|
Volume 270,
Number 15,
Issue of April 14, pp. 8763-8771, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Myb
and Ets Proteins Cooperate to Transactivate an Early Myeloid Gene (*)
Linda H.
Shapiro (§)
From the
(1)
Department of Experimental Oncology, St. Jude
Children's Research Hospital, Memphis, Tennessee 38101
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The earliest progenitor cell committed to the
granulocyte/monocyte developmental pathway can be identified by the
appearance of a 150-kDa glycoprotein on the cell surface
(CD13/aminopeptidase N (CD13/APN), EC 3.4.11.2). A 455-base pair
genomic fragment from the CD13/APN gene containing a Myb
consensus-binding site as well as three potential Ets-binding sites was
found to regulate tissue-appropriate expression of reporter genes in
hematopoietic cell lines. Transactivation experiments with plasmids
expressing either a full-length or truncated Myb protein and the
full-length Ets-1 or Ets-2 protein demonstrated that these proteins
cooperate to positively regulate CD13/APN gene expression.
This cooperation is synergistic, as levels of transcriptional activity
produced by Myb and Ets in combination were higher than those expected
from a purely additive effect. Mutation of the Myb consensus-binding
site completely abolished CD13/APN promoter activity in
myeloid cells. Introduction of a dominant interfering Myb allele
disrupted the ability of endogenous c-Myb in myeloid cells to
transactivate the CD13/APN construct. Other myeloid cell-expressed Ets
family members (PU.1, Fli-1, and Elf-1) failed to produce a cooperative
transactivating effect when combined with the Myb expression construct.
These data contrast with previous studies indicating that full-length
c-Myb is unable to positively cooperate with Ets proteins in the
regulation of myeloid genes. Because intact c-Myb and Ets-2 proteins,
both endogenously expressed in myeloid cells, act synergistically to
transactivate the CD13/APN promoter, this gene may represent a
physiological target for dissection of the roles of these transcription
factors in normal and malignant myelopoiesis.
INTRODUCTION
The metallopeptidase CD13/aminopeptidase N
(CD13/APN ; ( )EC 3.4.11.2) can be detected on the
earliest progenitor cell committed to the granulocyte/monocyte
developmental pathway as well as its more differentiated progeny, but
is not found on normal hematopoietic cells of other lineages or their
progenitors
(1, 2, 3) . The early and precise
lineage-specific expression of this surface antigen suggests that
control of the CD13/APN gene would be a useful model of gene
regulation in myelopoiesis, particularly in efforts to understand the
signals that drive multipotent progenitor cells toward lineage-specific
differentiation. Studies of mammalian developmental systems have begun
to establish a hierarchy of critical differentiation signals and cues
(4, 5, 6, 7, 8) . A recurring
theme of this research is that transcription factors can cooperate in
stage-specific regulation of genes essential to cell differentiation;
hence, by studying the expression of such proteins during defined
stages of development, one can begin to understand the complex genetic
programs that underlie normal and aberrant myelopoiesis.
One
candidate for scrutiny as an essential hematopoietic transcription
factor is the protein encoded by the c- myb proto-oncogene.
Studies of the few cellular gene targets known to be regulated by Myb
have indicated that it frequently acts in cooperation with other
transcription factors early in hematopoiesis. Examples include its
interaction with the CAAT enhancer binding protein to transactivate the
mim-1 and cMGF genes
(9, 10) and with
the polyomavirus enhancer binding factor 2 core binding factor
complex to transactivate the T-cell receptor ( TCR )
gene
(11) . Moreover, c-Myb expression is down-regulated after
maturation of hematopoietic cells
(12, 13, 14) ,
and its overexpression inhibits cell differentiation
(15, 16, 17, 18) . Mice carrying a
homozygous mutation in the c- myb locus die at a late
gestational age and display a multilineage defect in the generation of
hematopoietic progenitors, indicating a fundamental role for Myb in
hematopoietic cell development
(19) . Truncated c- myb
genes (due to viral insertion) have been found in murine tumors of
myeloid origin, and oncogenic v- myb of transforming avian
myeloblastosis virus and avian acute leukemia virus E26 truncates c-Myb
at both its amino and carboxyl termini
(20, 21, 22) . These alterations are thought to
be a common route to activation of Myb's latent transforming
properties
(23, 24, 25, 26) .
The Ets
family of transcription factors, which share a highly conserved
DNA-binding region
(27, 28, 29) , represents
another group of proteins that potentially regulates myeloid-specific
gene expression. The individual Ets proteins bind to similar but often
distinct purine-rich DNA sequences (GGAW) in the promoter regions of
specific target genes
(28) and often interact with other
proteins to form transcriptionally active complexes. For example, the
proteins encoded by the v- ets and v- myb oncogenes
have been shown to functionally synergize in the transformation of
cells by the E26 virus
(30, 31) .
CD13/APN transcription is initiated from two physically distinct sites in
myeloid and intestinal epithelial cells and is directed by separate
functional promoters
(32) . Here the nucleotide sequences
responsible for CD13/APN reporter gene expression in myeloid
cells are identified. Because this regulatory region contains both Myb
and Ets consensus-binding sites, the possibility that these two
important transcription factors control myeloid cell-specific
CD13/APN expression was examined. The results presented show
that a truncated or full-length form of c-Myb and the full-length Ets-1
or Ets-2 protein cooperate to transactivate the CD13/APN promoter and that the Myb consensus-binding site is essential for
transcription of this differentiation-linked gene in hematopoietic
cells.
EXPERIMENTAL PROCEDURES
Human cell lines included the
lymphoid leukemia lines MOLT-4 (ATCC CRL1582) and Jurkat (ATCC TIB152),
the myeloid leukemia lines U937 (ATCC CRL1593) and KG1a (ATCC
CCL246.1), the epithelial cell line C33A (ATCC HTB31), and the
fibroblast line VA-2
(33) . COS-7 cells (ATCC CRL1651) were used
to transiently express c-Myb proteins for the DNA binding assays.
Nonadherent cell lines were grown in RPMI 1640 medium, and adherent
lines were maintained in Dulbecco's modified Eagle's medium
containing 2 m
M
L-glutamine and 10% fetal calf serum.
A 1158-bp
XbaI/ HaeII CD13/APN genomic restriction
fragment ending within exon 1 was ligated into the XbaI site
of the promoterless and enhancerless luciferase reporter plasmid
(pGL2basic; Promega) to produce the p-1150luc construct. This
construct contains sequences from bp -1158 to +65 of the
CD13/APN myeloid promoter
(32) . 5`-Deletion mutants
constructed in the pGL2basic backbone were designated as -411luc,
-291luc, -120luc, and -40luc reporter plasmids. The
Myb consensus site in the -411luc reporter construct was changed
from TAACGGAC to TCTTGGAC using the Transformer kit
(CLONTECH) to produce the mybmutluc plasmid. Plasmids were also
constructed that linked genomic sequences to the neo gene. A 2.34-kb HindIII cassette containing
neo (34) was ligated into the
HindIII site of pBluescript SK , and
CD13/APN genomic sequences (1158-bp
XbaI/ HaeII genomic fragment) were inserted into the
XbaI site of the vector (pPFMyneo).
To facilitate analysis of deletion constructs, the KG1a
and Jurkat cell lines were electroporated with 10 µg of the
wild-type or deletion constructs and 4 µg of the control MAP1-SEAP
(where SEAP represents secreted alkaline phosphatase) plasmid
(35) as described
(36) . C33A epithelial cells were
transfected with 1 µg of the wild-type or deletion constructs and
0.5 µg of the control plasmid by the calcium phosphate method
(32) . The transfection efficiency with each construct was
normalized to the control level of secreted alkaline phosphatase
activity
(37) ; the reported values were calculated as relative
light units/unit of secreted alkaline phosphatase activity. To compare
results among the different cell lines, transcriptional activity was
expressed as the -fold increase over that produced with the
enhancerless luciferase vector, pGL2basic, determined in parallel
transfections. Each experiment was repeated at least three times. For
S1 analysis, the pPFMyneo and p-411neo plasmids were
cotransfected with the pRSVneo plasmid into U937 and MOLT-4 cell lines
as described
(36) and selected in medium containing 800
µg/ml G418 (Geneticin; Life Technologies, Inc.); G418-resistant
transfectants were pooled; and RNA was extracted
(32) . For
transactivation assays, C33A epithelial cells were transfected by the
calcium phosphate method
(32) with 0.5 µg of the MAP1-SEAP
control plasmid, and the indicated amounts of reporter and expression
plasmids (see Fig. 3 C): pCt, encoding the truncated Myb
protein, provided by Dr. E. Premkumar Reddy
(38) ; pCMV4cMyb,
encoding the full-length murine c-Myb protein, provided by Dr. C.
Hernandez-Munain; pEBets-1 and pEBets-2, provided by Dr. J. Ghysdael
(Orsay, France); and the pSCDMSMEnT dominant interfering Myb construct,
provided by Dr. Kathleen Weston
(39) . For transient expression
of the Myb protein, COS-7 cells were transfected with the pCMV4cMyb
plasmid by the DEAE-dextran method as described
(40) .
Figure 3:
Functionally defined myeloid regulatory
region of the CD13/APN promoter. A, nucleotide
sequences between bp -411 and -291 that define the myeloid
regulatory region of this gene. The putative Myb-binding site is
boxed, and possible Ets-binding sites are underlined.
B, comparison of the CD13/APN Myb consensus site with
functionally characterized Myb-binding sites found in the regulatory
regions of other genes. C, schematic diagram of expression
constructs used in the transfection analyses. Each of the upper three constructs contains Myb sequences:
full-length murine c-Myb (pCMV4cMyb), truncated murine Myb (pCt), and
the dominant interfering allele (pSCDMSMEnT). The lower two constructs are Ets-1 and Ets-2 expression
constructs. Promoter regions are indicated by dotted; other
key domains are labeled. CMV,
cytomegalovirus.
Assays
to detect luciferase activity were performed as described
(41) .
100-µl aliquots of total cellular protein from lysates representing
each transfection condition were tested for luciferase activity, and
the resulting values were normalized according to secreted alkaline
phosphatase activity assayed as described
(37) .
S1 mapping was
performed with end-labeled DNA probes as described
(32) . The
pPFMyneo plasmid was digested with BglII, which cuts within
the neo gene, dephosphorylated, and end-labeled
with T4 polynucleotide kinase and [ - P]ATP.
Total cellular RNAs (20 µg) were hybridized with the end-labeled
DNA fragments (50,000 dpm) for 16 h at 52 °C. The samples were
digested with S1 nuclease and analyzed by autoradiography after
electrophoresis on 8% denaturing polyacrylamide gels.
For DNA binding assays,
transiently transfected COS-7 whole cell lysates were freshly prepared
by scraping the cells into cold phosphate-buffered saline and
resuspending the pellet in 0.2 ml of lysis buffer (20 m
M Tris-HCl, pH 7.5, 2 m
M dithiothreitol, 20% glycerol, and
50 m
M KCl). After the addition of Triton X-100 to a 0.2% (v/v)
final concentration, the lysate was incubated on ice for 15 min, and
the debris was pelleted for 5 min at 12,500 rpm. Cell lysate (8 µl,
15-20 µg) from either mock- or pCMV4cMyb-transfected
COS-7 cells or 100 ng of GST-Ets-DBD protein (where GST represents
glutathione S-transferase and Ets-DBD represents the Ets
DNA-binding domain) was preincubated in binding buffer (10 m
M Hepes, pH 7.9, 50 m
M KCl, 5 m
M MgCl ,
10% glycerol, 1 m
M dithiothreitol, and 1 µg of
poly[d(I-C)]) in 25-µl reactions with or without 100 ng
of the consensus or mutant double-stranded oligonucleotide competitors
(mimAmyb, CTAGGACATTATAACGGTTTTTTAGT
(39) ; ets1con,
AATTCACCGGAAGTATTCGA
(42) ; mybmut, CCGGATCCTCTTGGACCGGC;
and ets1mut, AATTCACCTTAAGTATTCGA) for 10 min at 30 °C
before the addition of probe. For supershift experiments, 1 µl of a
murine anti-Myb monoclonal antibody (Type 1; Upstate Biotechnology,
Inc., Lake Placid, NY) or an isotype-matched irrelevant control
monoclonal antibody was preincubated with lysate for 10 min at 30
°C before probe addition. The P-end-labeled
oligonucleotide probe containing the CD13/APN Myb consensus
site (CD13Myb, CCGGATCCTAACGGACCGGC) or the genomic fragment probe
( XbaI/ DdeI fragment, containing bp -411 to
-281) was then added and incubated for an additional 15 min at 30
°C. Binding reactions were electrophoresed through a 5% acrylamide
gel in Tris borate buffer at 4 °C. Gels were dried and exposed to
x-ray film.
Recombinant
glutathione S-transferase fusion protein containing the
bacterially expressed Ets DNA-binding domain (GST-Ets-DBD) was purified
from bacterial cell lysates by a standard glutathione-bead method. The
GST-Ets-DBD plasmid was the gift of Dr. Michael Ostrowski (Duke
University).
RESULTS
A 1-kb genomic fragment of the CD13/APN gene, which includes sequences immediately upstream of the myeloid
and fibroblast transcription initiation sites, can direct correctly
initiated reporter gene expression
(32) . To confirm that this
region includes myeloid-specific regulatory elements, the pPFMyneo and
control pRSVneo plasmids were cotransfected into a panel of cell lines
known to use either the upstream (U937 and VA-2) or the downstream
(HepG2) CD13/APN promoter or to lack CD13/APN transcripts altogether (MOLT-4). S1 nuclease analysis of the RNAs
produced by the resulting neomycin-resistant stable lines showed
substantial levels of correctly initiated transcripts in the U937
myeloid transfectant, which expresses endogenous CD13/APN at high
levels, with much lower levels detected in the MOLT-4 lymphoid, HepG2
liver, and VA-2 fibroblast transfectants (Fig. 1 A).
Deletional analysis of the promoter fragment showed that constructs
containing 411 bp of upstream sequences were sufficient for correctly
initiated, tissue-appropriate transcription of the neo reporter gene (Fig. 1 B). These results indicate
that a 411-bp region within the original 1-kb fragment contains the
elements responsible for myeloid-specific CD13/APN gene
expression. The absence of transcripts in fibroblasts
(Fig. 1 A) that normally initiate CD13/APN transcription from the same upstream promoter used by myeloid
cells suggests that some of the elements responsible for
fibroblast-specific transcription of the CD13/APN gene do not
reside within this fragment. A Positive Regulator of CD13/APN Activity Is Located in the Region
between bp -291 and -411-To further localize the
myeloid-specific region of CD13/APN regulation, 5`-deletion
mutants of the myeloid cell promoter were inserted upstream of the
luciferase reporter gene. The results of transient transfection of the
reporter constructs into the KG1a myeloblastic cell line, the C33A
epithelial cell line, and the Jurkat T-ALL cell line (Fig. 2) confirmed
the myeloid specificity of the 1-kb fragment used in the preceding
experiment: the p-1150luc construct was expressed at 6-fold
higher levels in the myeloid cell line than in either the T-cell or
epithelial cell line. More important, the -411luc construct
retained myeloid specificity, while removal of sequences upstream of bp
-291 resulted in comparably lower levels of activity in each of
the three cell lines, indicating that a positive regulatory element
resides between bp -291 and -411.
Figure 1:
A
genomic fragment containing 411 bp of the upstream promoter region
directs correctly initiated, tissue-appropriate transcripts.
A, a genomic fragment containing 1 kb of sequences immediately
upstream of the CD13/APN myeloid transcription start site was
cloned upstream of the neomycin resistance reporter gene. The plasmid
construct (pPFMyneo) was cotransfected with the control plasmid pRSVneo
into a panel of cell lines that used the upstream CD13/APN promoter (U937 myeloid and VA-2 fibroblast cell lines) or the
downstream promoter (HepG2 liver line) or lacked CD13/APN expression (MOLT-4 lymphoid cell line). RNA from the resulting
stable lines was assayed by S1 nuclease mapping. Protected bands are
indicated by an arrowhead (pPFMyneo initiation sites) or a
plus sign (point at which pRSVneo diverges from the
probe, indicating control transcript levels). B, a 5`-deletion
of the genomic fragment included in pPFMyneo was cotransfected with the
control plasmid pRSVneo into the U937 myeloid (upstream CD13/APN promoter) or MOLT-4 lymphoid (no CD13/APN expression)
cell line. Protected bands are indicated as described for A.
C, shown is a diagram of the structure of the cotransfected
plasmids and probes used and the resulting products from each plasmid.
CD13/APN sequences are shown as hatched boxes, and neomycin gene sequences are dotted.
RSV-LTR, Rous sarcoma virus long terminal
repeat.
The sequence extending from bp -291 to -411
contains a c-Myb consensus DNA-binding site (YAACKG) between
nucleotides -375 and -381 and three Ets consensus-binding
sites (GGAW) (Fig. 3 A). As a preliminary step to the
functional assessment of these sites, the ability of Myb and Ets
proteins to physically bind to the consensus sites in vitro was evaluated by electrophoretic mobility shift assay. Whole cell
lysates from COS-7 cells transfected with vector alone or the pCMV4cMyb
expression plasmid were incubated with an end-labeled oligonucleotide
probe containing the putative CD13/APN Myb-binding site (Fig.
4 A). Unlabeled oligonucleotides containing self-competitor
(CD13Myb), the mimA Myb site from the mim-1 promoter (mimAmyb)
(Fig. 3 B), or a mutant Myb site (mybmut) were added to
the assays in 100-fold molar excess. The indicated protein-DNA complex
was not present in the mock-transfected lysate (Fig. 4 A,
lane 1) and was specifically competed by unlabeled
oligonucleotide probe ( lane 3) as well as by the
mimAmyb oligonucleotide ( lane 4), but not by the
oligonucleotide containing a mutant Myb site ( lane 5). To further characterize this specific protein-DNA
complex, monoclonal antibodies directed against the C-terminal region
of the murine c-Myb protein were added to the electrophoretic mobility
shift assay binding reaction. A supershift of the specific complex was
apparent with the use of the anti-Myb antibodies ( lane 7), but not with isotype-matched inappropriate control
antibody ( lane 6), confirming the physical
interaction of Myb with the CD13/APN promoter.
Figure 4:
Myb and Ets proteins directly bind to
CD13/APN promoter sequences in vitro. A,
whole cell lysates from COS-7 cells transfected with vector alone
(CMV-cos; lane 1) or c-Myb expression plasmids
(pCMV4cMyb-cos; lanes 2-7) were incubated with an
end-labeled oligonucleotide probe containing the putative CD13/APN Myb-binding site (see Fig. 3 B). Oligonucleotides
containing unlabeled self-competitor (CD13myb; lane 3), the mimA Myb site from the mim-1 promoter
(mimAmyb; lane 4), or a mutant Myb site (mybmut;
lane 5) were added to the assays in a 100-fold molar
excess. Antibodies ( Ab) directed against the Myb protein
( lane 7) or an isotype-matched control antibody
( lane 6) were added in equal amounts to binding
reactions. The arrowhead denotes the specific protein complex
competed by self- and mimAmyb oligonucleotides, but not mutant
oligonucleotides. The asterisk marks the Myb-specific
supershifted complex. B, a bacterially expressed GST-Ets-DBD
fusion protein was incubated with an end-labeled 130-bp promoter
fragment probe containing the functionally defined myeloid-specific
regulatory sequences ( lanes 1-3). The Ets-1 consensus
oligonucleotide (ets1con; lane 2) or an oligonucleotide
containing a mutant Ets-1 site (ets1mut; lane 3) was
added to binding reactions in a 100-fold excess in the indicated lanes.
Arrowheads denote specific protein complexes competed by the
self-competitor oligonucleotide, but not mutant competitor
oligonucleotides.
Analogous
experiments tested the physical association of the conserved Ets
DNA-binding domain with the CD13/APN promoter. A bacterially
expressed Ets-1 DNA-binding domain protein (GST-Ets-DBD) was incubated
with an end-labeled 130-bp promoter fragment probe containing the
functionally defined myeloid-specific CD13/APN regulatory
sequences (Fig. 4 B). Binding of GST-Ets-DBD to the
promoter fragment was inhibited with a 100-fold excess of an Ets-1
consensus oligonucleotide (ets1con), but not with a 100-fold excess of
an oligonucleotide containing a mutant Ets-1 site (ets1mut). Thus,
members of the Myb and Ets transcriptional protein families bind
specifically to the CD13/APN promoter.
Because Myb and Ets family proteins bind to
the functionally relevant region of the CD13/APN promoter, and
v-Myb and Ets-2 have been shown to cooperate in the regulation of the
chicken promyelocyte-specific gene mim-1 (38) , Myb-Ets
cooperation might also be a factor in myeloid-specific regulation of
the CD13/APN gene. Indeed, in experiments with the C33A human
epithelial cell line, either the truncated form of the Myb protein (pCt
plasmid) or the full-length Ets-1 protein (pEBets-1 plasmid)
transactivated the CD13/APN minimal promoter in a
dose-dependent manner. Use of a truncated form of the Myb protein was
prompted by other reports that this form is a more potent activator of
transcription
(38) and hence would be expected to amplify any
positive results. The initial availability of Ets-1 expression
constructs led to its use in the majority of the experiments in this
study.
Evidence for a synergistic cooperative effect by the two
proteins was obtained when the pCt and pEBets-1 plasmids were
cotransfected with the -411luc reporter plasmid. Reporter gene
mRNA levels seen with the plasmid combination at 0.5 µg of pEBets-1
and 1.0 µg of pCt were approximately twice the sum of results
obtained with the separate proteins (Fig. 5). The transactivation
capacity of the Myb-Ets combination was specific for the CD13/APN promoter, as indicated by the lack of transcriptional
up-regulation with four independent promoters (data not shown).
Figure 5:
Myb and Ets proteins cooperate to
transactivate the CD13/APN promoter. The C33A human epithelial
cell line was cotransfected with 1 µg of the -411luc reporter
construct and increasing amounts (0.01-3.0 µg) of pCt only
( Myb), pEBets-1 only ( Ets-1), or pCt plus a constant
0.5 µg of pEBets-1 ( Myb + .5µg Ets-1). The
average promoter activities were generated from duplicate conditions in
a representative experiment, and the standard deviation of the mean is
indicated by the error bars. All values were
normalized to those obtained with a cotransfected control plasmid
(MAP1-SEAP) for both transfection efficiency and as a control for the
Myb-Ets effect on other promoters. Results are expressed as -fold
activation relative to values obtained by cotransfecting cells with
equal amounts of the empty expression
vectors.
If the protein
generated from the Myb expression vector transactivates CD13/APN by binding to the Myb consensus site in the promoter, mutation of
this site should have a profound effect on reporter gene levels.
Surprisingly, alteration of this site from TAACGG to TCTCGG in the
context of the wild-type promoter did not affect its transactivation by
the Myb expression plasmid alone in C33A epithelial cells (Fig. 6).
Moreover, comparable levels of reporter gene activity were produced by
the wild-type, -291luc, and mybmutluc plasmids when Myb and Ets
were added separately. Cotransfection of Myb and Ets-1 with the
-291luc and mybmutluc plasmids yielded reporter gene activity
that was essentially additive, in contrast to the clearly synergistic
effect seen with the -411luc (wild-type) plasmid. Hence, mutation
of the putative Myb consensus-binding site abolishes the Myb-Ets
synergism seen with the intact promoter, despite the presence of other
Myb-binding sites in the luciferase reporter plasmid. This suggests
that Myb-Ets synergy depends upon features unique to the Myb
consensus-binding site in the CD13/APN promoter.
To confirm
the importance of the Myb consensus sequence in CD13/APN transcription in a more relevant context, the mybmutluc construct
was tested in both the CD13-positive myeloblastic (KG1a) and
myelomonocytic leukemia (U937) cell lines as well as in the
CD13-negative mature T-ALL (Jurkat) and epithelial (C33A) cell lines in
comparison with the wild-type -411luc construct in each cell
type. As shown in Fig. 7, mutation of the Myb-binding site
reduced transcription from the CD13/APN promoter fragment to
4% of that produced by the wild-type construct in KG1a cells.
Similarly, the mutant construct reduced CD13/APN transcriptional activity in the U937 and Jurkat cell lines to 10
and 15% of the wild-type levels, respectively. By contrast, the
mutation did not affect the ability of the promoter construct to drive
luciferase expression in epithelial cells. Thus, mutation of the Myb
site in the context of a normal CD13/APN promoter fragment
abolishes reporter gene transcription in both myeloid cells and
T-cells. These data substantiate the essential requirement for Myb in
CD13/APN expression in hematopoietic cells.
Figure 7:
The CD13/APN Myb-binding site is
functionally important in hematopoietic but not epithelial cells. The
mybmutluc construct was transfected into the KG1a myeloblastic, U937
myelomonocytic, Jurkat T lymphoblastic, or C33A epithelial cell line,
and its luciferase activity was compared with values obtained under
parallel conditions in which each cell type was transfected with the
wild-type -411luc construct (100%). The average promoter
activities were generated from at least three separate experiments for
each cell type, and the standard deviation of the mean is indicated by
the error bars. All values were normalized to those
obtained with the secreted alkaline phosphatase control to enable
comparison among cell types with different transfection
efficiencies.
A dominant
interfering allele (pSCDMSMEnT) consisting of the Myb DNA-binding
domain fused to the repressor domain of the Drosophila engrailed ( En) transcription factor gene
(43, 44) very efficiently represses the transactivation
of reporter constructs containing multimerized Myb sites from the
mim-1 promoter
(39) . If the Myb protein does in fact
regulate the CD13/APN promoter through binding at the Myb
consensus site, the addition of the pSCDMSMEnT construct should
interfere with transactivation by Myb and Ets and should attenuate
transcription from the CD13/APN promoter construct. As
predicted, the addition of increasing amounts of the dominant
interfering plasmid led to incremental inhibition of transcriptional
activity from the -411luc construct with previously determined
optimal doses of Myb and Ets expression plasmids (Fig. 8 A).
Similarly, cotransfection of the pSCDMSMEnT expression vector with
CD13-411luc constructs into KG1a myeloblastic cells interfered
with the endogenous c-Myb protein and abrogated the luciferase activity
driven by the CD13/APN promoter (Fig. 8 B).
Because the Myb dominant-negative mutant binds to the Myb consensus
site and regulates transcription through its engrailed negative regulatory domain, these data strongly indicate that a
transregulatory protein binds to the CD13/APN promoter at its
Myb consensus site and positively regulates its transcription.
Figure 8:
Myb dominant interfering alleles negate
the ability of exogenously added Myb to transactivate the CD13/APN promoter in C33A epithelial cells and abrogate the ability of
endogenous Myb to activate transcription from CD13/APN promoter constructs in myeloid cells. A, increasing
amounts of the dominant interfering allele construct pSCDMSMEnT (see
Fig. 3 C) were cotransfected with the wild-type -411luc
construct and optimal doses of the Myb (pCt; 1 µg) and Ets-1
(pEBets-1; 0.5 µg) expression constructs into C33A human epithelial
cells, and the luciferase activity was assayed at 24 h. All values are
expressed as mean reporter gene activity in relative light units
( RLU)/unit of secreted alkaline phosphatase ( SEAP)
activity under duplicate conditions of a representative experiment. The
standard deviation of the mean is indicated by the error bars. B, increasing amounts of the pSCDMSMEnT
dominant interfering allele expression vector were cotransfected with
the wild-type -411luc construct into KG1a myeloblastic cells, and
the luciferase activity was assayed at 24 h. All values are expressed
as mean reporter gene activity in relative light units/unit of secreted
alkaline phosphatase activity under duplicate conditions of a
representative experiment. The standard deviation of the mean is
indicated by the error bars.
In the original description
of Myb-Ets cooperation in transcriptional activation of the mim-1 promoter, full-length c- myb gene products were not able
to activate transcription, while a truncated form of the Myb protein
proved to be a potent transactivator
(38) . To determine if
restoration of the carboxyl terminus of c-Myb would affect
transactivation of the CD13/APN promoter, the C33A human
epithelial cell line was cotransfected with 1 µg of the
-411luc reporter construct together with either the full-length
c-Myb (pCMV4cMyb) or truncated Myb (pCt) expression construct and an
Ets-1 (pEBets-1) expression plasmid (Fig. 9 A). In contrast to
results with the mim-1 promoter, the full-length c-Myb protein
competently transactivated the CD13/APN reporter construct.
Experiments with the mim-1 promoter had also suggested that
only the more widely distributed Ets-2 protein, and not the Ets-1
protein, was capable of transactivating mim-1 gene expression.
Since the Ets-2 protein is normally expressed in myeloid cells
(45, 46, 47) , its ability to duplicate the
regulatory function shown by the closely related Ets-1 protein was
determined. In C33A human epithelial cells cotransfected with the
-411luc reporter construct with either the pEBets-1 or pEBets-2
plasmid and with truncated Myb (pCt) expression plasmids, Ets-2 as well
as Ets-1 cooperated with Myb to transactivate the CD13/APN promoter (Fig. 9 B). By contrast, in parallel
experiments, other Ets family members expressed in myeloid cells (PU.1,
Fli-1, and Elf-1) failed to produce a cooperative transactivating
effect when combined with the Myb expression construct, although
individually each was able to stimulate CD13/APN transcription
(data not shown). These results suggest that while any of several Ets
proteins normally found in myeloid cells can participate in the
regulation of the CD13/APN gene, the ability to cooperate with
Myb is more limited.
Figure 9:
A nontruncated Myb protein and Ets-2 can
also transactivate the CD13/APN promoter. A, the C33A
human epithelial cell line was cotransfected with 1 µg of the
-411luc reporter construct and optimal doses of expression
vectors containing truncated Myb only (pCt; 1 µg), Ets-1 only
(pEBets-1; 0.5 µg), full-length c-Myb only (pCMV4cMyb; 1 µg),
or 0.5 µg of Ets-1 in combination with 1.0 µg of either Myb
expression plasmid. The mean promoter activities were generated from
duplicate conditions in a representative experiment, and the standard
deviation of the mean is indicated by the error bars.
Results are expressed as -fold activation above that obtained with
cotransfection of equivalent amounts of the empty expression vectors.
All values are normalized to the cotransfected MAP1-SEAP control
plasmid. B, the C33A human epithelial cell line was
cotransfected with 1 µg of the -411luc reporter construct and
optimal doses of truncated Myb only (pCt; 1.0 µg), Ets-1 only
(pEBets-1; 0.5 µg), Ets-2 only (pEBets-2; 0.5 µg), or 1.0
µg of Myb in combination with 0.5 µg of either Ets expression
plasmid.
DISCUSSION
The CD13/APN differentiation antigen appears on the surface
of the earliest cells committed to the myeloid developmental pathway.
In myeloid cells, this antigen is thought to play a role in the
regulation of cellular responses to peptide hormones
(48) . Its
early and exclusively myeloid pattern of expression suggests that study
of CD13/APN gene regulation might yield valuable clues to the
transcriptional control of myeloid differentiation genes in general. As
demonstrated by this study, Myb and Ets, two well characterized
proteins with defined roles in normal and aberrant hematopoiesis, are
essential components of CD13/APN transcriptional regulation.
Precedence for Myb-Ets cooperativity comes from the avian E26 virus,
in which the myb and ets-1 genes are fused and
expressed as a tripartite protein containing the DNA-binding and
transactivation domains of both products, together with viral gag
sequences
(23, 49) . E26 infection in chickens results
in a mixed-lineage leukemia (myeloblasts with multipotent progenitor
cells) and can transform mixed multipotent colonies as well as
myeloblastic and mixed colonies in vitro (50, 51, 52) . Both v-Myb and v-Ets are
weakly oncogenic in bone marrow cells when expressed singly, but become
potent transforming and transactivating agents when coexpressed, either
as separate proteins or as a fusion construct
(31, 53) .
In agreement with these observations, cotransfection of either the
gag-myb-ets fusion protein or its components as separate proteins with
CD13/APN reporter constructs results in higher-than-additive levels of
reporter activity. ( )
The cooperativity
displayed by Myb and Ets during CD13/APN and mim-1 gene transcription, together with their fusion in the E26 virus,
suggests that the two proteins may physically associate in
transcription complexes. Either v-Myb or v-Ets can weakly transform
chicken erythroid cells, but only viruses containing the fusion protein
are capable of causing avian leukemia
(30) . Moreover, when
expressed as separate proteins from a single vector, v-Myb and v-Ets
induced leukemic cells at low efficiencies that, upon examination, had
invariably recombined their virus to produce a fusion of the two
oncoproteins
(30) . This requirement for Myb-Ets physical
association in leukemogenesis may simply reflect the normal interaction
between these proteins during cell regulation. Myb and Ets may
associate at specific points in normal hematopoiesis to regulate
transcription, either by direct contact with each other or through
interactions with other proteins. The lack of support for a physical
association between Myb and Ets in previous studies
(23, 30, 31, 38, 54) may
indicate that Myb-Ets interactions are weak or transient or perhaps are
achieved through as yet unidentified accessory proteins.
The
mammalian and avian c-Myb proteins have been reported to have a
negative regulatory domain (NRD) in their carboxyl-terminal regions,
which are often deleted in oncogenic forms of the genes
(20, 21, 22, 23) . Investigations of the
NRD have demonstrated that it may influence the ability of the protein
to bind DNA
(55) , while studies based on the CSF-1R promoter
(56) as well as investigations using Myb response elements
linked to heterologous promoter constructs
(24, 57, 58) indicate an active role for the NRD in repression of Myb
transactivating capacity. This regulatory domain has been proposed to
mediate interaction with an accessory negative regulatory protein that
attenuates the activity of the Myb transactivation domain
(58, 59, 60) . In support of this theory,
studies in yeast in which full-length c-Myb was a much stronger
activator than a protein bearing the oncogenic N- and C-terminal
deletions of v-Myb indicate that an accessory protein or molecule found
only in higher order organisms is responsible for the negative
regulatory effects of the c-Myb NRD
(61) . Investigations of
native promoters
(11, 38, 54, 62) have
generally shown c-Myb to be an effective transactivator, although a
full-length c-Myb expression plasmid was not as strong a transactivator
of the mim-1 promoter as was a truncated form (with deletion
of the NRD) in cooperation with the Ets-2 transcription factor
(38) . Experiments reported in the present study, while not
strictly addressing the relative transactivating ability of each
protein, do indicate that when an equivalent amount of plasmid is
transfected, an endogenous form of Myb is fully capable of synergizing
with the Ets protein to transactivate the CD13/APN promoter.
Apparent inconsistencies in the action of the NRD could again reflect
variations in the interaction of c-Myb with distinct transactivating
and accessory proteins in the context of a specific promoter. These
interacting proteins may also vary in their patterns of expression,
further influencing the effect of the NRD in different cell types and
stages of differentiation.
Myb is expressed in all hematopoietic
lineages
(12, 63) and participates in the regulation of
T-cell-specific
(11, 62) and stem cell-specific
(54) genes as well as genes whose expression is limited to
myeloid cells
(9, 10, 38) . Nevertheless,
transcription factors expressed in multiple lineages often play
important roles in myeloid-specific regulation of transcription through
cooperation with other tissue-specific or temporally regulated factors
(9, 10, 64, 65, 66) . For
example, although the Ets family member PU.1 is expressed in both
B-cells and myeloid cells, mutation of the PU.1-binding site
significantly decreases CSF-1R promoter activity specifically in
myeloid cells
(65) . However, the observation that mutation of
the Myb consensus site in the context of the wild-type CD13/APN promoter completely abrogated transcriptional activation in three
hematopoietic cell lines of two different lineages, but did not affect
the same construct in an epithelial cell line with low but detectable
levels of activity from the wild-type promoter, would indicate that Myb
does not solely determine the myeloid specificity of the CD13/APN promoter. Quite possibly, an Ets family member whose expression
overlaps that of c-Myb only in myeloid cells participates in
CD13/APN transcriptional regulation and confers myeloid
specificity to that promoter. Of the myeloid-associated Ets family
members tested in these experiments, only Ets-2 could cooperate with
c-Myb to stimulate the CD13/APN promoter, suggesting that
c-Myb may function to selectively boost the activity of this or a
related Ets transcription factor, thus contributing to the
lineage-restricted expression of the CD13/APN promoter.
Alternatively, myeloid specificity may be conferred by a unique factor
acting alone or in concert with Myb and Ets.
This report implicates
the Myb and Ets family proteins in the regulation of genes expressed
early in myeloid cell commitment. In related studies of the regulation
of the CD34 stem cell-surface antigen
(54) , c-Myb and Ets-2
were shown to act independently, with no evidence of a cooperative
effect, on reporter constructs containing a fragment of the first exon
of the CD34 gene linked to chloramphenicol acetyltransferase coding
sequences. Experiments with the CSF-1R promoter
(56) suggest
that c-Myb acts as a repressor that blocks CSF-1R transactivation by
Ets-1 and Ets-2. These findings contrast sharply with those of the
present study and with the cooperative effect of v-Myb and Ets-2 in
transactivation of the chicken promyelocyte-specific mim-1 promoter
(38) . In unpublished studies from this
laboratory, the synergistic effect of Myb and Ets was
restricted to the CD13/APN promoter and did not extend to the
human CD34, CSF-1R, or myeloperoxidase (which also contains Myb and Ets
consensus sites
(67) ) promoter constructs under identical
experimental conditions. Thus, reported discrepancies in Myb-Ets
interaction cannot be attributed solely to variations among
experimental systems. The fundamental importance of Myb and Ets in
myelopoiesis is clear from studies of myeloid cell development and E26
virus-induced avian leukemia. The experiments reported here suggest
that the regulation of the CD13/APN gene, which correlates
with the cooperation observed between the Myb and Ets proteins in E26
transformation, would provide an ideal mammalian model for studying Myb
and Ets interactions in normal and aberrant myelopoiesis.
FOOTNOTES
- *
- This work was supported in part by Grant RO1
CA-42804 from the National Institutes of Health and by the American
Lebanese Syrian Associated Charities of St. Jude Children's
Research Hospital. The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore by hereby marked `` advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 901-531-2404; Fax: 901-531-2032; E-mail:
lshapiro@mbcf.stjude.org.
- The
abbreviations used are: CD13/APN, CD13/aminopeptidase N; bp, base
pair(s); kb, kilobase pair(s); NRD, negative regulatory domain; CSF-1R,
colony-stimulating factor-1 receptor.
- L. H.
Shapiro, unpublished observations.
ACKNOWLEDGEMENTS
I thank Drs. Martine Roussel and Nathan Davis for many
helpful discussions and for providing reagents. I thank Dr. Kathleen
Weston for the pSCDMSMEnT dominant-negative Myb construct, Dr. Cristina
Hernandez-Munain for the pCMV4cMyb expression plasmid, Dr. E. Premkumar
Reddy for the pCt plasmid, Dr. Michael Ostrowski for the GST-Ets-DBD
plasmid, and Dr. Jacques Ghysdael for the Ets expression plasmids. I am
indebted to Jane D. Deaton, Elizabeth Mann, and Bart G. Jones for
expert technical assistance. I thank Drs. Richard Bram, A. T. Look, and
David Shapiro for helpful discussions and John Gilbert for editorial
review.
REFERENCES
- Griffin, J. D., Ritz, J., Nadler, L. M., and Schlossman, S. F. (1981) J. Clin. Invest. 68, 932-941
- Griffin, J. D., Ritz, J., Beveridge, R. P., Lipton, J. M., Daley, J. F., and Schlossman, S. F. (1983) Int. J. Cell Cloning 1, 33-48
[Abstract]
- Hogg, N., and Horton, M. J. (1987) in Proceedings of the Third International Workshop on Human Leukocyte Differentiation Antigens: Leukocyte Typing III, pp. 576-621, Oxford University Press, New York
- Olson, E. N., and Klein, W. H. (1994) Genes & Dev. 8, 1-8
- Olson, E. N. (1993) Circ. Res. 72, 1-6
[Abstract/Free Full Text]
- Kuo, C. J., Conley, P. B., Chen, L., Sladek, F. M., Darnell, J. E., Jr., and Crabtree, G. R. (1992) Nature 355, 457-461
[CrossRef][Medline]
[Order article via Infotrieve]
- Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S. F., D'Agati, V., Orkin, S. H., and Costantini, F. (1991) Nature 349, 257-260
[CrossRef][Medline]
[Order article via Infotrieve]
- Orkin, S. H. (1992) Blood 80, 575-581
[Free Full Text]
- Burk, O., Mink, S., Ringwald, M., and Klempnauer, K. H. (1993) EMBO J. 12, 2027-2038
[Medline]
[Order article via Infotrieve]
- Ness, S. A., Kowenz-Leutz, E., Casini, T., Graf, T., and Leutz, A. (1993) Genes & Dev. 7, 749-759
- Hernandez-Munain, C., and Krangel, M. S. (1994) Mol. Cell. Biol. 14, 473-483
[Abstract/Free Full Text]
- Westin, E. H., Gallo, R. C., Arya, S. K., Eva, A., Souza, L. M., Baluda, M. A., Aaronson, S. A., and Wong-Staal, F. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 2194-2198
[Abstract/Free Full Text]
- Gonda, T. J., and Metcalf, D. (1984) Nature 310, 249-251
[CrossRef][Medline]
[Order article via Infotrieve]
- Kuehl, W. M., Bender, T. P., Stafford, J., McClinton, D., Segal, S., and Dmitrovsky, E. (1988) Curr. Top. Microbiol. Immunol. 141, 318-323
[Medline]
[Order article via Infotrieve]
- Cuddihy, A. E., Brents, L. A., Aziz, N., Bender, T. P., and Kuehl, W. M. (1993) Mol. Cell. Biol. 13, 3505-3513
[Abstract/Free Full Text]
- Clarke, M. F., Kukowska-Latallo, J. F., Westin, E., Smith, M., and Prochownik, E. V. (1988) Mol. Cell. Biol. 8, 884-892
[Abstract/Free Full Text]
- Kirsch, I. R., Bertness, V., Silver, J., and Hollis, G. F. (1986) J. Cell. Biochem. 32, 11-21
[CrossRef][Medline]
[Order article via Infotrieve]
- Patel, G., Kreider, B., Rovera, G., and Reddy, E. P. (1993) Mol. Cell. Biol. 13, 2269-2276
[Abstract/Free Full Text]
- Mucenski, M. L., McLain, K., Kier, A. B., Swerdlow, S. H., Schreiner, C. M., Miller, T. A., Pietryga, D. W., Scott, W. J., Jr., and Potter, S. S. (1991) Cell 65, 677-689
[CrossRef][Medline]
[Order article via Infotrieve]
- Gerondakis, S., and Bishop, J. M. (1986) Mol. Cell. Biol. 6, 3677-3684
[Abstract/Free Full Text]
- Klempnauer, K. H., Symonds, G., Evan, G. I., and Bishop, J. M. (1984) Cell 37, 537-547
[CrossRef][Medline]
[Order article via Infotrieve]
- Rosson, D., and Reddy, E. P. (1986) Nature 319, 604-606
[CrossRef][Medline]
[Order article via Infotrieve]
- Graf, T. (1992) Curr. Opin. Genet. Dev. 2, 249-255
[CrossRef][Medline]
[Order article via Infotrieve]
- Sakura, H., Kanei-Ishii, C., Nagase, T., Nakagoshi, H., Gonda, T. J., and Ishii, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5758-5762
[Abstract/Free Full Text]
- Hu, Y. L., Ramsay, R. G., Kanei-Ishii, C., Ishii, S., and Gonda, T. J. (1991) Oncogene 6, 1549-1553
[Medline]
[Order article via Infotrieve]
- Grasser, F. A., Graf, T., and Lipsick, J. S. (1991) Mol. Cell. Biol. 11, 3987-3996
[Abstract/Free Full Text]
- Wasylyk, B., Hahn, S. L., and Giovane, A. (1993) Eur. J. Biochem. 211, 7-18
[Medline]
[Order article via Infotrieve]
- Wang, C. Y., Petryniak, B., Ho, I. C., Thompson, C. B., and Leiden, J. M. (1992) J. Exp. Med. 175, 1391-1399
[Abstract/Free Full Text]
- Laudet, V., Niel, C., Duterque-Coquillaud, M., Leprince, D., and Stehelin, D. (1993) Biochem. Biophys. Res. Commun. 190, 8-14
[CrossRef][Medline]
[Order article via Infotrieve]
- Metz, T., and Graf, T. (1991) Cell 66, 95-105
[CrossRef][Medline]
[Order article via Infotrieve]
- Metz, T., and Graf, T. (1991) Genes & Dev. 5, 369-380
- Shapiro, L. H., Ashmun, R. A., Roberts, W. M., and Look, A. T. (1991) J. Biol. Chem. 266, 11999-12007
[Abstract/Free Full Text]
- Lemons, R. S., Nash, W. G., O'Brien, S. J., Benveniste, R. E., and Sherr, C. J. (1978) Cell 14, 995-1005
[CrossRef][Medline]
[Order article via Infotrieve]
- Ulrich, M. J., and Ley, T. J. (1990) Blood 75, 990-999
[Abstract/Free Full Text]
- Bram, R. J., and Crabtree, G. R. (1994) Nature 371, 355-358
[CrossRef][Medline]
[Order article via Infotrieve]
- Zhang, D. E., Fujioka, K., Hetherington, C. J., Shapiro, L. H., Chen, H. M., Look, A. T., and Tenen, D. G. (1994) Mol. Cell. Biol. 14, 8085-8095
[Abstract/Free Full Text]
- Bram, R. J., Hung, D. T., Martin, P. K., Schreiber, S. L., and Crabtree, G. R. (1993) Mol. Cell. Biol. 13, 4760-4769
[Abstract/Free Full Text]
- Dudek, H., Tantravahi, R. V., Rao, V. N., Reddy, E. S., and Reddy, E. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1291-1295
[Abstract/Free Full Text]
- Badiani, P., Corbella, P., Kiossus, D., Marvel, J., and Weston, K. (1994) Genes & Dev. 8, 770-782
- Aruffo, A. (1988) Current Protocols in Molecular Biology, pp. 16.13.1-16.13.7, Wiley-Interscience, New York
- Pahl, H. L., Burn, T. C., and Tenen, D. G. (1991) Exp. Hematol. 19, 1038-1041
[Medline]
[Order article via Infotrieve]
- Nye, J. A., Petersen, J. M., Gunther, C. V., Jonsen, M. D., and Graves, B. J. (1992) Genes & Dev. 6, 975-990
- Jaynes, J. B., and O'Farrell, P. H. (1991) EMBO J. 10, 1427-1433
[Medline]
[Order article via Infotrieve]
- Han, K., and Manley, J. L. (1993) EMBO J. 12, 2723-2733
[Medline]
[Order article via Infotrieve]
- Bhat, N. K., Fisher, R. J., Fujiwara, S., Ascione, R., and Papas, T. S. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3161-3165
[Abstract/Free Full Text]
- Bhat, N. K., Komschlies, K. L., Fujiwara, S., Fisher, R. J., Mathieson, B. J., Gregorio, T. A., Young, H. A., Kasik, J. W., Ozato, K., and Papas, T. S. (1989) J. Immunol. 142, 672-678
[Abstract]
- Kola, I., Brookes, S., Green, A. R., Garber, R., Tymms, M., Papas, T. S., and Seth, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7588-7592
[Abstract/Free Full Text]
- Shipp, M. A., and Look, A. T. (1993) Blood 82, 1052-1070
[Free Full Text]
- Luscher, B., and Eisenman, R. N. (1990) Genes & Dev. 4, 2235-2241
- Graf, T., Oker-Blom, N., Todorov, T. G., and Beug, H. (1979) Virology 99, 431-436
[CrossRef][Medline]
[Order article via Infotrieve]
- Moscovici, M. G., Jurdic, P., Samarut, J., Gazzolo, L., Mura, C. V., and Moscovici, C. (1983) Virology 129, 65-78
[CrossRef][Medline]
[Order article via Infotrieve]
- Graf, T., McNagny, K., Brady, G., and Frampton, J. (1992) Cell 70, 201-213
[CrossRef][Medline]
[Order article via Infotrieve]
- Frampton, J., Kouzarides, T., Doderlein, G., Graf, T., and Weston, K. (1993) EMBO J. 12, 1333-1341
[Medline]
[Order article via Infotrieve]
- Melotti, P., and Calabretta B. (1994) J. Biol. Chem. 269, 25303-25309
[Abstract/Free Full Text]
- Ramsay, R. G., Ishii, S., and Gonda, T. J. (1991) Oncogene 6, 1875-1879
[Medline]
[Order article via Infotrieve]
- Reddy, M. A., Yang, B. S., Yue, X., Barnett, C. J. K., Ross, I. L., Sweet, M. J., Hume, D. A., and Ostrowski, M. C. (1994) J. Exp. Med. 180, 2309-2319
[Abstract/Free Full Text]
- Kalkbrenner, F., Guehmann, S., and Moelling, K. (1990) Oncogene 5, 657-661
[Medline]
[Order article via Infotrieve]
- Dubendorff, J. W., Whittaker, L. J., Eltman, J. T., and Lipsick, J. S. (1992) Genes & Dev. 6, 2524-2535
- Nomura, T., Sakai, N., Sarai, A., Sudo, T., Kanei-Ishii, C., Ramsay, R. G., Favier, D., Gonda, T. J., and Ishii, S. (1993) J. Biol. Chem. 268, 21914-21923
[Abstract/Free Full Text]
- Favier, D., and Gonda, T. J. (1994) Oncogene 9, 305-311
[Medline]
[Order article via Infotrieve]
- Chen, R. H., and Lipsick, J. S. (1993) Mol. Cell. Biol. 13, 4423-4431
[Abstract/Free Full Text]
- Siu, G., Wurster, A. L., Lipsick, J. S., and Hedrick, S. M. (1992) Mol. Cell. Biol. 12, 1592-1604
[Abstract/Free Full Text]
- Slamon, D. J., Boone, T. C., Murdock, D. C., Keith, D. E., Press, M. F., Larson, R. A., and Souza, L. M. (1986) Science 233, 347-351
[Abstract/Free Full Text]
- Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., and Tenen, D. G. (1993) J. Biol. Chem. 268, 8230-8239
[Abstract/Free Full Text]
- Zhang, D. E., Hetherington, C. J., Chen, H. M., and Tenen, D. G. (1994) Mol. Cell. Biol. 14, 373-381
[Abstract/Free Full Text]
- Zhang, D. E., Hetherington, C. J., Tan, S., Dziennis, S. E., Gonzalez, D. A., Chen, H. M., and Tenen, D. G. (1994) J. Biol. Chem. 269, 11425-11434
[Abstract/Free Full Text]
- Nuchprayoon, I., Meyers, S., Scott, L. M., Suzow, J., Hiebert, S., and Friedman, A. D. (1994) Mol. Cell. Biol. 14, 5558-5568
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Lin, A.-K. T. Perl, and J. M. Shannon
Erm/Thyroid Transcription Factor 1 Interactions Modulate Surfactant Protein C Transcription
J. Biol. Chem.,
June 16, 2006;
281(24):
16716 - 16726.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Cowburn, A. Sobolewski, B. J. Reed, J. Deighton, J. Murray, K. A. Cadwallader, J. R. Bradley, and E. R. Chilvers
Aminopeptidase N (CD13) Regulates Tumor Necrosis Factor-{alpha}-induced Apoptosis in Human Neutrophils
J. Biol. Chem.,
May 5, 2006;
281(18):
12458 - 12467.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. K. Goto, T. Zor, M. Martinez-Yamout, H. J. Dyson, and P. E. Wright
Cooperativity in Transcription Factor Binding to the Coactivator CREB-binding Protein (CBP). THE MIXED LINEAGE LEUKEMIA PROTEIN (MLL) ACTIVATION DOMAIN BINDS TO AN ALLOSTERIC SITE ON THE KIX DOMAIN
J. Biol. Chem.,
November 1, 2002;
277(45):
43168 - 43174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Rulli, J. Lenz, and L. S. Levy
Disruption of Hematopoiesis and Thymopoiesis in the Early Premalignant Stages of Infection with SL3-3 Murine Leukemia Virus
J. Virol.,
March 1, 2002;
76(5):
2363 - 2374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lauder, A. Castellanos, and K. Weston
c-myb Transcription Is Activated by Protein Kinase B (PKB) following Interleukin 2 Stimulation of T Cells and Is Required for PKB-Mediated Protection from Apoptosis
Mol. Cell. Biol.,
September 1, 2001;
21(17):
5797 - 5805.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-J. Shi, S.-R. Park, P.-H. Kim, and J. Stavnezer
Roles of Ets proteins, NF-{{kappa}}B and nocodazole in regulating induction of transcription of mouse germline Ig {{alpha}} RNA by transforming growth factor-{beta}1
Int. Immunol.,
June 1, 2001;
13(6):
733 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. V. Bhagwat, J. Lahdenranta, R. Giordano, W. Arap, R. Pasqualini, and L. H. Shapiro
CD13/APN is activated by angiogenic signals and is essential for capillary tube formation
Blood,
February 1, 2001;
97(3):
652 - 659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. A. Blobel
CREB-binding protein and p300: molecular integrators of hematopoietic transcription
Blood,
February 1, 2000;
95(3):
745 - 755.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Hegde, J. Zhao, R. A. Ashmun, and L. H. Shapiro
c-Maf Induces Monocytic Differentiation and Apoptosis in Bipotent Myeloid Progenitors
Blood,
September 1, 1999;
94(5):
1578 - 1589.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Parker, M. Rivera, T. Zor, A. Henrion-Caude, I. Radhakrishnan, A. Kumar, L. H. Shapiro, P. E. Wright, M. Montminy, and P. K. Brindle
Role of Secondary Structure in Discrimination between Constitutive and Inducible Activators
Mol. Cell. Biol.,
August 1, 1999;
19(8):
5601 - 5607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wang, E. Scott, C. L. Sawyers, and A. D. Friedman
C/EBPalpha Bypasses Granulocyte Colony-Stimulating Factor Signals to Rapidly Induce PU.1 Gene Expression, Stimulate Granulocytic Differentiation, and Limit Proliferation in 32D cl3 Myeloblasts
Blood,
July 15, 1999;
94(2):
560 - 571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Inoue, C. J. Sherr, and L. H. Shapiro
Regulation of the CD13/Aminopeptidase N Gene by DMP1, a Transcription Factor Antagonized by D-Type Cyclins
J. Biol. Chem.,
October 30, 1998;
273(44):
29188 - 29194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Hegde, A. Kumar, C. Kurschner, and L. H. Shapiro
c-Maf Interacts with c-Myb To Regulate Transcription of an Early Myeloid Gene during Differentiation
Mol. Cell. Biol.,
May 1, 1998;
18(5):
2729 - 2737.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Ma, Q. Su, and P. Tempst
Differentiation-stimulated Activity Binds an ETS-like, Essential Regulatory Element in the Human Promyelocytic defensin-1 Promoter
J. Biol. Chem.,
April 10, 1998;
273(15):
8727 - 8740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yang, L. H. Shapiro, M. Rivera, A. Kumar, and P. K. Brindle
A Role for CREB Binding Protein and p300 Transcriptional Coactivators in Ets-1 Transactivation Functions
Mol. Cell. Biol.,
April 1, 1998;
18(4):
2218 - 2229.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Z. Ratajczak, D. Perrotti, P. Melotti, M. Powzaniuk, B. Calabretta, K. Onodera, D. A. Kregenow, B. Machalinski, and A. M. Gewirtz
Myb and Ets Proteins Are Candidate Regulators of c-kit Expression in Human Hematopoietic Cells
Blood,
March 15, 1998;
91(6):
1934 - 1946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Noti
Sp3 Mediates Transcriptional Activation of the Leukocyte Integrin Genes CD11C and CD11B and Cooperates with c-Jun to Activate CD11C
J. Biol. Chem.,
September 19, 1997;
272(38):
24038 - 24045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Tenen, R. Hromas, J. D. Licht, and D.-E. Zhang
Transcription Factors, Normal Myeloid Development, and Leukemia
Blood,
July 15, 1997;
90(2):
489 - 519.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Nuchprayoon, C. P. Simkevich, M. Luo, A. D. Friedman, and A. G. Rosmarin
GABP Cooperates With c-Myb and C/EBP to Activate the Neutrophil Elastase Promoter
Blood,
June 15, 1997;
89(12):
4546 - 4554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. Brandt, D. J. Fraser, S. Leal, P. M. Halandras, A. R. Kroll, and D. J. Kroll
c-Myb trans-Activates the Human DNA Topoisomerase IIalpha Gene Promoter
J. Biol. Chem.,
March 7, 1997;
272(10):
6278 - 6284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Frampton, T Ramqvist, and T Graf
v-Myb of E26 leukemia virus up-regulates bcl-2 and suppresses apoptosis in myeloid cells.
Genes & Dev.,
November 1, 1996;
10(21):
2720 - 2731.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kang, H. Saito, Y. Ihara, E. Miyoshi, N. Koyama, Y. Sheng, and N. Taniguchi
Transcriptional Regulation of the N-Acetylglucosaminyltransferase V Gene in Human Bile Duct Carcinoma Cells (HuCC-T1) Is Mediated by Ets-1
J. Biol. Chem.,
October 25, 1996;
271(43):
26706 - 26712.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|