![]()
|
|
||||||||
From the
Previous observations have shown that binding of growth hormone
to its receptor leads to activation of transcription factors via a
mechanism involving phosphorylation on tyrosine residues. In order to
establish whether the prolactin-activated transcription factor Stat 5
(mammary gland factor) is also activated by growth hormone, nuclear
extracts were prepared from COS-7 cells transiently expressing
transfected Stat 5 and growth hormone receptor cDNA. Gel
electrophoresis mobility shift analyses revealed the growth
hormone-dependent presence of specific DNA-binding proteins in these
extracts. The complexes formed could be supershifted by polyclonal
anti-Stat 5 antiserum. In other experiments nuclear extracts from
growth hormone-treated Chinese hamster ovary cells stably expressing
transfected growth hormone receptor cDNA and liver from growth
hormone-treated hypophysectomized rats were used for gel
electrophoresis mobility shift analyses. These also revealed the
presence of specific DNA-binding proteins sharing antigenic
determinants with Stat 5. Stat 5 cDNA was shown to be capable of
complementing the growth hormone-dependent activation of transcription
of a reporter gene in the otherwise unresponsive COS-7 cell line. This
complementation was dependent on the presence of Stat 5 tyrosine 694,
suggesting a role for phosphorylation of this residue in growth
hormone-dependent activation of DNA-binding and transcription.
Pituitary growth hormone is the principal hormone regulating
growth in mammals (1). However, in addition to its unique somatogenic
effects, growth hormone also shares some of the lactogenic properties
of its close relative prolactin: stimulating both mammary gland
development
(2, 3) and lactation
(4) . Both
growth hormone and prolactin regulate cellular processes as a result of
their binding to specific membrane-bound receptors
(5, 6, 7, 8) . These receptors have been
cloned from a variety of species and assigned to a family of peptide
hormone and growth factor receptors, the cytokine receptor superfamily.
This family, which includes receptors for prolactin, interleukins-2
through -7, erythropoietin, and granulocyte- and granulocyte-macrophage
colony-stimulating factors, is characterized by structural features
such as a single membrane spanning domain, an arrangement of four
conserved extracellular cysteine residues, the absence of intrinsic
protein kinase activity, and an intracellular proline-rich region
(9, 10, 11) . There is now increasing evidence
that the cytokine receptors also share common components in their
signal transduction pathways. Prominent among these are protein
tyrosine kinases of the Janus kinase family
(12) which have
been shown to associate with a variety of cytokine receptors, including
those for growth hormone and prolactin
(13, 14) . In
addition, growth hormone, prolactin, interleukins-4 and -6, and
interferon-
Growth hormone stimulation of several cell lines has
been shown to activate binding of nuclear proteins to a GAS-like DNA
element, the serine protease inhibitor GAS-like element 1 (SPI-GLE 1),
present in the serine protease inhibitor 2.1 promoter. This in turn
leads to the enhancement of expression of adjacent cDNA sequences in
reporter-plasmid constructs
(15) . In this paper we describe the
growth hormone-dependent activation of SPI-GLE 1 binding of the
recently described prolactin-activated Stat, Stat 5 (mammary gland
factor, Ref. 22). We also demonstrate that Stat 5 cDNA is able to
facilitate the activation of a growth hormone reporter system based on
the SPI-GLE 1. These results indicate that the similarities between the
endocrinology of growth hormone and prolactin extend to their ability
to utilize the same factor for the enhancement of gene transcription.
Cell Culture and Animals COS-7 cells were cultured in Dulbecco's modified Eagle's
medium (Life Technology, Inc.) and Chinese hamster ovary cells stably
expressing transfected rat growth hormone receptor cDNA (designated
CHO-4 cells) in Ham's F-12 Medium (Life Technology, Inc.). Both
media were supplemented with 10% fetal calf serum (Life Technology,
Inc.) and 50 units/ml penicillin, 50 µg/ml streptomycin (Life
Technology, Inc.). Hypophysectomized Sprague-Dawley male rats were
purchased from ALAB, Denmark and maintained on standard chow. Preparation of Antisera Polyclonal Stat 5 ``antiserum'' was raised, using the chicken
egg yolk system, against a Stat 5-glutathione S-transferase
fusion protein containing Stat 5 amino acid residues 6-132. This
antiserum was found to be specific for Stat 5 in so far as it did not
recognize either Stat 1 or Stat 3 in gel electrophoresis mobility shift
assays.
We have shown previously that growth hormone treatment of
Buffalo rat liver and Chinese hamster ovary cells that have been stably
transfected with rat growth hormone receptor cDNA (designated BRL-4 and
CHO-4 cells, respectively) causes the rapid activation of nuclear
protein binding activity to an 11-base pair DNA element, the serine
protease inhibitor
We have shown previously that SPI-GLE 1 is
capable of mediating growth hormone-dependent transcriptional
activation of a reporter cDNA in transfection experiments with Buffalo
rat liver and Chinese hamster ovary cells stably expressing transfected
growth hormone receptor cDNA
(15) . This is also the case for
Buffalo rat liver cells transiently expressing transfected prolactin
receptor cDNA.
Rapid progress has recently been made in elucidating the
mechanisms of signal transduction of the cytokine receptor superfamily.
It is now possible to hypothesize a working model (Fig. 6) in which,
following ligand binding, membrane-bound cytokine receptors activate
tyrosine kinases of the Janus kinase family. This activation leads to
tyrosine phosphorylation of the JAK molecule itself, the associated
receptor and members of the Stat family of DNA-binding proteins
(26, 27, 28, 29, 30) . Six
members of the Stat family have been characterized to date, these being
p91 and its splice variant p84 (termed Stat 1
The gel mobility shift analyses
presented here reveal that growth hormone, like prolactin, can activate
the specific DNA binding of Stat 5 in transfected COS-7 cells. That
this artificial sytem bears some similarity to the in vivo situation is indicated by similar experiments showing that an
endogenously expressed Stat sharing antigenic determinants with Stat 5
is activated in both cultured ovary cells and liver. Further support
for a role for Stat 5 in growth hormone signal transduction can be
derived from the observation that transfection of Stat 5 cDNA
facilitates the growth hormone-dependent activation of a reporter gene
in COS-7 cells. The results obtained with COS-7 cells reveal a
phenomenon seen with other cell lines of non-hepatic origin, that is a
growth hormone receptor-dependent, but growth hormone-independent,
activation of reporter genes (compare Fig. 4, lanes 1, 3, and
4). Such an effect is not seen in Buffalo rat liver (BRL)
cells,
Growth hormone and prolactin have been shown
previously to share similarities both in terms of their physiological
effects on mammary gland development and their common use of JAK 2 in
signal transduction. We have now demonstrated that the similarities in
the endocrinology of these two hormones extends to their ability to
activate the transcription factor Stat 5 via, in both cases, a
mechanism requiring the presence of Stat tyrosine 694. How these
similarities can be reconciled with the unique effects of growth
hormone and prolactin is as yet unclear. It appears paradoxical that
prolactin induces luciferase expression via the SPI-GLE 1 in prolactin
receptor cDNA-transfected cell lines but does not induce SPI 2.1 mRNA
expression in hepatocytes
(41) .
The activation of a single
Stat member by several cytokines is not unique to Stat 5. Several
different molecules, including interferon-
Several cytokines, including growth hormone,
prolactin, and interleukin-6, are capable of simultaneously activating
more than one different Stat family member
(16, 32, 42) . The formation of cell
type-specific patterns of homo- and heteromeric Stat multimers is
therefore an additional potential source of specificity. There are
several lines of published evidence to support this hypothesis.
Glycerol gradient analyses indicate that tyrosine phosphorylation
induces homo- and heterodimerization of both p91 and p84
(36) .
In addition, interferon-
Volume 270,
Number 16,
Issue of April 21, pp. 9448-9453, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
, the receptor for which bear some similarity with the
other cytokine receptors
(11) , all appear to enhance gene
transcription as a result of activation of members of the Stat family
of DNA-binding proteins
(15, 16, 17, 18, 19, 20) .
These molecules are grouped together on the basis of their possession
of src homology domains of type 2 and 3 (SH2 and SH3) and
their ability to bind to short palindromic interferon-
-activated
sequence (GAS)
(
)
-like DNA elements. Such elements
are widely distributed among cytokine-activated gene promoters
(21) .
(
)
Preparation of Cell Extracts
CHO-4 Cells
CHO-4 cells were cultured as described and
then prior to addition of 100 n
M recombinant human growth
hormone (Pharmacia) were starved of fetal calf serum for 12-20 h.
After treatment, the cultures (1-2
10
/extract) were chilled on ice, rinsed with ice-cold
phosphate-buffered saline, and nuclear extracts prepared. The cells
were scraped into 10 ml of resuspension buffer containing 10 m
M TrisHCl, pH 7.4, 10 m
M NaCl, 6 m
M MgCl
, 1 m
M DTT, 0.4 m
M PMSF, and 0.1
m
M Na
VO
and then homogenized in a
Dounce type B homogenizer. The nuclear pellet, after centrifugation,
was resuspended in 3 volumes of lysis buffer containing 20% glycerol,
20 m
M Hepes, pH 7.9, 420 m
M NaCl, 1.5 m
M MgCl
, 0.2 m
M EDTA, 0.2 m
M PMSF, 1
m
M DTT, and 0.1 m
M Na
VO
, and
incubated on ice for 30 min. Further cell debris was removed by
centrifugation and the supernatant nuclear extract collected for gel
electrophoresis mobility shift assays.
COS-7 Cells
COS-7 cells were cultured as described
and then co-transfected with expression plasmids for the growth hormone
receptor and Stat 5. Transfections were carried out with DOTAP
(Boehringer Mannheim) using 2 10
cells for each
extract together with 10 µg of each CsCl density gradient purified
expression plasmid, following the manufacturer's instructions.
After transfection cells were incubated in serum free media for 48 h
and then exposed to 100 n
M human growth hormone for 15 min.
Whole cell extracts were then prepared. Cells were scraped into 1.5 ml
of hypotonic lysis buffer containing 10 m
M TrisHCl, pH
7.4, 10 m
M NaCl, 6 m
M MgCl
, 1 m
M DTT, 0.4 m
M PMSF, and 0.1 m
M Na
VO
. The extract was then centrifuged,
the supernatant discarded, and the cell pellet incubated for 45 min in
3 volumes of a buffer containing 20% glycerol, 20 m
M Hepes, pH
7.9, 420 m
M NaCl, 1.5 m
M MgCl
, 0.2 m
M EDTA, 0.2 m
M PMSF, 1 m
M DTT, 0.1 m
M Na
VO
. Further cell debris was removed by
centrifugation and the supernatant collected for gel electrophoresis
mobility shift assays.
Rat Liver
Six hours or 2 h prior to sacrifice
male, hypophysectomized, Sprague-Dawley rats were given a single
subcutaneous injection of 25 µg of bovine growth hormone. Following
sacrifice of the rats by decapitation, livers were removed, minced, and
frozen in liquid nitrogen. Each nuclear extract was prepared from 2 g
of liver. The liver was disrupted using a Polytron in 2 ml of lysis
buffer containing 10 m
M Hepes, pH 7.9, 25 m
M NaCl,
0.15 m
M spermine, 10% glycerol, and 1 m
M EDTA. A
further 7 ml of lysis buffer was added and homogenization continued
with 10 strokes in a Dounce homogenizer. Nuclei were then isolated by
centrifugation at 100,000 g for 30 min, resuspended in
3 volumes of extraction buffer containing 10 m
M Hepes, pH 7.9,
400 m
M NaCl, 1 m
M DTT, 0.1 m
M PMSF, and
incubated for 1 h at 4 °C. The extract was finally centrifuged at
10,000
g and the supernatant collected and frozen at
-70 °C Gel Electrophoresis Mobility Shift Assay Nuclear extracts were incubated with
P-labeled
double-stranded SPI-GLE 1: (TGTTCTGAGAAATA) oligonucleotides (core
sequence shown underlined), in 15 µl of a buffer containing 4%
Ficoll, 12 m
M Hepes, pH 7.9, 4 m
M Tris
HCl, pH
7.9, 0.1 m
M EDTA, 1 m
M DTT, and 5 µg of
poly(dI-dC). Assembly of Reporter Constructs Double-stranded oligonucleotides containing three tandem SPI-GLE 1
sequences: CTAGTGTTCTGAGAAATGAACGGTTCTGAGAAAGTACAGGTTCTGAGAAAT (SPI-GLE
1 elements shown underlined) were ligated together with a minimal
thymidine kinase (TK) promoter into the pGL2 plasmid (Promega), which
contains the firefly luciferase cDNA, to make pGLE-LUC. The TK promoter
alone was ligated into pGL2 to give the control plasmid pTK-LUC. Cell Transfection with Reporter Plasmid and Luciferase Assay COS-7 cells were cultured in 30-mm dishes to
75% confluence and
then washed twice with phosphate-buffered saline. Transfections were
carried out in serum-free Dulbecco's modified Eagle's
medium with DOTAP (Boehringer Mannheim) according to the
manufacturer's instructions using, in various combinations, the
reporter plasmids pGLE-LUC or pTK-LUC and cDNA expression plasmids for:
(i) wild type Stat 5, (ii) Tyrosine 694
phenylalanine Stat 5
mutant, (iii) rat growth hormone receptors, (iv) mouse prolactin
receptors (long form), and (v) chloramphenicol acetyltransferase (CAT).
All plasmids had been purified by CsCl density gradient centrifugation.
Cells were incubated with DOTAP/DNA for 12 h and then the media was
changed to serum-free Dulbecco's modified Eagle's medium
containing 100 n
M human growth hormone. Human, unlike bovine,
growth hormone binds to both the rodent prolactin and growth hormone
receptors with high affinity
(23) and was thus considered a
suitable substitute for mouse prolactin. Binding assays were performed
as described
(24) , and untransfected COS-7 cells were found to
express less than 1% of the human growth hormone binding activity of
COS-7 cells which had been transiently transfected with rat growth
hormone receptor cDNA. After a further 12 h, cells were washed with
phosphate-buffered saline and then scraped into lysis buffer containing
25 m
M Tris phosphate, pH 7.8, 2 m
M DTT, 2 m
M 1,2-diaminocyclohexane- N,N,N`, N`-tetraacetic
acid, 10% glycerol, and 1% Triton X-100. CAT assays were performed by
incubating 30 µl of extract with 3 µl of
[
C]chloramphenicol (Amersham Corp., 50-62
mCi/mmol, 25 mCi/ml) and 5 µl of 5 mg/ml butyryl coenzyme A
(Boehringer Mannheim) for 3 h at 37 °C. Butyrylated chloramphenicol
was then extracted with xylene and detected using a Wallac
scintillation counter. Luciferase assays were performed using a
BioOrbit luminometer with a pump dispenser. 30 µl of extract was
added to 300 µl of buffer containing 0.12 mg/ml
D-luciferin, 10 m
M DTT, 1 mg/ml bovine serum albumin,
10 m
M magnesium acetate, 0.1
M Tris acetate, pH 7.75,
and 2 m
M EDTA. Luciferase measurements were started by
injecting 30 µl of 5 m
M ATP, 0.5 m
M sodium
pyrophosphate and continued for 30 s. The integrated signal was taken
as representative of luciferase activity.
-activated sequence-like element 1 (SPI-GLE 1,
Ref. 15). SPI-GLE 1 is partly responsible for the growth
hormone-responsiveness of a region of the serine protease 2.1 promoter
and shares homology with DNA elements found in promoters activated by
interferon-
, interleukin-6, and prolactin
(21) . Following
publication of results revealing that the prolactin-activated mammary
gland factor DNA-binding protein is a member of the Stat family
(22) , and bearing in mind the similarities between growth
hormone and prolactin's mechanisms of action, we were interested
to see whether this molecule, Stat 5, is activated by growth hormone
with respect to SPI-GLE 1 binding. COS-7 cells were co-transfected with
growth hormone receptor and Stat 5 cDNA or growth hormone receptor cDNA
alone, treated for 10 min with human growth hormone, a regime which has
been shown previously to elicit maximal SPI-GLE 1 binding activity, and
then harvested for preparation of nuclear extracts. Gel electrophoresis
mobility shift assays revealed that only cells which had been
transfected with both Stat 5 and growth hormone receptor cDNA and then
growth hormone-treated contained specific SPI-GLE 1-binding proteins
(Fig. 1). A nonspecific band of greater mobility than the
specific band was sometimes observed. The presence of this band did not
appear to depend upon any particular treatment regime. Co-incubation of
nuclear extracts during gel shift assays with polyclonal antisera
raised against a Stat 5-glutathione S-transferase fusion
protein confirmed that the growth hormone-dependent complex formed
contained Stat 5.
Figure 1:
Growth hormone activates binding of
Stat 5 to SPI-GLE 1. COS-7 cells were transiently transfected with
growth hormone receptor cDNA ( GHR) either in the presence or
absence of Stat 5 cDNA. Following transfection cells were treated with
100 n
M human growth hormone ( hGH) and whole cell
extracts prepared for gel electophoresis mobility shift assays.
Extracts were co-incubated with non-immune serum or polyclonal Stat 5
antiserum as indicated.
Having shown that growth hormone is capable of
activating Stat 5 in transfected COS-7 cells, it was of interest to
determine whether the endogenous growth hormone-activated DNA binding
protein seen in other cells shares antigenic determinants with Stat 5.
We have described previously
(15) the specific growth
hormone-dependent activation of SPI-GLE 1-binding in growth hormone
receptor transfected Chinese hamster ovary cells (CHO-4 cells). We
therefore subjected nuclear extracts prepared from human growth
hormone-treated CHO-4 cells to gel electrophoresis mobility shift
assays in the presence or absence of polyclonal Stat 5 antiserum using
the SPI-GLE 1 probe. A distinct supershift in the mobility of the
observed DNA binding activity was seen in the presence of the
polyclonal anti-Stat 5 antisera but not preimmune sera (Fig. 2),
indicating that growth hormone does indeed activate the DNA binding of
Stat 5 or a similar molecule in CHO-4 cells. No SPI-GLE 1 binding is
seen in extracts from untreated CHO-4 cells
(15) .
Figure 2:
Growth hormone activates DNA-binding of a
protein sharing antigenic determinants with Stat 5 in CHO-4 cells.
Nuclear extracts were prepared from CHO-4 cells which had been treated
with 100 n
M human growth hormone for 10 min. The extracts were
subjected to gel electrophoresis mobility shift assays with a SPI-GLE 1
probe, alone and in the presence of preimmune or Stat 5
antiserum.
Northern
blot analysis has revealed that the expression of Stat 5 is not
restricted to mammary gland but rather ubiquitous
(22) . We were
therefore interested to see whether Stat 5 is present and activated by
growth hormone in liver, since this is a major target for growth
hormone stimulation. Nuclear extracts were prepared from livers of
hypophysectomized male rats 2 or 6 h after a single injection of bovine
growth hormone. Control extracts from hypophysectomized but untreated
rats were also prepared. The extracts were then subjected to gel
mobility shift assay with a SPI-GLE 1 probe in the presence or absence
of polyclonal Stat 5 antiserum. Gel electrophoresis mobility shift
assays revealed the presence of nuclear proteins capable of binding to
SPI-GLE 1 only in extracts from growth hormone-treated animals (Fig.
3). These complexes contained proteins sharing antigenic determinants
with Stat 5. We were, however, unable to supershift the growth hormone
dependent complex in its entirety even after increasing the ratio of
antiserum to nuclear proteins (data not shown). The experiment shown
represents a gel mobility shift assay using approximately equivalent
amounts of nuclear extract and antiserum to the analyses shown for
COS-7 and CHO-4 cells.
(
)
In order to determine whether
this growth hormone-dependent transcriptional activation could be
mediated by Stat 5, we co-transfected COS-7 cells with expression
plasmids for Stat 5 and the growth hormone or prolactin receptors
together with a luciferase reporter construct either containing
(pGLE-LUC) or lacking (pTK-LUC) three copies of the SPI-GLE 1. In the
absence of SPI-GLE 1 elements in the reporter plasmid no growth
hormone-dependent induction in luciferase expression was seen even when
the cells were transfected with cDNA for growth hormone receptors and
Stat 5 (Fig. 4, lane 1). Similarly low levels of
activity were seen when cells were transfected with pGLE-LUC either
alone or in the presence of Stat 5 cDNA ( lanes 2 and
3). Co-transfection of growth hormone receptor cDNA with
pGLE-LUC resulted in higher levels of growth hormone-independent
luciferase activity with a small induction of activity following
hormone treatment ( lane 4). Transfection of additional Stat 5
cDNA together with growth hormone receptor cDNA and pGLE-LUC, however,
complemented the ability of COS-7 cells to respond to growth hormone
and an approximately 2-fold induction of luciferase activity was seen
following growth hormone treatment. The luciferase activity induced by
human growth hormone treatment of COS-7 cells transfected with
pGLE-LUC, and cDNA for Stat 5 and the mouse prolactin receptor is shown
for comparison ( lane 6). The results described here thus
demonstrate that Stat 5 is capable of complementing a growth hormone
response normally only weakly expressed in COS-7 cells via both the
growth hormone and prolactin receptors.
Figure 4:
Stat 5 is capable of mediating growth
hormone-dependent transcriptional activation. COS-7 cells were
transfected with various combinations of reporter plasmids containing
or lacking SPI-GLE 1 DNA elements ( pGLE-LUC or
pTK-LUC, respectively) and expression plasmids for Stat 5,
growth hormone receptors ( GHR), or prolactin receptors
( PRLR) together with a plasmid constitutively expressing
chloramphenicol acetyltransferase (CAT). Each bar represents
the average of three independent experiments with error bars
representing standard deviations. CAT activities were measured for each
sample and the variation in transfection efficiencies found to lie
within the standard deviations presented.
Prolactin has been shown to
activate DNA-binding of Stat 5 by inducing its phosphorylation on
tyrosine residue 694
(25) . Both growth hormone and prolactin
stimulate tyrosine phosphorylation of JAK 2, a molecule which has been
shown to be necessary for the activation of Stats by other cytokines
and which is probably a Stat kinase. It is consequently not
unreasonable to suppose that growth hormone and prolactin activate Stat
5 by the same mechanism. This hypothesis was supported by the
observation that substitution of tyrosine 694 for a phenylalanine in
the Stat 5 expression plasmid resulted in a loss of growth hormone
dependence of luciferase expression in co-transfection experiments with
COS-7 cells (Fig. 5).
Figure 5:
Tyrosine 694 is essential for activation
of Stat 5 by growth hormone. COS-7 cells were transfected with pGLE-LUC
and expression plasmid for growth hormone receptors ( GHR) and
mutated (Tyr Phe) or wild type Stat 5 together
with a plasmid constitutively expressing CAT. Each bar represents the average of three independent experiments with error
bars representing standard deviations. CAT activities were measured for
each sample and the variation in transfection efficiencies found to lie
within the standard deviations presented.
and
,
respectively), p113 (Stat 2)
(21) , epidermal growth factor- and
interleukin-6-activated Stat 3 (acute phase response factor, Refs.
31-33), Stat 4
(34) , interleukin-4-activated
interleukin-4 Stat
(35) , and Stat 5 (mammary gland factor, Ref.
22). Following their phosphorylation on tyrosine residues, Stat
molecules dimerize, presumably as a result of phosphotyrosine-SH2
domain interactions, and a specific DNA binding complex is formed
(36) . A consensus Stat binding sequence, TT A/CC N NN AA, can
be derived from elements found within a variety of cytokine-regulated
gene promoters. How Stat-DNA binding enhances gene transcription is
unclear, although Stat 5 has been shown to de-repress expression via
the
-casein promoter by displacing the ubiquitous transcription
factor YY 1
(37, 38) . The frequent observation of
potential Stat binding elements in serial repeat may also be relevant
to the mechanism of enhancement of transcription by the Stats
(15, 39) . It is not clear whether the Stats necessarily
bind directly to their activating receptor, although this appears to be
the case for at least interleukin-4 Stat
(35) and the
interleukin-4 receptor and p91/Stat 1
and the epidermal growth
factor receptor
(40) .
(
)
thus explaining why a significantly
larger induction of activity is seen following growth hormone treatment
of BRL-4 cells than following identical treatment of COS-7 cells
(15) .
, epidermal growth
factor, interleukin-6, and indeed both growth hormone and prolactin,
activate a Stat recognized by polyclonal antisera to p91
(17, 20, 32, 42) . It may be the case
that specificity depends upon the design of the sequence flanking the
Stat response element, the presence of other transcription factors in
the DNA-bound complex, or the cellular expression or tyrosine
phosphorylation patterns of receptors, JAKs and Stats. That Stat 5
tyrosine 694 appears to be the target for both prolactin and, as shown
here, growth hormone-induced phosphorylation is not consistent with the
two hormones retaining their specificity via differential Stat
phosphorylation patterns. However, the observation that the growth
hormone-activated Stats derived from NIH 3T3
(17) cells, but
not CHO-4, BRL-4, and IM-9
(15, 43) cells, are
recognized by antibodies capable of recognizing
interferon-
-activated p91 suggest that differential expression
could be important.
stimulates the formation of a DNA binding
complex consisting of a heteromer containing p84/p91 (Stat1), p113
(Stat 2), and a 48-kDa DNA-binding protein (44). We observed that it
was not possible to fully supershift the complexes formed between
SPI-GLE 1 and nuclear proteins extracted from growth hormone-treated
hypophysectomized rat liver using the same conditions capable of
inducing a complete shift with CHO-4 cells. This suggests that in
addition to Stat 5 other, as yet uncharacterized, transcription factors
are activated by growth hormone in rat liver. We are currently
investigating this possibility.
-activated sequence; SPI-GLE 1, serine protease
inhibitor 2.1 GAS-like element 1; PMSF, phenylmethylsulfonyl fluoride;
pGLE-LUC, luciferase reporter plasmid containing thymidine kinase
promoter and SPI-GLE 1 enhancer elements; TK, thymidine kinase;
pTK-LUC, luciferase reporter plasmid containing thymidine kinase
promoter; BRL cells, Buffalo rat liver cells; CHO cells, Chinese
hamster ovary cells; COS-7, African green monkey CV1 cells transformed
with an origin-defective SV-40 mutant virus; CAT, chloramphenicol
acetyltransferase; JAK: Janus (just another) kinase; DOTAP,
N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium
methyl sulfate.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
O. M. Vidal, R. Merino, E. Rico-Bautista, L. Fernandez-Perez, D. J. Chia, J. Woelfle, M. Ono, B. Lenhard, G. Norstedt, P. Rotwein, et al. In Vivo Transcript Profiling and Phylogenetic Analysis Identifies Suppressor of Cytokine Signaling 2 as a Direct Signal Transducer and Activator of Transcription 5b Target in Liver Mol. Endocrinol., January 1, 2007; 21(1): 293 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gardmo and A. Mode In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression J. Mol. Endocrinol., December 1, 2006; 37(3): 433 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Maamra, A Milward, H Z. Esfahani, L P Abbott, L A Metherell, M O Savage, A J L Clark, and R J M Ross A 36 residues insertion in the dimerization domain of the growth hormone receptor results in defective trafficking rather than impaired signaling J. Endocrinol., February 1, 2006; 188(2): 251 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Q. Xu, B. S. Emerald, E. L. K. Goh, N. Kannan, L. D. Miller, P. D. Gluckman, E. T. Liu, and P. E. Lobie Gene Expression Profiling to Identify Oncogenic Determinants of Autocrine Human Growth Hormone in Human Mammary Carcinoma J. Biol. Chem., June 24, 2005; 280(25): 23987 - 24003. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Endo, Y. Takahashi, Y. Sasaki, T. Saito, and T. Kamataki Novel Gender-Related Regulation of CYP2C12 Gene Expression in Rats Mol. Endocrinol., May 1, 2005; 19(5): 1181 - 1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ling and P. E. Lobie RhoA/ROCK Activation by Growth Hormone Abrogates p300/Histone Deacetylase 6 Repression of Stat5-mediated Transcription J. Biol. Chem., July 30, 2004; 279(31): 32737 - 32750. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Milward, L. Metherell, M. Maamra, M. J. Barahona, I. R. Wilkinson, C. Camacho-Hubner, M. O. Savage, C. M. Bidlingmaier, A. J. L. Clark, R. J. M. Ross, et al. Growth Hormone (GH) Insensitivity Syndrome due to a GH Receptor Truncated after Box1, Resulting in Isolated Failure of STAT 5 Signal Transduction J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1259 - 1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Faulds, H. Olsen, L. A. Helguero, J.-A. Gustafsson, and L.-A. Haldosen Estrogen Receptor Functional Activity Changes during Differentiation of Mammary Epithelial Cells Mol. Endocrinol., February 1, 2004; 18(2): 412 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Li, C. Miller, S. Hegde, and D. Wojchowski Roles for an Epo Receptor Tyr-343 Stat5 Pathway in Proliferative Co-signaling with Kit J. Biol. Chem., October 17, 2003; 278(42): 40702 - 40709. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Shelburne, M. E. McCoy, R. Piekorz, V. Sexl, K.-H. Roh, S. M. Jacobs-Helber, S. R. Gillespie, D. P. Bailey, P. Mirmonsef, M. N. Mann, et al. Stat5 expression is critical for mast cell development and survival Blood, August 15, 2003; 102(4): 1290 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ling, T. Zhu, and P. E. Lobie Src-CrkII-C3G-dependent Activation of Rap1 Switches Growth Hormone-stimulated p44/42 MAP Kinase and JNK/SAPK Activities J. Biol. Chem., July 11, 2003; 278(29): 27301 - 27311. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Mertani, M. Raccurt, A. Abbate, J. Kindblom, J. Tornell, N. Billestrup, Y. Usson, G. Morel, and P. E. Lobie Nuclear Translocation and Retention of Growth Hormone Endocrinology, July 1, 2003; 144(7): 3182 - 3195. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, T. Zhu, Y. Chen, H. C. Mertani, K.-O. Lee, and P. E. Lobie Human Growth Hormone-regulated HOXA1 Is a Human Mammary Epithelial Oncogene J. Biol. Chem., February 21, 2003; 278(9): 7580 - 7590. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Graichen, J. Sandstedt, E. L. K. Goh, O. G. P. Isaksson, J. Tornell, and P. E. Lobie The Growth Hormone-binding Protein Is a Location-dependent Cytokine Receptor Transcriptional Enhancer J. Biol. Chem., February 14, 2003; 278(8): 6346 - 6354. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhu, L. Ling, and P. E. Lobie Identification of a JAK2-independent Pathway Regulating Growth Hormone (GH)-stimulated p44/42 Mitogen-activated Protein Kinase Activity. GH ACTIVATION OF Ral AND PHOSPHOLIPASE D IS Src-DEPENDENT J. Biol. Chem., November 15, 2002; 277(47): 45592 - 45603. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Kopchick, C. Parkinson, E. C. Stevens, and P. J. Trainer Growth Hormone Receptor Antagonists: Discovery, Development, and Use in Patients with Acromegaly Endocr. Rev., October 1, 2002; 23(5): 623 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Morales, M. H. Faulds, U. J. Lindgren, and L.-A. Haldosen 1alpha ,25-Dihydroxyvitamin D3 Inhibits GH-induced Expression of SOCS-3 and CIS and Prolongs Growth Hormone Signaling via the Janus Kinase (JAK2)/Signal Transducers and Activators of Transcription (STAT5) System in Osteoblast-like Cells J. Biol. Chem., September 13, 2002; 277(38): 34879 - 34884. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. E. Timsit and D. S. Riddick Stimulation of Hepatic Signal Transducer and Activator of Transcription 5b by GH Is Not Altered by 3-Methylcholanthrene Endocrinology, September 1, 2002; 143(9): 3284 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Graichen, D. Liu, Y. Sun, K.-O. Lee, and P. E. Lobie Autocrine Human Growth Hormone Inhibits Placental Transforming Growth Factor-beta Gene Transcription to Prevent Apoptosis and Allow Cell Cycle Progression of Human Mammary Carcinoma Cells J. Biol. Chem., July 12, 2002; 277(29): 26662 - 26672. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Helander, J.-A. Gustafsson, and A. Mode Possible Involvement of Truncated Signal Transducer and Activator of Transcription-5 in the GH Pattern-Dependent Regulation of CYP2C12 Gene Expression in Rat Liver Mol. Endocrinol., July 1, 2002; 16(7): 1598 - 1611. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Flores-Morales, H. Gullberg, L. Fernandez, N. Stahlberg, N. H. Lee, B. Vennstrom, and G. Norstedt Patterns of Liver Gene Expression Governed by TR{beta} Mol. Endocrinol., June 1, 2002; 16(6): 1257 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. O'Brien, J. J. O'Shea, and C. Carter-Su SH2-B Family Members Differentially Regulate JAK Family Tyrosine Kinases J. Biol. Chem., March 1, 2002; 277(10): 8673 - 8681. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Faulds, K. Pettersson, J.-A. Gustafsson, and L.-A. Haldosen Cross-Talk Between ERs and Signal Transducer and Activator of Transcription 5 Is E2 Dependent and Involves Two Functionally Separate Mechanisms Mol. Endocrinol., November 1, 2001; 15(11): 1929 - 1940. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cao, P. M. Gowri, T. C. Ganguly, M. Wood, J. F. Hyde, F. Talamantes, and M. Vore PRL, Placental Lactogen, and GH Induce Na+/Taurocholate-Cotransporting Polypeptide Gene Expression by Activating Signal Transducer and Activator of Transcription-5 in Liver Cells Endocrinology, October 1, 2001; 142(10): 4212 - 4222. [Abstract] [Full Text] [PDF] |