Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shapiro, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shapiro, L. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 15, Issue of April 14, pp. 8763-8771, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Myb and Ets Proteins Cooperate to Transactivate an Early Myeloid Gene (*)

Linda H. Shapiro (§)

From the (1) Department of Experimental Oncology, St. Jude Children's Research Hospital, Memphis, Tennessee 38101

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The earliest progenitor cell committed to the granulocyte/monocyte developmental pathway can be identified by the appearance of a 150-kDa glycoprotein on the cell surface (CD13/aminopeptidase N (CD13/APN), EC 3.4.11.2). A 455-base pair genomic fragment from the CD13/APN gene containing a Myb consensus-binding site as well as three potential Ets-binding sites was found to regulate tissue-appropriate expression of reporter genes in hematopoietic cell lines. Transactivation experiments with plasmids expressing either a full-length or truncated Myb protein and the full-length Ets-1 or Ets-2 protein demonstrated that these proteins cooperate to positively regulate CD13/APN gene expression. This cooperation is synergistic, as levels of transcriptional activity produced by Myb and Ets in combination were higher than those expected from a purely additive effect. Mutation of the Myb consensus-binding site completely abolished CD13/APN promoter activity in myeloid cells. Introduction of a dominant interfering Myb allele disrupted the ability of endogenous c-Myb in myeloid cells to transactivate the CD13/APN construct. Other myeloid cell-expressed Ets family members (PU.1, Fli-1, and Elf-1) failed to produce a cooperative transactivating effect when combined with the Myb expression construct. These data contrast with previous studies indicating that full-length c-Myb is unable to positively cooperate with Ets proteins in the regulation of myeloid genes. Because intact c-Myb and Ets-2 proteins, both endogenously expressed in myeloid cells, act synergistically to transactivate the CD13/APN promoter, this gene may represent a physiological target for dissection of the roles of these transcription factors in normal and malignant myelopoiesis.


INTRODUCTION

The metallopeptidase CD13/aminopeptidase N (CD13/APN; ()EC 3.4.11.2) can be detected on the earliest progenitor cell committed to the granulocyte/monocyte developmental pathway as well as its more differentiated progeny, but is not found on normal hematopoietic cells of other lineages or their progenitors (1, 2, 3) . The early and precise lineage-specific expression of this surface antigen suggests that control of the CD13/APN gene would be a useful model of gene regulation in myelopoiesis, particularly in efforts to understand the signals that drive multipotent progenitor cells toward lineage-specific differentiation. Studies of mammalian developmental systems have begun to establish a hierarchy of critical differentiation signals and cues (4, 5, 6, 7, 8) . A recurring theme of this research is that transcription factors can cooperate in stage-specific regulation of genes essential to cell differentiation; hence, by studying the expression of such proteins during defined stages of development, one can begin to understand the complex genetic programs that underlie normal and aberrant myelopoiesis.

One candidate for scrutiny as an essential hematopoietic transcription factor is the protein encoded by the c- myb proto-oncogene. Studies of the few cellular gene targets known to be regulated by Myb have indicated that it frequently acts in cooperation with other transcription factors early in hematopoiesis. Examples include its interaction with the CAAT enhancer binding protein to transactivate the mim-1 and cMGF genes (9, 10) and with the polyomavirus enhancer binding factor 2 core binding factor complex to transactivate the T-cell receptor ( TCR) gene (11) . Moreover, c-Myb expression is down-regulated after maturation of hematopoietic cells (12, 13, 14) , and its overexpression inhibits cell differentiation (15, 16, 17, 18) . Mice carrying a homozygous mutation in the c- myb locus die at a late gestational age and display a multilineage defect in the generation of hematopoietic progenitors, indicating a fundamental role for Myb in hematopoietic cell development (19) . Truncated c- myb genes (due to viral insertion) have been found in murine tumors of myeloid origin, and oncogenic v- myb of transforming avian myeloblastosis virus and avian acute leukemia virus E26 truncates c-Myb at both its amino and carboxyl termini (20, 21, 22) . These alterations are thought to be a common route to activation of Myb's latent transforming properties (23, 24, 25, 26) .

The Ets family of transcription factors, which share a highly conserved DNA-binding region (27, 28, 29) , represents another group of proteins that potentially regulates myeloid-specific gene expression. The individual Ets proteins bind to similar but often distinct purine-rich DNA sequences (GGAW) in the promoter regions of specific target genes (28) and often interact with other proteins to form transcriptionally active complexes. For example, the proteins encoded by the v- ets and v- myb oncogenes have been shown to functionally synergize in the transformation of cells by the E26 virus (30, 31) .

CD13/APN transcription is initiated from two physically distinct sites in myeloid and intestinal epithelial cells and is directed by separate functional promoters (32) . Here the nucleotide sequences responsible for CD13/APN reporter gene expression in myeloid cells are identified. Because this regulatory region contains both Myb and Ets consensus-binding sites, the possibility that these two important transcription factors control myeloid cell-specific CD13/APN expression was examined. The results presented show that a truncated or full-length form of c-Myb and the full-length Ets-1 or Ets-2 protein cooperate to transactivate the CD13/APN promoter and that the Myb consensus-binding site is essential for transcription of this differentiation-linked gene in hematopoietic cells.


EXPERIMENTAL PROCEDURES

Cell Lines

Human cell lines included the lymphoid leukemia lines MOLT-4 (ATCC CRL1582) and Jurkat (ATCC TIB152), the myeloid leukemia lines U937 (ATCC CRL1593) and KG1a (ATCC CCL246.1), the epithelial cell line C33A (ATCC HTB31), and the fibroblast line VA-2 (33) . COS-7 cells (ATCC CRL1651) were used to transiently express c-Myb proteins for the DNA binding assays. Nonadherent cell lines were grown in RPMI 1640 medium, and adherent lines were maintained in Dulbecco's modified Eagle's medium containing 2 m M L-glutamine and 10% fetal calf serum.

Plasmid Construction

A 1158-bp XbaI/ HaeII CD13/APN genomic restriction fragment ending within exon 1 was ligated into the XbaI site of the promoterless and enhancerless luciferase reporter plasmid (pGL2basic; Promega) to produce the p-1150luc construct. This construct contains sequences from bp -1158 to +65 of the CD13/APN myeloid promoter (32) . 5`-Deletion mutants constructed in the pGL2basic backbone were designated as -411luc, -291luc, -120luc, and -40luc reporter plasmids. The Myb consensus site in the -411luc reporter construct was changed from TAACGGAC to TCTTGGAC using the Transformer kit (CLONTECH) to produce the mybmutluc plasmid. Plasmids were also constructed that linked genomic sequences to the neogene. A 2.34-kb HindIII cassette containing neo(34) was ligated into the HindIII site of pBluescript SK, and CD13/APN genomic sequences (1158-bp XbaI/ HaeII genomic fragment) were inserted into the XbaI site of the vector (pPFMyneo).

Transfection of Recombinant Plasmids and Reporter Gene Assays

To facilitate analysis of deletion constructs, the KG1a and Jurkat cell lines were electroporated with 10 µg of the wild-type or deletion constructs and 4 µg of the control MAP1-SEAP (where SEAP represents secreted alkaline phosphatase) plasmid (35) as described (36) . C33A epithelial cells were transfected with 1 µg of the wild-type or deletion constructs and 0.5 µg of the control plasmid by the calcium phosphate method (32) . The transfection efficiency with each construct was normalized to the control level of secreted alkaline phosphatase activity (37) ; the reported values were calculated as relative light units/unit of secreted alkaline phosphatase activity. To compare results among the different cell lines, transcriptional activity was expressed as the -fold increase over that produced with the enhancerless luciferase vector, pGL2basic, determined in parallel transfections. Each experiment was repeated at least three times. For S1 analysis, the pPFMyneo and p-411neo plasmids were cotransfected with the pRSVneo plasmid into U937 and MOLT-4 cell lines as described (36) and selected in medium containing 800 µg/ml G418 (Geneticin; Life Technologies, Inc.); G418-resistant transfectants were pooled; and RNA was extracted (32) . For transactivation assays, C33A epithelial cells were transfected by the calcium phosphate method (32) with 0.5 µg of the MAP1-SEAP control plasmid, and the indicated amounts of reporter and expression plasmids (see Fig. 3 C): pCt, encoding the truncated Myb protein, provided by Dr. E. Premkumar Reddy (38) ; pCMV4cMyb, encoding the full-length murine c-Myb protein, provided by Dr. C. Hernandez-Munain; pEBets-1 and pEBets-2, provided by Dr. J. Ghysdael (Orsay, France); and the pSCDMSMEnT dominant interfering Myb construct, provided by Dr. Kathleen Weston (39) . For transient expression of the Myb protein, COS-7 cells were transfected with the pCMV4cMyb plasmid by the DEAE-dextran method as described (40) .


Figure 3: Functionally defined myeloid regulatory region of the CD13/APN promoter. A, nucleotide sequences between bp -411 and -291 that define the myeloid regulatory region of this gene. The putative Myb-binding site is boxed, and possible Ets-binding sites are underlined. B, comparison of the CD13/APN Myb consensus site with functionally characterized Myb-binding sites found in the regulatory regions of other genes. C, schematic diagram of expression constructs used in the transfection analyses. Each of the upper three constructs contains Myb sequences: full-length murine c-Myb (pCMV4cMyb), truncated murine Myb (pCt), and the dominant interfering allele (pSCDMSMEnT). The lower two constructs are Ets-1 and Ets-2 expression constructs. Promoter regions are indicated by dotted; other key domains are labeled. CMV, cytomegalovirus.



Assays to detect luciferase activity were performed as described (41) . 100-µl aliquots of total cellular protein from lysates representing each transfection condition were tested for luciferase activity, and the resulting values were normalized according to secreted alkaline phosphatase activity assayed as described (37) .

S1 Nuclease Protection Assays

S1 mapping was performed with end-labeled DNA probes as described (32) . The pPFMyneo plasmid was digested with BglII, which cuts within the neogene, dephosphorylated, and end-labeled with T4 polynucleotide kinase and [-P]ATP. Total cellular RNAs (20 µg) were hybridized with the end-labeled DNA fragments (50,000 dpm) for 16 h at 52 °C. The samples were digested with S1 nuclease and analyzed by autoradiography after electrophoresis on 8% denaturing polyacrylamide gels.

DNA Binding Assays

For DNA binding assays, transiently transfected COS-7 whole cell lysates were freshly prepared by scraping the cells into cold phosphate-buffered saline and resuspending the pellet in 0.2 ml of lysis buffer (20 m M Tris-HCl, pH 7.5, 2 m M dithiothreitol, 20% glycerol, and 50 m M KCl). After the addition of Triton X-100 to a 0.2% (v/v) final concentration, the lysate was incubated on ice for 15 min, and the debris was pelleted for 5 min at 12,500 rpm. Cell lysate (8 µl, 15-20 µg) from either mock- or pCMV4cMyb-transfected COS-7 cells or 100 ng of GST-Ets-DBD protein (where GST represents glutathione S-transferase and Ets-DBD represents the Ets DNA-binding domain) was preincubated in binding buffer (10 m M Hepes, pH 7.9, 50 m M KCl, 5 m M MgCl, 10% glycerol, 1 m M dithiothreitol, and 1 µg of poly[d(I-C)]) in 25-µl reactions with or without 100 ng of the consensus or mutant double-stranded oligonucleotide competitors (mimAmyb, CTAGGACATTATAACGGTTTTTTAGT (39) ; ets1con, AATTCACCGGAAGTATTCGA (42) ; mybmut, CCGGATCCTCTTGGACCGGC; and ets1mut, AATTCACCTTAAGTATTCGA) for 10 min at 30 °C before the addition of probe. For supershift experiments, 1 µl of a murine anti-Myb monoclonal antibody (Type 1; Upstate Biotechnology, Inc., Lake Placid, NY) or an isotype-matched irrelevant control monoclonal antibody was preincubated with lysate for 10 min at 30 °C before probe addition. The P-end-labeled oligonucleotide probe containing the CD13/APN Myb consensus site (CD13Myb, CCGGATCCTAACGGACCGGC) or the genomic fragment probe ( XbaI/ DdeI fragment, containing bp -411 to -281) was then added and incubated for an additional 15 min at 30 °C. Binding reactions were electrophoresed through a 5% acrylamide gel in Tris borate buffer at 4 °C. Gels were dried and exposed to x-ray film.

Bacterial Protein Preparations

Recombinant glutathione S-transferase fusion protein containing the bacterially expressed Ets DNA-binding domain (GST-Ets-DBD) was purified from bacterial cell lysates by a standard glutathione-bead method. The GST-Ets-DBD plasmid was the gift of Dr. Michael Ostrowski (Duke University).


RESULTS

A 411-bp Sequence within the CD13/APN Upstream Promoter Contains Elements That Regulate Myeloid-specific Gene Expression

A 1-kb genomic fragment of the CD13/APN gene, which includes sequences immediately upstream of the myeloid and fibroblast transcription initiation sites, can direct correctly initiated reporter gene expression (32) . To confirm that this region includes myeloid-specific regulatory elements, the pPFMyneo and control pRSVneo plasmids were cotransfected into a panel of cell lines known to use either the upstream (U937 and VA-2) or the downstream (HepG2) CD13/APN promoter or to lack CD13/APN transcripts altogether (MOLT-4). S1 nuclease analysis of the RNAs produced by the resulting neomycin-resistant stable lines showed substantial levels of correctly initiated transcripts in the U937 myeloid transfectant, which expresses endogenous CD13/APN at high levels, with much lower levels detected in the MOLT-4 lymphoid, HepG2 liver, and VA-2 fibroblast transfectants (Fig. 1 A). Deletional analysis of the promoter fragment showed that constructs containing 411 bp of upstream sequences were sufficient for correctly initiated, tissue-appropriate transcription of the neoreporter gene (Fig. 1 B). These results indicate that a 411-bp region within the original 1-kb fragment contains the elements responsible for myeloid-specific CD13/APN gene expression. The absence of transcripts in fibroblasts (Fig. 1 A) that normally initiate CD13/APN transcription from the same upstream promoter used by myeloid cells suggests that some of the elements responsible for fibroblast-specific transcription of the CD13/APN gene do not reside within this fragment. A Positive Regulator of CD13/APN Activity Is Located in the Region between bp -291 and -411-To further localize the myeloid-specific region of CD13/APN regulation, 5`-deletion mutants of the myeloid cell promoter were inserted upstream of the luciferase reporter gene. The results of transient transfection of the reporter constructs into the KG1a myeloblastic cell line, the C33A epithelial cell line, and the Jurkat T-ALL cell line (Fig. 2) confirmed the myeloid specificity of the 1-kb fragment used in the preceding experiment: the p-1150luc construct was expressed at 6-fold higher levels in the myeloid cell line than in either the T-cell or epithelial cell line. More important, the -411luc construct retained myeloid specificity, while removal of sequences upstream of bp -291 resulted in comparably lower levels of activity in each of the three cell lines, indicating that a positive regulatory element resides between bp -291 and -411.


Figure 1: A genomic fragment containing 411 bp of the upstream promoter region directs correctly initiated, tissue-appropriate transcripts. A, a genomic fragment containing 1 kb of sequences immediately upstream of the CD13/APN myeloid transcription start site was cloned upstream of the neomycin resistance reporter gene. The plasmid construct (pPFMyneo) was cotransfected with the control plasmid pRSVneo into a panel of cell lines that used the upstream CD13/APN promoter (U937 myeloid and VA-2 fibroblast cell lines) or the downstream promoter (HepG2 liver line) or lacked CD13/APN expression (MOLT-4 lymphoid cell line). RNA from the resulting stable lines was assayed by S1 nuclease mapping. Protected bands are indicated by an arrowhead (pPFMyneo initiation sites) or a plus sign (point at which pRSVneo diverges from the probe, indicating control transcript levels). B, a 5`-deletion of the genomic fragment included in pPFMyneo was cotransfected with the control plasmid pRSVneo into the U937 myeloid (upstream CD13/APN promoter) or MOLT-4 lymphoid (no CD13/APN expression) cell line. Protected bands are indicated as described for A. C, shown is a diagram of the structure of the cotransfected plasmids and probes used and the resulting products from each plasmid. CD13/APN sequences are shown as hatched boxes, and neomycin gene sequences are dotted. RSV-LTR, Rous sarcoma virus long terminal repeat.



Myb and Ets Family Members Directly Bind to the CD13/APN Promoter

The sequence extending from bp -291 to -411 contains a c-Myb consensus DNA-binding site (YAACKG) between nucleotides -375 and -381 and three Ets consensus-binding sites (GGAW) (Fig. 3 A). As a preliminary step to the functional assessment of these sites, the ability of Myb and Ets proteins to physically bind to the consensus sites in vitro was evaluated by electrophoretic mobility shift assay. Whole cell lysates from COS-7 cells transfected with vector alone or the pCMV4cMyb expression plasmid were incubated with an end-labeled oligonucleotide probe containing the putative CD13/APN Myb-binding site (Fig. 4 A). Unlabeled oligonucleotides containing self-competitor (CD13Myb), the mimA Myb site from the mim-1 promoter (mimAmyb) (Fig. 3 B), or a mutant Myb site (mybmut) were added to the assays in 100-fold molar excess. The indicated protein-DNA complex was not present in the mock-transfected lysate (Fig. 4 A, lane 1) and was specifically competed by unlabeled oligonucleotide probe ( lane 3) as well as by the mimAmyb oligonucleotide ( lane 4), but not by the oligonucleotide containing a mutant Myb site ( lane 5). To further characterize this specific protein-DNA complex, monoclonal antibodies directed against the C-terminal region of the murine c-Myb protein were added to the electrophoretic mobility shift assay binding reaction. A supershift of the specific complex was apparent with the use of the anti-Myb antibodies ( lane 7), but not with isotype-matched inappropriate control antibody ( lane 6), confirming the physical interaction of Myb with the CD13/APN promoter.


Figure 4: Myb and Ets proteins directly bind to CD13/APN promoter sequences in vitro. A, whole cell lysates from COS-7 cells transfected with vector alone (CMV-cos; lane 1) or c-Myb expression plasmids (pCMV4cMyb-cos; lanes 2-7) were incubated with an end-labeled oligonucleotide probe containing the putative CD13/APN Myb-binding site (see Fig. 3 B). Oligonucleotides containing unlabeled self-competitor (CD13myb; lane 3), the mimA Myb site from the mim-1 promoter (mimAmyb; lane 4), or a mutant Myb site (mybmut; lane 5) were added to the assays in a 100-fold molar excess. Antibodies ( Ab) directed against the Myb protein ( lane 7) or an isotype-matched control antibody ( lane 6) were added in equal amounts to binding reactions. The arrowhead denotes the specific protein complex competed by self- and mimAmyb oligonucleotides, but not mutant oligonucleotides. The asterisk marks the Myb-specific supershifted complex. B, a bacterially expressed GST-Ets-DBD fusion protein was incubated with an end-labeled 130-bp promoter fragment probe containing the functionally defined myeloid-specific regulatory sequences ( lanes 1-3). The Ets-1 consensus oligonucleotide (ets1con; lane 2) or an oligonucleotide containing a mutant Ets-1 site (ets1mut; lane 3) was added to binding reactions in a 100-fold excess in the indicated lanes. Arrowheads denote specific protein complexes competed by the self-competitor oligonucleotide, but not mutant competitor oligonucleotides.



Analogous experiments tested the physical association of the conserved Ets DNA-binding domain with the CD13/APN promoter. A bacterially expressed Ets-1 DNA-binding domain protein (GST-Ets-DBD) was incubated with an end-labeled 130-bp promoter fragment probe containing the functionally defined myeloid-specific CD13/APN regulatory sequences (Fig. 4 B). Binding of GST-Ets-DBD to the promoter fragment was inhibited with a 100-fold excess of an Ets-1 consensus oligonucleotide (ets1con), but not with a 100-fold excess of an oligonucleotide containing a mutant Ets-1 site (ets1mut). Thus, members of the Myb and Ets transcriptional protein families bind specifically to the CD13/APN promoter.

Myb and Ets Proteins Cooperate to Transactivate the CD13/APN Promoter

Because Myb and Ets family proteins bind to the functionally relevant region of the CD13/APN promoter, and v-Myb and Ets-2 have been shown to cooperate in the regulation of the chicken promyelocyte-specific gene mim-1 (38) , Myb-Ets cooperation might also be a factor in myeloid-specific regulation of the CD13/APN gene. Indeed, in experiments with the C33A human epithelial cell line, either the truncated form of the Myb protein (pCt plasmid) or the full-length Ets-1 protein (pEBets-1 plasmid) transactivated the CD13/APN minimal promoter in a dose-dependent manner. Use of a truncated form of the Myb protein was prompted by other reports that this form is a more potent activator of transcription (38) and hence would be expected to amplify any positive results. The initial availability of Ets-1 expression constructs led to its use in the majority of the experiments in this study.

Evidence for a synergistic cooperative effect by the two proteins was obtained when the pCt and pEBets-1 plasmids were cotransfected with the -411luc reporter plasmid. Reporter gene mRNA levels seen with the plasmid combination at 0.5 µg of pEBets-1 and 1.0 µg of pCt were approximately twice the sum of results obtained with the separate proteins (Fig. 5). The transactivation capacity of the Myb-Ets combination was specific for the CD13/APN promoter, as indicated by the lack of transcriptional up-regulation with four independent promoters (data not shown).


Figure 5: Myb and Ets proteins cooperate to transactivate the CD13/APN promoter. The C33A human epithelial cell line was cotransfected with 1 µg of the -411luc reporter construct and increasing amounts (0.01-3.0 µg) of pCt only ( Myb), pEBets-1 only ( Ets-1), or pCt plus a constant 0.5 µg of pEBets-1 ( Myb + .5µg Ets-1). The average promoter activities were generated from duplicate conditions in a representative experiment, and the standard deviation of the mean is indicated by the error bars. All values were normalized to those obtained with a cotransfected control plasmid (MAP1-SEAP) for both transfection efficiency and as a control for the Myb-Ets effect on other promoters. Results are expressed as -fold activation relative to values obtained by cotransfecting cells with equal amounts of the empty expression vectors.



Mutation of the CD13/APN Myb Consensus-binding Site Abolishes the Synergistic Activity of Myb-Ets

If the protein generated from the Myb expression vector transactivates CD13/APN by binding to the Myb consensus site in the promoter, mutation of this site should have a profound effect on reporter gene levels. Surprisingly, alteration of this site from TAACGG to TCTCGG in the context of the wild-type promoter did not affect its transactivation by the Myb expression plasmid alone in C33A epithelial cells (Fig. 6). Moreover, comparable levels of reporter gene activity were produced by the wild-type, -291luc, and mybmutluc plasmids when Myb and Ets were added separately. Cotransfection of Myb and Ets-1 with the -291luc and mybmutluc plasmids yielded reporter gene activity that was essentially additive, in contrast to the clearly synergistic effect seen with the -411luc (wild-type) plasmid. Hence, mutation of the putative Myb consensus-binding site abolishes the Myb-Ets synergism seen with the intact promoter, despite the presence of other Myb-binding sites in the luciferase reporter plasmid. This suggests that Myb-Ets synergy depends upon features unique to the Myb consensus-binding site in the CD13/APN promoter.

The Myb-binding Site of the CD13/APN Promoter Is Important in Hematopoietic but Not Epithelial Cells

To confirm the importance of the Myb consensus sequence in CD13/APN transcription in a more relevant context, the mybmutluc construct was tested in both the CD13-positive myeloblastic (KG1a) and myelomonocytic leukemia (U937) cell lines as well as in the CD13-negative mature T-ALL (Jurkat) and epithelial (C33A) cell lines in comparison with the wild-type -411luc construct in each cell type. As shown in Fig. 7, mutation of the Myb-binding site reduced transcription from the CD13/APN promoter fragment to 4% of that produced by the wild-type construct in KG1a cells. Similarly, the mutant construct reduced CD13/APN transcriptional activity in the U937 and Jurkat cell lines to 10 and 15% of the wild-type levels, respectively. By contrast, the mutation did not affect the ability of the promoter construct to drive luciferase expression in epithelial cells. Thus, mutation of the Myb site in the context of a normal CD13/APN promoter fragment abolishes reporter gene transcription in both myeloid cells and T-cells. These data substantiate the essential requirement for Myb in CD13/APN expression in hematopoietic cells.


Figure 7: The CD13/APN Myb-binding site is functionally important in hematopoietic but not epithelial cells. The mybmutluc construct was transfected into the KG1a myeloblastic, U937 myelomonocytic, Jurkat T lymphoblastic, or C33A epithelial cell line, and its luciferase activity was compared with values obtained under parallel conditions in which each cell type was transfected with the wild-type -411luc construct (100%). The average promoter activities were generated from at least three separate experiments for each cell type, and the standard deviation of the mean is indicated by the error bars. All values were normalized to those obtained with the secreted alkaline phosphatase control to enable comparison among cell types with different transfection efficiencies.



Myb Dominant Interfering Alleles Abolish the Ability of Myb to Transactivate the CD13/APN Promoter

A dominant interfering allele (pSCDMSMEnT) consisting of the Myb DNA-binding domain fused to the repressor domain of the Drosophila engrailed ( En) transcription factor gene (43, 44) very efficiently represses the transactivation of reporter constructs containing multimerized Myb sites from the mim-1 promoter (39) . If the Myb protein does in fact regulate the CD13/APN promoter through binding at the Myb consensus site, the addition of the pSCDMSMEnT construct should interfere with transactivation by Myb and Ets and should attenuate transcription from the CD13/APN promoter construct. As predicted, the addition of increasing amounts of the dominant interfering plasmid led to incremental inhibition of transcriptional activity from the -411luc construct with previously determined optimal doses of Myb and Ets expression plasmids (Fig. 8 A). Similarly, cotransfection of the pSCDMSMEnT expression vector with CD13-411luc constructs into KG1a myeloblastic cells interfered with the endogenous c-Myb protein and abrogated the luciferase activity driven by the CD13/APN promoter (Fig. 8 B). Because the Myb dominant-negative mutant binds to the Myb consensus site and regulates transcription through its engrailed negative regulatory domain, these data strongly indicate that a transregulatory protein binds to the CD13/APN promoter at its Myb consensus site and positively regulates its transcription.


Figure 8: Myb dominant interfering alleles negate the ability of exogenously added Myb to transactivate the CD13/APN promoter in C33A epithelial cells and abrogate the ability of endogenous Myb to activate transcription from CD13/APN promoter constructs in myeloid cells. A, increasing amounts of the dominant interfering allele construct pSCDMSMEnT (see Fig. 3 C) were cotransfected with the wild-type -411luc construct and optimal doses of the Myb (pCt; 1 µg) and Ets-1 (pEBets-1; 0.5 µg) expression constructs into C33A human epithelial cells, and the luciferase activity was assayed at 24 h. All values are expressed as mean reporter gene activity in relative light units ( RLU)/unit of secreted alkaline phosphatase ( SEAP) activity under duplicate conditions of a representative experiment. The standard deviation of the mean is indicated by the error bars. B, increasing amounts of the pSCDMSMEnT dominant interfering allele expression vector were cotransfected with the wild-type -411luc construct into KG1a myeloblastic cells, and the luciferase activity was assayed at 24 h. All values are expressed as mean reporter gene activity in relative light units/unit of secreted alkaline phosphatase activity under duplicate conditions of a representative experiment. The standard deviation of the mean is indicated by the error bars.



A Nontruncated Myb Protein and Ets-2 Can Also Transactivate the CD13/APN Promoter

In the original description of Myb-Ets cooperation in transcriptional activation of the mim-1 promoter, full-length c- myb gene products were not able to activate transcription, while a truncated form of the Myb protein proved to be a potent transactivator (38) . To determine if restoration of the carboxyl terminus of c-Myb would affect transactivation of the CD13/APN promoter, the C33A human epithelial cell line was cotransfected with 1 µg of the -411luc reporter construct together with either the full-length c-Myb (pCMV4cMyb) or truncated Myb (pCt) expression construct and an Ets-1 (pEBets-1) expression plasmid (Fig. 9 A). In contrast to results with the mim-1 promoter, the full-length c-Myb protein competently transactivated the CD13/APN reporter construct.

Experiments with the mim-1 promoter had also suggested that only the more widely distributed Ets-2 protein, and not the Ets-1 protein, was capable of transactivating mim-1 gene expression. Since the Ets-2 protein is normally expressed in myeloid cells (45, 46, 47) , its ability to duplicate the regulatory function shown by the closely related Ets-1 protein was determined. In C33A human epithelial cells cotransfected with the -411luc reporter construct with either the pEBets-1 or pEBets-2 plasmid and with truncated Myb (pCt) expression plasmids, Ets-2 as well as Ets-1 cooperated with Myb to transactivate the CD13/APN promoter (Fig. 9 B). By contrast, in parallel experiments, other Ets family members expressed in myeloid cells (PU.1, Fli-1, and Elf-1) failed to produce a cooperative transactivating effect when combined with the Myb expression construct, although individually each was able to stimulate CD13/APN transcription (data not shown). These results suggest that while any of several Ets proteins normally found in myeloid cells can participate in the regulation of the CD13/APN gene, the ability to cooperate with Myb is more limited.


Figure 9: A nontruncated Myb protein and Ets-2 can also transactivate the CD13/APN promoter. A, the C33A human epithelial cell line was cotransfected with 1 µg of the -411luc reporter construct and optimal doses of expression vectors containing truncated Myb only (pCt; 1 µg), Ets-1 only (pEBets-1; 0.5 µg), full-length c-Myb only (pCMV4cMyb; 1 µg), or 0.5 µg of Ets-1 in combination with 1.0 µg of either Myb expression plasmid. The mean promoter activities were generated from duplicate conditions in a representative experiment, and the standard deviation of the mean is indicated by the error bars. Results are expressed as -fold activation above that obtained with cotransfection of equivalent amounts of the empty expression vectors. All values are normalized to the cotransfected MAP1-SEAP control plasmid. B, the C33A human epithelial cell line was cotransfected with 1 µg of the -411luc reporter construct and optimal doses of truncated Myb only (pCt; 1.0 µg), Ets-1 only (pEBets-1; 0.5 µg), Ets-2 only (pEBets-2; 0.5 µg), or 1.0 µg of Myb in combination with 0.5 µg of either Ets expression plasmid.




DISCUSSION

The CD13/APN differentiation antigen appears on the surface of the earliest cells committed to the myeloid developmental pathway. In myeloid cells, this antigen is thought to play a role in the regulation of cellular responses to peptide hormones (48) . Its early and exclusively myeloid pattern of expression suggests that study of CD13/APN gene regulation might yield valuable clues to the transcriptional control of myeloid differentiation genes in general. As demonstrated by this study, Myb and Ets, two well characterized proteins with defined roles in normal and aberrant hematopoiesis, are essential components of CD13/APN transcriptional regulation.

Precedence for Myb-Ets cooperativity comes from the avian E26 virus, in which the myb and ets-1 genes are fused and expressed as a tripartite protein containing the DNA-binding and transactivation domains of both products, together with viral gag sequences (23, 49) . E26 infection in chickens results in a mixed-lineage leukemia (myeloblasts with multipotent progenitor cells) and can transform mixed multipotent colonies as well as myeloblastic and mixed colonies in vitro (50, 51, 52) . Both v-Myb and v-Ets are weakly oncogenic in bone marrow cells when expressed singly, but become potent transforming and transactivating agents when coexpressed, either as separate proteins or as a fusion construct (31, 53) . In agreement with these observations, cotransfection of either the gag-myb-ets fusion protein or its components as separate proteins with CD13/APN reporter constructs results in higher-than-additive levels of reporter activity.()

The cooperativity displayed by Myb and Ets during CD13/APN and mim-1 gene transcription, together with their fusion in the E26 virus, suggests that the two proteins may physically associate in transcription complexes. Either v-Myb or v-Ets can weakly transform chicken erythroid cells, but only viruses containing the fusion protein are capable of causing avian leukemia (30) . Moreover, when expressed as separate proteins from a single vector, v-Myb and v-Ets induced leukemic cells at low efficiencies that, upon examination, had invariably recombined their virus to produce a fusion of the two oncoproteins (30) . This requirement for Myb-Ets physical association in leukemogenesis may simply reflect the normal interaction between these proteins during cell regulation. Myb and Ets may associate at specific points in normal hematopoiesis to regulate transcription, either by direct contact with each other or through interactions with other proteins. The lack of support for a physical association between Myb and Ets in previous studies (23, 30, 31, 38, 54) may indicate that Myb-Ets interactions are weak or transient or perhaps are achieved through as yet unidentified accessory proteins.

The mammalian and avian c-Myb proteins have been reported to have a negative regulatory domain (NRD) in their carboxyl-terminal regions, which are often deleted in oncogenic forms of the genes (20, 21, 22, 23) . Investigations of the NRD have demonstrated that it may influence the ability of the protein to bind DNA (55) , while studies based on the CSF-1R promoter (56) as well as investigations using Myb response elements linked to heterologous promoter constructs (24, 57, 58) indicate an active role for the NRD in repression of Myb transactivating capacity. This regulatory domain has been proposed to mediate interaction with an accessory negative regulatory protein that attenuates the activity of the Myb transactivation domain (58, 59, 60) . In support of this theory, studies in yeast in which full-length c-Myb was a much stronger activator than a protein bearing the oncogenic N- and C-terminal deletions of v-Myb indicate that an accessory protein or molecule found only in higher order organisms is responsible for the negative regulatory effects of the c-Myb NRD (61) . Investigations of native promoters (11, 38, 54, 62) have generally shown c-Myb to be an effective transactivator, although a full-length c-Myb expression plasmid was not as strong a transactivator of the mim-1 promoter as was a truncated form (with deletion of the NRD) in cooperation with the Ets-2 transcription factor (38) . Experiments reported in the present study, while not strictly addressing the relative transactivating ability of each protein, do indicate that when an equivalent amount of plasmid is transfected, an endogenous form of Myb is fully capable of synergizing with the Ets protein to transactivate the CD13/APN promoter. Apparent inconsistencies in the action of the NRD could again reflect variations in the interaction of c-Myb with distinct transactivating and accessory proteins in the context of a specific promoter. These interacting proteins may also vary in their patterns of expression, further influencing the effect of the NRD in different cell types and stages of differentiation.

Myb is expressed in all hematopoietic lineages (12, 63) and participates in the regulation of T-cell-specific (11, 62) and stem cell-specific (54) genes as well as genes whose expression is limited to myeloid cells (9, 10, 38) . Nevertheless, transcription factors expressed in multiple lineages often play important roles in myeloid-specific regulation of transcription through cooperation with other tissue-specific or temporally regulated factors (9, 10, 64, 65, 66) . For example, although the Ets family member PU.1 is expressed in both B-cells and myeloid cells, mutation of the PU.1-binding site significantly decreases CSF-1R promoter activity specifically in myeloid cells (65) . However, the observation that mutation of the Myb consensus site in the context of the wild-type CD13/APN promoter completely abrogated transcriptional activation in three hematopoietic cell lines of two different lineages, but did not affect the same construct in an epithelial cell line with low but detectable levels of activity from the wild-type promoter, would indicate that Myb does not solely determine the myeloid specificity of the CD13/APN promoter. Quite possibly, an Ets family member whose expression overlaps that of c-Myb only in myeloid cells participates in CD13/APN transcriptional regulation and confers myeloid specificity to that promoter. Of the myeloid-associated Ets family members tested in these experiments, only Ets-2 could cooperate with c-Myb to stimulate the CD13/APN promoter, suggesting that c-Myb may function to selectively boost the activity of this or a related Ets transcription factor, thus contributing to the lineage-restricted expression of the CD13/APN promoter. Alternatively, myeloid specificity may be conferred by a unique factor acting alone or in concert with Myb and Ets.

This report implicates the Myb and Ets family proteins in the regulation of genes expressed early in myeloid cell commitment. In related studies of the regulation of the CD34 stem cell-surface antigen (54) , c-Myb and Ets-2 were shown to act independently, with no evidence of a cooperative effect, on reporter constructs containing a fragment of the first exon of the CD34 gene linked to chloramphenicol acetyltransferase coding sequences. Experiments with the CSF-1R promoter (56) suggest that c-Myb acts as a repressor that blocks CSF-1R transactivation by Ets-1 and Ets-2. These findings contrast sharply with those of the present study and with the cooperative effect of v-Myb and Ets-2 in transactivation of the chicken promyelocyte-specific mim-1 promoter (38) . In unpublished studies from this laboratory,the synergistic effect of Myb and Ets was restricted to the CD13/APN promoter and did not extend to the human CD34, CSF-1R, or myeloperoxidase (which also contains Myb and Ets consensus sites (67) ) promoter constructs under identical experimental conditions. Thus, reported discrepancies in Myb-Ets interaction cannot be attributed solely to variations among experimental systems. The fundamental importance of Myb and Ets in myelopoiesis is clear from studies of myeloid cell development and E26 virus-induced avian leukemia. The experiments reported here suggest that the regulation of the CD13/APN gene, which correlates with the cooperation observed between the Myb and Ets proteins in E26 transformation, would provide an ideal mammalian model for studying Myb and Ets interactions in normal and aberrant myelopoiesis.


FOOTNOTES

*
This work was supported in part by Grant RO1 CA-42804 from the National Institutes of Health and by the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 901-531-2404; Fax: 901-531-2032; E-mail: lshapiro@mbcf.stjude.org.

The abbreviations used are: CD13/APN, CD13/aminopeptidase N; bp, base pair(s); kb, kilobase pair(s); NRD, negative regulatory domain; CSF-1R, colony-stimulating factor-1 receptor.

L. H. Shapiro, unpublished observations.


ACKNOWLEDGEMENTS

I thank Drs. Martine Roussel and Nathan Davis for many helpful discussions and for providing reagents. I thank Dr. Kathleen Weston for the pSCDMSMEnT dominant-negative Myb construct, Dr. Cristina Hernandez-Munain for the pCMV4cMyb expression plasmid, Dr. E. Premkumar Reddy for the pCt plasmid, Dr. Michael Ostrowski for the GST-Ets-DBD plasmid, and Dr. Jacques Ghysdael for the Ets expression plasmids. I am indebted to Jane D. Deaton, Elizabeth Mann, and Bart G. Jones for expert technical assistance. I thank Drs. Richard Bram, A. T. Look, and David Shapiro for helpful discussions and John Gilbert for editorial review.


REFERENCES
  1. Griffin, J. D., Ritz, J., Nadler, L. M., and Schlossman, S. F. (1981) J. Clin. Invest. 68, 932-941
  2. Griffin, J. D., Ritz, J., Beveridge, R. P., Lipton, J. M., Daley, J. F., and Schlossman, S. F. (1983) Int. J. Cell Cloning 1, 33-48 [Abstract]
  3. Hogg, N., and Horton, M. J. (1987) in Proceedings of the Third International Workshop on Human Leukocyte Differentiation Antigens: Leukocyte Typing III, pp. 576-621, Oxford University Press, New York
  4. Olson, E. N., and Klein, W. H. (1994) Genes & Dev. 8, 1-8
  5. Olson, E. N. (1993) Circ. Res. 72, 1-6 [Abstract/Free Full Text]
  6. Kuo, C. J., Conley, P. B., Chen, L., Sladek, F. M., Darnell, J. E., Jr., and Crabtree, G. R. (1992) Nature 355, 457-461 [CrossRef][Medline] [Order article via Infotrieve]
  7. Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S. F., D'Agati, V., Orkin, S. H., and Costantini, F. (1991) Nature 349, 257-260 [CrossRef][Medline] [Order article via Infotrieve]
  8. Orkin, S. H. (1992) Blood 80, 575-581 [Free Full Text]
  9. Burk, O., Mink, S., Ringwald, M., and Klempnauer, K. H. (1993) EMBO J. 12, 2027-2038 [Medline] [Order article via Infotrieve]
  10. Ness, S. A., Kowenz-Leutz, E., Casini, T., Graf, T., and Leutz, A. (1993) Genes & Dev. 7, 749-759
  11. Hernandez-Munain, C., and Krangel, M. S. (1994) Mol. Cell. Biol. 14, 473-483 [Abstract/Free Full Text]
  12. Westin, E. H., Gallo, R. C., Arya, S. K., Eva, A., Souza, L. M., Baluda, M. A., Aaronson, S. A., and Wong-Staal, F. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 2194-2198 [Abstract/Free Full Text]
  13. Gonda, T. J., and Metcalf, D. (1984) Nature 310, 249-251 [CrossRef][Medline] [Order article via Infotrieve]
  14. Kuehl, W. M., Bender, T. P., Stafford, J., McClinton, D., Segal, S., and Dmitrovsky, E. (1988) Curr. Top. Microbiol. Immunol. 141, 318-323 [Medline] [Order article via Infotrieve]
  15. Cuddihy, A. E., Brents, L. A., Aziz, N., Bender, T. P., and Kuehl, W. M. (1993) Mol. Cell. Biol. 13, 3505-3513 [Abstract/Free Full Text]
  16. Clarke, M. F., Kukowska-Latallo, J. F., Westin, E., Smith, M., and Prochownik, E. V. (1988) Mol. Cell. Biol. 8, 884-892 [Abstract/Free Full Text]
  17. Kirsch, I. R., Bertness, V., Silver, J., and Hollis, G. F. (1986) J. Cell. Biochem. 32, 11-21 [CrossRef][Medline] [Order article via Infotrieve]
  18. Patel, G., Kreider, B., Rovera, G., and Reddy, E. P. (1993) Mol. Cell. Biol. 13, 2269-2276 [Abstract/Free Full Text]
  19. Mucenski, M. L., McLain, K., Kier, A. B., Swerdlow, S. H., Schreiner, C. M., Miller, T. A., Pietryga, D. W., Scott, W. J., Jr., and Potter, S. S. (1991) Cell 65, 677-689 [CrossRef][Medline] [Order article via Infotrieve]
  20. Gerondakis, S., and Bishop, J. M. (1986) Mol. Cell. Biol. 6, 3677-3684 [Abstract/Free Full Text]
  21. Klempnauer, K. H., Symonds, G., Evan, G. I., and Bishop, J. M. (1984) Cell 37, 537-547 [CrossRef][Medline] [Order article via Infotrieve]
  22. Rosson, D., and Reddy, E. P. (1986) Nature 319, 604-606 [CrossRef][Medline] [Order article via Infotrieve]
  23. Graf, T. (1992) Curr. Opin. Genet. Dev. 2, 249-255 [CrossRef][Medline] [Order article via Infotrieve]
  24. Sakura, H., Kanei-Ishii, C., Nagase, T., Nakagoshi, H., Gonda, T. J., and Ishii, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5758-5762 [Abstract/Free Full Text]
  25. Hu, Y. L., Ramsay, R. G., Kanei-Ishii, C., Ishii, S., and Gonda, T. J. (1991) Oncogene 6, 1549-1553 [Medline] [Order article via Infotrieve]
  26. Grasser, F. A., Graf, T., and Lipsick, J. S. (1991) Mol. Cell. Biol. 11, 3987-3996 [Abstract/Free Full Text]
  27. Wasylyk, B., Hahn, S. L., and Giovane, A. (1993) Eur. J. Biochem. 211, 7-18 [Medline] [Order article via Infotrieve]
  28. Wang, C. Y., Petryniak, B., Ho, I. C., Thompson, C. B., and Leiden, J. M. (1992) J. Exp. Med. 175, 1391-1399 [Abstract/Free Full Text]
  29. Laudet, V., Niel, C., Duterque-Coquillaud, M., Leprince, D., and Stehelin, D. (1993) Biochem. Biophys. Res. Commun. 190, 8-14 [CrossRef][Medline] [Order article via Infotrieve]
  30. Metz, T., and Graf, T. (1991) Cell 66, 95-105 [CrossRef][Medline] [Order article via Infotrieve]
  31. Metz, T., and Graf, T. (1991) Genes & Dev. 5, 369-380
  32. Shapiro, L. H., Ashmun, R. A., Roberts, W. M., and Look, A. T. (1991) J. Biol. Chem. 266, 11999-12007 [Abstract/Free Full Text]
  33. Lemons, R. S., Nash, W. G., O'Brien, S. J., Benveniste, R. E., and Sherr, C. J. (1978) Cell 14, 995-1005 [CrossRef][Medline] [Order article via Infotrieve]
  34. Ulrich, M. J., and Ley, T. J. (1990) Blood 75, 990-999 [Abstract/Free Full Text]
  35. Bram, R. J., and Crabtree, G. R. (1994) Nature 371, 355-358 [CrossRef][Medline] [Order article via Infotrieve]
  36. Zhang, D. E., Fujioka, K., Hetherington, C. J., Shapiro, L. H., Chen, H. M., Look, A. T., and Tenen, D. G. (1994) Mol. Cell. Biol. 14, 8085-8095 [Abstract/Free Full Text]
  37. Bram, R. J., Hung, D. T., Martin, P. K., Schreiber, S. L., and Crabtree, G. R. (1993) Mol. Cell. Biol. 13, 4760-4769 [Abstract/Free Full Text]
  38. Dudek, H., Tantravahi, R. V., Rao, V. N., Reddy, E. S., and Reddy, E. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1291-1295 [Abstract/Free Full Text]
  39. Badiani, P., Corbella, P., Kiossus, D., Marvel, J., and Weston, K. (1994) Genes & Dev. 8, 770-782
  40. Aruffo, A. (1988) Current Protocols in Molecular Biology, pp. 16.13.1-16.13.7, Wiley-Interscience, New York
  41. Pahl, H. L., Burn, T. C., and Tenen, D. G. (1991) Exp. Hematol. 19, 1038-1041 [Medline] [Order article via Infotrieve]
  42. Nye, J. A., Petersen, J. M., Gunther, C. V., Jonsen, M. D., and Graves, B. J. (1992) Genes & Dev. 6, 975-990
  43. Jaynes, J. B., and O'Farrell, P. H. (1991) EMBO J. 10, 1427-1433 [Medline] [Order article via Infotrieve]
  44. Han, K., and Manley, J. L. (1993) EMBO J. 12, 2723-2733 [Medline] [Order article via Infotrieve]
  45. Bhat, N. K., Fisher, R. J., Fujiwara, S., Ascione, R., and Papas, T. S. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3161-3165 [Abstract/Free Full Text]
  46. Bhat, N. K., Komschlies, K. L., Fujiwara, S., Fisher, R. J., Mathieson, B. J., Gregorio, T. A., Young, H. A., Kasik, J. W., Ozato, K., and Papas, T. S. (1989) J. Immunol. 142, 672-678 [Abstract]
  47. Kola, I., Brookes, S., Green, A. R., Garber, R., Tymms, M., Papas, T. S., and Seth, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7588-7592 [Abstract/Free Full Text]
  48. Shipp, M. A., and Look, A. T. (1993) Blood 82, 1052-1070 [Free Full Text]
  49. Luscher, B., and Eisenman, R. N. (1990) Genes & Dev. 4, 2235-2241
  50. Graf, T., Oker-Blom, N., Todorov, T. G., and Beug, H. (1979) Virology 99, 431-436 [CrossRef][Medline] [Order article via Infotrieve]
  51. Moscovici, M. G., Jurdic, P., Samarut, J., Gazzolo, L., Mura, C. V., and Moscovici, C. (1983) Virology 129, 65-78 [CrossRef][Medline] [Order article via Infotrieve]
  52. Graf, T., McNagny, K., Brady, G., and Frampton, J. (1992) Cell 70, 201-213 [CrossRef][Medline] [Order article via Infotrieve]
  53. Frampton, J., Kouzarides, T., Doderlein, G., Graf, T., and Weston, K. (1993) EMBO J. 12, 1333-1341 [Medline] [Order article via Infotrieve]
  54. Melotti, P., and Calabretta B. (1994) J. Biol. Chem. 269, 25303-25309 [Abstract/Free Full Text]
  55. Ramsay, R. G., Ishii, S., and Gonda, T. J. (1991) Oncogene 6, 1875-1879 [Medline] [Order article via Infotrieve]
  56. Reddy, M. A., Yang, B. S., Yue, X., Barnett, C. J. K., Ross, I. L., Sweet, M. J., Hume, D. A., and Ostrowski, M. C. (1994) J. Exp. Med. 180, 2309-2319 [Abstract/Free Full Text]
  57. Kalkbrenner, F., Guehmann, S., and Moelling, K. (1990) Oncogene 5, 657-661 [Medline] [Order article via Infotrieve]
  58. Dubendorff, J. W., Whittaker, L. J., Eltman, J. T., and Lipsick, J. S. (1992) Genes & Dev. 6, 2524-2535
  59. Nomura, T., Sakai, N., Sarai, A., Sudo, T., Kanei-Ishii, C., Ramsay, R. G., Favier, D., Gonda, T. J., and Ishii, S. (1993) J. Biol. Chem. 268, 21914-21923 [Abstract/Free Full Text]
  60. Favier, D., and Gonda, T. J. (1994) Oncogene 9, 305-311 [Medline] [Order article via Infotrieve]
  61. Chen, R. H., and Lipsick, J. S. (1993) Mol. Cell. Biol. 13, 4423-4431 [Abstract/Free Full Text]
  62. Siu, G., Wurster, A. L., Lipsick, J. S., and Hedrick, S. M. (1992) Mol. Cell. Biol. 12, 1592-1604 [Abstract/Free Full Text]
  63. Slamon, D. J., Boone, T. C., Murdock, D. C., Keith, D. E., Press, M. F., Larson, R. A., and Souza, L. M. (1986) Science 233, 347-351 [Abstract/Free Full Text]
  64. Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E., and Tenen, D. G. (1993) J. Biol. Chem. 268, 8230-8239 [Abstract/Free Full Text]
  65. Zhang, D. E., Hetherington, C. J., Chen, H. M., and Tenen, D. G. (1994) Mol. Cell. Biol. 14, 373-381 [Abstract/Free Full Text]
  66. Zhang, D. E., Hetherington, C. J., Tan, S., Dziennis, S. E., Gonzalez, D. A., Chen, H. M., and Tenen, D. G. (1994) J. Biol. Chem. 269, 11425-11434 [Abstract/Free Full Text]
  67. Nuchprayoon, I., Meyers, S., Scott, L. M., Suzow, J., Hiebert, S., and Friedman, A. D. (1994) Mol. Cell. Biol. 14, 5558-5568 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Lin, A.-K. T. Perl, and J. M. Shannon
Erm/Thyroid Transcription Factor 1 Interactions Modulate Surfactant Protein C Transcription
J. Biol. Chem., June 16, 2006; 281(24): 16716 - 16726.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. Cowburn, A. Sobolewski, B. J. Reed, J. Deighton, J. Murray, K. A. Cadwallader, J. R. Bradley, and E. R. Chilvers
Aminopeptidase N (CD13) Regulates Tumor Necrosis Factor-{alpha}-induced Apoptosis in Human Neutrophils
J. Biol. Chem., May 5, 2006; 281(18): 12458 - 12467.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. K. Goto, T. Zor, M. Martinez-Yamout, H. J. Dyson, and P. E. Wright
Cooperativity in Transcription Factor Binding to the Coactivator CREB-binding Protein (CBP). THE MIXED LINEAGE LEUKEMIA PROTEIN (MLL) ACTIVATION DOMAIN BINDS TO AN ALLOSTERIC SITE ON THE KIX DOMAIN
J. Biol. Chem., November 1, 2002; 277(45): 43168 - 43174.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Rulli, J. Lenz, and L. S. Levy
Disruption of Hematopoiesis and Thymopoiesis in the Early Premalignant Stages of Infection with SL3-3 Murine Leukemia Virus
J. Virol., March 1, 2002; 76(5): 2363 - 2374.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Lauder, A. Castellanos, and K. Weston
c-myb Transcription Is Activated by Protein Kinase B (PKB) following Interleukin 2 Stimulation of T Cells and Is Required for PKB-Mediated Protection from Apoptosis
Mol. Cell. Biol., September 1, 2001; 21(17): 5797 - 5805.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M.-J. Shi, S.-R. Park, P.-H. Kim, and J. Stavnezer
Roles of Ets proteins, NF-{{kappa}}B and nocodazole in regulating induction of transcription of mouse germline Ig {{alpha}} RNA by transforming growth factor-{beta}1
Int. Immunol., June 1, 2001; 13(6): 733 - 746.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. V. Bhagwat, J. Lahdenranta, R. Giordano, W. Arap, R. Pasqualini, and L. H. Shapiro
CD13/APN is activated by angiogenic signals and is essential for capillary tube formation
Blood, February 1, 2001; 97(3): 652 - 659.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. A. Blobel
CREB-binding protein and p300: molecular integrators of hematopoietic transcription
Blood, February 1, 2000; 95(3): 745 - 755.
[Full Text] [PDF]


Home page
BloodHome page
S. P. Hegde, J. Zhao, R. A. Ashmun, and L. H. Shapiro
c-Maf Induces Monocytic Differentiation and Apoptosis in Bipotent Myeloid Progenitors
Blood, September 1, 1999; 94(5): 1578 - 1589.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Parker, M. Rivera, T. Zor, A. Henrion-Caude, I. Radhakrishnan, A. Kumar, L. H. Shapiro, P. E. Wright, M. Montminy, and P. K. Brindle
Role of Secondary Structure in Discrimination between Constitutive and Inducible Activators
Mol. Cell. Biol., August 1, 1999; 19(8): 5601 - 5607.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Wang, E. Scott, C. L. Sawyers, and A. D. Friedman
C/EBPalpha Bypasses Granulocyte Colony-Stimulating Factor Signals to Rapidly Induce PU.1 Gene Expression, Stimulate Granulocytic Differentiation, and Limit Proliferation in 32D cl3 Myeloblasts
Blood, July 15, 1999; 94(2): 560 - 571.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Inoue, C. J. Sherr, and L. H. Shapiro
Regulation of the CD13/Aminopeptidase N Gene by DMP1, a Transcription Factor Antagonized by D-Type Cyclins
J. Biol. Chem., October 30, 1998; 273(44): 29188 - 29194.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. P. Hegde, A. Kumar, C. Kurschner, and L. H. Shapiro
c-Maf Interacts with c-Myb To Regulate Transcription of an Early Myeloid Gene during Differentiation
Mol. Cell. Biol., May 1, 1998; 18(5): 2729 - 2737.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. Ma, Q. Su, and P. Tempst
Differentiation-stimulated Activity Binds an ETS-like, Essential Regulatory Element in the Human Promyelocytic defensin-1 Promoter
J. Biol. Chem., April 10, 1998; 273(15): 8727 - 8740.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Yang, L. H. Shapiro, M. Rivera, A. Kumar, and P. K. Brindle
A Role for CREB Binding Protein and p300 Transcriptional Coactivators in Ets-1 Transactivation Functions
Mol. Cell. Biol., April 1, 1998; 18(4): 2218 - 2229.
[Abstract] [Full Text]


Home page
BloodHome page
M. Z. Ratajczak, D. Perrotti, P. Melotti, M. Powzaniuk, B. Calabretta, K. Onodera, D. A. Kregenow, B. Machalinski, and A. M. Gewirtz
Myb and Ets Proteins Are Candidate Regulators of c-kit Expression in Human Hematopoietic Cells
Blood, March 15, 1998; 91(6): 1934 - 1946.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Noti
Sp3 Mediates Transcriptional Activation of the Leukocyte Integrin Genes CD11C and CD11B and Cooperates with c-Jun to Activate CD11C
J. Biol. Chem., September 19, 1997; 272(38): 24038 - 24045.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. G. Tenen, R. Hromas, J. D. Licht, and D.-E. Zhang
Transcription Factors, Normal Myeloid Development, and Leukemia
Blood, July 15, 1997; 90(2): 489 - 519.
[Full Text] [PDF]


Home page
BloodHome page
I. Nuchprayoon, C. P. Simkevich, M. Luo, A. D. Friedman, and A. G. Rosmarin
GABP Cooperates With c-Myb and C/EBP to Activate the Neutrophil Elastase Promoter
Blood, June 15, 1997; 89(12): 4546 - 4554.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. L. Brandt, D. J. Fraser, S. Leal, P. M. Halandras, A. R. Kroll, and D. J. Kroll
c-Myb trans-Activates the Human DNA Topoisomerase IIalpha Gene Promoter
J. Biol. Chem., March 7, 1997; 272(10): 6278 - 6284.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J Frampton, T Ramqvist, and T Graf
v-Myb of E26 leukemia virus up-regulates bcl-2 and suppresses apoptosis in myeloid cells.
Genes & Dev., November 1, 1996; 10(21): 2720 - 2731.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
R. Kang, H. Saito, Y. Ihara, E. Miyoshi, N. Koyama, Y. Sheng, and N. Taniguchi
Transcriptional Regulation of the N-Acetylglucosaminyltransferase V Gene in Human Bile Duct Carcinoma Cells (HuCC-T1) Is Mediated by Ets-1
J. Biol. Chem., October 25, 1996; 271(43): 26706 - 26712.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shapiro, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shapiro, L. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement