![]()
|
|
||||||||
From the
Two DNA clones encoding rabbit
The H antigen, the fucosylated structure of the terminal
Since these
fucosylated glycoconjugates showed developmental changes, especially
during the perinatal period
(7) , they may function as important
molecules in the development of the nervous system, such as axon
elongation or myelination. Some fucosylated glycoconjugates are known
to play an important role in cell adhesion
(9, 10, 11) . However, the significance of
glycoconjugates bearing a Fuc
Recent genetic and biochemical studies
indicated that human H blood-type
To express the soluble forms of RFT-I and
RFT-II, comprising recombinant fucosyltransferases in which the
N-terminal part was replaced with the immunoglobulin signal peptide
sequence, expression plasmids pUGS-RFT-I and pUGS-RFT-II were
constructed. The genes encoding the putative catalytic domain and
3`-untranslated region were specifically amplified by PCR using a
synthetic sense primer, 5`-TGTCTGGAATTCCAGCCGGTGCCAGCCCC-3`, and an
antisense primer, 5`-TCTCCCGAATTCTGCCCAGGTAGAATCACT-3`, for RFT-I, and
another sense primer, 5`-GTGGTCGAATTCCCCGGACACCTACCCC-3`, and another
antisense primer, 5`-AAGTCTGAATTCAGACTCCGTGTGGGATCC-3`, for RFT-II
(synthetic EcoRI site underlined). The amplified DNA fragments
were digested with EcoRI and then ligated into the
EcoRI site of pUGS
(20) to generate pUGS-RFT-I and
pUGS-RFT-II. The fusion constructs were verified by DNA sequencing to
confirm fusion junction sequences.
To obtain the soluble forms, COS-7 cells (100-mm
culture dish) were transiently transfected with 10 µg of pUGS-RFT-I
or pUGS-RFT-II by the DEAE-dextran method. The culture medium was
concentrated 10-fold on Centricon 30 filters (Amicon) and then
subjected to the fucosyltransferase assay.
RFT-I and RFT-II catalyze the transfer of GDP-fucose to a
The
deduced amino acid sequence of RFT-I showed 80% identity with that of
human H blood-type
RFT-II has higher affinity to types 1 and 3 acceptors than type 2
ones. It exhibits significantly lower affinity for
phenyl-
Comparison of the rabbit
Our previous
histochemical study revealed that the expression of fucosyl G
The table shows the apparent K
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank/EMBL Data Bank with accession number(s) X80225 and X80226.
We thank Drs. Nobuyuki Kurosawa, Takashi Nakaoka,
Naoya Kojima, and Toshiro Hamamoto for helpful discussions.
Volume 270,
Number 15,
Issue of April 14, pp. 8844-8850, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
-Galactoside
1,2-Fucosyltransferase (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-galactoside
1,2-fucosyltransferase (RFT-I and RFT-II) have been isolated from
a rabbit genomic DNA library. The DNA sequences revealed open reading
frames coding for 373 (RFT-I) and 354 (RFT-II) amino acids,
respectively. The deduced amino acid sequences of RFT-I and RFT-II
showed 56% identity with each other, and that of RFT-I showed 80%
identity with that of human H blood type
1,2-fucosyltransferase.
Northern blot analysis of embryo and adult rabbit tissues revealed that
the RFT-I gene was expressed in adult brain, and that the RFT-II gene
was expressed in salivary and lactating mammary glands. The identities
of these enzymes were confirmed by constructing recombinant
fucosyltransferases in which the N-terminal part including the
cytoplasmic tail and signal anchor domain was replaced with the
immunoglobulin signal peptide sequence. RFT-I expressed in COS-7 cells
exhibited similar transferase activity to that of human H blood type
1,2-fucosyltransferase. RFT-II expressed in COS-7 cells showed
higher affinity for type 1 (Gal
1,3GlcNAc) and type 3
(Gal
1,3GalNAc) acceptors than type 2 (Gal
1,4GlcNAc) ones,
which suggested that RFT-II was a putative secretor-type
1,2-fucosyltransferase.
-
D-Gal residue, is synthesized by
GDP-
L-fucose:
-
D-galactoside
2-
-
L-fucosyltransferase (
1,2-FT)(
)
(reviewed in Ref. 1). The expression of H determinants is
strictly regulated temporally and spatially during vertebrate
development
(2, 3, 4) . We previously reported
histochemical investigation of glycoconjugates containing a terminal
Fuc
1,2Gal residue in the human and rabbit nervous systems, using
polyclonal and monoclonal anti-fucosyl Gantibodies, and
UEA-1 lectin
(5, 6, 7, 8) . The
anti-fucosyl G
antibodies and UEA-1 lectin recognized a
subpopulation of neurons in the dorsal root ganglia (DRG) and dorsal
horn of the spinal cord. The anti-fucosyl G
antibodies
also bound to the satellite cells surrounding the fucosyl
G
-positive neurons
(5, 7) . In addition, in
rabbits, the anti-fucosyl G
antibodies bound to the axons
and the myelin of the small myelinated fibers in the dorsal root, and
the large neurons in the ventral horn
(8) .
1,2Gal residue remains to be
clarified. To elucidate the mechanisms underlying the regulation of
fucosylation and the possible functional roles of the glycoconjugates
with a Fuc
1,2Gal residue, molecular analysis of the
1,2-FT
gene is indispensable.
1,2-FT and Se-type
1,2-FT
are encoded by distinct but closely linked structural genes, the H and
Se genes
(12, 13) . Enzymatic characterization of the
two
1,2-FTs revealed differences in the Kvalues for various oligosaccharide acceptors
(14, 15) . Further analysis of the structures and in
their regulation of the
1,2-FT genes requires molecular cloning,
and one
1,2-FT gene for an H blood-type determinant has been
cloned so far
(16) . We have tried to clone rabbit
1,2-FTs
in order to reveal the role of the Fuc
1,2Gal epitope in the
development of the nervous system. A rabbit genomic DNA library was
screened, because the entire open reading frame of human H blood-type
1,2-FT is encoded by one exon
(17) . Here we report the
molecular cloning of two types of rabbit
1,2-FTs, one of which is
a counterpart of human H blood-type
1,2-FT and the other a
putative Se-type
1,2-FT as judged on kinetic analysis.
Materials
GDP-Fuc, phenyl-
-
D-Gal,
p-nitrophenyl-
-
D-Gal,
p-nitrophenyl-
-
D-Gal,
p-nitrophenyl-
-
D-GalNAc, galactose
1,3- N-acetyl-glucosaminide (Gal
1,3GlcNAc),
Gal
1,4GlcNAc, Gal
1,3GalNAc, lactose, Fuc
1,2lactose,
lacto- N-tetraose, lacto- N-neotetraose, asialofetuin,
1-acid glycoprotein, bovine submaxillary mucin, and FITC-labeled
UEA-1 lectin were from Sigma. Asialo-
1-acid glycoprotein and
bovine submaxillary asialomucin were obtained by mild acid treatment of
the respective glycoproteins. GDP-[
C]Fuc (10.5
GBq/mmol) was from DuPont Corp. (France). Gwas from
Biosynth AG (Switzerland). Paragloboside was from Dia-Iatron (Tokyo,
Japan). Monoclonal antibodies to blood groups A and B were from Biomeda
(Foster City, CA). FITC-labeled anti-mouse Ig(G and M) was from Tago
(Burlingame, CA). Restriction endonucleases were from Takara (Kyoto,
Japan).
Construction of a Genomic DNA Library
The standard
molecular cloning techniques described by Maniatis and co-workers were
used
(18) . DNA was prepared from rabbit brain and then
partially digested with Sau3AI. Size-fractionated DNA
(10-15 kb) was ligated to -EMBL3 (Stratagene) and then
packaged in vitro with the Gigapack II Gold packaging extract
(Stratagene). The resulting genomic DNA library was plated using
Escherichia coli strain MRA as a host for screening.
Polymerase Chain Reaction (PCR)
The PCR fragments
used as probes for screening of the rabbit genomic DNA library were
amplified using primers as to the deduced catalytic region of human H
blood-type
1,2-FT. Sense primer FT12, TCGTGGTCACCAGCAACGGCATG, and
antisense primer FT14, TCAGAGTCTGGCAGGGTGAAGTT, were synthesized with
an Applied Biosystem 394 DNA Synthesizer, and rabbit genomic DNA was
used as a template for PCR. PCR amplification was carried out using a
DNA thermal cycler (Perkin-Elmer), with 40 cycles consisting of
denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s,
and extension at 72 °C for 30 s. The PCR products (229 bp) were
blunt-ended, phosphorylated, and then subcloned into the EcoRV
site of plasmid pBluescript SK(+).
Screening of the Rabbit Genomic DNA Library
About
2 10
plaques of the rabbit genomic DNA library were
screened by the standard hybridization method with the
P-labeled random-primed (Amersham Corp.) PCR product (229
bp) as a probe. Two independent positive plaques containing 12.6-kb
(RG11) and 14.9-kb (RG101) inserts were isolated to homogeneity.
DNA Sequence Analysis
The RG11 and RG101 DNA
fragments were digested with appropriate restriction enzymes and then
subcloned into vector plasmid pUC 119. The DNA sequences were
determined by the dideoxynucleotide chain-termination method using an
Autocycle DNA sequencing kit and an ALF DNA sequencer (Pharmacia
Biotech Inc.). The sequences were analyzed using a PC/Gene (Teijin
System Technology, Japan).
Northern and Southern Hybridization
Total RNA was
prepared by the guanidium thiocyanate method and purified by
ultracentrifugation through 5.7
M CsCl. Poly(A)-rich RNA was
purified with Oligotex-dT30 (Takara). The poly(A)-rich RNA (5 µg)
was fractionated on a denaturing formaldehyde-agarose gel (1.2%), and
then transferred onto a nylon membrane (Nytran; Schleicher &
Schell). Genomic DNA (10 µg) was digested for 2 h with several
restriction enzymes and then loaded onto a 0.6% agarose gel. After
electrophoresis, the gel was denatured (1 h) with 0.5
N NaOH
and 1.5
M NaCl, and then the DNA was transferred to a nylon
membrane. Both Northern and Southern filters were prehybridized in 50%
formamide, 5 SSPE, 5
Denhardt's, 0.5% SDS, 0.25%
sodium lauryl sarcosine, and 100 µg/ml denatured salmon sperm DNA
at 37 °C for 2 h. Hybridization was then performed overnight at 37
°C with the PstI fragment (680 bp) for RFT-I and with the
NaeI fragment (446 bp) for RFT-II labeled with
P,
using the random priming method. The filters were washed twice in 2
SSC, 0.1% SDS at 65 °C, and finally in 0.5
SSC,
0.1% SDS at 65 °C for 30 min.
Mammalian Vector Plasmid Construction
A
SmaI fragment (1.5 kb) of RG11 DNA containing the full open
reading frame of RFT-I was ligated into mammalian expression vector
pcD-SR
(19) , which had previously been digested with
EcoRI, blunt-ended with T4 DNA polymerase, and
dephosphorylated with bacterial alkaline phosphatase. RG101 DNA was
digested with SalI and partially digested with XhoI,
and a XhoI- SalI fragment (2.3 kb) containing the full
open reading frame of RFT-II was ligated into pcD-SR
, which had
previously been digested with XhoI and then dephosphorylated.
The single insertion in the correct orientation was finally analyzed
with restriction enzymes.
Expression of Fucosyltransferase
COS-7 cells
(100-mm culture dish) were transiently transfected with 10 µg of
pcD-SR
-RFT-I or pcD-SR
-RFT-II using the DEAE-dextran
procedure
(21) . The cells were trypsinized and divided into
several smaller dishes 24 h post-transfection. The cells were stained
with FITC-labeled UEA-1 lectin or with monoclonal antibodies to blood
group A or B at 72 h post-transfection. After washing with PBS, the
cells were fixed with formaldehyde for 3 min, washed, and then
incubated in 3% bovine serum albumin/PBS. After washing briefly with
PBS, the cells were incubated in 2 ng/ml FITC-labeled UEA-1 lectin in
3% bovine serum albumin/PBS for 1.5 h, or in monoclonal antibodies to
blood group A or B for 1.5 h, and then washed with PBS, followed by
incubation with FITC-labeled anti-mouse Ig(G and M) for 1 h. After
washing three times with PBS, the cells were observed under a
fluorescence microscope. The cells from another dish were washed with
PBS and then with 25 m
M MES for 10 min, and then collected
with a rubber policemen and pelleted by centrifugation. The pellets
were resuspended in cold 1% Triton X-100 and then sonicated briefly
(22) .
Fucosyltransferase Assay
The fucosyltransferase
assays were performed according to the previous report
(22) , in
a mixture of 25 m
M sodium phosphate (pH 6.1), 5 m
M ATP, 30 µ
M GDP-fucose, 3 µ
M GDP-[
C]fucose (10.5 Bq/pmol), the enzyme
solution and substrates in a final volume of 10 µl. Each reaction
mixture was incubated at 37 °C for 2 h, and then applied to a
Silica Gel 60 HPTLC plate (Merck, Germany). The plate was developed
with ethanol:pyridine:1-butanol:water:acetic acid (100:10:10:30:3) for
oligosaccharide acceptors, and with chloroform:methanol:0.5% CaCl
(55:45:10) for glycolipid acceptors, respectively. When
glycolipids and benzyl-oligosaccharides were used as substrates, the
reaction mixture was applied to C-18 Sep-Pak cartridge
(Waters-Millipore), washed with 2 ml of water, and then eluted with 1
ml of methanol. The eluate was then applied to a HPTLC plate and
developed. The radioactivity on each plate was visualized and
determined with a BAS2000 radioimage analyzer (Fuji Film, Japan).
Cloning and Nucleotide Sequence of Rabbit
A DNA fragment (229 bp; Fig. 2 A,
underlined) was obtained by PCR amplification with sense
primer FT-12 and antisense primer FT-14 from rabbit genomic DNA. To
obtain DNA encoding rabbit
1,2-FT
1,2-FT, a rabbit genomic DNA library
was screened with the PCR product as a probe. Two positive clones, RG11
(Fig. 1 A) and RG101 (Fig. 1 B), were obtained.
Sequence analysis revealed that RG11 contained an entire open reading
frame, encoding 373 amino acids with a predicted molecular mass of 42
kDa (RFT-I, Fig. 2 A) and that RG101 contained an entire open
reading frame, encoding 354 amino acids with a predicted molecular mass
of 40 kDa (RFT-II, Fig. 2 B).
Figure 2:
Nucleotide and deduced amino acid
sequences of rabbit RFT-I ( A) and RFT-II ( B), and
comparison of the deduced amino acid sequences of human H blood-type
1,2-FT, RFT-I, and RFT-II ( C). A and B,
the nucleotide and amino acid sequences are numbered from the
presumed start codon and initiation methionine, respectively. The
boxed amino acids correspond to a putative signal-anchor
domain. The asterisks indicate potential
N-glycosylation sites (Asn- X-Ser/Thr). The PCR
product used as a probe for screening of the genomic DNA library is
underlined. C, a putative signal-anchor domains is
boxed. The asterisks indicate that the three aligned
residues are identical.
Figure 1:
Restriction maps for RG11 ( A)
and RG101 ( B), and the sequence-analysis strategy. The coding
region is depicted as a shaded box and the non-coding
region as a solid line. The arrows indicate
the direction and extent of sequencing.
Comparison of the
primary structure of RFT-I and RFT-II revealed 56% of significant amino
acid identity (Fig. 2 C). Deduced amino acid sequences of
RFT-I and RFT-II showed 80% and 55% identity with that of human
1,2-FT, respectively.
Southern and Northern Blot Analysis
When the
entire coding region was used as a probe, more than one band was
detected on genomic Southern blot analysis. We then used the
PstI fragment (680 bp) of RFT-I and the NaeI fragment
(446 bp) of RFT-II as probes that hybridized to one band on Southern
blotting (data not shown). Northern blot analysis revealed that a
3.8-kb mRNA of RFT-I was expressed in adult cerebrum and cerebellum
(Fig. 3 A), and that a 1.6-kb mRNA of RFT-II was detected in
salivary and lactating mammary glands (Fig. 3 B). The
transcription of RFT-I in brain was first detected on embryonic day 28
and increased thereafter. The probe for RFT-II did not hybridize to
embryonic tissues.
Figure 3:
Northern blot analyses of RFT-I
( A) and RFT-II ( B). Poly(A)-rich rabbit RNAs (5
µg) were electrophoresed and then hybridized with the PstI
fragment (680 bp) of RFT-I or with the NaeI fragment (446 bp)
of RFT-II labeled with P.
Expression of RFT-I and RFT-II and the Enzyme
Assay
Cell extracts from COS-7 cells transfected with
pcD-SR
-RFT-I or pcD-SR
-RFT-II, and concentrated culture
medium from COS-7 cells transfected with pUGS-RFT-I or pUGS-RFT-II were
subjected to the fucosyltransferase assay. When
phenyl-
-
D-Gal was used as a substrate, radiolabeled
fucose was incorporated into the substrate with any of the enzyme
preparations (Fig. 4), which meant both RFT-I and RFT-II were
fucosyltransferases. FITC-labeled UEA-1 lectin staining, however,
showed that pcD-SR
-RFT-I transfected COS-7 cells were positive but
that pcD-SR
-RFT-II transfected COS-7 cells were negative (Fig. 5),
which suggested differences in acceptor specificity between RFT-I and
RFT-II. COS-7 cells transfected with pcD-SR
-RFT-I or
pcD-SR
-RFT-II were positive for blood group A, but both were
negative for blood group B (Fig. 5).
Figure 5:
Expression of UEA-1 lectin-reactive
glycoconjugates and blood group A antigens on RFT-I and RFT-II
transfected COS-7 cells. COS-7 cells were transiently transfected with
10 µg of pcD-SR
, pcD-SR
-RFT-I, or pcD-SR
-RFT-II
using the DEAE-dextran procedure. The cells were divided into five
dishes by trypsinization 24 h post-transfection, and were stained with
UEA-1 lectin, anti-blood group A or B antibodies, or negative control
IgG 72 h post-transfection. Transfection of RFT-I or RFT-II was
verified by measuring fucosyltransferase activity using cell extract
from another dish.
Because the
fucosyltransferase activity of the cell extracts was virtually
identical with and stronger than that of concentrated culture medium,
respectively, the cell extracts were used for further kinetic analysis.
Both RFT-I and RFT-II could transfer fucose to pNP-
-Gal but not to
pNP-
-Gal or pNP-
-GalNAc. Both enzymes could also fucosylate
lactose to form fucosyl lactose, which comigrated with
Fuc
1,2lactose on HPTLC with several solvent systems. As shown in
Table I, RFT-I exhibited almost the same reactivity with type 1
(Gal
1,3GlcNAc), type 2 (Gal
1,4GlcNAc), and type 3
(Gal
1,3GalNAc) acceptors, but RFT-II showed higher reactivity with
type 1 or type 3 than type 2 acceptors. Lineweaver-Burk plots for LNT,
LNnT, phenyl-
-
D-Gal, and types 1, 2, and 3
oligosaccharides are shown in Fig. 6. RFT-I and RFT-II could transfer
fucose not only to asialoglycoproteins but also to glycolipids.
Experiments were performed in triplicate, and typical plots and values
of Kand
V
/ Kwere shown in
Fig. 6
and , respectively.
Figure 6:
Lineweaver-Burk plots. Lineweaver-Burk
plots for RFT-I ( closed circles) and RFT-II
( closed squares) used to calculate the K and
V
/ K values are shown. Experiments were
performed in triplicate, and typical plots are
shown.
-Gal residue but not to
-Gal or
-GalNAc. Fucosyl lactose
formed from fucose and lactose by both enzymes comigrated with standard
Fuc
1,2lactose on HPTLC with several solvent systems. COS-7 cells
transfected with RFT-I were stained with UEA-1 lectin, which is thought
to recognize the fucosylated type 2 chain of glycoproteins with an
1,2 linkage
(23) . Whereas COS-7 cells maintain
N-acetylgalactosaminyltransferase activity, both RFT-I and
RFT-II transfected COS-7 cells were positive for monoclonal antibodies
to blood group A, which is specific to
GalNAc
1,4-(Fuc
1,2)-
-galactoside. These observations
support the notion that RFT-I and RFT-II could be
1,2-FTs.
1,2-FT
(16) , whereas the deduced amino
acid sequence of RFT-II showed 55% and 56% identity with those of RFT-I
and human H blood-type
1,2-FT, respectively. The
Kvalues of RFT-I are comparable for
phenyl-
-
D-Gal, and types 1, 2, and 3 acceptors, which
suggests that the binding specificity of RFT-I is primarily restricted
to terminal
-
D-Gal residues of acceptors. This
observation is consistent with the kinetic properties of human H
blood-type
1,2-FT
(14) . RFT-I exhibited reactivity with
glycolipids that share the same terminal determinant with a free
oligosaccharide, but there were some discrepancies regarding the
reactivity of H blood-type
1,2-FT with glycolipids among previous
reports
(14, 24, 25) . The structural and
kinetic characteristics support that RFT-I is a rabbit counterpart of
human H blood-type
1,2-FT. Human H blood-type
1,2-FT is
expressed in tissues of mesodermal origin
(1, 12) ,
whereas the expression of RFT-I is limited in the brain. It is not
uncommon that an expression pattern differs from species to species.
-
D-Gal and type 2 acceptors, compared with RFT-I.
The kinetic parameters of RFT-II are comparable with those of human
Se-type
1,2-FT, which has higher affinity for types 1 and 3
acceptors than type 2 ones and phenyl-
-
D-Gal
(15) . The transcription distribution of RFT-II in secretory
glands is similar to that of human Se-type
1,2-FT
(13) . We
conclude that RFT-II is a rabbit counterpart of putative human Se-type
1,2-FT. RFT-II transfected COS-7 cells were negative for UEA-1
lectin staining but were positive for blood group A. RFT-II is possibly
unable to accept type 2 glycochains as acceptors, and, in this case,
the blood group A antigens of RFT-II transfected COS-7 cells comprise
type 1 glycochains. Another possible explanation is that RFT-II
transfers fucose in a lower amount to type 2 glycochains, which are
then completely converted to blood group A active molecules.
1,2-FTs and recently cloned rat DNA
fragments of the putative
1,2-FTs
(26) revealed that the
deduced amino acid sequence of RFT-I showed more homology with that of
rat FTA (84% identity) than with that of rat FTB (72% identity). The
deduced amino acid sequence of RFT-II showed 74% and 80% identity with
those of rat FTA and rat FTB, respectively. However, this does not
necessarily mean that rat FTA and FTB are genes corresponding to RFT-I
and RFT-II, respectively, because there might be additional and closely
related
1,2-FTs other than RFT-I and RFT-II. Molecular cloning of
the entire genes and kinetic analysis of putative rat
1,2-FTs are
necessary before coming to a conclusion regarding the relationship
between RFT-I, RFT-II, and rat FTA and FTB.
and UEA-1 lectin reactive antigens was strictly regulated during
development, especially during the perinatal period
(7, 8) . In rabbit DRG neurons, fucosyl G
is readily detected immunohistochemically on embryonic day 25,
followed by the appearance of UEA-1 lectin-reactive antigens
postnatally
(7) . UEA-1 lectin-reactive antigens of DRG neurons
in postnatal rabbits could be formed through fucosylation catalyzed by
RFT-I, although we could not analyze the developmental expression
pattern of RFT-I in DRG because of the scarcity of the tissue and the
relative non-abundance of RFT-I expression. On the contrary, fucosyl
G
observed in DRG neurons of embryonic day 25 rabbits
might not be the product of RFT-I because UEA-1 lectin-reactive
antigens are not detected at that stage. This observation suggests the
existence of another type of
1,2-FT that catalyzes preferential
fucosylation of glycolipids.
Table: Acceptor specificities of RFT-I and RFT-II
and V
/ Kvalues and relative activities as to the incorporation of fucose
into phenyl-
-
D-Gal as a substrate.
1,2-FT,
GDP-
L-fucose:
-
D-galactoside
2-
-
L-fucosyltransferase; kb, kilobase(s); bp, base
pair(s); PCR, polymerase chain reaction; PBS, phosphate-buffered
saline; MES, 2-( N-morpholino)ethanesulfonic acid; FITC,
fluorescein isothiocyanate; HPTLC, high performance thin layer
chromatography; DRG, dorsal root ganglia; UEA-1, Ulex europaeus agglutinin 1; Se-type, secretor-type; nomenclature for
gangliosides and glycolipids follows the system of Svennerholm (27).
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. Saunier, J.-P. Barreaud, A. Eggen, R. Oriol, H. Leveziel, R. Julien, and J.-M. Petit Organization of the Bovine {alpha}2-Fucosyltransferase Gene Cluster Suggests that the Sec1 Gene Might Have Been Shaped Through a Nonautonomous L1-Retrotransposition Event Within the Same Locus Mol. Biol. Evol., November 1, 2001; 18(11): 2083 - 2091. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Barreaud, K. Saunier, J. Souchaire, D. Delourme, A. Oulmouden, R. Oriol, H. Leveziel, R. Julien, and J.-M. Petit Three bovine {alpha}2-fucosyltransferase genes encode enzymes that preferentially transfer fucose on Gal{beta}1-3GalNAc acceptor substrates Glycobiology, June 1, 2000; 10(6): 611 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-A. Apoil, F. Roubinet, S. Despiau, R. Mollicone, R. Oriol, and A. Blancher Evolution of {alpha}2-Fucosyltransferase Genes in Primates: Relation Between an Intronic Alu-Y Element and Red Cell Expression of ABH Antigens Mol. Biol. Evol., March 1, 2000; 17(3): 337 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hitoshi, S. Kusunoki, I. Kanazawa, and S. Tsuji Dorsal Root Ganglia Neuron-specific Promoter Activity of the Rabbit beta -Galactoside alpha 1,2-Fucosyltransferase Gene J. Biol. Chem., January 1, 1999; 274(1): 389 - 396. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Sidhu and S. J. Kimber Hormonal Control of H-Type {alpha}(1-2)Fucosyltransferase Messenger Ribonucleic Acid in the Mouse Uterus Biol Reprod, January 1, 1999; 60(1): 147 - 157. [Abstract] [Full Text] |
||||
![]() |
M. Costache, P.-A. Apoil, A. Cailleau, A. Elmgren, G. Larson, S. Henry, A. Blancher, D. Iordachescu, R. Oriol, and R. Mollicone Evolution of Fucosyltransferase Genes in Vertebrates J. Biol. Chem., November 21, 1997; 272(47): 29721 - 29728. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaneko, S. Nishihara, N. Shinya, T. Kudo, H. Iwasaki, T. Seno, Y. Okubo, and H. Narimatsu Wide Variety of Point Mutations in the H Gene of Bombay and Para-Bombay Individuals That Inactivate H Enzyme Blood, July 15, 1997; 90(2): 839 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Oulmouden, A. Wierinckx, J.-M. Petit, M. Costache, M. M. Palcic, R. Mollicone, R. Oriol, and R. Julien Molecular Cloning and Expression of a Bovine alpha (1,3)-Fucosyltransferase Gene Homologous to a Putative Ancestor Gene of the Human FUT3-FUT5-FUT6 Cluster J. Biol. Chem., March 28, 1997; 272(13): 8764 - 8773. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koda, M. Soejima, and H. Kimura Structure and Expression of H-type GDP-L-Fucose:beta -D-Galactoside 2-alpha -L-Fucosyltransferase Gene (FUT1). TWO TRANSCRIPTION START SITES AND ALTERNATIVE SPLICING GENERATE SEVERAL FORMS OF FUT1 mRNA J. Biol. Chem., March 14, 1997; 272(11): 7501 - 7505. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hitoshi, S. Kusunoki, I. Kanazawa, and S. Tsuji Molecular Cloning and Expression of a Third Type of Rabbit GDP-L-Fucose:beta -D-Galactoside 2-alpha -L-Fucosyltransferase J. Biol. Chem., July 12, 1996; 271(28): 16975 - 16981. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kurosawa, M. Inoue, Y. Yoshida, and S. Tsuji Molecular Cloning and Genomic Analysis of Mouse Galbeta 1,3GalNAc-specific GalNAc alpha 2,6-Sialyltransferase J. Biol. Chem., June 21, 1996; 271(25): 15109 - 15116. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. West, T. Scott-Ward, P. Teng-umnuay, H. van der Wel, E. Kozarov, and A. Huynh Purification and Characterization of an alpha1,2-L-Fucosyltransferase, Which Modifies the Cytosolic Protein FP21, from the Cytosol of Dictyostelium J. Biol. Chem., May 17, 1996; 271(20): 12024 - 12035. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kudo, H. Iwasaki, S. Nishihara, N. Shinya, T. Ando, I. Narimatsu, and H. Narimatsu Molecular Genetic Analysis of the Human Lewis Histo-blood Group System J. Biol. Chem., April 19, 1996; 271(16): 9830 - 9837. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Thurin and M. Blaszczyk-Thurin Porcine Submaxillary Gland GDP-L-fucose:beta-D-Galactoside alpha-2-L-Fucosyltransferase Is Likely a Counterpart of the Human Secretor Gene-encoded Blood Group Transferase J. Biol. Chem., November 3, 1995; 270(44): 26577 - 26580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Domino, L. Zhang, and J. B. Lowe Molecular Cloning, Genomic Mapping, and Expression of Two Secretor Blood Group alpha (1,2)Fucosyltransferase Genes Differentially Regulated in Mouse Uterine Epithelium and Gastrointestinal Tract J. Biol. Chem., June 22, 2001; 276(26): 23748 - 23756. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |