JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watson, A.
Right arrow Articles by Latchman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watson, A.
Right arrow Articles by Latchman, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 16, Issue of April 21, pp. 9655-9660, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Cyclic AMP Response Element in the Calcitonin/Calcitonin Gene-related Peptide Gene Promoter Is Necessary but Not Sufficient for Its Activation by Nerve Growth Factor (*)

Andrea Watson , David Latchman (§)

From the (1) Department of Molecular Pathology, University College London Medical School, The Windeyer Building, Cleveland Street, London, W1P 6DB United Kingdom

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The gene encoding calcitonin gene-related peptide (CGRP) is inducible by nerve growth factor (NGF) in primary dorsal root ganglion neurons. By transfecting these primary neurons, we have defined a region of the CGRP promoter from -140 to -72 relative to the transcriptional start site which is essential for its inducibility by NGF as well as by cyclic AMP and which can confer these responses on a heterologous promoter. A cyclic AMP response element (CRE) within this region is essential for both these responses which are abolished by site-directed mutagenesis of this element. In contrast to the intact fragment the isolated CRE can confer responsiveness to cyclic AMP but not NGF on a heterologous promoter. The reasons for the different role of the CRE in the response of the CGRP promoter to cyclic AMP and NGF are discussed.


INTRODUCTION

Nerve growth factor (NGF)() has a number of effects on specific neuronal cells promoting both survival and differentiation (1, 2) . Such effects are mediated via the binding of NGF to the TrkA surface receptor which has a tyrosine kinase activity that is stimulated by NGF binding (3, 4) . The signaling cascade which is activated by this process ends in the nucleus with the activation of specific genes whose protein products are involved in mediating the cellular changes which occur in response to NGF.

The analysis of such changes in gene expression has been greatly aided by the availability of the PC12 pheochromocytoma cell line (5) which responds to NGF by differentiation to a sympathetic neuron-like phenotype (for review, see Ref. 6). Studies using these cells have defined a number of genes whose transcription is activated by NGF. These include those encoding transcription factors such as c- fos (7, 8) and NGFIA (9) and NGFIB (10) , which are induced rapidly and transiently, as well as others such as those encoding tyrosine hydroxylase (11) and peripherin (12) which are induced more slowly.

Evidently insights obtained in this immortalized cell line need to be confirmed in the appropriate primary neurons. The inability of sympathetic or embryonic dorsal root ganglion (DRG) sensory neurons to survive in the absence of NGF (13) has rendered this difficult however. It has been possible however to confirm some of the insights obtained with PC12 cells using cultures of adult DRG neurons which are responsive to NGF but do not require it for survival (14, 15) . Thus these cells respond to NGF by inducing expression of the mRNA encoding c-Fos (16) as well as those encoding NGFIA and IB (17) . These cells also show elevated levels of the neuropeptides substance P and calcitonin gene-related peptide (CGRP) in response to NGF (18) .

Interestingly, however, our recent experiments suggest that although the CGRP gene promoter can be activated by NGF in both DRG and PC12 cells, the mechanisms mediating this effect are different in the two cell types (19) . Thus by modifying a procedure used by others for chick neurons (20) , we were able to successfully transfect adult rat DRG neurons using a calcium phosphate procedure. This allowed us to show that the induction of the CGRP promoter in DRG cells requires only sequences located from -140 upstream of the transcriptional start site to +8 downstream (19) . In contrast in PC12 cells a construct containing this region is not inducible, and induction requires in addition sequences located between -1670 and -140 (19) .

The 149-base pair element in the CGRP promoter thus offers the opportunity to dissect an NGF-responsive region which is specifically active in primary DRG neurons. Here we show that the NGF inducibility mediated by this region in DRG neurons is dependent upon a cyclic AMP response element (CRE) within it. However, this CRE alone is not sufficient to mediate a response to NGF when separated from other sequences in this region, although it can produce a response to cyclic AMP in these circumstances.


MATERIALS AND METHODS

Adult Dorsal Root Ganglion Cultures

Cultures were prepared from adult Wistar rats. Spinal ganglia were removed aseptically, digested with 0.3% collagenase (Boehringer Mannheim) for 90 min, then mechanically dissociated through a 1-ml Gilson tip. Cells were plated for at least 2 h in the absence of NGF on polyornithine-coated 35-mm tissue culture Petri dishes. Lightly adherent neurons were separated from more adherent non-neuronal cells using a stream of medium from a 1-ml Gilson pipette. To further purify the neurons they were then pelleted at 120 g through fetal calf serum. Neurons were replated in the absence of NGF onto 35-mm tissue culture Petri dishes coated with poly- L-lysine at a density of 10cells/dish and grown in F-14 medium with 4% Ultraser G (Life Technologies, Inc.), 100 mg/ml streptomycin and 100 units/ml penicillin in the presence of the mitotic inhibitor cytosine arabinoside at 10 µ M. Cells for histochemical staining were grown in 10 mm Lab-Tec Chamber slides (Nunc) at a density of 1000 cells/well. When appropriate either 2.5 S NGF (Promega) to a final concentration of 5 ng/ml or dibutyryl cyclic AMP to 50 µ M was added to the cultures.

Transfection

At least 8 h after plating the neuronally enriched cultures, DNA transfections were performed using the calcium phosphate procedure with 10 µg/ml plasmid DNA essentially as described by Gorman (21) and Gabellini et al. (20) , but with the following modifications (19) . Transfection was performed in the presence of 10 µg/ml polyornithine for 7 h followed by a 30% MeSO shock for 4 min at room temperature (22) . Cells were left for 36 h after transfection before the addition of NGF then left for a further 48 h before harvesting. Neuronal cell networks free from residual non-neuronal cells were removed from the poly- L-lysine as described in the cell culture section and assayed for CAT activity. PC12 cells were transfected in the absence of polyornithine and were not subjected to a MeSO shock. NGF was added immediately after transfection.

Plasmid DNAs

The calgcat 4 plasmid (see Fig. 3a) contains 140 bases of the 5`-upstream region of the human calcitonin/CGRP gene together with the first 8 bases of exon 1 fused to the CAT gene (23) .


Figure 3: a, position of the CRE in the CGRP promoter constructs used in this study. The position of a heat shock-like element ( HSE) discussed in the text is also indicated. b, consensus cyclic AMP response element (38) compared with the sequence in the CGRP promoter. The mutations made in the CGRP CRE are also indicated. The 2 bases altered are absolutely conserved in the 15 CRE motifs on which the consensus is based (38).



Calgcat 9 (Fig. 3 a) was made by polymerase chain reaction amplification of calgcat 3 (23) using synthetic oligonucleotide primers 5` primer (TGCTGGATCCTCCAGGTTCTG) and 3` primer (TATCTAGACCAATGGGCGGAGGGGTCC); the amplified fragment was cloned into the T Vector plasmid (Promega) and sequenced. The 68-base pair fragment containing the CGRP promoter from -140 to -72 was then removed using BamHI- Sau3A and cloned into the BamHI site of pBLCAT2 (24) . Calgcat 10 (Fig. 3 a) was made by polymerase chain reaction amplification of calgcat 3 (23) using synthetic oligonucleotide primers 5` primer (TAGGATCCGACCCCTCCGCCCATTGGTT) and 3` primer (TACTGCAGTCTCTGATGCCTCCCAGCGC); the amplified fragment was cloned into the T Vector plasmid (Promega) and sequenced. The 97-base pair fragment containing the CGRP promoter from -88 to +9 was then ligated into BamHI- PstI-digested GCATG (25) . The CRE in calgcat 4 was mutated to TGGAGCA using the pAlter vector (Promega). Mutated bases are underlined. All constructs were sequenced using the Sequenase kit (U. S. Biochemical Corp.).

CAT Assay

Assays of CAT activity were carried out as described by Gorman (21) with extracts which were equalized for protein content, as determined by the method of Bradford (26) . The values of CAT activity obtained in this way were subsequently equalized for differences in the efficiency of plasmid DNA uptake between samples as determined by dot blot hybridization of the DNA in an aliquot of the cell extract using a probe derived from the CAT gene (27) .

Phospho-CREB Immunostaining

DRG neurons were treated with 5 ng/ml NGF for 24 h or left untreated. Cells were then fixed in methanol and then stained with anti-phospho-CREB (Santa Cruz Biotechnology Ltd.) using a rhodamine-conjugated secondary antibody (Dako).


RESULTS

In our previous experiments (19) we used calcium phosphate-mediated transfection to show that a construct (calgcat 4) containing the region of the CGRP gene from -140 to +9 relative to the transcriptional start site contains all the sequences required to mediate NGF inducibility in adult DRG neurons. To delineate the elements required further, another construct calgcat 10 containing sequences from -88 to +8 was prepared. When transfected into DRG neurons, this construct showed no statistically significant difference in activity in the presence or absence of NGF, although it did give a basal activity above the background level of the parental GCATG vector (25) which lacks any promoter element driving the CAT gene (Fig. 1). Hence the sequences mediating NGF inducibility must lie, at least in part, between -140 and -88, although sequences downstream of -88 constitute a functional promoter.

We therefore prepared a construct containing the sequence of the CGRP promoter from -140 to -72 so as to include this upstream region together with any regulatory elements which might span the -88 end point of calgcat 10. As this upstream fragment will evidently lack the CGRP basal promoter, its effect was tested by cloning it at position -105 upstream of the herpes simplex virus thymidine kinase promoter in the pBL CAT 2 vector (24) . This construct, calgcat 9 showed a statistically significant increase in activity in the presence of NGF ( p = 0.05), although its basal activity was similar to the pBL CAT 2 vector (Fig. 2). As the parental pBL CAT 2 vector is not affected by NGF, this indicates that the region from -140 to -72 constitutes an NGF-inducible enhancer element which mediates the activation of the CGRP promoter by NGF and which can also act on a heterologous promoter to render it NGF-inducible.


Figure 2: CAT assay of DRG neuronal cultures transfected with either the calgcat 9 construct containing CGRP promoter sequences from -140 to -72 cloned upstream of the thymidine kinase promoter in the vector pBL CAT 2 or the empty pBL CAT2 vector and either treated with NGF or left untreated. Values are normalized to that obtained with unstimulated cells transfected with calgcat 9 and are the mean of three independent transfections whose standard deviation is shown by the bars.



Inspection of the DNA sequence of this region revealed a sequence at -103 to -109 showing a close relationship to the consensus sequence of a cyclic AMP response element (Fig. 3, CRE) which mediates gene activation in cells treated with cyclic AMP (28) . In agreement with this, both calgcat 9 (Fig. 4) and calgcat 4 (Fig. 5 a) showed a statistically significant increase in activity upon treatment of DRG neurons with 50 µ M dibutyryl cyclic AMP ( p = 0.05 for calgcat 9 and p = 0.01 for calgcat 4). In order to test the role of the CRE in mediating the response to NGF, we used site-directed mutagenesis to inactivate it by altering two central bases (Fig. 3) within the context of calgcat 4. This mutation rendered the construct nonresponsive to both cyclic AMP (Fig. 5 a) and NGF (Fig. 5 b) with no statistically significant change in activity being observed following either of these treatments. However, as expected from our previous work (19) the parental calgcat 4 construct was clearly inducible by NGF (Fig. 5 b, p = 0.01) as well as by cyclic AMP. Hence the CRE motif in the CGRP promoter is required not only for its response to cyclic AMP but also for its NGF inducibility.


Figure 4: CAT assay of DRG neuronal cultures transfected with calgcat 9 or pBL CAT2 and either left untreated or treated with dibutyryl cyclic AMP. Values are normalized relative to the level obtained with unstimulated cells transfected with pBL CAT2 and are the average of three determinations whose standard deviation is shown by the bars.




Figure 5: CAT assay of DRG neuronal cultures transfected with calgcat 4 containing CGRP promoter sequences from -140 to +8 or the same construct in which 2 bases in the CRE have been mutated as indicated in Fig. 3. a shows the results of treatment with cyclic AMP and b of treatment with NGF. In each case, values are expressed relative to the activity obtained with calgcat 4 in unstimulated cells and are the average of three determinations whose standard deviation is shown by the bars.



To extend these observations we investigated whether the CRE from the CGRP promoter could mediate cyclic AMP and NGF inducibility when isolated from the other sequences between -140 to -72. An 18-base pair oligonucleotide derived from CGRP promoter sequences and consisting of the CRE and 6 flanking bases on either side was therefore cloned into the same site at -105 in the thymidine kinase promoter used to clone the -140 to -72 fragment. A statistically significant increase in activity of this construct was observed following cyclic AMP treatment (Fig. 6 a, p = 0.05). Hence the isolated CGRP CRE is able to confer cyclic AMP inducibility on the thymidine kinase promoter in agreement with previous results using the CRE motifs from other promoters (29) . In contrast this motif is not sufficient to confer responsiveness to NGF on the thymidine kinase promoter with no statistically significant increase in activity of the construct being observed following NGF treatment (Fig. 6 b). Hence this motif is necessary and sufficient for the response to cyclic AMP and is necessary but not sufficient for the NGF response.


Figure 6: CAT assay of DRG neuronal cultures transfected with either pBL CAT 2 vector or the same vector containing a cloned 18-base pair oligonucleotide from the CGRP promoter containing the CRE and flanking bases. a shows the results of treatment with cyclic AMP and b of treatment with NGF. In each case, values are expressed relative to the activity obtained with pBL CAT 2 in unstimulated cells and are the average of three determination whose standard deviation is shown by the bars.



It is known that cyclic AMP activates transcription through the CRE by phosphorylating the CREB transcription factor on serine 133 (29) . This stimulates the activity of the CREB transcriptional activation domain allowing DNA-bound CREB to activate transcription (30) . To test whether NGF also stimulated phosphorylation of CREB, we used an antibody which specifically recognizes CREB only when it is phosphorylated on serine 133. In these experiments this antibody detected phosphorylated CREB in DRG neurons that had been treated with NGF for 24 h but not in cultures maintained in the absence of NGF (Fig. 7). Hence the necessity for an intact CRE to allow an NGF response in the CGRP promoter is likely to be dependent on the ability of NGF to induce phosphorylation of CREB. Moreover the inability of the isolated CRE to mediate the NGF response in the absence of other sequences is not explained by the absence of appropriately phosphorylated CREB in NGF-treated cells.


Figure 7: Immunofluorescent staining of dorsal root ganglion cells maintained in the absence (-) ( a) or presence (+) ( b) of nerve growth factor. The antibody specifically recognizes the form of the CREB transcription factor which is phosphorylated on serine 133.




DISCUSSION

The minimal NGF-inducible CGRP promoter (-140 to +8) which we defined in our previous work (19) contains both a CRE at -103 to -109 and an element related to the consensus binding site for the heat shock transcription factor which is located between -58 to -45 relative to the transcriptional start site. Although a similar heat shock element-like sequence has been suggested to mediate the NGF inducibility of the substance P gene in PC12 cells (31, 32) , we find no evidence that the related element in the CGRP promoter is involved in its NGF inducibility. Thus, this heat shock element-like sequence cannot confer NGF inducibility when linked to the thymidine kinase promoter,() whereas the calgcat 9 construct consisting of sequences from -88 to +8 contains this element and is not NGF inducible.

Rather the NGF inducibility of the CGRP promoter is dependent upon the CRE and is associated with the NGF-induced phosphorylation of CREB on serine 133. Although the phosphorylation of CREB at this position also occurs in response to cyclic AMP (28, 29, 30) , the isolated CRE is not sufficient to mediate the NGF response whereas it can confer responsiveness to cyclic AMP. This difference may be related to other post-translational changes in CREB which occur in response to cyclic AMP but not NGF or vice versa. Thus, for example, it has been shown that calcium/calmodulin-dependent protein kinase type II phosphorylates CREB on serine 133 and serine 142 and does not activate transcription via a CRE, whereas calcium/calmodulin-dependent protein kinase type IV phosphorylates only on serine 133 and activates transcription (33) .

It is also possible, however, that this effect is related to differences in the modulation of other non DNA binding accessory molecules which interact with CREB and are required for transcriptional activation. Thus the CREB-binding protein binds specifically to phosphorylated CREB (34) and is itself activated in response to cyclic AMP (35) . It is possible therefore that following NGF treatment this or other changes in accessory factors do not occur and that promoter activation therefore requires not only CREB but also another DNA-binding protein which binds in the region from -140 to -72 but not to the 18-base pair element containing the CRE. A similar situation occurs in the response of the NGFI-A promoter to treatment with granulocyte-macrophage colony-stimulating factor and interleukin-3. Thus although the CRE in the promoter is required for activation by these factors, it is not itself sufficient, and induction also required an adjacent serum response element (36) .

Interestingly the CRE in the c- fos promoter has also been shown to be necessary but not sufficient for an NGF response, whereas NGF treatment of these cells has been shown to result in CREB phosphorylation on serine 133 by a novel Ras-dependent kinase (37) . In this case also promoter activation requires an adjacent serum response element in addition to the CRE binding site for phosphorylated CREB (37) , indicating that serum response element-binding protein(s) such as the serum response factor cooperate with phosphorylated CREB to produce the response.

These considerations support a model in which induction of the CGRP promoter in response to NGF requires both phosphorylated CREB and another factor binding to an adjacent site within the -140 to -72 region. This region does not contain any serum response elements, suggesting that another factor modulated by NGF is involved in this case. Indeed this would be predicted from the fact that, unlike the c- fos promoter, the minimal CGRP promoter in calgcat 4 is not induced by NGF in PC12 cells (19) . Hence the second factor binding to the -140 to -72 region is likely to be DRG-specific in either its activation or response to NGF. This would account for the requirement in PC12 cells for a region further upstream for NGF inducibility if this upstream region bound an NGF-modulated factor which was present in PC12 cells and could cooperate with CREB.

These considerations focus attention on the nature of the second factor which binds to the -140 to -72 region. We are currently carrying out DNA mobility shift assays to identify proteins other that CREB which bind in this region as well as deletion mapping the region to identify the minimal sequence which can produce NGF inducibility.

Whatever the precise identity of this factor, our studies indicate the necessity to confirm results obtained in PC12 cells using primary neuronal material, since there are clear dissimilarities as well as similarities between the regulatory pathways in the two cell types. Moreover, they identify the CRE in the CGRP promoter as being necessary but not sufficient for NGF inducibility, although it is both necessary and sufficient for inducibility by cyclic AMP.


FOOTNOTES

*
This work was supported by a grant from the Sandoz Research Advisory Board. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed.

The abbreviations used are: NGF, nerve growth factor; DRG, dorsal root ganglion; CGRP, calcitonin gene-related peptide; CRE, cyclic AMP response element; CREB, cyclic AMP response element-binding protein; CAT, chloramphenicol acetyltransferase.

A. Watson and D. Latchman, unpublished data.


ACKNOWLEDGEMENTS

We thank Giles Kendall, Aviva Symes, Janet Winter, and John Wood for helpful discussions.


REFERENCES
  1. Lo, D. C. (1992) Curr. Opin. Neurobiol. 2, 336-340 [CrossRef][Medline] [Order article via Infotrieve]
  2. Levi-Montalcini, R. (1976) Prog. Brain Res. 45, 235-238 [Medline] [Order article via Infotrieve]
  3. Klein, R., Jing, S., Narduri, V., O'Rourke, E., and Barbacid, M. (1991) Cell 65, 189-197 [CrossRef][Medline] [Order article via Infotrieve]
  4. Barbacid, M., Lamballe, F., Pulido, D., and Klein, R. (1991) Biochim. Biophys. Acta 1072, 115-127 [Medline] [Order article via Infotrieve]
  5. Greene, L. A., and Tischler, S. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 2424-2428 [Abstract/Free Full Text]
  6. Greene, L., and Tischler, A. S. (1982) Adv. Cell. Neurobiol. 3, 373-414
  7. Greenberg, M. E., Greene, L. A., and Ziff, E. B. (1985) J. Biol. Chem. 260, 14101-14110 [Abstract/Free Full Text]
  8. Millbrandt, J. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 4789-4793 [Abstract/Free Full Text]
  9. Millbrandt, J. (1987) Science 238, 797-799 [Abstract/Free Full Text]
  10. Millbrandt, J. (1988) Neuron 1, 183-188 [CrossRef][Medline] [Order article via Infotrieve]
  11. Gizang-Ginsberg, E., and Ziff, E. B. (1990) Genes & Dev. 4, 477-491
  12. Leonard, D. G. B., Ziff, E. B., and Greene, L. A. ((1987) Mol. Cell. Biol. 7, 3156-3167 [Abstract/Free Full Text]
  13. Johnson, E. M., Gorin, P. M., Brandeis, L. D., and Pearson, J. (1980) Science 210, 916-918 [Abstract/Free Full Text]
  14. Lindsay, R. M. (1988) J. Neurosci. 8, 2394-2405 [Abstract]
  15. Winter, G., Forbes, A., Sternberg, J., and Lindsay, R. M. (1988) Neuron 1, 973-981 [CrossRef][Medline] [Order article via Infotrieve]
  16. Lindsay, R. M., Shooter, E. M., Radeke, M. J., Misko, T. P., Dechant, G., Thoener, H., and Lindholm, D. (1990) Eur. J. Neurosci. 2, 389-396 [CrossRef][Medline] [Order article via Infotrieve]
  17. Kendall, G., Ensor, E., Brar-Rai, A., Winter, J., and Latchman, D. S. (1994) Mol. Brain Res. 25, 73-79 [Medline] [Order article via Infotrieve]
  18. Lindsay, R. M., and Harmar, A. J. (1989) Nature 337, 362-364 [CrossRef][Medline] [Order article via Infotrieve]
  19. Watson, A., Ensor, E., Symes, A., Winter, J., Kendall, G., and Latchman, D. (1995) Eur. J. Neurosci., in press
  20. Gabellini, N., Minozzi, M.-C., Leon, A., and Dal Toro, R. (1992) J. Cell Biol. 118, 131-138 [Abstract/Free Full Text]
  21. Gorman, C. M. (1985) in DNA Cloning: A Practical Approach, (Glover, D. M., ed) Vol. 2, pp. 143-190, IRL Press, Oxford
  22. Dong, Y., Stioultchi, A. I., and Pollard, J. W. (1993) Nucleic Acids Res. 21, 771-771 [Free Full Text]
  23. Symes, A. J., Craig, R. K., and Brickell, P. M. (1992) FEBS Lett. 306, 229-233 [CrossRef][Medline] [Order article via Infotrieve]
  24. Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 15, 5490 [Free Full Text]
  25. Frebourg, T., and Brison, O. (1988) Gene ( Amst.) 65, 315-318 [CrossRef][Medline] [Order article via Infotrieve]
  26. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  27. Abken, H., and Reifenrath, B. (1992) Nucleic Acids Res. 20, 3527 [Free Full Text]
  28. Lalli, E., and Sassone-Corsi, P. (1994) J. Biol. Chem. 269, 17359-17362 [Free Full Text]
  29. Gonzalez, G. A., and Montminy, M. R. (1989) Cell 59, 675-680 [CrossRef][Medline] [Order article via Infotrieve]
  30. Yamamoto, K. K., Gonzalez, G. A., Biggs, W. H., and Montminy, M. R. (1988) Nature 334, 494-498 [CrossRef][Medline] [Order article via Infotrieve]
  31. Gilchrist, C. A., Morrison, C. F., Chapman, K. E., and Harmar, A. J. (1991) DNA Cell Biol. 10, 743-749 [Medline] [Order article via Infotrieve]
  32. Gilchrist, C. A., Morrison, C. F., and Harmar, A. J. (1992) Biochem. Biophys. Res. Commun. 187, 1395-1400 [CrossRef][Medline] [Order article via Infotrieve]
  33. Sun, P., Enslen, H., Myung, P. S., and Maurer, R. A. (1994) Genes & Dev. 8, 2527-2539
  34. Chriva, J. C., Kwok, R. P. S., Lamb, N., Hagiwara, M., Montminy, M. R., and Goodman, R. (1993) Nature 365, 855-859 [CrossRef][Medline] [Order article via Infotrieve]
  35. Kwok, R. P. S., Lundblad, J. R., Chriva, J. C., Richards, J. P., Bachinger, H. P., Brennan, R. G., Roberts, S. G. E., Green, M. R., and Goodman, R. H. (1994) Nature 370, 223-226 [CrossRef][Medline] [Order article via Infotrieve]
  36. Sakamoto, K. M., Fraser, J. K., Lee, H.-J. J., Lehman, E., and Gasson, J. C. (1994) Mol. Cell. Biol. 14, 5975-5985 [Abstract/Free Full Text]
  37. Ginty, D. D., Bonni, A., and Greenberg, M. E. (1994) Cell 77, 713-725 [CrossRef][Medline] [Order article via Infotrieve]
  38. Lin, Y.-S., and Green, M. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3396-3400 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
P. Lanlua, P.R.R. Gangula, G. Taglialatela, and C. Yallampalli
Gestational Changes in Calcitonin Gene-Related Peptide, Nerve Growth Factor, and Its Receptors in Rat Dorsal Root Ganglia
Biol Reprod, November 1, 2001; 65(5): 1601 - 1605.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. M. Shadiack, Y. Sun, and R. E. Zigmond
Nerve Growth Factor Antiserum Induces Axotomy-Like Changes in Neuropeptide Expression in Intact Sympathetic and Sensory Neurons
J. Neurosci., January 15, 2001; 21(2): 363 - 371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-Z. Liu, J. C. Chrivia, and D. S. Latchman
Nerve Growth Factor Up-regulates the Transcriptional Activity of CBP through Activation of the p42/p44MAPK Cascade
J. Biol. Chem., December 4, 1998; 273(49): 32400 - 32407.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
X. Ai, S. E. MacPhedran, and A. K. Hall
Depolarization Stimulates Initial Calcitonin Gene-Related Peptide Expression by Embryonic Sensory Neurons In Vitro
J. Neurosci., November 15, 1998; 18(22): 9294 - 9302.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. L. Durham and A. F. Russo
Serotonergic Repression of Mitogen-Activated Protein Kinase Control of the Calcitonin Gene-Related Peptide Enhancer
Mol. Endocrinol., July 1, 1998; 12(7): 1002 - 1009.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
S. Ahn, M. Olive, S. Aggarwal, D. Krylov, D. D. Ginty, and C. Vinson
A Dominant-Negative Inhibitor of CREB Reveals that It Is a General Mediator of Stimulus-Dependent Transcription of c-fos
Mol. Cell. Biol., February 1, 1998; 18(2): 967 - 977.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. M. Lanigan and A. F. Russo
Binding of Upstream Stimulatory Factor and a Cell-specific Activator to the Calcitonin/Calcitonin Gene-related Peptide Enhancer
J. Biol. Chem., July 18, 1997; 272(29): 18316 - 18324.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watson, A.
Right arrow Articles by Latchman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watson, A.
Right arrow Articles by Latchman, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.