DNA fragments of this size will not circularize without the addition of
accessory factors, and the DNA concentration is kept very low to favor
intramolecular reactions. Under these conditions, monomer circles form
at levels corresponding to the ability of the protein to wrap the DNA
helix. This assay was used to compare the DNA bending activities of
HMG1 and HMG2 with HU
(16) , which showed that while all three
proteins facilitate the formation of DNA circles
78 bp, only HMG1
and -2 can catalyze the production of 66-bp circles that are one
helical turn smaller.
NHP6A and -B Introduce Negative Supercoils into
DNA
Chromosomal DNA in most cells is kept in a negatively
supercoiled state, in part due to the action of DNA-associated
proteins. HU, HMG1, and HMG2 have been shown to induce negative
supercoils into relaxed closed circular plasmids in the presence of
topoisomerase I
(35, 36, 37, 38) and
thus probably contribute to the overall topological state of DNA in
vivo. To compare the effects of NHP6A and HMG1 on DNA supercoiling
density in vitro, varying amounts of protein was incubated
with pBR322 DNA which had already been completely relaxed with
topoisomerase I (Fig. 6 A). More topoisomerase I was added with
the accessory protein to continue to relax any free supercoils in the
DNA substrate. The reaction in lane 1 of Fig. 6 A contains no additional protein, those in lanes 2-8 and lanes 9-15 contain titrations of HMG1 and
NHP6A, respectively, from protein:DNA molar ratios of 25:1 to 175:1. In
this range of protein concentrations, a 175:1 protein:DNA molar ratio
of HMG1 only converts a subset of the relaxed DNA into the highly
supercoiled species, whereas a 100:1 ratio of NHP6A converts all the
available substrate into the faster migrating supercoiled species.
Similar reactions were electrophoresed in agarose gels containing
varying amounts of chloroquine, which introduces positive supercoils
into the DNA substrate (data not shown). Under these conditions,
increasing amounts of either HMG1 or NHP6A reversed the effect of the
chloroquine; therefore, both proteins introduce negative supercoils
(also shown for HMG1 by Stros et al. (38) ). From the
experiment shown in Fig. 6 A, we conclude that NHP6A is
at least 2-3-fold more efficient in the production of negative
supercoils compared to HMG1 in vitro.
Figure 6:
Introduction of negative supercoils into
relaxed circular plasmid DNA by HMG1 and NHP6A. A, in
vitro, pBR322 DNA was incubated first with topoisomerase I to
remove existing supercoils, then with either buffer ( lane 1),
HMG1 ( lanes 2-8), or NHP6A ( lanes 9-15)
and additional topoisomerase for 30 min. Reactions were then incubated
with SDS and proteinase K before loading onto a 0.7% agarose gel.
Protein:DNA molar ratios ranged from 25:1 to 175:1 by increments of
25:1. Arrows indicate the different forms of the plasmid
substrate: open circular/relaxed ( OC), linear ( lin),
and supercoiled ( SC). B, in vivo, pRJ1227
DNA was isolated from CAG4000 (wild-type, lane 1) or RJ1975
( hupAhupB, lanes 2 and 3) E. coli strains. The cells in lane 3 were grown in the presence
of 1 m
M IPTG which induces expression of NHP6A. After
purification, plasmid DNA was loaded onto a 0.7% agarose gel containing
13 µg/ml chloroquine.
Plasmid DNA was also
collected from E. coli strains to visualize the effects of
NHP6A on DNA linking number in vivo. A plasmid containing
NHP6A under the control of the lac promoter was transformed
into a wild-type E. coli strain and into a hupAhupB strain deficient in HU. Lane 1 in Fig. 6 B contains plasmid DNA isolated from wild-type cells in midlog phase
and run on an agarose gel containing chloroquine to allow the different
topological species to be compared more readily. Lane 2 contains the same DNA isolated from hupAhupB cells which
clearly has a broader distribution of linking number shifted toward the
more relaxed species, very similar to a previous observation of linking
number difference in Salmonella strains lacking HU
(39) . Lane 3 shows plasmid DNA isolated from
hupAhupB E. coli which were grown to midlog phase in the
presence of 1 m
M IPTG to induce expression of NHP6A. The
pattern of bands appears to be an intermediate distribution between
that seen in wild-type and hupAhupB cells, suggesting that
NHP6A partially, but not completely, compensates for the absence of HU
in these cells with respect to DNA supercoiling.
NHP6A Expression Compensates for Deficiencies in
Nucleoid-associated Proteins in Vivo
E. coli cells
lacking both HU subunits have a distinct morphology characterized by
increased cell length and extended, somewhat inflated, nucleoids
(8, 40) . The effect of NHP6A expression was tested by
inducing production of the yeast protein in the hupAhupB strain (Figs. 7 and 8, ). Fig. 7 A shows
wild-type E. coli which were grown to early log phase, then
fixed and stained with 4,6-diamidino-2-phenylindole to visualize the
DNA. Each cell contains one or two distinct compact nucleoids with an
average cell length of 2.02 ± 0.60 µm. In contrast,
hupAhupB cells are much more heterogeneous in appearance,
exhibiting cell lengths of 4.02 ± 2.14 µm and extended,
usually single, nucleoids. hupAhupB nucleoid areas are
approximately twice that of wild-type cells and are highly variable in
size (Fig. 7 B and Fig. 8), as indicated by the large
standard deviation (). In addition, 9.7% of the cells
lacking HU are anucleate, as has been previously reported
(8, 41) . When NHP6A is expressed under lac control in the same strain, however, the cells resemble wild-type
(Fig. 7 C). Cell lengths are reduced to 2.88 ±
0.78 µm, nucleoid areas revert to wild-type levels, and <1% of
cells lack DNA.
Figure 7:In vivo effects of NHP6A
expression on the cellular morphology of E. coli mutants
lacking HU and Fis. A, CAG4000 (wild-type); B, RJ1975
( hupAhupB) + pRJ823; C, RJ1975 + pRJ823
+ pRJ1226; D, RJ1995 ( hupAhupB fis) +
pRJ823; E, RJ1995 + pRJ823 + pRJ1226.
lacI
is expressed from pRJ823; NHP6A is expressed
under the control of the lac promoter from pRJ1226. Cells were
grown to early log phase, fixed, stained with
4,6-diamidino-2-phenylindole, and observed under UV and visible light
simultaneously to visualize cells and DNA. All mutant strains were
grown in the presence of 200 µ
M IPTG. Scale bar = 10 µm.
The E. coli Fis protein, like HU, is also
associated with the bacterial nucleoid in vivo. Cells
deficient in Fis exhibit increased cell length
(42) , although
under our culturing conditions the nucleoids are often distinct and
separated along the length of the filamented cell (data not shown).
Mutants lacking HU and Fis are extremely heterogeneous, exhibiting cell
lengths of 7.13 ± 7.59 µm, dispersed nucleoids, and 9%
anucleate cells, as shown in Fig. 7 D. When NHP6A is
expressed in this mutant strain, the cells revert to almost wild-type
appearance with cell lengths of 3.22 ± 0.97 µm, mostly
condensed distinct nucleoids, and <1% anucleate cells
(Fig. 7 E). The increase in nucleoid area seen in both
the mutant strains cannot be explained by a defect in segregation which
would simply double the average number of genomes in a single nucleoid,
because the statistical distribution is very broad and does not favor
multiples of the wild-type value (Fig. 8). Apparently NHP6A is
able to substitute for HU and Fis in nucleoid condensation, resulting
in the restoration of efficient chromosome segregation and cell
division.
excision reactions
(18, 19) .
In our assays, the presence of HU increases phage yields upon induction
of a
lysogen
3-fold over hupAhupB himA background
levels. Expression of NHP6A also partially compensates for the lack of
IHF, yielding
3-5-fold higher levels of phage, an effect
even greater than that of HU, although still substantially lower than
in the presence of IHF (data not shown).
100 bp, efficient
assembly of the invertasome requires the presence of the bacterial
assembly factor HU
(14) . The correlation between the length of
the DNA segment and the requirement for HU strongly suggests that its
function in this assay is to facilitate the formation of a small loop
between the enhancer and recombination sites such that the other
proteins (Hin and Fis) can interact with each other productively. In
this work, we describe the isolation of two proteins from S.
cerevisiae, NHP6A and NHP6B, which can substitute for HU in
stimulating assembly of the invertasome. A strictly architectural role
is supported by evidence for DNA bending by HU, NHP6A/B, and the
mammalian counterparts HMG1, and HMG2, which are also active in this
assay
(16) . Direct protein-protein interactions between the
assembly factors and Hin or Fis is unlikely given the heterologous
combination of eukaryotic proteins with a prokaryotic system and the
lack of sequence homology between HU and NHP6A/B or HMG1/2.
11-kDa polypeptides transcribed from two highly
related genes
(32) . Each protein contains one HMG box, a
degenerate motif found in a few nonspecific eukaryotic DNA-binding
proteins, such as HMG1/2 in mammals and HMG-D in Drosophila (43, 44, 45, 46) , as well as in
many sequence-specific DNA-binding proteins, including LEF-1/TCR
,
SRY, and mtTF1
(47, 48, 49) . The NMR structure
of HMG box B from HMG1 has been determined
(50, 51) ,
identifying a unique DNA binding motif, although the mechanism of DNA
binding and bending remains to be elucidated. Of the HMG box proteins
isolated from S. cerevisiae, four are known to bind DNA
nonspecifically: NHP6A/B (52 and this work), SIN1
(53) , and the
mitochondrial protein HM/ABF2
(41, 54, 55) .
Expression of NHP6A with a mitochondrial signal sequence in S.
cerevisiae lacking HM/ABF2 restores respiration competency to the
mutant strain
(52) , suggesting that some HMG box proteins may
be interchangeable. NHP6A/B have also been implicated in a
mitogen-activated protein kinase pathway by their ability to suppress
the synthetic lethality of protein kinase C/mitogen-activated protein
kinase mutants, although the mechanism responsible for this function is
not yet known
(56) .
5 proteins bound per plasmid
substrate or 1 protein per
900 bp. Thus, the activity of NHP6A/B
in invertasome assembly does not seem to require coating of the DNA
with protein. We have previously shown that the effect of HU on
invertasome assembly in the cleavage reaction is greatest on DNA
substrates containing 63, 73, or 83 bp between the recombinational
enhancer and one of the hix sites, but is minimal on
substrates containing DNA segments of
51 bp
(14) . In
comparison, NHP6A yields higher levels of invertasome structures on the
substrate with 63 bp between sites than either HU or HMG1 and supports
moderate levels of assembly on a substrate containing only 51 bp
between sites (data not shown). Thus, NHP6A appears to be more active
than its bacterial counterpart in facilitating the formation of the
smallest DNA loops.
DNA Binding Characteristics of NHP6A/B Compared to HU and
HMG1
NHP6A/B are distinct from HU and HMG1/2 in that they bind
linear DNA with much higher affinity in gel mobility shift assays.
HU-DNA binding, under the conditions used, appears to be highly
cooperative, such that only high molecular weight complexes are formed.
HMG1 forms low levels of specific complexes but only when very large
amounts (0.8-1.6 µg) of protein are added. This is in
contrast to the relatively stable complexes formed between HU, HMG1,
and HMG2 with modified forms of DNA, specifically cisplatinated helices
and branched DNA structures
(27, 28, 58) .
3-fold higher affinity than HU and
50-fold
higher affinity than HMG1. Determination of protein concentrations
needed to shift 50% of the input DNA yield K
estimates of approximately 100 n
M for NHP6A and 40
n
M for NHP6B. By comparison, the K
of LEF-1 sequence-specific binding to DNA has been reported to be
1 n
M (47) .
DNA Bending Characteristics
Ligation of small DNA
fragments into covalent circles has proven to be a useful means of
comparing the DNA bending activities of HU, HMG1/2
(16) , and
NHP6A/B (this study). Using this assay, all of these proteins were
found to wrap DNA fragments
78 bp such that significant levels of
monomer circles were formed in the presence of T4 DNA ligase. In
addition, HMG1/2 and NHP6A/B also efficiently catalyze the formation of
66-bp circles, approximately one helical turn smaller than 78 bp,
suggesting that the mammalian and yeast proteins distort the path of
the DNA helix to a greater degree than HU.
DNA complexes as compared to HMG1/2 or HU complexes, or
perhaps to a DNA bending angle exerted by NHP6A/B binding which is more
suited to the angle between DNA strands recognized by ligase.
(
)
These data
do not support the idea that these proteins only recognize statically
bent DNA sequences, which has been suggested because of the high
affinity of HU and HMG1/2 for cruciform structures and modified DNA
(27, 28) . However, binding to linear DNA may be
initiated at transient distortions within the helix. NMR studies have
suggested that while the average conformation of DNA in solution
resembles the linear DNA seen in crystal structures, there is actually
a wide range of torsion angles and transiently distorted molecules
represented in the distribution
(61, 62) .
Introduction of Negative Supercoils by NHP6A
With
the exception of some archaebacteria, chromosomal DNA in both
prokaryotes and eukaryotes is believed to be restrained by proteins
into negative toroidal supercoils. In eukaryotes, this is primarily
achieved by nucleosomes and in prokaryotes by
``histone-like'' or nucleoid-associated proteins. We find
that NHP6A is very efficient at introducing negative supercoils into
relaxed closed circular DNA in vitro in the presence of
topoisomerase I. This activity, which is probably relevant to the
action of these proteins in vivo, has also been noted by Kao
et al. (52) for NHP6A as well as for HU, HMG1, and
HMG2
(35, 36, 37, 38) . In Fig. 6,
we show that NHP6A is at least 2-3-fold more efficient than HMG1
in the generation of supercoils in vitro. In addition, the
expression of NHP6A in hupAhupB cells partially reverses the
reduction in superhelical density created by the absence of HU.
Complementation of E. coli Mutant Phenotypes
The
in vivo effects of NHP6A on chromosome structure and function
was further investigated using well-characterized E. coli mutants deficient in general nucleoid-associated proteins. We
found that expression of NHP6A restored virtually wild-type appearance
to hupAhupB cells with respect to each of these parameters. In
addition, the generation time was shifted closer to, but not identical
with, the wild-type value (data not shown). From these results we
conclude that the presence of NHP6A can function to modulate bacterial
chromatin structure leading to more faithfully replicated and
segregated chromosomes in the absence of one of the major nonspecific
DNA binding proteins. The hupAhupB mutant phenotype has also
been shown to be alleviated by expression of the mitochondrial HM/ABF2
protein
(41) , a finding which further suggests an
interchangeability between HU and HMG box proteins.
Biological Implications
By analogy to HU it is
probable that NHP6A/B have multiple roles in the yeast cell. The
ability of the yeast proteins to supercoil DNA in vitro and
in vivo and to compensate for the deficit in nucleoid
condensation in hupAhupB cells suggests that NHP6A/B may have
similar general functions in the modulation of chromosome structure in
S. cerevisiae. Such a role may be most prominent at localized
regions of high DNA activity such as promoters, replication origins,
chiasmata, or other sites of active chromatin remodeling. NHP6A/B may
also contribute to the formation of specific nucleoprotein complexes, a
role suggested by their observed stimulation of invertasome assembly
and
excision. Our finding that protein
DNA complexes between
NHP6A or -B and linear DNA are much more stable than equivalent
complexes with HU or HMG proteins might mean that the NHP6 proteins are
more specialized than their bacterial and mammalian counterparts. In
this regard, NHP6A/B may be contributing to condensation of nucleosomal
DNA in S. cerevisiae, as has been suggested for HMG-D in the
developing Drosophila embryo
(45) , since in both cases
histone H1 is believed to be absent. We are currently in the process of
identifying and characterizing the role of NHP6A/B in facilitating the
assembly of various types of nucleoprotein complexes in yeast, as well
as determining whether other proteins exist in this organism which
augment their activities.
Table:
Summary of cellular parameters of E. coli
mutants
-
D-galactopyranoside.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
N. A. Becker, J. D. Kahn, and L. J. Maher III Eukaryotic HMGB proteins as replacements for HU in E. coli repression loop formation Nucleic Acids Res., July 1, 2008; 36(12): 4009 - 4021. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Kaufman, N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter, and E. A. Shoubridge The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures Mol. Biol. Cell, September 1, 2007; 18(9): 3225 - 3236. [Abstract] [Full Text] [PDF] |