JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paull, T. T.
Right arrow Articles by Johnson, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paull, T. T.
Right arrow Articles by Johnson, R. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 15, Issue of April 14, pp. 8744-8754, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
DNA Looping by Saccharomyces cerevisiae High Mobility Group Proteins NHP6A/B
CONSEQUENCES FOR NUCLEOPROTEIN COMPLEX ASSEMBLY AND CHROMATIN CONDENSATION (*)

Tanya T. Paull (§) , Reid C. Johnson (¶)

From the (1) Molecular Biology Institute, UCLA, Los Angeles, California 90095 and the Department of Biological Chemistry, UCLA School of Medicine, Los Angeles, California 90095-1737

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The formation of higher order proteinDNA structures often requires bending of DNA strands between specific sites, a process that can be facilitated by the action of nonspecific DNA-binding proteins which serve as assembly factors. A model for this activity is the formation of the invertasome, an intermediate structure created in the Hin-mediated site-specific DNA inversion reaction, which is stimulated by the prokaryotic nucleoid-associated protein HU. Previously, we have shown that the mammalian HMG1/2 proteins substitute for HU in this system and display efficient DNA wrapping activity in vitro. In the present work, we isolate the primary sources of assembly factor activity in Saccharomyces cerevisiae, as measured by the ability to stimulate invertasome formation, and show that these are the previously identified NHP6A/B proteins. NHP6A/B have comparable or greater activity in DNA binding, bending, and supercoiling with respect to HU and HMG1 and appear to form more stable proteinDNA complexes. In addition, expression of NHP6A in mutant Escherichia coli cells lacking HU and Fis restores normal morphological appearance to these cells, specifically in nucleoid condensation and segregation. From these data we predict diverse architectural roles for NHP6A/B in manipulating chromosome structure and promoting the assembly of multicomponent proteinDNA complexes.


INTRODUCTION

Many DNA transactions involve the formation of nucleoprotein structures containing multiple proteins and DNA sites. These complexes have been shown to include not only the DNA molecule and relevant sequence-specific DNA-binding proteins, but in some cases also require nonspecific DNA-binding proteins which serve as accessory factors in these reactions. The exact functions of such ``architectural'' proteins probably vary between experimental systems, but in most instances studied thus far they have been shown to stimulate complex formation by bending or wrapping the DNA strands into specific configurations such that other proteins can interact productively to carry out the reaction (1, 2, 3, 4, 5) .

One of the best examples of such an assembly factor is the prokaryotic protein HU. This abundant heterodimeric protein binds DNA nonspecifically in vitro and is thought to be associated with the bacterial nucleoid in vivo (6, 7, 8, 9) . HU stimulates replication from oriC (10, 11) and facilitates the assembly of intermediates in several different types of specialized recombination reactions (12, 13, 14) . In Hin-mediated DNA inversion, HU stimulates construction of the invertasome (see Fig. 1), particularly when two of the three sites which synapse together are separated by less than 100 bp() in the DNA substrate (14) . Given the known ability of HU to bend DNA (15, 16) , its proposed role in this reaction is to wrap the short length of DNA helix into a loop such that the Hin recombinase and the Fis protein can associate into a stable complex. HU also stimulates formation of the type 1 transpososome, an intermediate structure necessary for transposition by bacteriophage Mu. Its role in this system involves catalyzing the assembly of MuA transposase at the left end of the Mu DNA, perhaps in a manner specific to the spatial configuration of MuA binding sites in this region (12, 13, 17) . In addition, HU partially substitutes for the related but sequence-specific DNA-binding protein IHF (integration host factor) in phage excision (18, 19) . The functional replacement of IHF binding sites in the attP region of with either phased A-tracts or a cAMP receptor protein binding site supports the interpretation of a primarily structural role for IHF (and HU) in this system (20) .


Figure 1: Schematic illustration of the Hin-mediated DNA inversion reaction. A, plasmid substrate containing hixLand hixLbinding sites for Hin recombinase and the recombinational enhancer which contains two binding sites for the Fis protein. The DNA between the hix sites containing the enhancer is referred to as the invertible segment. B, Hin and Fis protein dimers bound at their respective sites. C, the invertasome complex with HU/HMG1 assembly factors shown theoretically in the small DNA loop between hixL and the enhancer. D, the invertasome complex after DNA strand exchange and ligation by Hin. E, plasmid substrate after inversion, with proteins removed. The hixLand hixLsites are now composite.



In mammals, the functional equivalents of HU appear to be the high mobility group (HMG) proteins 1 and 2, which are also abundant and thought to be associated with chromatin in vivo (21) . HMG1 and -2 efficiently substitute for HU in stimulating invertasome formation in the Hin DNA inversion reaction (16) . The mammalian proteins facilitate invertasome formation on substrates containing one helical turn less DNA in the loop between the recombinational enhancer and a hix site (see Fig. 1) compared to the smallest substrates assembled into invertasomes in the presence of HU (16) . HMG1 and -2 have also been shown to be even more effective than HU in bending DNA as measured by the formation of small DNA circles in the presence of T4 DNA ligase. Both HMG proteins facilitate the formation of 66-bp DNA circles, which are one helical turn shorter than the smallest formed in the presence of HU (16) . HMG1 can also substitute for HU in promoting the Mu strand cleavage reaction (22) and in stimulating intasome formation (19) . A role for HMG1 and HMG2 in transcription has been implicated in some systems (23, 24, 25) although the C-terminal acidic tail apparently does not function as a general transcriptional activator domain (26) . HMG1 has also been shown to bind with high affinity to cruciform structures (27) , cisplatinated DNA (28) , and to associate with histone H1 (29) .

Despite the large number of in vitro studies performed on HMG1/2, their biological roles in vivo remain to be demonstrated. As the first step in an attempt to characterize these roles genetically, we have identified functional equivalents of HMG1/2 in yeast by using the Hin-mediated DNA inversion reaction as an assay for DNA bending or wrapping activity. In this work, we show that the two yeast proteins detected by this method are the non-histone proteins (NHP) 6A and NHP6B which had previously been isolated on the basis of solubility and amino acid sequence similarity to mammalian HMG proteins (30) . The DNA binding and bending abilities of NHP6A/B are investigated, as well as their effects on DNA supercoiling and on the phenotypes of bacterial mutants lacking general nucleoid-associated proteins.


EXPERIMENTAL PROCEDURES

Escherichia coli Strains and Plasmids

Supercoiling assays and microscopy studies were performed using the following E. coli strains: CAG4000 (MG1655 lacX74, obtained from C. Gross), RJ1975 (CAG4000 hupA::cm hupB::km), RJ1995 (RJ1975 fis-985), and RJ1999 (RJ1975 himA83-Tn 10). Genes were disrupted by P1 transduction using lysates made from NH277 ( hupB: km) and NH278 ( hupA: cm) (provided by P. Higgins), RJ1803 ( fis-985) (65) , and N6127 ( himA83-Tn 10, obtained from H. Miller). Recombinant NHP6A/B protein was produced in RJ1878 (BL21 (DE3) (Novagen) hupA::cm hupB::km). excision assays (66) were performed using RJ3031 (CAG4000 himA83-Tn10 cI857 S7), RJ3030 (RJ1999 cI857 S7), and RJ3030 containing pRJ1227.

Construction of NHP6A/B plasmids was as follows: the NHP6A and NHP6B genes were obtained by polymerase chain reaction of genomic Saccharomyces cerevisiae DNA (gift of E. Bensen and G. Payne) with NdeI and BamHI sites engineered at the 5` and 3` ends, respectively. The polymerase chain reaction products were digested with NdeI and BamHI and were ligated into pET11a (Novagen) to create pRJ1228 (NHP6A) and pRJ1229 (NHP6B) containing the NHP6A/B genes under the control of the T7 promoter. The NdeI- BamHI fragment from pRJ1228 was then inserted into the BamHI site of a pBR322 derivative containing the lacP UV5 promoter between the EcoRI and BamHI sites by ligating the BamHI sites first, filling in the remaining BamHI and NdeI ends with T4 DNA polymerase and dNTPs, and ligating the blunt ends together to create pRJ1226, containing NHP6A under the control of the lac promoter. This plasmid was then cut with SspI and BamHI to excise the lacP-NHP6A region which was ligated between the BclI and ScaI sites on pRJ823 (pACYC184 lacI), after filling in protruding ends with T4 DNA polymerase and dNTPs, to create pRJ1227. Expression of NHP6A under the control of the lac promoter during exponential growth yielded approximately 5000-10000 molecules of protein per cell as determined by Western blotting of cell lysates (data not shown).

Recombination and Ligation Assays

Unless otherwise noted, all cleavage assays contained pMS551-83, a plasmid substrate containing hixL1, hixL2, and the Hin recombinational enhancer in pBR322 with 83 bp between the center of hixL1 and the center of the proximal Fis binding site in the enhancer, as described (14) . In vitro cleavage assays were performed as described previously (14) , although in some cases (Fig. 3), 50 m M CHAPS was added to the reactions. Incubations were for 3 min in standard reactions and 0.25 min in reactions containing CHAPS to measure reaction rates.


Figure 3: Comparison of invertasome assembly rates in the presence of HU, HMG1, NHP6A, and NHP6B. Reactions contained plasmid substrate pMS551-83 and were done in the presence of 50 m M CHAPS. Percent cleavage reflects the level of invertasome assembly above background levels (no accessory protein added).



Ligation substrates were made by polymerase chain reaction of the set of recombination substrates containing varying DNA lengths between the enhancer and hixL1 as described (16) . Each fragment was internally labeled with [-P]dATP and digested with EcoRI. Note that the protein:DNA molar ratios cited previously (16) were 10-fold lower than the actual ratios, due to an error in quantitation. Ligation assays were performed as described previously (16) .

Proteins

Hin, Fis, HU, and bovine HMG1/2 were purified as described (14, 16) . NHP6A/B were isolated from both whole cell and nuclear extracts from S. cerevisiae BJ1991(MAT prb1-112 pep4-3 leu2 trp1 ura3-52, obtained from A. Carmen and M. Grunstein). Whole cell extracts were prepared by passage of cells twice through a French press in buffer containing 10 m M Tris-HCl (pH 7.5), 100 m M NaCl, 10% glycerol, 1 m M dithiothreitol, 10 m M EDTA, 3 m M phenylmethylsulfonyl fluoride, and 10 µg/ml each of leupeptin, antipain, pepstatin, and chymostatin, followed by centrifugation at 30,000 g. Nuclear extracts were prepared using a modified combination of protocols (67, 68) () which involves spheroplast formation by lyticase (Enzogenetics), osmotic lysis of spheroplasts in a buffered 9% Ficoll solution, and purification of nuclei by centrifugation through a 30% Ficoll cushion. Isolated nuclei were incubated in extraction buffer: 10 m M Tris-HCl (pH 8.0), 0.5% Nonidet P-40, 0.25 M sorbitol, 1 m M phenylmethylsulfonyl fluoride, containing 0.5 M NaCl on ice for 1 h. Nuclear debris was then pelleted at 20,000 g for 10 min, and the supernatant was collected.

Whole cell and nuclear extracts were selectively extracted with 30%, 60%, and 90% saturated ammonium sulfate (removed by overnight dialysis against buffer A: 10 m M Tris-HCl (pH 8.0), 10% glycerol, 0.1 m M EDTA, and 50 m M NaCl) or with 2% followed by 10% trichloroacetic acid (removed by washing the pellet with acetone, lyophilization, and resuspension in buffer A). Activity in the cleavage assay was first seen at this stage of the purification and only in the 60-90% ammonium sulfate and 2-10% trichloroacetic acid precipitates. These were then loaded onto a heparin-agarose column equilibrated in buffer A and eluted in a linear salt gradient from 50 m M to 1 M NaCl. The activity eluted from the column with 0.4-0.5 M NaCl. Fractions were pooled, dialyzed against buffer A, and loaded onto an FPLC Mono Q column (Pharmacia Biotech) in the same buffer. The flow-through fractions were then loaded onto a HR5/10 reverse-phase FPLC column (Pharmacia) and eluted with a continuous gradient from 0 to 100% acetonitrile. Fractions containing NHP6A and NHP6B eluted at 27% and 30% acetonitrile, respectively. Acetonitrile was removed by lyophilization, and pellets were resuspended in buffer A. Amino acid composition analysis and N-terminal sequencing of active fractions identified each peak unambiguously as NHP6A/B. All protein concentrations were determined by Bradford (Pierce) assays, using bovine serum albumin as the standard, adjusted for each protein by values obtained by quantitative amino acid analysis.

Recombinant NHP6A and NHP6B were produced in E. coli strain RJ1878 containing pRJ1228 and pRJ1229, respectively. Protein expression was induced by addition of 1 m M IPTG at OD= 0.5 for 30 min (NHP6A) or 2 h (NHP6B). The lysis procedure was essentially as described for HU (69) , except that the final supernatant was dialyzed into buffer A overnight. The partially purified proteins were loaded onto an EconoPak S cartridge (Bio-Rad) equilibrated in buffer A, washed with 0.35 M NaCl, and eluted with a linear gradient from 0.35 M to 0.65 M NaCl in buffer A. Both NHP6A/B proteins eluted at 0.5 M NaCl. Fractions containing the yeast proteins were dialyzed against buffer A overnight and then loaded onto a heparin-agarose column (Bio-Rad), washed with buffer A and 0.3 M NaCl, followed by a linear gradient from 0.3 M to 0.6 M NaCl in buffer A. Both NHP6A/B proteins eluted at 0.5 M NaCl, and fractions contained no other polypeptides visible by Coomassie Blue staining of SDS-polyacrylamide gels.

Gel Mobility Shift Assays

DNA fragments used in gel-shift assays were: 46-bp (GACGTCAATCTTCTTGAAAACCAAGGTTTTTGATAAGATCAGGCCT), 34-bp (AGCTTACTAGTGCAAATTGTGACCGCATTTTTGA), 26-bp (ATACTAGTGCAAATTGTGACCGCATT), and 21-bp (CTAGTGCAAATTGTGACCGCA). 20-µl reactions contained 20 m M HEPES (pH 7.5), 40 m M NaCl, 10 m M EDTA, 2 µg of bovine serum albumin, 5% glycerol, and 0.5 TBE. Proteins in each reaction were incubated with 1 ng of P-labeled DNA fragment at 30 °C for at least 10 min before loading onto the gel, which contained 5%, 8%, or 10% acrylamide (60:1 acrylamide:bis) and 0.5 TBE. Gels were run at 6-8 V/cm for 2-3 h, fixed, dried, and exposed to x-ray film (Kodak). No significant differences in relative affinities were observed in proteinDNA complex formation between DNA fragments of varying sequences.

Supercoiling Assays

In vitro assays contained 0.1 pmol of pBR322, 50 m M Tris-HCl (pH 7.5), 50 m M KCl, 10 m M MgCl, 0.1 m M EDTA, 0.5 m M dithiothreitol, and 30 µg/ml bovine serum albumin per 20-µl reaction. Plasmid DNA was first completely relaxed with topoisomerase I (Life Technologies, Inc.) for 1 h at 37 °C, then incubated with varying amounts of protein plus 1 unit of additional topoisomerase I for 1 h at 37 °C before the addition of 0.5% SDS and 5 µg of proteinase K. Reactions were further incubated for 15 min before loading onto a 0.7% agarose gel containing Tris-phosphate-EDTA (TPE) buffer (70) and electrophoresed at 2 V/cm for approximately 24 h.

In vivo assays were done in E. coli strains CAG4000 (wild-type) and RJ1975 ( hupAhupB) containing plasmid substrate pRJ1227. Plasmid DNA was isolated from 5-ml cultures of CAG4000, RJ1975, and RJ1975 grown in the presence of 1 m M IPTG. Each strain was grown to an ODof 0.5 from a 1:500 dilution of an overnight culture (uninduced), and DNA was recovered using a modified alkaline lysis protocol. DNA obtained was electrophoresed on a 0.7% TPE agarose gel in the presence of 13 µg/ml chloroquine at 2 V/cm for 24 h.

Microscopy

All E. coli strains described in Fig. 7, Fig. 8, and were inoculated into LB from a single colony, grown to early log phase (OD= 0.3), and fixed as described (71) . RJ1975 ( hupAhupB) and RJ1995 ( hupAhupB fis) strains contained pRJ823 ( lacI) with or without pRJ1226 ( lacP-NHP6A). All mutant strains were grown in the presence of 200 µ M IPTG. Cells were visualized using a 100 Oel objective lens (Zeiss) on a Microphot-FXA microscope (Nikon) and photographed using 160 tungsten Ektachrome color slide film (Kodak). Cell lengths, nucleoid areas, and percent anucleate cell levels were quantitated using an HP9864A digitizer with the Sigmascan analysis program.


Figure 8: Distributions of nucleoid area in E. coli mutants. A, CAG4000 (wild-type); B, RJ1975 ( hupAhupB) + pRJ823; C, RJ1975 + pRJ823 + pRJ1226; D, RJ1995 ( hupAhupB fis) + pRJ823; E, RJ1995 + pRJ823 + pRJ1226. Plasmids are as described in Fig. 7 and under ``Experimental Procedures.'' At least 500 cells were measured for each strain. The x axis interval used in constructing the histograms = 0.05 µm. The y axis reflects the number of cells in a given interval.




RESULTS

Our primary assay for DNA-wrapping proteins is the formation of an intermediate structure required for Hin-mediated DNA inversion, shown in Fig. 1(31) . A dimer of the Hin recombinase binds to each of the recombination sites, hixLand hixL(Fig. 1, A and B). Two dimers of the Fis protein bind to the recombinational enhancer, which associates with the Hin-bound hix sites into a specific intermediate configuration called the invertasome (Fig. 1 C). In the presence of ethylene glycol and the absence of magnesium, invertasome complexes are trapped and do not continue through the inversion pathway. Under these ``cleavage'' conditions, the amount of Hin-mediated cutting at the center of one or both of the hix sites corresponds to the amount of invertasome complex formed during the reaction. Under standard conditions, however, Hin then catalyzes DNA strand exchange and ligation (Fig. 1 D) such that the DNA segment between the hix sites is inverted (Fig. 1 E). On substrates which contain less than approximately 100 bp between a hix site and the enhancer, the presence of HU, HMG1, or HMG2 is necessary for efficient invertasome formation (14, 16) .

To identify yeast proteins which substitute for HU, whole cell and nuclear extracts from S. cerevisiae were assayed using the Hin cleavage reaction on a DNA substrate containing 83 bp between hixLand the recombinational enhancer. Activity was not seen in initial S30 supernatants, but appeared after either selective ammonium sulfate or trichloroacetic acid precipitations (as described under ``Experimental Procedures''). Active fractions were then sequentially separated on heparin-agarose, Mono Q, and reverse-phase chromatography columns. Fractions from the last step of the purification, an HR5/10 reverse-phase FPLC column, are shown in Fig. 2A after electrophoresis on a denaturing SDS-polyacrylamide gel and silver staining. In cleavage assays, the invertasome-stimulating activities corresponded to the fractions containing protein peaks in lanes 5-8 and lanes 10-14. Amino acid composition analysis and N-terminal sequencing determined that the first peak contained NHP6A and the second peak contained NHP6B. These two related proteins are transcribed from different genes although they are 87% identical and each contains one ``HMG box,'' a DNA binding motif now found in many different specific and nonspecific proteins (21, 32) . The HMG boxes in NHP6A and NHP6B are 45% and 40% identical with domain B of HMG1, respectively. Minor bands above the major ones in Fig. 2A are probably modified forms of the two proteins.


Figure 2: Purification and identification of NHP6A/B. A, silver-stained SDS-acrylamide gel containing successive fractions ( lanes 2-15) from an HR5/10 reverse-phase FPLC column at the final step of NHP6A/B purification from a whole cell preparation of S. cerevisiae. Lane 1 contains the column load; lanes 5-8 and 10-13 contain NHP6A and NHP6B, respectively. Arrows indicate major forms of NHP6A and NHP6B. B, cleavage reactions on DNA substrate pMS551-83 in the presence of increasing amounts of recombinant NHP6A/B, electrophoresed in a 1% agarose gel. Lane 1 contains 100 ng of HMG1, lane 2 contains no accessory protein, lanes 3-16 contain 5, 10, 20, 40, 80, 160, or 320 ng of NHP6A ( lanes 3-9) or NHP6B ( lanes 10-16), respectively. Arrows indicate the positions of open circular plasmid (nicked) ( OC), supercoiled plasmid (uncut) ( SC), linearized plasmid (single hix site cut) ( lin), excised vector (two hix sites cut) ( vec), and excised invertible segment (two hix sites cut) ( inv).



NHP6A and -B Efficiently Substitute for HU in Hin Invertasome Formation

To obtain large quantities of NHP6A and NHP6B, recombinant forms of the proteins were expressed under the control of the T7 promoter in bacteria and then purified to homogeneity by ion exchange chromatography. The effect of the yeast proteins on formation of invertasome structures in vitro is clearly seen in Fig. 2 B. Lane 1 contains a cleavage reaction in the presence of 100 ng of HMG1 ( arrows indicate the linearized plasmid (one hix site cut), vector, and released intervening segment (two hix sites cut)). The reaction in lane 2 contains no accessory protein, and lanes 3-9 and 10-16 contain titrations of NHP6A and NHP6B, respectively. High levels of cleaved DNA substrate are seen in the presence of both proteins. The modified forms of NHP6A/B seen in Fig. 2 A are not observed in the bacterial extracts and are apparently not necessary for the activity of these proteins in our assays because the recombinant proteins exhibit virtually identical stimulation in cleavage assays compared to their native counterparts. Unless specified, all characterization of NHP6A/B shown in this work was done with the recombinant forms of the proteins.

NHP6A/B each exhibit similar activity in the cleavage assay compared to HU and HMG1. Fig. 3 shows the percentage of DNA substrate molecules formed into invertasome complexes in the presence of varying amounts of the native yeast proteins. The optimum ratio of protein to DNA in these reactions is approximately 30-40 protein monomers per plasmid substrate, although significant stimulation is observed even with ratios of 5-10. Unlike HU and HMG1, however, NHP6A/B also completely inhibit invertasome formation at higher concentrations. With more than 50 molecules of protein for each DNA substrate, the amounts of cleaved substrate decrease with increasing protein concentration until even the basal reaction is inhibited (also seen in Fig. 2 B). Unlike HU and HMG1/2, the yeast proteins also do not appear to stimulate the complete inversion reaction under conditions in which the DNA strands are exchanged and religated after DNA strand cleavage (data not shown), an observation perhaps explained by the unique DNA binding characteristics of NHP6A/B (see below).

NHP6A/B Form More Stable Complexes with DNA Fragments than HU or HMG1

To investigate the relative stability of NHP6A/BDNA complexes in comparison to those containing HU or HMG1, each of these proteins was added to a 46-bp P-labeled double-stranded DNA and run in a nondenaturing polyacrylamide gel to separate the protein-bound DNA from the free DNA fragments. At high protein concentrations (100-1600 ng/reaction), HU and HMG1 form nondistinct high molecular weight complexes (Fig. 4 A). Under the conditions used, HU does not form a ladder of specific complexes with DNA fragments, in contrast to other reports (33) . HMG1 appears to bind linear DNA with low affinity in gel shifts, as has been reported by others (27, 28) .


Figure 4: Comparison of DNA binding by HU, HMG1, NHP6A, and NHP6B in gel mobility shift assays. A, gel shifts on a 46-bp linear DNA fragment by HU and HMG1. A P-labeled 46-bp DNA fragment was incubated with buffer alone ( lane 1) or with increasing amounts of HU ( lanes 2-6) or HMG1 ( lanes 7-11). Protein concentrations ranged from 100 ng to 1600 ng by 2-fold increments. B, gel shifts on a 46-bp linear DNA fragment by NHP6A and NHP6B. The same fragment as in A was incubated with buffer alone ( lanes 1 and 12), 4-64 ng of NHP6A ( lanes 2-6), or 4-64 ng of NHP6B ( lanes 7-11), increasing by 2-fold increments. C, gel shifts on a 34-bp linear DNA fragment by NHP6A and NHP6B. P-labeled 34-bp fragment of a different DNA sequence from the 46-bp fragment was incubated with buffer alone ( lane 1), 4-64 ng of NHP6A ( lanes 2-6), or 4-64 ng of NHP6B ( lanes 7-11), increasing by 2-fold increments.



Complexes of NHP6A/B with DNA are significantly more stable in gel mobility shift assays as compared to HU or HMG1 (Fig. 4 B). Under the same conditions, proteinDNA complexes are seen in the presence of only 2-4 ng of NHP6A/B, and over 50% of the DNA is bound in the presence of 32 ng of NHP6A and 16 ng of NHP6B. From these data, the Kvalues for NHP6A and NHPB are calculated to be approximately 100 n M and 40 n M, respectively, assuming each protein binds as a monomer. Preliminary glycerol gradient sedimentation analysis is consistent with a monomeric form of NHP6A in solution, although the multimeric state when bound to DNA is not known (data not shown). Three distinct protein-DNA bands are seen in titrations of NHP6A and NHP6B on a 46-bp DNA fragment (Fig. 4 B), and gel shifts on a 34-bp fragment yield two distinct bands (Fig. 4 C). Both proteins bind with almost identical affinity to the 34-bp fragment as to the 46-bp fragment of a completely different sequence. NHP6A/B also form one major complex on 21-bp and 26-bp fragments (data not shown). Taken together, these data are consistent with a minimal binding site of 14-15 bp.

NHP6A and -B Wrap DNA Duplexes

One of the most direct methods of analyzing the DNA bending activities of proteins which bind DNA nonspecifically is the ligase-mediated circularization assay (15, 16, 34) . A P-labeled DNA fragment shorter than the average persistence length of 150 bp is incubated with a given DNA-binding protein and with T4 DNA ligase. DNA fragments of this size will not circularize without the addition of accessory factors, and the DNA concentration is kept very low to favor intramolecular reactions. Under these conditions, monomer circles form at levels corresponding to the ability of the protein to wrap the DNA helix. This assay was used to compare the DNA bending activities of HMG1 and HMG2 with HU (16) , which showed that while all three proteins facilitate the formation of DNA circles 78 bp, only HMG1 and -2 can catalyze the production of 66-bp circles that are one helical turn smaller.

Like HU and HMG1/2, NHP6A/B can also efficiently induce DNA circle formation (shown on a 98-bp fragment in Fig. 5 A). Lane 1 contains the DNA fragment alone, and lane 2 contains the dimer linear and dimer circular products formed after addition of ligase. Lane 3 contains the same reaction as lane 2, but after further incubation with exonuclease III, which digests all the linear species. Lanes 4-9 and 10-15 contain similar reactions with titrations of NHP6A and -B, respectively, from protein:DNA ratios of 2.5:1 to 80:1. Reactions in lanes 4-15 were all incubated with exonuclease III before loading. Monomer circles first appear at protein:DNA ratios of 5:1, and, with increasing protein concentrations, high levels of input DNA are converted to the monomer circle species.

Similar assays were done with NHP6A on DNA fragments ranging from 50-99 bp (summarized in Fig. 4 B). The sinusoidal-like pattern of circle production with respect to DNA length reflects the requirement for an exact alignment of the DNA ends for ligation and thus is a consequence of the helical repeat. Like HMG1 and -2, the NHP6 proteins efficiently catalyze the formation of circles as small as 66 bp. Significantly, NHP6A/B are 5-20 times more efficient at facilitating circle formation compared to our HU, HMG1, or HMG2 preparations (16) . No difference between native and recombinant proteins in ligation assays was observed. NHP6B showed similar activity in comparison to NHP6A, although slightly lower levels of monomer circle were consistently produced by NHP6B.

NHP6A and -B Introduce Negative Supercoils into DNA

Chromosomal DNA in most cells is kept in a negatively supercoiled state, in part due to the action of DNA-associated proteins. HU, HMG1, and HMG2 have been shown to induce negative supercoils into relaxed closed circular plasmids in the presence of topoisomerase I (35, 36, 37, 38) and thus probably contribute to the overall topological state of DNA in vivo. To compare the effects of NHP6A and HMG1 on DNA supercoiling density in vitro, varying amounts of protein was incubated with pBR322 DNA which had already been completely relaxed with topoisomerase I (Fig. 6 A). More topoisomerase I was added with the accessory protein to continue to relax any free supercoils in the DNA substrate. The reaction in lane 1 of Fig. 6 A contains no additional protein, those in lanes 2-8 and lanes 9-15 contain titrations of HMG1 and NHP6A, respectively, from protein:DNA molar ratios of 25:1 to 175:1. In this range of protein concentrations, a 175:1 protein:DNA molar ratio of HMG1 only converts a subset of the relaxed DNA into the highly supercoiled species, whereas a 100:1 ratio of NHP6A converts all the available substrate into the faster migrating supercoiled species. Similar reactions were electrophoresed in agarose gels containing varying amounts of chloroquine, which introduces positive supercoils into the DNA substrate (data not shown). Under these conditions, increasing amounts of either HMG1 or NHP6A reversed the effect of the chloroquine; therefore, both proteins introduce negative supercoils (also shown for HMG1 by Stros et al. (38) ). From the experiment shown in Fig. 6 A, we conclude that NHP6A is at least 2-3-fold more efficient in the production of negative supercoils compared to HMG1 in vitro.


Figure 6: Introduction of negative supercoils into relaxed circular plasmid DNA by HMG1 and NHP6A. A, in vitro, pBR322 DNA was incubated first with topoisomerase I to remove existing supercoils, then with either buffer ( lane 1), HMG1 ( lanes 2-8), or NHP6A ( lanes 9-15) and additional topoisomerase for 30 min. Reactions were then incubated with SDS and proteinase K before loading onto a 0.7% agarose gel. Protein:DNA molar ratios ranged from 25:1 to 175:1 by increments of 25:1. Arrows indicate the different forms of the plasmid substrate: open circular/relaxed ( OC), linear ( lin), and supercoiled ( SC). B, in vivo, pRJ1227 DNA was isolated from CAG4000 (wild-type, lane 1) or RJ1975 ( hupAhupB, lanes 2 and 3) E. coli strains. The cells in lane 3 were grown in the presence of 1 m M IPTG which induces expression of NHP6A. After purification, plasmid DNA was loaded onto a 0.7% agarose gel containing 13 µg/ml chloroquine.



Plasmid DNA was also collected from E. coli strains to visualize the effects of NHP6A on DNA linking number in vivo. A plasmid containing NHP6A under the control of the lac promoter was transformed into a wild-type E. coli strain and into a hupAhupB strain deficient in HU. Lane 1 in Fig. 6 B contains plasmid DNA isolated from wild-type cells in midlog phase and run on an agarose gel containing chloroquine to allow the different topological species to be compared more readily. Lane 2 contains the same DNA isolated from hupAhupB cells which clearly has a broader distribution of linking number shifted toward the more relaxed species, very similar to a previous observation of linking number difference in Salmonella strains lacking HU (39) . Lane 3 shows plasmid DNA isolated from hupAhupB E. coli which were grown to midlog phase in the presence of 1 m M IPTG to induce expression of NHP6A. The pattern of bands appears to be an intermediate distribution between that seen in wild-type and hupAhupB cells, suggesting that NHP6A partially, but not completely, compensates for the absence of HU in these cells with respect to DNA supercoiling.

NHP6A Expression Compensates for Deficiencies in Nucleoid-associated Proteins in Vivo

E. coli cells lacking both HU subunits have a distinct morphology characterized by increased cell length and extended, somewhat inflated, nucleoids (8, 40) . The effect of NHP6A expression was tested by inducing production of the yeast protein in the hupAhupB strain (Figs. 7 and 8, ). Fig. 7 A shows wild-type E. coli which were grown to early log phase, then fixed and stained with 4,6-diamidino-2-phenylindole to visualize the DNA. Each cell contains one or two distinct compact nucleoids with an average cell length of 2.02 ± 0.60 µm. In contrast, hupAhupB cells are much more heterogeneous in appearance, exhibiting cell lengths of 4.02 ± 2.14 µm and extended, usually single, nucleoids. hupAhupB nucleoid areas are approximately twice that of wild-type cells and are highly variable in size (Fig. 7 B and Fig. 8), as indicated by the large standard deviation (). In addition, 9.7% of the cells lacking HU are anucleate, as has been previously reported (8, 41) . When NHP6A is expressed under lac control in the same strain, however, the cells resemble wild-type (Fig. 7 C). Cell lengths are reduced to 2.88 ± 0.78 µm, nucleoid areas revert to wild-type levels, and <1% of cells lack DNA.


Figure 7:In vivo effects of NHP6A expression on the cellular morphology of E. coli mutants lacking HU and Fis. A, CAG4000 (wild-type); B, RJ1975 ( hupAhupB) + pRJ823; C, RJ1975 + pRJ823 + pRJ1226; D, RJ1995 ( hupAhupB fis) + pRJ823; E, RJ1995 + pRJ823 + pRJ1226. lacIis expressed from pRJ823; NHP6A is expressed under the control of the lac promoter from pRJ1226. Cells were grown to early log phase, fixed, stained with 4,6-diamidino-2-phenylindole, and observed under UV and visible light simultaneously to visualize cells and DNA. All mutant strains were grown in the presence of 200 µ M IPTG. Scale bar = 10 µm.



The E. coli Fis protein, like HU, is also associated with the bacterial nucleoid in vivo. Cells deficient in Fis exhibit increased cell length (42) , although under our culturing conditions the nucleoids are often distinct and separated along the length of the filamented cell (data not shown). Mutants lacking HU and Fis are extremely heterogeneous, exhibiting cell lengths of 7.13 ± 7.59 µm, dispersed nucleoids, and 9% anucleate cells, as shown in Fig. 7 D. When NHP6A is expressed in this mutant strain, the cells revert to almost wild-type appearance with cell lengths of 3.22 ± 0.97 µm, mostly condensed distinct nucleoids, and <1% anucleate cells (Fig. 7 E). The increase in nucleoid area seen in both the mutant strains cannot be explained by a defect in segregation which would simply double the average number of genomes in a single nucleoid, because the statistical distribution is very broad and does not favor multiples of the wild-type value (Fig. 8). Apparently NHP6A is able to substitute for HU and Fis in nucleoid condensation, resulting in the restoration of efficient chromosome segregation and cell division.

Integration host factor (IHF) is another nucleoid-associated protein in E. coli which, like Fis, shows sequence-specific DNA binding yet also is thought to be involved in general chromosome topology (1) . HU partially substitutes for IHF in model phage excision reactions (18, 19) . In our assays, the presence of HU increases phage yields upon induction of a lysogen 3-fold over hupAhupB himA background levels. Expression of NHP6A also partially compensates for the lack of IHF, yielding 3-5-fold higher levels of phage, an effect even greater than that of HU, although still substantially lower than in the presence of IHF (data not shown).


DISCUSSION

We have used the invertasome, an intermediate structure necessary for Hin-mediated DNA inversion, as a model nucleoprotein complex to examine the properties of nonspecific DNA-binding proteins. When the length of DNA between the recombinational enhancer and one of the Hin recombinase binding sites is less than 100 bp, efficient assembly of the invertasome requires the presence of the bacterial assembly factor HU (14) . The correlation between the length of the DNA segment and the requirement for HU strongly suggests that its function in this assay is to facilitate the formation of a small loop between the enhancer and recombination sites such that the other proteins (Hin and Fis) can interact with each other productively. In this work, we describe the isolation of two proteins from S. cerevisiae, NHP6A and NHP6B, which can substitute for HU in stimulating assembly of the invertasome. A strictly architectural role is supported by evidence for DNA bending by HU, NHP6A/B, and the mammalian counterparts HMG1, and HMG2, which are also active in this assay (16) . Direct protein-protein interactions between the assembly factors and Hin or Fis is unlikely given the heterologous combination of eukaryotic proteins with a prokaryotic system and the lack of sequence homology between HU and NHP6A/B or HMG1/2.

NHP6A and NHP6B are 11-kDa polypeptides transcribed from two highly related genes (32) . Each protein contains one HMG box, a degenerate motif found in a few nonspecific eukaryotic DNA-binding proteins, such as HMG1/2 in mammals and HMG-D in Drosophila (43, 44, 45, 46) , as well as in many sequence-specific DNA-binding proteins, including LEF-1/TCR, SRY, and mtTF1 (47, 48, 49) . The NMR structure of HMG box B from HMG1 has been determined (50, 51) , identifying a unique DNA binding motif, although the mechanism of DNA binding and bending remains to be elucidated. Of the HMG box proteins isolated from S. cerevisiae, four are known to bind DNA nonspecifically: NHP6A/B (52 and this work), SIN1 (53) , and the mitochondrial protein HM/ABF2 (41, 54, 55) . Expression of NHP6A with a mitochondrial signal sequence in S. cerevisiae lacking HM/ABF2 restores respiration competency to the mutant strain (52) , suggesting that some HMG box proteins may be interchangeable. NHP6A/B have also been implicated in a mitogen-activated protein kinase pathway by their ability to suppress the synthetic lethality of protein kinase C/mitogen-activated protein kinase mutants, although the mechanism responsible for this function is not yet known (56) .

NHP6A/B each yield high levels of invertasome structures comparable to those formed in the presence of HU, HMG1, and HMG2. Maximum rates of NHP6A/B-stimulated DNA cleavage are seen with 2-4 pmol of protein per 0.1 pmol of DNA substrate, which yields an estimate of 112-225 bp per bound protein. Stimulation is first observed with 5 proteins bound per plasmid substrate or 1 protein per 900 bp. Thus, the activity of NHP6A/B in invertasome assembly does not seem to require coating of the DNA with protein. We have previously shown that the effect of HU on invertasome assembly in the cleavage reaction is greatest on DNA substrates containing 63, 73, or 83 bp between the recombinational enhancer and one of the hix sites, but is minimal on substrates containing DNA segments of 51 bp (14) . In comparison, NHP6A yields higher levels of invertasome structures on the substrate with 63 bp between sites than either HU or HMG1 and supports moderate levels of assembly on a substrate containing only 51 bp between sites (data not shown). Thus, NHP6A appears to be more active than its bacterial counterpart in facilitating the formation of the smallest DNA loops.

Unlike the bacterial and mammalian proteins, however, the NHP6 proteins start to inhibit the reaction at protein:DNA molar ratios higher than 50:1. The explanation for this result is unclear, but may be related to the higher affinity of the yeast proteins for DNA compared to HU and HMG1 such that high concentrations of NHP6A/B would inhibit either binding of Hin and Fis or prevent strand exchange. This may also explain the inability of NHP6A/B to stimulate the complete inversion reaction in which the Hin recombinase not only cleaves but exchanges and religates the DNA strands. An additional turn of twist is necessary for the strand exchange process; thus, it is possible that the yeast proteins may prevent this event topologically by binding tightly in their preferred configurations. In this sense, HU and HMG1 are better suited to the name ``DNA chaperones'' (5, 57) in that they appear to bind DNA more dynamically and may be more easily displaced from the intermediate structure. Further work will be required to determine whether release of assembly factors normally accompanies strand exchange in the Hin inversion reaction.

DNA Binding Characteristics of NHP6A/B Compared to HU and HMG1

NHP6A/B are distinct from HU and HMG1/2 in that they bind linear DNA with much higher affinity in gel mobility shift assays. HU-DNA binding, under the conditions used, appears to be highly cooperative, such that only high molecular weight complexes are formed. HMG1 forms low levels of specific complexes but only when very large amounts (0.8-1.6 µg) of protein are added. This is in contrast to the relatively stable complexes formed between HU, HMG1, and HMG2 with modified forms of DNA, specifically cisplatinated helices and branched DNA structures (27, 28, 58) .

Low concentrations of NHP6A/B, however, yield distinct protein-DNA complexes in gel-shift experiments and bind nonspecifically to various DNA fragments with 3-fold higher affinity than HU and 50-fold higher affinity than HMG1. Determination of protein concentrations needed to shift 50% of the input DNA yield Kestimates of approximately 100 n M for NHP6A and 40 n M for NHP6B. By comparison, the Kof LEF-1 sequence-specific binding to DNA has been reported to be 1 n M (47) .

In addition, by measuring the number of complexes formed on DNA fragments of different sizes, we were able to estimate the minimal length of DNA necessary for binding of NHP6A/B. Three distinct protein-DNA complexes were formed on a 46-bp DNA fragment, plus a slower migrating smear which appears with high protein concentrations. Two distinct complexes formed on 34-bp DNA, whereas gel shifts on 26- and 21-bp DNA fragments yielded only one distinct bound complex. Therefore, NHP6A/B binding appears to require 14-15 bp, consistent with the estimate of 14 bp per HMG1 binding site determined by fluorescence quenching of HMG1 in the presence of DNA (59) , and with DNase 1 footprinting analysis of LEF-1 with its binding site which also yielded an estimate of 14 bp (47) .

DNA Bending Characteristics

Ligation of small DNA fragments into covalent circles has proven to be a useful means of comparing the DNA bending activities of HU, HMG1/2 (16) , and NHP6A/B (this study). Using this assay, all of these proteins were found to wrap DNA fragments 78 bp such that significant levels of monomer circles were formed in the presence of T4 DNA ligase. In addition, HMG1/2 and NHP6A/B also efficiently catalyze the formation of 66-bp circles, approximately one helical turn smaller than 78 bp, suggesting that the mammalian and yeast proteins distort the path of the DNA helix to a greater degree than HU.

The pattern of DNA fragment circularization for different lengths of substrate in the presence of NHP6A is very similar to the patterns seen with HMG1 and HU (16) . Significantly, the DNA substrates which did not form circles in the presence of the HMG proteins because of the requirement for a complete helical repeat also did not form circles in the presence of the yeast proteins. Thus, if NHP6A/B are underwinding or overwinding the DNA, they are either distorting the helix to exactly the same extent as HMG1/2 and HU or none of the proteins are adding any net change in twist to the DNA substrates. Fourier analysis of the periodicity of circularization with respect to DNA length yields a helical repeat of 10.6-10.7 bp per turn (16 and this work), consistent with the measured value of linear DNA in vitro (60) .

NHP6A/B are in fact more efficient than HMG1/2 in the ligation assay, yielding as much as 2-3-fold higher levels of circles on the optimal substrates in the presence of 10-fold less protein. In the presence of NHP6A/B, 50-80% of the input fragment can be converted into monomer circles on the most efficient substrates. This effect may either be due to the relatively high stability of NHP6A/BDNA complexes as compared to HMG1/2 or HU complexes, or perhaps to a DNA bending angle exerted by NHP6A/B binding which is more suited to the angle between DNA strands recognized by ligase.

In recombination, gel mobility shift, and ligation assays, we have seen no significant preference of HMG1/2 or NHP6A/B for specific DNA sequences among many different DNA fragments used. Circular permutation analysis has revealed no intrinsic bends in the 34-bp or 21-bp DNA fragments used in gel mobility shift assays.() These data do not support the idea that these proteins only recognize statically bent DNA sequences, which has been suggested because of the high affinity of HU and HMG1/2 for cruciform structures and modified DNA (27, 28) . However, binding to linear DNA may be initiated at transient distortions within the helix. NMR studies have suggested that while the average conformation of DNA in solution resembles the linear DNA seen in crystal structures, there is actually a wide range of torsion angles and transiently distorted molecules represented in the distribution (61, 62) .

Introduction of Negative Supercoils by NHP6A

With the exception of some archaebacteria, chromosomal DNA in both prokaryotes and eukaryotes is believed to be restrained by proteins into negative toroidal supercoils. In eukaryotes, this is primarily achieved by nucleosomes and in prokaryotes by ``histone-like'' or nucleoid-associated proteins. We find that NHP6A is very efficient at introducing negative supercoils into relaxed closed circular DNA in vitro in the presence of topoisomerase I. This activity, which is probably relevant to the action of these proteins in vivo, has also been noted by Kao et al. (52) for NHP6A as well as for HU, HMG1, and HMG2 (35, 36, 37, 38) . In Fig. 6, we show that NHP6A is at least 2-3-fold more efficient than HMG1 in the generation of supercoils in vitro. In addition, the expression of NHP6A in hupAhupB cells partially reverses the reduction in superhelical density created by the absence of HU.

Complementation of E. coli Mutant Phenotypes

The in vivo effects of NHP6A on chromosome structure and function was further investigated using well-characterized E. coli mutants deficient in general nucleoid-associated proteins. We found that expression of NHP6A restored virtually wild-type appearance to hupAhupB cells with respect to each of these parameters. In addition, the generation time was shifted closer to, but not identical with, the wild-type value (data not shown). From these results we conclude that the presence of NHP6A can function to modulate bacterial chromatin structure leading to more faithfully replicated and segregated chromosomes in the absence of one of the major nonspecific DNA binding proteins. The hupAhupB mutant phenotype has also been shown to be alleviated by expression of the mitochondrial HM/ABF2 protein (41) , a finding which further suggests an interchangeability between HU and HMG box proteins.

The Fis protein is another member of the family of general nucleoid-associated proteins, although it displays some specificity of binding. Cellular Fis levels are similar to HU in rapidly growing cells, and Fis has been shown to play specific roles in recombination, transcription, and replication reactions (63) . Under our culturing conditions, fis mutant cells are filamented to approximately the same degree as hupAhupB mutants but contain multiple nucleoids that are more distinct and separated along the length of the cell (data not shown).

hupAhupB fis mutants exhibit defects much more extreme than either the hupAhupB or fis mutants alone. Cells lacking Fis and HU are extremely filamented and contain multiple and highly dispersed nucleoids, and 9% do not have DNA visible by 4,6-diamidino-2-phenylindole staining. Again, NHP6A expression in these cells almost completely restores nucleoid dimensions and cell size to wild-type levels. Thus, the yeast HMG1 homologue can largely substitute for both HU and Fis with respect to chromosome maintenance. These results further suggest that Fis is performing a relatively nonspecific function in chromosome replication and segregation. This is distinct from its specialized roles in mediating enhancer function in site-specific DNA inversion, which is not substituted by NHP6A/B, and in regulating specific promoter activities. We cannot conclude from these data whether the role that Fis performs at its specific binding site in oriC to facilitate chromosome replication (42, 64) is satisfied by the presence of NHP6A.

Biological Implications

By analogy to HU it is probable that NHP6A/B have multiple roles in the yeast cell. The ability of the yeast proteins to supercoil DNA in vitro and in vivo and to compensate for the deficit in nucleoid condensation in hupAhupB cells suggests that NHP6A/B may have similar general functions in the modulation of chromosome structure in S. cerevisiae. Such a role may be most prominent at localized regions of high DNA activity such as promoters, replication origins, chiasmata, or other sites of active chromatin remodeling. NHP6A/B may also contribute to the formation of specific nucleoprotein complexes, a role suggested by their observed stimulation of invertasome assembly and excision. Our finding that proteinDNA complexes between NHP6A or -B and linear DNA are much more stable than equivalent complexes with HU or HMG proteins might mean that the NHP6 proteins are more specialized than their bacterial and mammalian counterparts. In this regard, NHP6A/B may be contributing to condensation of nucleosomal DNA in S. cerevisiae, as has been suggested for HMG-D in the developing Drosophila embryo (45) , since in both cases histone H1 is believed to be absent. We are currently in the process of identifying and characterizing the role of NHP6A/B in facilitating the assembly of various types of nucleoprotein complexes in yeast, as well as determining whether other proteins exist in this organism which augment their activities.

  
Table: Summary of cellular parameters of E. coli mutants

Mean cell lengths and nucleoid areas with standard deviations were quantitated with a digitizer. A minimum of 500 cells were analyzed for each strain.



FOOTNOTES

*
This work was supported in part by National Institutes of Health Grant GM38509. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Supported in part by a National Science Foundation fellowship.

Recipient of a faculty research award from the American Cancer Society. To whom correspondence and reprint requests should be addressed: Dept. of Biological Chemistry, UCLA School of Medicine, Los Angeles, CA 90095-1737. Tel: 310-825-7800; Fax: 310-206-5272; E-mail: ialvrcj@mvs.oac.ucla.edu.

The abbreviations used are: bp, base pair(s); IHF, integration host factor; HMG, high mobility group; NHP, non-histone protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; FPLC, fast protein liquid chromatography; IPTG, isopropyl-1-thio-- D-galactopyranoside.

L. Bird and J. Mellor, personal communication.

S. E. Finkel and R. C. Johnson, unpublished observations.


ACKNOWLEDGEMENTS

We thank Louise Bird and Jan Mellor for their advice in yeast nuclei preparation and Eric Bensen and Greg Payne for their donation of genomic DNA. We also acknowledge members of the laboratory for helpful comments on the manuscript. Amino acid composition analysis and N-terminal sequencing was performed by Audree Fowler at the UCLA protein microsequencing facility.


REFERENCES
  1. Nash, H. A. (1990) Trends Biochem. Sci. 15, 222-227 [CrossRef][Medline] [Order article via Infotrieve]
  2. Lilley, D. M. (1992) Nature 357, 282-283 [CrossRef][Medline] [Order article via Infotrieve]
  3. Crothers, D. M. (1993) Curr. Biol. 3, 675-676 [CrossRef][Medline] [Order article via Infotrieve]
  4. Grosschedl, R., Giese, K., and Pagel, J. (1994) Trends Genet. 10, 94-100 [CrossRef][Medline] [Order article via Infotrieve]
  5. Travers, A. A., Ner, S. S., and Churchill, M. E. A. (1994) Cell 77, 167-169 [CrossRef][Medline] [Order article via Infotrieve]
  6. Drlica, K., and Rouviere-Yaniv, J. (1987) Microbiol. Rev. 51, 301-319 [Free Full Text]
  7. Pettijohn, D. E. (1988) J. Biol. Chem. 263, 12793-12796 [Free Full Text]
  8. Huisman, O., Faelen, M., Girard, D., Jaffe, A., Toussaint, A., and Rouviere-Yaniv, J. (1989) J. Bacteriol. 171, 3704-3712 [Abstract/Free Full Text]
  9. Shellman, V. L., and Pettijohn, D. E. (1991) J. Bacteriol. 173, 3047-3059 [Abstract/Free Full Text]
  10. Skarstad, K., Baker, T., and Kornberg, A. (1990) EMBO J. 9, 2341-2348 [Medline] [Order article via Infotrieve]
  11. Hwang, D. S., and Kornberg, A. (1992) J. Biol. Chem. 267, 23083-23086 [Abstract/Free Full Text]
  12. Lavoie, B. D., and Chaconas, G. (1990) J. Biol. Chem. 265, 1623-1627 [Abstract/Free Full Text]
  13. Baker, T. A., and Mizuuchi, K. (1992) Genes & Dev. 6, 2221-2232
  14. Haykinson, M. J., and Johnson, R. C. (1993) EMBO J. 12, 2503-2512 [Medline] [Order article via Infotrieve]
  15. Hodges-Garcia, Y., Hagerman, P. J., and Pettijohn, D. E. (1989) J. Biol. Chem. 264, 14621-14623 [Abstract/Free Full Text]
  16. Paull, T. T., Haykinson, M. J., and Johnson, R. C. (1993) Genes & Dev. 7, 1521-1534
  17. Lavoie, B. D., and Chaconas, G. (1993) Genes & Dev. 7, 2510-2519
  18. Goodman, S. D., Nicholson, S. C., and Nash, H. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11910-11914 [Abstract/Free Full Text]
  19. Segall, A. M., Goodman, S. D., and Nash, H. A. (1994) EMBO J. 13, 4536-4548 [Medline] [Order article via Infotrieve]
  20. Goodman, S. D., and Nash, H. A. (1989) Nature 341, 251-254 [CrossRef][Medline] [Order article via Infotrieve]
  21. Landsman, D., and Bustin, M. (1993) Bioessays 15, 539-545 [CrossRef][Medline] [Order article via Infotrieve]
  22. Lavoie, B. D., and Chaconas, G. (1994) J. Biol. Chem. 269, 15571-15576 [Abstract/Free Full Text]
  23. Tremethick, D. J., and Molloy, P. L. (1986) J. Biol. Chem. 261, 6986-6992 [Abstract/Free Full Text]
  24. Tremethick, D. J., and Molloy, P. L. (1988) Nucleic Acids Res. 16, 11107-11123 [Abstract/Free Full Text]
  25. Singh, J., and Dixon, G. H. (1990) Biochemistry 29, 6295-6302 [CrossRef][Medline] [Order article via Infotrieve]
  26. Landsman, D., and Bustin, M. (1991) Mol. Cell. Biol. 11, 4483-4489 [Abstract/Free Full Text]
  27. Bianchi, M. E., Beltrame, M., and Paonessa, G. (1989) Science 243, 1056-1058 [Abstract/Free Full Text]
  28. Pil, P. M., and Lippard, S. J. (1992) Science 256, 234-237 [Abstract/Free Full Text]
  29. Kohlstaedt, L. A., and Cole, R. D. (1994) Biochemistry 33, 570-575 [CrossRef][Medline] [Order article via Infotrieve]
  30. Kolodrubetz, D., Haggren, W., and Burgum, A. (1988) FEBS Lett. 238,175-179 [CrossRef][Medline] [Order article via Infotrieve]
  31. Johnson, R. C. (1991) Curr. Opin. Genet. & Dev. 1, 404-411 [CrossRef][Medline] [Order article via Infotrieve]
  32. Kolodrubetz, D., and Burgum, A. (1990) J. Biol. Chem. 265, 3234-3239 [Abstract/Free Full Text]
  33. Bonnefoy, E., and Rouviere-Yaniv, J. (1991) EMBO J. 10, 687-696 [Medline] [Order article via Infotrieve]
  34. Pil, P. M., Chow, C. S., and Lippard, S. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9465-9469 [Abstract/Free Full Text]
  35. Javaherian, K., Liu, L. F., and Wang, J. C. (1978) Science 199, 1345-1346 [Abstract/Free Full Text]
  36. Rouviere-Yaniv, J., Yaniv, M., and Germond, J. E. (1979) Cell 17, 265-274 [CrossRef][Medline] [Order article via Infotrieve]
  37. Broyles, S. S., and Pettijohn, D. E. (1986) J. Mol. Biol. 187, 47-60 [CrossRef][Medline] [Order article via Infotrieve]
  38. Stros, M., Stokrova, J., and Thomas, J. O. (1994) Nucleic Acids Res. 22, 1044-1051 [Abstract/Free Full Text]
  39. Hillyard, D. R., Edlund, M., Hughes, K. T., Marsh, M., and Higgins, N. P. (1990) J. Bacteriol. 172, 5402-5407 [Abstract/Free Full Text]
  40. Dri, A-M., Rouviere-Yaniv, J., and Moreau, P. L. (1991) J. Bacteriol. 173, 2852-2863 [Abstract/Free Full Text]
  41. Megraw, T. L., and Chae, C.-B. (1993) J. Biol. Chem. 268, 12758-12763 [Abstract/Free Full Text]
  42. Filutowicz, M., Ross, W., Wild, J., and Gourse, R. L. (1992) J. Bacteriol. 174, 398-407 [Abstract/Free Full Text]
  43. Wagner, C. R., Hamana, K., and Elgin, S. C. R. (1992) Mol. Cell. Biol. 12, 1915-1923 [Abstract/Free Full Text]
  44. Ner, S. S., Churchill, M. E. A., Searles, M. A., and Travers, A. A. (1993) Nucleic Acids Res. 21, 4369-4371 [Abstract/Free Full Text]
  45. Ner, S. S., and Travers, A. A. (1994) EMBO J. 13, 1817-1822 [Medline] [Order article via Infotrieve]
  46. Wisniewski, J. R., and Schulze, E. (1994) J. Biol. Chem. 269, 10713-10719 [Abstract/Free Full Text]
  47. Giese, K., Amsterdam, A., and Grosschedl, R. (1991) Genes & Dev. 5, 2567-2578
  48. Parisi, M. A., and Clayton, D. A. (1991) Science 252, 965-969 [Abstract/Free Full Text]
  49. Harley, V. R., Jackson, D. I., Hextall, P. J., Hawkins, J. R., Berkovitz, G. D., Sockanathan, S., Lovell-Badge, R., and Goodfellow, P. N. (1992) Science 255, 453-456 [Abstract/Free Full Text]
  50. Weir, H. M., Kraulis, P. J., Hill, C. S., Raine, A. R. C., Laue, E. D., and Thomas, J. O. (1993) EMBO J. 12, 1311-1319 [Medline] [Order article via Infotrieve]
  51. Read, C. M., Cary, P. D., Crane-Robinson, C., Driscoll, P. C., and Norman, D. G. (1993) Nucleic Acids Res. 21, 3427-3436 [Abstract/Free Full Text]
  52. Kao, L.-R., Megraw, T. L., and Chae, C.-B. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5598-5602 [Abstract/Free Full Text]
  53. Kruger, W., and Herskowitz, I. (1991) Mol. Cell. Biol. 11, 4135-4146 [Abstract/Free Full Text]
  54. Caron, F., Jacq, C., and Rouviere-Yaniv, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4265-4269 [Abstract/Free Full Text]
  55. Diffley, J. F. X., and Stillman, B. (1992) J. Biol. Chem. 267, 3368-3374 [Abstract/Free Full Text]
  56. Costigan, C., Kolodrubetz, D., and Snyder, M. (1994) Mol. Cell. Biol. 14, 2391-2403 [Abstract/Free Full Text]
  57. Ner, S. S., Travers, A. A., and Churchill, M. E. A. (1994) Trends Biochem. Sci. 19, 185-187 [CrossRef][Medline] [Order article via Infotrieve]
  58. Pontiggia, A., Negri, A., Beltrame, M., and Bianchi, M. E. (1993) Mol. Microbiol. 7, 343-350 [CrossRef][Medline] [Order article via Infotrieve]
  59. Butler, A. P., Mardian, J. K. W., and Olins, D. E. (1985) J. Biol. Chem. 260, 10613-10620 [Abstract/Free Full Text]
  60. Bellomy, G. R., and Record, M. T., Jr. (1990) Prog. Nucleic Acid Res. Mol. Biol. 39, 81-127 [Medline] [Order article via Infotrieve]
  61. Metzler, W. J., Wang, C., Kitchen, D. B., Levy, R. M., and Pardi, A. (1990) J. Mol. Biol. 214, 711-736 [CrossRef][Medline] [Order article via Infotrieve]
  62. Schmitz, U., Ulyanov, N. B., Kumar, A., and James, T. L. (1993) J. Mol. Biol. 234, 373-389 [CrossRef][Medline] [Order article via Infotrieve]
  63. Finkel, S. E., and Johnson, R. C. (1992) Mol. Microbiol. 6, 3257-3265 [Medline] [Order article via Infotrieve]
  64. Gille, H., Egan, J. B., Roth, A., and Messer, W. (1991) Nucleic Acids Res. 19, 4167-4172 [Abstract/Free Full Text]
  65. Ball, C. A., Osuna, R., Ferguson, K. C., and Johnson, R. C. (1992) J. Bacteriol. 174, 8043-8056 [Abstract/Free Full Text]
  66. Ball, C. A., and Johnson, R. C. (1991) J. Bacteriol. 173, 4027-4031 [Abstract/Free Full Text]
  67. May, R. (1971) Z. Allg. Mikrobiol. 11, 131-142 [Medline] [Order article via Infotrieve]
  68. Almer, A., and Horz, W. (1986) EMBO J. 5, 2681-2687 [Medline] [Order article via Infotrieve]
  69. Johnson, R. C., and Simon, M. I. (1985) Cell 41, 781-791 [CrossRef][Medline] [Order article via Infotrieve]
  70. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
  71. Hiraga, S., Niki, H., Ogura, T., Ichinose, C., Mori, H., Ezaki, B., and Jaffe, A. (1989) J. Bacteriol. 171, 1496-1505 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
N. A. Becker, J. D. Kahn, and L. J. Maher III
Eukaryotic HMGB proteins as replacements for HU in E. coli repression loop formation
Nucleic Acids Res., July 1, 2008; 36(12): 4009 - 4021.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. A. Kaufman, N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter, and E. A. Shoubridge
The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures
Mol. Biol. Cell, September 1, 2007; 18(9): 3225 - 3236.
[Abstract] [Full Text] [PDF]