|
Volume 270,
Number 16,
Issue of April 21, pp. 9258-9264, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Construction
of a Human Genomic Library of Clones Containing
Poly(dG-dA) Poly(dT-dC) Tracts by Mg -dependent
Triplex Affinity Capture
DNA POLYMORPHISM ASSOCIATED WITH THE TRACTS (*)
Naoko
Nishikawa
,
Michio
Oishi
,
Ryoiti
Kiyama (§)
From the
(1)
Institute of Molecular and Cellular Biosciences,
University of Tokyo, Bunkyo-ku, Tokyo 113, Japan
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Microsatellite DNA is a useful tool for detecting DNA
polymorphisms among species or individuals, especially those among
closely related individuals. We constructed a library of clones that
contained poly(dG-dA) poly(dT-dC) tracts from human genomic DNA by
Mg -dependent triplex DNA formation. Examination of
triplex DNA formation in the presence of various metal ions
Mg , Mn , or Zn revealed that the procedure worked best in the presence of
Mg . Affinity enrichment was performed with
AluI-digested chromosomal DNA mixed with biotinylated
(dG-dA) in the presence of Mg . A library
constructed after three cycles of affinity enrichment showed that over
80% of the clones contained at least one poly(dG-dA) poly(dT-dC)
tract. Most of them contained a perfect (dG-dA) repeat 30-84 base pairs in length, while some contained
variants such as (dC-dT) -(dC)-(dC-dT) . Using
the clones from the library as a probe, we detected DNA polymorphisms
associated with the repeat length of the tracts in the Japanese
population. We also detected a microsatellite instability among the
tracts in a cancer tissue sample.
INTRODUCTION
DNA polymorphism has been playing an important role in the
analysis of complex genomes. Restriction fragment-length polymorphism
was the first utilized for distinguishing individuals
(1) . This
technique is based upon differences in nucleotide sequences at
restriction sites, which are detected by a specific probe. The
disadvantages, i.e. difficulty in finding an appropriate
combination of restriction sites and probes and a relatively low
frequency of polymorphism occurrence, were later improved by the usage
of minisatellite DNAs
(2) . These consist of a few tens to
100 bp ( )
of the unit sequence, which repeats
a few to 100 times tandemly. They also exhibit high mutation rates
among the repeat units, thus increasing the chance of detecting
polymorphic sites among individuals. However, most are present in a
single locus or up to a few, and although some of their core structure
is conserved, collecting minisatellites is still laborious work. This
relatively lengthy procedure was again improved by using a more
abundant and highly repetitive sequence class, microsatellite DNA,
which is characterized by a simple repeat unit of 1 to a few bp
(3, 4, 5, 6) . Polymorphisms associated
with this class of DNA are detected solely as variations in total
repeat length but not as variations in nucleotide sequence within the
units. This could also be termed as the variable number of tandem
repeats, although this term was originally described and has been used
exclusively for minisatellites
(7) . One of the most utilized
microsatellites is the poly(dC-dA) poly(dT-dG) tract, which is
present at approximately 10 loci in the human genome
(8) . The instability of these tracts has been attributed to
their specific structure or to the presence of the specific binding
proteins
(9, 10) . Microsatellite instability has been
commonly seen in hereditary nonpolyposis colorectal cancers, which are
caused by mutations in the mismatch repair genes
(11, 12) .
Polypurine-polypyrimidine sequences are
one of the microsatellite DNAs and are known to form a triplex DNA
structure under specific conditions
(13) .
Poly(dA) poly(dT) sequences can form a triplex with poly(dT) in
the presence of metal ions such as Mg at neutral pH.
Other types of microsatellites, poly(dG) poly(dC) and
poly(dG-dA) poly(dT-dC), also form a triplex structure in the
presence of metal ions
(14, 15, 16, 17, 18) . Since
their formation can be controlled under relatively simple conditions
such as the presence of metal ions or a pH shift for example, a number
of applications have been devised. Dervan and his associates
(19, 20, 21) attempted to cleave a specific
site in the human and yeast genomes by forming triplex DNA with a
chemically modified third strand. Protection of DNA sequences by
triplex formation has also been used as an alternative for controlling
gene expression as well as in genome research
(22, 23, 24) .
Ito et al. (25) first introduced the application of triplex DNA formation
for enrichment of a microsatellite, poly(dG-dA) poly(dT-dC), which
was carried out by formation and dissociation of the triplex DNA by a
pH shift. This method, termed triplex affinity capture, was modified by
us and others by using metal ions to control the formation and
dissociation of triplex DNA
(26, 27) . We previously
described enrichment of poly(dA) poly(dT)-containing sequences
from the human genome by this Mg -dependent triplex
affinity capture method
(27) . A library constructed after three
cycles of affinity enrichment, attaining a total of 2
10 -fold of enrichment, showed that more than 80% of the
clones contained the tract. Approximately 60% of poly(dA) poly(dT)
tracts were derived from the poly(dA) tail of retroposons, Alu family or human L1 family.
EXPERIMENTAL PROCEDURES
Oligonucleotides used for
triplex affinity capture were 3`-biotinylated (dG-dA) ,
GATCCGCGGCCGCCCGAT (adaptor oligonucleotide A) and ATCGGGCGGCCGCG
(adaptor oligonucleotide B). The adaptor was formed by boiling 0.8
µ
M of the adaptor oligonucleotides A and B, followed by
gradual cooling to room temperature. PCR primers used for amplification
of a (dG-dA) -containing fragment in the erythropoietin
receptor gene locus (accession no. S45332, EMBL data base) 45 were
CTATGATTGTGCCACTGCAC (positions 1285-1304) and
CTTCAGACTTCTCATCTGTA (positions 1580-1561). PCR primers for
analysis of DNA polymorphism were: ATGATTGTCTGAGACCTGAG and
AGAACGGCAGTTCAAAGCCA for pHGA6, GAGTCACTTAACTTCTGCTG and
ACTCCTATGTTTGCAGATTC for pHGA8, and GTCAGCTGGGATCAGGAATA and
GATGATTGTCTGAGACCTGA for pHGA11. Streptavidin-coated magnetic beads
were purchased from Promega. Plasmid pGA19 was constructed by inserting
the (dA-dG) sequence between EcoRI and
SacI sites in the polylinker of the pUC19 vector. The method
used for preparation of chromosomal DNA from human blood and tissue was
described elsewhere
(28) .
Formation of
triplex DNA was performed as previously described
(29) with a
modification of the buffer for each type of metal ions. Briefly,
plasmid or genomic DNA was mixed with 20 µl of 100 n
M P-labeled (dG-dA) in triplex buffer I
(10 m
M Tris-HCl, pH 8.0, 10 m
M MgCl , 50
m
M NaCl), triplex buffer II (10 m
M Tris-HCl, pH 8.0,
10 m
M MnCl , 50 m
M NaCl), or triplex
buffer III (10 m
M Tris-HCl, pH 8.0, 10 m
M ZnSO , 50 m
M sodium acetate) and incubated at
37 °C for 30 min. For the gel assay, the sample was then
electrophoresed at 1 V/cm for 17 h at 4 °C in a 1% agarose gel in
90 m
M Tris borate containing 5 m
M MgCl ,
MnCl , or ZnSO , respectively. The gel was fixed
with 10% (w/v) trichloroacetic acid, dried under a stack of paper
towels, and exposed to Kodak X-Omat AR-5 film at -80 °C for a
few days.
Approximately 1 µg of plasmid DNA or
genomic DNA before or after restriction enzyme digestion was mixed with
200 n
M biotinylated (dG-dA) in 25 µl of
triplex buffer I, II, or III and incubated at 37 °C for 30 min. The
sample was mixed with 0.5 ml of the respective triplex buffer and 0.3
mg of streptavidin-coated magnetic beads. After incubation with 0.5 ml
of the triplex buffer at room temperature for 30 min, the beads were
separated by brief centrifugation. After extensive washing with the
triplex buffer (7 times with 0.5 ml), the bound DNA was eluted with 2.5
ml of the elution buffer (10 m
M Tris-HCl, pH 8.0, 5 m
M EDTA, 50 m
M NaCl).
Chromosomal DNA from
HeLa cells digested with AluI was ligated with the adaptor and
amplified by PCR with adaptor oligonucleotide A as a primer. 1 µg
of the amplified DNA was incubated with biotinylated (dG-dA) in triplex buffer I at 37 °C for 30 min. The triplex DNA
formed was adsorbed onto streptavidin-coated magnetic beads, followed
by washing with triplex buffer I and elution with the elution buffer.
The recovered DNA was amplified by PCR and used for the next cycle of
affinity enrichment. After three cycles of triplex affinity capture,
DNA was digested with NotI and cloned into pBluescript
SK(-). The conditions for the PCR amplification were as follows:
denaturation at 94 °C for 1 min, annealing at 40 °C for 2 min,
and extension at 72 °C for 3 min during each cycle with a final
extension at 72 °C for 10 min in 50 µl of the PCR buffer
containing 50 m
M KCl, 10 m
M Tris-HCl, pH 8.3, 1.25
m
M MgCl , 0.01% (w/v) gelatin, and 1.25 m
M dNTPs. The number of PCR cycles for each step of enrichment was a
total of 18 cycles with a 1/20 dilution after the 9th cycle for the
first, 27 cycles with a 1/20 dilution after the 12th cycle for the
second, and 33 cycles with a 1/20 dilution after the 12th cycle for the
third cycle of the enrichment.
DNA
fragments containing (dG-dA) tracts were amplified
by PCR in 25 µl of PCR buffer in the presence of 0.01% (v/v)
formamide with a pair of primers for each fragment. PCR conditions were
the same as described above except for the annealing temperature of 53
°C. Amplified DNA was labeled with
[ - P]ATP (4500 Ci/mmol, ICN) and T4
polynucleotide kinase (New England Biolabs), digested with
TaqI for pHGA6 and pHGA11 or BsaI for pHGA8, and
separated by electrophoresis in 8% polyacrylamide-8
M urea
gels under denaturing conditions, followed by autoradiography.
RESULTS
Specific conditions are required for the
stability of triplex DNA. For example,
poly(dC ) poly(dG) poly(dC) triplex DNA needs
acidic pH, while poly(dT) poly(dA) poly(dT) and
poly(dG) poly(dG) poly(dC) need metal ions such as
Mg . Poly(dG-dA) poly(dG-dA) poly(dT-dC)
also needs metal ions. Malkov et al. (30) examined the
stability of triplex DNA in the presence of various metal ions and
found that this type of triplex DNA is stabilized by
Cd , Co , Mn ,
Ni , or Zn but is not stable with
Ba , Ca , Hg , or
Mg . We re-examined first the stability of the triplex
DNA in the presence of Mg , Mn , or
Zn by the affinity enrichment using biotinylated
(dG-dA) and streptavidin-coated magnetic beads. Table I
shows the enrichment of pGA19 DNA from the mixture of pGA19 and pUC19
DNAs (1:20 ratio) in the presence of Mg ,
Mn , or Zn , and the results
indicated that the procedure worked best in the presence of
Mg (21.0-fold enrichment for Mg compared with 5.5- and 0.69-fold for Mn and
Zn , respectively). This result was reproduced by
triplex DNA gel assay, where the degree of triplex DNA formation was
best for Mg among these metal ions (data not shown).
Fig. 1 A shows the
enrichment of poly(dG-dA) poly(dT-dC)-containing DNAs by triplex
affinity capture using Mg from AluI-digested
chromosomal DNA from human (HeLa) cells. The intensity of the signal of
the 0.3-1.5-kilobase fragments increased as the enrichment was
repeated. To see the enrichment of specific bands, we examined a
(dG-dA) (dT-dC) tract, which is present
in the erythropoietin receptor gene locus. As shown in
Fig. 1B, the 296-bp AluI fragment containing
the tract was enriched through three cycles of the procedure ( lanes 1-4) to about 10 -fold after the third
cycle ( lanes 5 and 6). Since the enrichment
reached a plateau after three cycles (Fig. 1 A, lane 4), we constructed a library of clones with samples after
the third cycle. Analysis of Clones with Poly(dG-dA) Poly(dT-dC)
Tracts-We first examined 14 clones randomly selected from
the library by the triplex DNA gel assay. As shown in Fig. 2 A,
86% of the clones (12/14) showed complex formation, confirming the
saturation of enrichment. The clones that showed a positive signal in
the gel assay were examined further by nucleotide sequencing.
Fig. 2B summarizes the location of the
poly(dG-dA) poly(dT-dC) tracts in these clones. All of the clones
analyzed contained at least one poly(dG-dA) poly(dT-dC) tract,
while the clone pHGA7 contained two tracts. Interestingly, incomplete
repeats of the (dG-dA) or (dT-dC) sequence, such as
(dC-dT) -(dC)-(dC-dT) (pHGA6) or
(dA-dG) -(dG)-(dA-dG) (pHGA8), were also
efficiently enriched. The clones with poly(dG-dA) poly(dT-dC)
tracts are summarized in Table II.
Figure 1:
Enrichment of
poly(dG-dA) poly(dT-dC)-containing DNA fragments. A,
general profile of the enriched fragments. PCR-amplified chromosomal
DNA in each cycle of affinity enrichment and the initial sample (1
µg each) were used for the triplex DNA gel assay with 100 n
M P-labeled (dG-dA) . B,
enrichment of a poly(dG-dA) poly(dT-dC) tract in the human
erythropoietin receptor locus. Enrichment of the 296-bp AluI
fragment containing (dG-dA) in the locus
( arrowed) was monitored by a total of 25 cycles (with a 1/10
dilution after the 15th cycle) of PCR with 100 ng of DNA samples before
( lane 1) or after the first ( lane 2), second ( lane 3), or third ( lane 4) cycle of affinity enrichment. Degree of enrichment was
examined by PCR amplification (a total of 35 cycles with a 1/10
dilution after the 15th cycle of PCR) of DNA before (100 ng as the
starting material, lane 5) or after (100 pg, lane 6) 3 cycles of enrichment. DNA samples were
electrophoresed on a 1% agarose gel and stained with ethidium
bromide.
Figure 2:
Analysis of clones containing
poly(dG-dA) poly(dT-dC) tracts. A, triplex DNA gel assay.
About 200 ng of the purified plasmid DNA (in the covalently closed
circular form) from 14 randomly selected clones was mixed with 100
n
M of P-labeled (dG-dA) in the
presence of Mg . The complex formed was resolved
through a 1% agarose gel in the presence of Mg . Minor
bands represent the signal from the open circular or linear form of
plasmid DNA. pBl, pBluescript cloning vector. B, map
of the clones. The location of the poly(dG-dA) poly(dT-dC) tract
is shaded. The positions of primers ( horizontal arrows) and the restriction sites ( vertical arrows) used for the polymorphism assay in Fig. 3 for
clones pHGA6, pHGA8, and pHGA11 are indicated. C, nucleotide
sequences of the poly(dG-dA) poly(dT-dC) tracts and their flanking
regions.
Fig. 3 A shows
variations in the length of the tract among 20 Japanese individuals. We
detected allelic variations for the length of the tracts, 32-42
bp for pHGA6, 26-58 bp for pHGA8, and 34-44 bp for pHGA11,
which appeared at frequencies (PIC; see Ref. 1) of 0.70, 0.726, and
0.75, respectively, in the Japanese population (Fig. 3 A and summarized in Table III). The tracts detected in the clones
pHGA6, pHGA8, and pHGA11 showed Mendelian transmission, and there was
no instability during transmission (Fig. 3 B). Meanwhile, an
instability was detected in the chromosomal DNA isolated from a colon
cancer by examining the tract between normal and cancer tissues with
pHGA8 (Fig. 3 C). Such an instability of microsatellite
could be one of the reasons for extra minor band species observed among
some individuals (see lanes 3 and 15 for
pHGA8 for example).
Figure 3:
DNA
polymorphism associated with the poly(dG-dA) poly(dT-dC) tracts.
Panel A, polymorphism in the length of the tracts in pHGA6,
pHGA8, or pHGA11 detected among 20 individuals. Panel B,
analysis of a family. F, father; M, mother;
D1-D3, three daughters. Panel C, microsatellite
instability at the tracts between normal ( N) and colon cancer
cells ( C) from the same individual detected with pairs of
specific primers for the tracts on pHGA8. The additional bands observed
in the cancer sample are arrowed. The fragments containing the
tracts were amplified by PCR, labeled with T4 polynucleotide kinase and
[ - P]ATP, and electrophoresed in 8%
polyacrylamide, 8
M urea gels after digestion with restriction
enzymes. See ``Experimental Procedures'' for details.
Presence of additional bands in the cancer sample was confirmed by
three independent preparations.
DISCUSSION
We described here the construction of a library
of clones containing poly(dG-dA) poly(dT-dC) tracts by
Mg -dependent triplex DNA formation (triplex affinity
capture). Triplex DNA used here was
poly(dG-dA) poly(dG-dA) poly(dT-dC), which needs metal ions
to stabilize the structure and is dissociated to a duplex and single
strand when these ions are absent. Among the metal ions
Mg , Mn , and Zn ,
which were previously described to stabilize this type or other triplex
structures
(13, 14, 15, 16, 17, 30) ,
Mg showed the lowest background in the gel assay
(data not shown) and the highest rate of enrichment of
poly(dG-dA) poly(dT-dC)-containing plasmid DNA (Table I). This
result is contradictory to that described by Malkov et al. (30) . However, this could be explained by their use of
shorter oligonucleotides, 10 nucleotides long (dA-dG) or
(dC-dT) , as the third strand in comparison with our study.
Triplex DNA with a longer third strand would naturally be stabilized to
a greater extent. In the presence of Mn or
Zn , on the other hand, an aggregate was formed
between the duplex DNA and the oligonucleotide (dG-dA) .
Using Mg for triplex DNA formation with biotinylated
(dG-dA) , the fragments containing
poly(dG-dA) poly(dT-dC) tracts were enriched from human
chromosomal DNA to about 10-100-fold per cycle by our procedure
(Fig. 1 A).
Randomly selected clones from the library
constructed after three cycles of affinity enrichment showed that more
than 80% of the clones contained the tract (Fig. 2 A).
From analysis of the tract in the erythropoietin receptor gene locus,
we estimated the rate of enrichment to be 10 -fold and also
that tracts present as a single copy in the genome were successfully
enriched (Fig. 1 B).
The library contained clones with
perfect repeats of the dinucleotide (dG-dA), although about 92% (11/12)
of the tracts contained a variation of the repeat sequence around the
tracts. For example, pHGA1 contained (dT-dC) -(dT) and (dC-dT) -(dT-dC) sequences, variations
of the (dT-dC) repeat, next to the (dT-dC) sequence. This
is quite different from the library of poly(dA) poly(dT) tracts
constructed by the same strategy using biotinylated poly(dT). All of
the clones analyzed contained a perfect repeat of
poly(dA) poly(dT) 14-37 bp in length
(27) . On the
other hand, the library of poly(dG) poly(dC) tracts contained
various types of sequences that were different from the perfect
repeat. ( )
Microsatellite DNA
frequently shows polymorphism of the repeat length among individuals.
This type of the polymorphism was first described for minisatellite DNA
as variable number of tandem repeats
(7) . Recently, however,
because of the abundance in the genome and the divergence of the repeat
length and also the feasibility of PCR analysis, microsatellites are
commonly used as polymorphic markers. All three clones from the library
of poly(dG-dA) poly(dT-dC) tracts showed variable number of tandem
repeat-type polymorphisms among the Japanese population (Fig. 3, A and B) at the frequencies of 0.70-0.75, a
relatively high rate for a homogeneous population such as the Japanese.
Frequencies of other types of microsatellite DNA such as
poly(dC-dA) poly(dT-dG) are 0.31-0.79 (average 0.544)
(31) . We also observed DNA polymorphism between cancer and
normal cells from the same individual (Fig. 3 C). This
was presumably due to the instability of microsatellites during the
process of tumorigenesis, which was often observed for proximal colon
cancers
(32) .
Although the polymorphisms associated with
poly(dC-dA) poly(dT-dG) tracts were extensively analyzed, other
types of microsatellites were not well studied. This was partly because
of the abundance of the sequence in the genome.
Poly(dC-dA) poly(dT-dG) tracts are estimated to be present at as
much as 10 loci per higher eukaryotic genome, and their
polymorphism seems to be due to the instability of the tracts during
replication or sister chromatid exchange
(9, 33, 34, 35) . DNA fragments with
these tracts can form Z-DNA under conditions such as high ionic
strength, and this structure can cause replication error and/or
recombination
(36, 37) . In contrast, DNA fragments with
poly(dG-dA) poly(dT-dC) tracts can form triplex DNA in the
presence of the third strand poly(dG-dA) and metal ions
(30, 38) . The third strand could be supplied from the
same tract (intramolecular triplex formation) or from a similar tract
at another location
(13) . There have been several reports that
these tracts were also associated with recombination hotspots and
replication arrest
(39, 40, 41) . Therefore, it
is not surprising that such tracts are unstable in the genome and are
associated with DNA polymorphism. Our results suggest that the
complexity of the library of fragments containing
poly(dG-dA) poly(dT-dC) tracts is about 1/1000 of that of the
original genome (roughly 10 , see Fig. 1 B), which
is in a good accordance with a previous report on the abundance of
these tracts (0.07% of the total human genome)
(42) .
There are a number of methods to obtain polymorphic
markers. Restriction-fragment length polymorphism markers were
originally obtained by Southern blots of chromosomal DNA digested with
various restriction enzymes using locus-specific probes. More abundant
markers, minisatellites, were obtained by cross-hybridization with
known minisatellites
(2) . Microsatellites could be obtained by
PCR or computer survey when the sequence of the locus of interest is
known. However, all of these methods include lengthy procedures such as
subcloning, sequencing, and hybridization. Several methods were devised
to collectively obtain these markers, strategies using differential
cloning or PCR with degenerate primers
(43, 44) . Our
approach, using triplex affinity capture first creates a library of
clones containing poly(dG-dA) poly(dT-dC) tracts. Cloned fragments
0.3-1.5 kilobases in length can be directly screened by colony
hybridization with cosmids or YACs or DNA fragments containing a region
of interest to obtain polymorphic markers derived from the region.
Furthermore, since this method has no double-stranded DNA denaturation
step, the fragments containing repetitive sequences, which tend to be
lost through subtractive cloning procedures, could be efficiently
obtained.
Table: Efficiency of triplex affinity capture
Table: 0p4in
Incomplete
repeats.
Table: Allele
frequencies for (dG-dA) detected by
pHGA6, pHGA8, and pHGA11
FOOTNOTES
- *
- This work was supported by
grants-in-aid from the Ministry of Education of Japan (to M. O. and R.
K.). The costs of publication of this article were defrayed in part by
the payment of page charges. This article must therefore by hereby
marked `` advertisement'' in accordance with 18
U.S.C. Section 1734 solely to indicate this fact.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank/EMBL Data Bank with accession number(s) D45426-D45436.
- §
- To whom correspondence should be addressed.
Tel.: 81-3-3812-2111 (ext. 7835); Fax: 81-3-3818-9437.
- The abbreviations used are: bp, base pair(s);
PCR, polymerase chain reaction.
- N. Nishikawa,
M. Oishi, and R. Kiyama, unpublished results.
ACKNOWLEDGEMENTS
We thank Drs. Kenich Seta, Tatsuo Katayama, Toshio
Yokoyama, and Shuichi Nogami (Hakujikai Memorial Hospital) and Dr.
Nobuyuki Yokokawa (Japanese Red Cross Society) for providing blood and
cancer tissue samples and Rieko Ohki for analysis of microsatellite
instability.
REFERENCES
- Botstein, D., White, R., Skolnick, M., and Davis, R. W. (1980) Am. J. Hum. Genet. 32, 314-331
[Medline]
[Order article via Infotrieve]
- Jeffreys, A. J., Wilson, V., and Thein, S. L. (1985) Nature 314, 67-73
[CrossRef][Medline]
[Order article via Infotrieve]
- Hearne, C. M., Ghosh, S., and Todd, J. A. (1992) Trends Genet. 8, 288-294
[Medline]
[Order article via Infotrieve]
- Wrogemann, K., Biancalana, R., Devys, D., Imbert, G., Trottier, Y., and Mandel, J.-L. (1993) in DNA Fingerprinting: State of the Science (Pena, S. D. J., Chakraborty, R., Epplen, J. T., and Jeffreys, A. J., eds) pp. 141-152, Birkhauser Verlag, Basel, Switzerland
- Weissenbach, J. (1993) Curr. Opin. Genet. Dev. 3, 414-417
[CrossRef][Medline]
[Order article via Infotrieve]
- Wooster, R., Cleton-Jansen, A.-M., Collins, N., Mangion, J., Cornelis, R. S., Cooper, C. S., Gusterson, B. A., Ponder, B. A. J., von Demling, A., Wiestler, O. D., Cornelisse, C. J., Devilee, P., and Stratton, M. R. (1994) Nat. Genet. 6, 152-156
[CrossRef][Medline]
[Order article via Infotrieve]
- Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm. T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E., and White, R. (1987) Science 235, 1616-1622
[Abstract/Free Full Text]
- Hamada, J., Petrino, M. G., and Kakunaga, T. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 6465-6469
[Abstract/Free Full Text]
- Weinreb, A., Katzenberg, D. R., Gilmore, G. L., and Birshtein, B. K. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 529-533
[Abstract/Free Full Text]
- Gut, S. H., Bischoff, M., Hobi. R., and Kuenzle, C. C. (1987) Nucleic Acids Res. 15, 9691-9705
[Abstract/Free Full Text]
- Fishel, R., Lescoe, M. K., Rao, M. R. S., Copeland, N. G., Jenkins, N. A., Garber, J., Kane, M., and Kolodner, R. (1993) Cell 75, 1027-1038
[CrossRef][Medline]
[Order article via Infotrieve]
- Prolla, T. A., Pang, Q., Alani, E., Kolodner, R. D., and Liskay, R. M. (1994) Science 265, 1091-1093
[Abstract/Free Full Text]
- Wells, R. D., Collier, D. A., Hanvey, J. C., Shimizu, M., and Wohlrab, F. (1988) FASEB J. 2, 2939-2949
[Abstract]
- Kohwi, Y., and Kohwi-Shigematsu, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3781-3785
[Abstract/Free Full Text]
- Usdin, K., and Furano, A. V. (1989) J. Biol. Chem. 264, 15681-15687
[Abstract/Free Full Text]
- Bernues, J., Beltoran, R., Casasnovas, J. M., and Azorin, F. (1990) Nucleic Acids Res. 18, 4067-4073
[Abstract/Free Full Text]
- Malkov, V, A., Soyfer, V. N., and Frank-Kamenetskii, M. D. (1992) Nucleic Acids Res. 20, 4889-4895
[Abstract/Free Full Text]
- Martinez-Balbas, A., and Azorin, F. (1993) Nucleic Acids Res. 21, 2557-2562
[Abstract/Free Full Text]
- Strobel, S. A., and Dervan, P. B. (1990) Science 249, 73-75
[Abstract/Free Full Text]
- Strobel, S. A., and Dervan, P. B. (1991) Nature 350, 172-174
[CrossRef][Medline]
[Order article via Infotrieve]
- Strobel, S. A., Doucette-Stamm, L. A., Riba, L., Housman, D. E., and Dervan, P. B. (1991) Science 254, 1639-1642
[Abstract/Free Full Text]
- Cooney, M., Czernuszewicz, G., Postel, E. H., Flint, S. J., and Hogan, M. E. (1988) Science 241, 456-459
[Abstract/Free Full Text]
- Postel, E. H., Flint, S. J., Kessler, D. J., and Hogan, M. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8227-8231
[Abstract/Free Full Text]
- Dual-Valentin, G., Thuong, N. T., and Helene, C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 504-508
[Abstract/Free Full Text]
- Ito, T., Smith, C. L., and Cantor, C. R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 495-498
[Abstract/Free Full Text]
- Fox, K. R. (1992) Nucleic Acids Res. 6, 1235-1242
- Kiyama, R., Nishikawa, N., and Oishi, M. (1994) J. Mol. Biol. 237, 193-200
[CrossRef][Medline]
[Order article via Infotrieve]
- Yokota, H., Amano, S., Yamane, T., Ataka, K., Kikuya, E., and Oishi, M. (1994) Anal. Biochem. 219, 131-138
[CrossRef][Medline]
[Order article via Infotrieve]
- Kiyama, R., and Camerine-Otero, R. D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10450-10454
[Abstract/Free Full Text]
- Malkov, V. A., Voloshin, O. N., Soyfer, V. N., and Frank-Kamenetskii, M. D. (1993) Nucleic Acids Res. 21, 585-591
[Abstract/Free Full Text]
- Weber, J. L., and May, P. E. (1989) Am. J. Hum. Genet. 44 388-396
[Medline]
[Order article via Infotrieve]
- Thibodeau, S. N., Bren, G., and Schaid, D. (1993) Science 260, 816-819
[Abstract/Free Full Text]
- Hamada, H., and Kakunaga, T. (1982) Nature 298, 396-398
[CrossRef][Medline]
[Order article via Infotrieve]
- Blaho, J. A., and Wells, R. D. (1986) Proc. Natl. Acad. Sci. U. S. A. 37, 107-126
- Lapidot, A., Baran, N., and Manor, H. (1989) Nucleic Acids Res. 17, 883-900
[Abstract/Free Full Text]
- Rich, A., Nordheim, A., and Wang, A. H.-J. (1984) Annu. Rev. Biochem. 33, 791-846
[CrossRef]
- Blaho, J. A., and Wells, R. D. (1989) Prog. Nucleic Acid Res. Mol. Biol. 37, 107-126
[Medline]
[Order article via Infotrieve]
- Lyamichev, V. I., Voloshin, O. N., Frank-Kamenetskii, M. D., and Soyfer, V. N. (1991) Nucleic Acids Res. 19, 1633-1638
[Abstract/Free Full Text]
- Steinmetz, M., Stephan, D., and Lindahl, K. F. (1986) Cell 44, 895-904
[CrossRef][Medline]
[Order article via Infotrieve]
- Weinreb, A., Collier, D. A., Birshtein, B. K., and Wells, R. D. (1990) J. Biol. Chem. 265, 1352-1359
[Abstract/Free Full Text]
- Baron, A., Lapidot, A., and Manor, H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 507-511
[Abstract/Free Full Text]
- Manor, H., Rao, B. S., and Martin, R. G. (1988) J. Mol. Evol. 27, 96-101
[CrossRef][Medline]
[Order article via Infotrieve]
- Lisitsyn, N., Lisitsyn, N., and Wigler, M. (1993) Science 259, 946-951
[Abstract]
- LeBlanc-Straceski, J. M., Montogomery, K. T., Kissel, H., Murtaugh, L., Tsai, P., Ward, D. C., Krauter, K. S., and Kucherlapati, R. (1994) Genomics 19, 341-349
[CrossRef][Medline]
[Order article via Infotrieve]
- Noguchi, C. T., Bae, K. S., Chin, K., Wada, Y., Schechter, A. N., and Hankins, W. D. (1991) Blood 78, 2548-2556
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|