Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Kiyama, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Kiyama, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 16, Issue of April 21, pp. 9258-9264, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Construction of a Human Genomic Library of Clones Containing Poly(dG-dA)Poly(dT-dC) Tracts by Mg-dependent Triplex Affinity Capture
DNA POLYMORPHISM ASSOCIATED WITH THE TRACTS (*)

Naoko Nishikawa , Michio Oishi , Ryoiti Kiyama (§)

From the (1) Institute of Molecular and Cellular Biosciences, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Microsatellite DNA is a useful tool for detecting DNA polymorphisms among species or individuals, especially those among closely related individuals. We constructed a library of clones that contained poly(dG-dA)poly(dT-dC) tracts from human genomic DNA by Mg-dependent triplex DNA formation. Examination of triplex DNA formation in the presence of various metal ions Mg, Mn, or Znrevealed that the procedure worked best in the presence of Mg. Affinity enrichment was performed with AluI-digested chromosomal DNA mixed with biotinylated (dG-dA)in the presence of Mg. A library constructed after three cycles of affinity enrichment showed that over 80% of the clones contained at least one poly(dG-dA)poly(dT-dC) tract. Most of them contained a perfect (dG-dA)repeat 30-84 base pairs in length, while some contained variants such as (dC-dT)-(dC)-(dC-dT). Using the clones from the library as a probe, we detected DNA polymorphisms associated with the repeat length of the tracts in the Japanese population. We also detected a microsatellite instability among the tracts in a cancer tissue sample.


INTRODUCTION

DNA polymorphism has been playing an important role in the analysis of complex genomes. Restriction fragment-length polymorphism was the first utilized for distinguishing individuals (1) . This technique is based upon differences in nucleotide sequences at restriction sites, which are detected by a specific probe. The disadvantages, i.e. difficulty in finding an appropriate combination of restriction sites and probes and a relatively low frequency of polymorphism occurrence, were later improved by the usage of minisatellite DNAs (2) . These consist of a few tens to 100 bp() of the unit sequence, which repeats a few to 100 times tandemly. They also exhibit high mutation rates among the repeat units, thus increasing the chance of detecting polymorphic sites among individuals. However, most are present in a single locus or up to a few, and although some of their core structure is conserved, collecting minisatellites is still laborious work. This relatively lengthy procedure was again improved by using a more abundant and highly repetitive sequence class, microsatellite DNA, which is characterized by a simple repeat unit of 1 to a few bp (3, 4, 5, 6) . Polymorphisms associated with this class of DNA are detected solely as variations in total repeat length but not as variations in nucleotide sequence within the units. This could also be termed as the variable number of tandem repeats, although this term was originally described and has been used exclusively for minisatellites (7) . One of the most utilized microsatellites is the poly(dC-dA)poly(dT-dG) tract, which is present at approximately 10loci in the human genome (8) . The instability of these tracts has been attributed to their specific structure or to the presence of the specific binding proteins (9, 10) . Microsatellite instability has been commonly seen in hereditary nonpolyposis colorectal cancers, which are caused by mutations in the mismatch repair genes (11, 12) .

Polypurine-polypyrimidine sequences are one of the microsatellite DNAs and are known to form a triplex DNA structure under specific conditions (13) . Poly(dA)poly(dT) sequences can form a triplex with poly(dT) in the presence of metal ions such as Mgat neutral pH. Other types of microsatellites, poly(dG)poly(dC) and poly(dG-dA)poly(dT-dC), also form a triplex structure in the presence of metal ions (14, 15, 16, 17, 18) . Since their formation can be controlled under relatively simple conditions such as the presence of metal ions or a pH shift for example, a number of applications have been devised. Dervan and his associates (19, 20, 21) attempted to cleave a specific site in the human and yeast genomes by forming triplex DNA with a chemically modified third strand. Protection of DNA sequences by triplex formation has also been used as an alternative for controlling gene expression as well as in genome research (22, 23, 24) .

Ito et al. (25) first introduced the application of triplex DNA formation for enrichment of a microsatellite, poly(dG-dA)poly(dT-dC), which was carried out by formation and dissociation of the triplex DNA by a pH shift. This method, termed triplex affinity capture, was modified by us and others by using metal ions to control the formation and dissociation of triplex DNA (26, 27) . We previously described enrichment of poly(dA)poly(dT)-containing sequences from the human genome by this Mg-dependent triplex affinity capture method (27) . A library constructed after three cycles of affinity enrichment, attaining a total of 2 10-fold of enrichment, showed that more than 80% of the clones contained the tract. Approximately 60% of poly(dA)poly(dT) tracts were derived from the poly(dA) tail of retroposons, Alu family or human L1 family.


EXPERIMENTAL PROCEDURES

Materials

Oligonucleotides used for triplex affinity capture were 3`-biotinylated (dG-dA), GATCCGCGGCCGCCCGAT (adaptor oligonucleotide A) and ATCGGGCGGCCGCG (adaptor oligonucleotide B). The adaptor was formed by boiling 0.8 µ M of the adaptor oligonucleotides A and B, followed by gradual cooling to room temperature. PCR primers used for amplification of a (dG-dA)-containing fragment in the erythropoietin receptor gene locus (accession no. S45332, EMBL data base) 45 were CTATGATTGTGCCACTGCAC (positions 1285-1304) and CTTCAGACTTCTCATCTGTA (positions 1580-1561). PCR primers for analysis of DNA polymorphism were: ATGATTGTCTGAGACCTGAG and AGAACGGCAGTTCAAAGCCA for pHGA6, GAGTCACTTAACTTCTGCTG and ACTCCTATGTTTGCAGATTC for pHGA8, and GTCAGCTGGGATCAGGAATA and GATGATTGTCTGAGACCTGA for pHGA11. Streptavidin-coated magnetic beads were purchased from Promega. Plasmid pGA19 was constructed by inserting the (dA-dG)sequence between EcoRI and SacI sites in the polylinker of the pUC19 vector. The method used for preparation of chromosomal DNA from human blood and tissue was described elsewhere (28) .

Triplex DNA Gel Assay

Formation of triplex DNA was performed as previously described (29) with a modification of the buffer for each type of metal ions. Briefly, plasmid or genomic DNA was mixed with 20 µl of 100 n M P-labeled (dG-dA)in triplex buffer I (10 m M Tris-HCl, pH 8.0, 10 m M MgCl, 50 m M NaCl), triplex buffer II (10 m M Tris-HCl, pH 8.0, 10 m M MnCl, 50 m M NaCl), or triplex buffer III (10 m M Tris-HCl, pH 8.0, 10 m M ZnSO, 50 m M sodium acetate) and incubated at 37 °C for 30 min. For the gel assay, the sample was then electrophoresed at 1 V/cm for 17 h at 4 °C in a 1% agarose gel in 90 m M Tris borate containing 5 m M MgCl, MnCl, or ZnSO, respectively. The gel was fixed with 10% (w/v) trichloroacetic acid, dried under a stack of paper towels, and exposed to Kodak X-Omat AR-5 film at -80 °C for a few days.

Mg-dependent Triplex Affinity Capture

Approximately 1 µg of plasmid DNA or genomic DNA before or after restriction enzyme digestion was mixed with 200 n M biotinylated (dG-dA)in 25 µl of triplex buffer I, II, or III and incubated at 37 °C for 30 min. The sample was mixed with 0.5 ml of the respective triplex buffer and 0.3 mg of streptavidin-coated magnetic beads. After incubation with 0.5 ml of the triplex buffer at room temperature for 30 min, the beads were separated by brief centrifugation. After extensive washing with the triplex buffer (7 times with 0.5 ml), the bound DNA was eluted with 2.5 ml of the elution buffer (10 m M Tris-HCl, pH 8.0, 5 m M EDTA, 50 m M NaCl).

Construction of the Library of Poly(dG-dA)Poly(dT-dC) Tracts

Chromosomal DNA from HeLa cells digested with AluI was ligated with the adaptor and amplified by PCR with adaptor oligonucleotide A as a primer. 1 µg of the amplified DNA was incubated with biotinylated (dG-dA)in triplex buffer I at 37 °C for 30 min. The triplex DNA formed was adsorbed onto streptavidin-coated magnetic beads, followed by washing with triplex buffer I and elution with the elution buffer. The recovered DNA was amplified by PCR and used for the next cycle of affinity enrichment. After three cycles of triplex affinity capture, DNA was digested with NotI and cloned into pBluescript SK(-). The conditions for the PCR amplification were as follows: denaturation at 94 °C for 1 min, annealing at 40 °C for 2 min, and extension at 72 °C for 3 min during each cycle with a final extension at 72 °C for 10 min in 50 µl of the PCR buffer containing 50 m M KCl, 10 m M Tris-HCl, pH 8.3, 1.25 m M MgCl, 0.01% (w/v) gelatin, and 1.25 m M dNTPs. The number of PCR cycles for each step of enrichment was a total of 18 cycles with a 1/20 dilution after the 9th cycle for the first, 27 cycles with a 1/20 dilution after the 12th cycle for the second, and 33 cycles with a 1/20 dilution after the 12th cycle for the third cycle of the enrichment.

Analysis of DNA Polymorphism

DNA fragments containing (dG-dA)tracts were amplified by PCR in 25 µl of PCR buffer in the presence of 0.01% (v/v) formamide with a pair of primers for each fragment. PCR conditions were the same as described above except for the annealing temperature of 53 °C. Amplified DNA was labeled with [-P]ATP (4500 Ci/mmol, ICN) and T4 polynucleotide kinase (New England Biolabs), digested with TaqI for pHGA6 and pHGA11 or BsaI for pHGA8, and separated by electrophoresis in 8% polyacrylamide-8 M urea gels under denaturing conditions, followed by autoradiography.


RESULTS

Metal Ion Requirement for Triplex DNA Formation

Specific conditions are required for the stability of triplex DNA. For example, poly(dC)poly(dG)poly(dC) triplex DNA needs acidic pH, while poly(dT)poly(dA)poly(dT) and poly(dG)poly(dG)poly(dC) need metal ions such as Mg. Poly(dG-dA)poly(dG-dA)poly(dT-dC) also needs metal ions. Malkov et al. (30) examined the stability of triplex DNA in the presence of various metal ions and found that this type of triplex DNA is stabilized by Cd, Co, Mn, Ni, or Znbut is not stable with Ba, Ca, Hg, or Mg. We re-examined first the stability of the triplex DNA in the presence of Mg, Mn, or Znby the affinity enrichment using biotinylated (dG-dA)and streptavidin-coated magnetic beads. Table I shows the enrichment of pGA19 DNA from the mixture of pGA19 and pUC19 DNAs (1:20 ratio) in the presence of Mg, Mn, or Zn, and the results indicated that the procedure worked best in the presence of Mg(21.0-fold enrichment for Mgcompared with 5.5- and 0.69-fold for Mnand Zn, respectively). This result was reproduced by triplex DNA gel assay, where the degree of triplex DNA formation was best for Mgamong these metal ions (data not shown).

Enrichment of Poly(dG-dA)Poly(dT-dC)-containing DNAs from Human Chromosomal DNA

Fig. 1 A shows the enrichment of poly(dG-dA)poly(dT-dC)-containing DNAs by triplex affinity capture using Mgfrom AluI-digested chromosomal DNA from human (HeLa) cells. The intensity of the signal of the 0.3-1.5-kilobase fragments increased as the enrichment was repeated. To see the enrichment of specific bands, we examined a (dG-dA)(dT-dC)tract, which is present in the erythropoietin receptor gene locus. As shown in Fig. 1B, the 296-bp AluI fragment containing the tract was enriched through three cycles of the procedure ( lanes 1-4) to about 10-fold after the third cycle ( lanes 5 and 6). Since the enrichment reached a plateau after three cycles (Fig. 1 A, lane 4), we constructed a library of clones with samples after the third cycle. Analysis of Clones with Poly(dG-dA)Poly(dT-dC) Tracts-We first examined 14 clones randomly selected from the library by the triplex DNA gel assay. As shown in Fig. 2 A, 86% of the clones (12/14) showed complex formation, confirming the saturation of enrichment. The clones that showed a positive signal in the gel assay were examined further by nucleotide sequencing. Fig. 2B summarizes the location of the poly(dG-dA)poly(dT-dC) tracts in these clones. All of the clones analyzed contained at least one poly(dG-dA)poly(dT-dC) tract, while the clone pHGA7 contained two tracts. Interestingly, incomplete repeats of the (dG-dA) or (dT-dC) sequence, such as (dC-dT)-(dC)-(dC-dT)(pHGA6) or (dA-dG)-(dG)-(dA-dG)(pHGA8), were also efficiently enriched. The clones with poly(dG-dA)poly(dT-dC) tracts are summarized in Table II.


Figure 1: Enrichment of poly(dG-dA)poly(dT-dC)-containing DNA fragments. A, general profile of the enriched fragments. PCR-amplified chromosomal DNA in each cycle of affinity enrichment and the initial sample (1 µg each) were used for the triplex DNA gel assay with 100 n M P-labeled (dG-dA). B, enrichment of a poly(dG-dA)poly(dT-dC) tract in the human erythropoietin receptor locus. Enrichment of the 296-bp AluI fragment containing (dG-dA)in the locus ( arrowed) was monitored by a total of 25 cycles (with a 1/10 dilution after the 15th cycle) of PCR with 100 ng of DNA samples before ( lane 1) or after the first ( lane 2), second ( lane 3), or third ( lane 4) cycle of affinity enrichment. Degree of enrichment was examined by PCR amplification (a total of 35 cycles with a 1/10 dilution after the 15th cycle of PCR) of DNA before (100 ng as the starting material, lane 5) or after (100 pg, lane 6) 3 cycles of enrichment. DNA samples were electrophoresed on a 1% agarose gel and stained with ethidium bromide.




Figure 2: Analysis of clones containing poly(dG-dA)poly(dT-dC) tracts. A, triplex DNA gel assay. About 200 ng of the purified plasmid DNA (in the covalently closed circular form) from 14 randomly selected clones was mixed with 100 n M of P-labeled (dG-dA)in the presence of Mg. The complex formed was resolved through a 1% agarose gel in the presence of Mg. Minor bands represent the signal from the open circular or linear form of plasmid DNA. pBl, pBluescript cloning vector. B, map of the clones. The location of the poly(dG-dA)poly(dT-dC) tract is shaded. The positions of primers ( horizontal arrows) and the restriction sites ( vertical arrows) used for the polymorphism assay in Fig. 3 for clones pHGA6, pHGA8, and pHGA11 are indicated. C, nucleotide sequences of the poly(dG-dA)poly(dT-dC) tracts and their flanking regions.



DNA Polymorphism Associated with the Poly(dG-dA)Poly(dT-dC) Tracts

Fig. 3 A shows variations in the length of the tract among 20 Japanese individuals. We detected allelic variations for the length of the tracts, 32-42 bp for pHGA6, 26-58 bp for pHGA8, and 34-44 bp for pHGA11, which appeared at frequencies (PIC; see Ref. 1) of 0.70, 0.726, and 0.75, respectively, in the Japanese population (Fig. 3 A and summarized in Table III). The tracts detected in the clones pHGA6, pHGA8, and pHGA11 showed Mendelian transmission, and there was no instability during transmission (Fig. 3 B). Meanwhile, an instability was detected in the chromosomal DNA isolated from a colon cancer by examining the tract between normal and cancer tissues with pHGA8 (Fig. 3 C). Such an instability of microsatellite could be one of the reasons for extra minor band species observed among some individuals (see lanes 3 and 15 for pHGA8 for example).


Figure 3: DNA polymorphism associated with the poly(dG-dA)poly(dT-dC) tracts. Panel A, polymorphism in the length of the tracts in pHGA6, pHGA8, or pHGA11 detected among 20 individuals. Panel B, analysis of a family. F, father; M, mother; D1-D3, three daughters. Panel C, microsatellite instability at the tracts between normal ( N) and colon cancer cells ( C) from the same individual detected with pairs of specific primers for the tracts on pHGA8. The additional bands observed in the cancer sample are arrowed. The fragments containing the tracts were amplified by PCR, labeled with T4 polynucleotide kinase and [-P]ATP, and electrophoresed in 8% polyacrylamide, 8 M urea gels after digestion with restriction enzymes. See ``Experimental Procedures'' for details. Presence of additional bands in the cancer sample was confirmed by three independent preparations.




DISCUSSION

Library Constructed by Triplex DNA Formation

We described here the construction of a library of clones containing poly(dG-dA)poly(dT-dC) tracts by Mg-dependent triplex DNA formation (triplex affinity capture). Triplex DNA used here was poly(dG-dA)poly(dG-dA)poly(dT-dC), which needs metal ions to stabilize the structure and is dissociated to a duplex and single strand when these ions are absent. Among the metal ions Mg, Mn, and Zn, which were previously described to stabilize this type or other triplex structures (13, 14, 15, 16, 17, 30) , Mgshowed the lowest background in the gel assay (data not shown) and the highest rate of enrichment of poly(dG-dA)poly(dT-dC)-containing plasmid DNA (Table I). This result is contradictory to that described by Malkov et al. (30) . However, this could be explained by their use of shorter oligonucleotides, 10 nucleotides long (dA-dG)or (dC-dT), as the third strand in comparison with our study. Triplex DNA with a longer third strand would naturally be stabilized to a greater extent. In the presence of Mnor Zn, on the other hand, an aggregate was formed between the duplex DNA and the oligonucleotide (dG-dA). Using Mgfor triplex DNA formation with biotinylated (dG-dA), the fragments containing poly(dG-dA)poly(dT-dC) tracts were enriched from human chromosomal DNA to about 10-100-fold per cycle by our procedure (Fig. 1 A).

Randomly selected clones from the library constructed after three cycles of affinity enrichment showed that more than 80% of the clones contained the tract (Fig. 2 A). From analysis of the tract in the erythropoietin receptor gene locus, we estimated the rate of enrichment to be 10-fold and also that tracts present as a single copy in the genome were successfully enriched (Fig. 1 B).

The library contained clones with perfect repeats of the dinucleotide (dG-dA), although about 92% (11/12) of the tracts contained a variation of the repeat sequence around the tracts. For example, pHGA1 contained (dT-dC)-(dT)and (dC-dT)-(dT-dC)sequences, variations of the (dT-dC) repeat, next to the (dT-dC)sequence. This is quite different from the library of poly(dA)poly(dT) tracts constructed by the same strategy using biotinylated poly(dT). All of the clones analyzed contained a perfect repeat of poly(dA)poly(dT) 14-37 bp in length (27) . On the other hand, the library of poly(dG)poly(dC) tracts contained various types of sequences that were different from the perfect repeat.()

DNA Polymorphism Associated with Poly(dG-dA)Poly(dT-dC) Tracts

Microsatellite DNA frequently shows polymorphism of the repeat length among individuals. This type of the polymorphism was first described for minisatellite DNA as variable number of tandem repeats (7) . Recently, however, because of the abundance in the genome and the divergence of the repeat length and also the feasibility of PCR analysis, microsatellites are commonly used as polymorphic markers. All three clones from the library of poly(dG-dA)poly(dT-dC) tracts showed variable number of tandem repeat-type polymorphisms among the Japanese population (Fig. 3, A and B) at the frequencies of 0.70-0.75, a relatively high rate for a homogeneous population such as the Japanese. Frequencies of other types of microsatellite DNA such as poly(dC-dA)poly(dT-dG) are 0.31-0.79 (average 0.544) (31) . We also observed DNA polymorphism between cancer and normal cells from the same individual (Fig. 3 C). This was presumably due to the instability of microsatellites during the process of tumorigenesis, which was often observed for proximal colon cancers (32) .

Instability of Poly(dG-dA)Poly(dT-dC) Tracts

Although the polymorphisms associated with poly(dC-dA)poly(dT-dG) tracts were extensively analyzed, other types of microsatellites were not well studied. This was partly because of the abundance of the sequence in the genome. Poly(dC-dA)poly(dT-dG) tracts are estimated to be present at as much as 10loci per higher eukaryotic genome, and their polymorphism seems to be due to the instability of the tracts during replication or sister chromatid exchange (9, 33, 34, 35) . DNA fragments with these tracts can form Z-DNA under conditions such as high ionic strength, and this structure can cause replication error and/or recombination (36, 37) . In contrast, DNA fragments with poly(dG-dA)poly(dT-dC) tracts can form triplex DNA in the presence of the third strand poly(dG-dA) and metal ions (30, 38) . The third strand could be supplied from the same tract (intramolecular triplex formation) or from a similar tract at another location (13) . There have been several reports that these tracts were also associated with recombination hotspots and replication arrest (39, 40, 41) . Therefore, it is not surprising that such tracts are unstable in the genome and are associated with DNA polymorphism. Our results suggest that the complexity of the library of fragments containing poly(dG-dA)poly(dT-dC) tracts is about 1/1000 of that of the original genome (roughly 10, see Fig. 1 B), which is in a good accordance with a previous report on the abundance of these tracts (0.07% of the total human genome) (42) .

Poly(dG-dA)Poly(dT-dC) Tracts as Polymorphic Markers

There are a number of methods to obtain polymorphic markers. Restriction-fragment length polymorphism markers were originally obtained by Southern blots of chromosomal DNA digested with various restriction enzymes using locus-specific probes. More abundant markers, minisatellites, were obtained by cross-hybridization with known minisatellites (2) . Microsatellites could be obtained by PCR or computer survey when the sequence of the locus of interest is known. However, all of these methods include lengthy procedures such as subcloning, sequencing, and hybridization. Several methods were devised to collectively obtain these markers, strategies using differential cloning or PCR with degenerate primers (43, 44) . Our approach, using triplex affinity capture first creates a library of clones containing poly(dG-dA)poly(dT-dC) tracts. Cloned fragments 0.3-1.5 kilobases in length can be directly screened by colony hybridization with cosmids or YACs or DNA fragments containing a region of interest to obtain polymorphic markers derived from the region. Furthermore, since this method has no double-stranded DNA denaturation step, the fragments containing repetitive sequences, which tend to be lost through subtractive cloning procedures, could be efficiently obtained.

  
Table: Efficiency of triplex affinity capture


  
Table: 0p4in Incomplete repeats.

  
Table: Allele frequencies for (dG-dA) detected by pHGA6, pHGA8, and pHGA11



FOOTNOTES

*
This work was supported by grants-in-aid from the Ministry of Education of Japan (to M. O. and R. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) D45426-D45436.

§
To whom correspondence should be addressed. Tel.: 81-3-3812-2111 (ext. 7835); Fax: 81-3-3818-9437.

The abbreviations used are: bp, base pair(s); PCR, polymerase chain reaction.

N. Nishikawa, M. Oishi, and R. Kiyama, unpublished results.


ACKNOWLEDGEMENTS

We thank Drs. Kenich Seta, Tatsuo Katayama, Toshio Yokoyama, and Shuichi Nogami (Hakujikai Memorial Hospital) and Dr. Nobuyuki Yokokawa (Japanese Red Cross Society) for providing blood and cancer tissue samples and Rieko Ohki for analysis of microsatellite instability.


REFERENCES
  1. Botstein, D., White, R., Skolnick, M., and Davis, R. W. (1980) Am. J. Hum. Genet. 32, 314-331 [Medline] [Order article via Infotrieve]
  2. Jeffreys, A. J., Wilson, V., and Thein, S. L. (1985) Nature 314, 67-73 [CrossRef][Medline] [Order article via Infotrieve]
  3. Hearne, C. M., Ghosh, S., and Todd, J. A. (1992) Trends Genet. 8, 288-294 [Medline] [Order article via Infotrieve]
  4. Wrogemann, K., Biancalana, R., Devys, D., Imbert, G., Trottier, Y., and Mandel, J.-L. (1993) in DNA Fingerprinting: State of the Science (Pena, S. D. J., Chakraborty, R., Epplen, J. T., and Jeffreys, A. J., eds) pp. 141-152, Birkhauser Verlag, Basel, Switzerland
  5. Weissenbach, J. (1993) Curr. Opin. Genet. Dev. 3, 414-417 [CrossRef][Medline] [Order article via Infotrieve]
  6. Wooster, R., Cleton-Jansen, A.-M., Collins, N., Mangion, J., Cornelis, R. S., Cooper, C. S., Gusterson, B. A., Ponder, B. A. J., von Demling, A., Wiestler, O. D., Cornelisse, C. J., Devilee, P., and Stratton, M. R. (1994) Nat. Genet. 6, 152-156 [CrossRef][Medline] [Order article via Infotrieve]
  7. Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm. T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E., and White, R. (1987) Science 235, 1616-1622 [Abstract/Free Full Text]
  8. Hamada, J., Petrino, M. G., and Kakunaga, T. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 6465-6469 [Abstract/Free Full Text]
  9. Weinreb, A., Katzenberg, D. R., Gilmore, G. L., and Birshtein, B. K. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 529-533 [Abstract/Free Full Text]
  10. Gut, S. H., Bischoff, M., Hobi. R., and Kuenzle, C. C. (1987) Nucleic Acids Res. 15, 9691-9705 [Abstract/Free Full Text]
  11. Fishel, R., Lescoe, M. K., Rao, M. R. S., Copeland, N. G., Jenkins, N. A., Garber, J., Kane, M., and Kolodner, R. (1993) Cell 75, 1027-1038 [CrossRef][Medline] [Order article via Infotrieve]
  12. Prolla, T. A., Pang, Q., Alani, E., Kolodner, R. D., and Liskay, R. M. (1994) Science 265, 1091-1093 [Abstract/Free Full Text]
  13. Wells, R. D., Collier, D. A., Hanvey, J. C., Shimizu, M., and Wohlrab, F. (1988) FASEB J. 2, 2939-2949 [Abstract]
  14. Kohwi, Y., and Kohwi-Shigematsu, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3781-3785 [Abstract/Free Full Text]
  15. Usdin, K., and Furano, A. V. (1989) J. Biol. Chem. 264, 15681-15687 [Abstract/Free Full Text]
  16. Bernues, J., Beltoran, R., Casasnovas, J. M., and Azorin, F. (1990) Nucleic Acids Res. 18, 4067-4073 [Abstract/Free Full Text]
  17. Malkov, V, A., Soyfer, V. N., and Frank-Kamenetskii, M. D. (1992) Nucleic Acids Res. 20, 4889-4895 [Abstract/Free Full Text]
  18. Martinez-Balbas, A., and Azorin, F. (1993) Nucleic Acids Res. 21, 2557-2562 [Abstract/Free Full Text]
  19. Strobel, S. A., and Dervan, P. B. (1990) Science 249, 73-75 [Abstract/Free Full Text]
  20. Strobel, S. A., and Dervan, P. B. (1991) Nature 350, 172-174 [CrossRef][Medline] [Order article via Infotrieve]
  21. Strobel, S. A., Doucette-Stamm, L. A., Riba, L., Housman, D. E., and Dervan, P. B. (1991) Science 254, 1639-1642 [Abstract/Free Full Text]
  22. Cooney, M., Czernuszewicz, G., Postel, E. H., Flint, S. J., and Hogan, M. E. (1988) Science 241, 456-459 [Abstract/Free Full Text]
  23. Postel, E. H., Flint, S. J., Kessler, D. J., and Hogan, M. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8227-8231 [Abstract/Free Full Text]
  24. Dual-Valentin, G., Thuong, N. T., and Helene, C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 504-508 [Abstract/Free Full Text]
  25. Ito, T., Smith, C. L., and Cantor, C. R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 495-498 [Abstract/Free Full Text]
  26. Fox, K. R. (1992) Nucleic Acids Res. 6, 1235-1242
  27. Kiyama, R., Nishikawa, N., and Oishi, M. (1994) J. Mol. Biol. 237, 193-200 [CrossRef][Medline] [Order article via Infotrieve]
  28. Yokota, H., Amano, S., Yamane, T., Ataka, K., Kikuya, E., and Oishi, M. (1994) Anal. Biochem. 219, 131-138 [CrossRef][Medline] [Order article via Infotrieve]
  29. Kiyama, R., and Camerine-Otero, R. D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10450-10454 [Abstract/Free Full Text]
  30. Malkov, V. A., Voloshin, O. N., Soyfer, V. N., and Frank-Kamenetskii, M. D. (1993) Nucleic Acids Res. 21, 585-591 [Abstract/Free Full Text]
  31. Weber, J. L., and May, P. E. (1989) Am. J. Hum. Genet. 44 388-396 [Medline] [Order article via Infotrieve]
  32. Thibodeau, S. N., Bren, G., and Schaid, D. (1993) Science 260, 816-819 [Abstract/Free Full Text]
  33. Hamada, H., and Kakunaga, T. (1982) Nature 298, 396-398 [CrossRef][Medline] [Order article via Infotrieve]
  34. Blaho, J. A., and Wells, R. D. (1986) Proc. Natl. Acad. Sci. U. S. A. 37, 107-126
  35. Lapidot, A., Baran, N., and Manor, H. (1989) Nucleic Acids Res. 17, 883-900 [Abstract/Free Full Text]
  36. Rich, A., Nordheim, A., and Wang, A. H.-J. (1984) Annu. Rev. Biochem. 33, 791-846 [CrossRef]
  37. Blaho, J. A., and Wells, R. D. (1989) Prog. Nucleic Acid Res. Mol. Biol. 37, 107-126 [Medline] [Order article via Infotrieve]
  38. Lyamichev, V. I., Voloshin, O. N., Frank-Kamenetskii, M. D., and Soyfer, V. N. (1991) Nucleic Acids Res. 19, 1633-1638 [Abstract/Free Full Text]
  39. Steinmetz, M., Stephan, D., and Lindahl, K. F. (1986) Cell 44, 895-904 [CrossRef][Medline] [Order article via Infotrieve]
  40. Weinreb, A., Collier, D. A., Birshtein, B. K., and Wells, R. D. (1990) J. Biol. Chem. 265, 1352-1359 [Abstract/Free Full Text]
  41. Baron, A., Lapidot, A., and Manor, H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 507-511 [Abstract/Free Full Text]
  42. Manor, H., Rao, B. S., and Martin, R. G. (1988) J. Mol. Evol. 27, 96-101 [CrossRef][Medline] [Order article via Infotrieve]
  43. Lisitsyn, N., Lisitsyn, N., and Wigler, M. (1993) Science 259, 946-951 [Abstract]
  44. LeBlanc-Straceski, J. M., Montogomery, K. T., Kissel, H., Murtaugh, L., Tsai, P., Ward, D. C., Krauter, K. S., and Kucherlapati, R. (1994) Genomics 19, 341-349 [CrossRef][Medline] [Order article via Infotrieve]
  45. Noguchi, C. T., Bae, K. S., Chin, K., Wada, Y., Schechter, A. N., and Hankins, W. D. (1991) Blood 78, 2548-2556 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Kiyama, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishikawa, N.
Right arrow Articles by Kiyama, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement