![]()
|
|
||||||||
From the
The gene encoding calcitonin gene-related peptide (CGRP) is
inducible by nerve growth factor (NGF) in primary dorsal root ganglion
neurons. By transfecting these primary neurons, we have defined a
region of the CGRP promoter from -140 to -72 relative to
the transcriptional start site which is essential for its inducibility
by NGF as well as by cyclic AMP and which can confer these responses on
a heterologous promoter. A cyclic AMP response element (CRE) within
this region is essential for both these responses which are abolished
by site-directed mutagenesis of this element. In contrast to the intact
fragment the isolated CRE can confer responsiveness to cyclic AMP but
not NGF on a heterologous promoter. The reasons for the different role
of the CRE in the response of the CGRP promoter to cyclic AMP and NGF
are discussed.
Nerve growth factor (NGF)
The analysis of such changes in gene
expression has been greatly aided by the availability of the PC12
pheochromocytoma cell line
(5) which responds to NGF by
differentiation to a sympathetic neuron-like phenotype (for review, see
Ref. 6). Studies using these cells have defined a number of genes whose
transcription is activated by NGF. These include those encoding
transcription factors such as c- fos (7, 8) and
NGFIA
(9) and NGFIB
(10) , which are induced rapidly and
transiently, as well as others such as those encoding tyrosine
hydroxylase
(11) and peripherin
(12) which are induced
more slowly.
Evidently insights obtained in this immortalized cell
line need to be confirmed in the appropriate primary neurons. The
inability of sympathetic or embryonic dorsal root ganglion (DRG)
sensory neurons to survive in the absence of NGF
(13) has
rendered this difficult however. It has been possible however to
confirm some of the insights obtained with PC12 cells using cultures of
adult DRG neurons which are responsive to NGF but do not require it for
survival
(14, 15) . Thus these cells respond to NGF by
inducing expression of the mRNA encoding c-Fos
(16) as well as
those encoding NGFIA and IB
(17) . These cells also show
elevated levels of the neuropeptides substance P and calcitonin
gene-related peptide (CGRP) in response to NGF
(18) .
Interestingly, however, our recent experiments suggest that although
the CGRP gene promoter can be activated by NGF in both DRG and PC12
cells, the mechanisms mediating this effect are different in the two
cell types
(19) . Thus by modifying a procedure used by others
for chick neurons
(20) , we were able to successfully transfect
adult rat DRG neurons using a calcium phosphate procedure. This allowed
us to show that the induction of the CGRP promoter in DRG cells
requires only sequences located from -140 upstream of the
transcriptional start site to +8 downstream
(19) . In
contrast in PC12 cells a construct containing this region is not
inducible, and induction requires in addition sequences located between
-1670 and -140
(19) .
The 149-base pair element
in the CGRP promoter thus offers the opportunity to dissect an
NGF-responsive region which is specifically active in primary DRG
neurons. Here we show that the NGF inducibility mediated by this region
in DRG neurons is dependent upon a cyclic AMP response element (CRE)
within it. However, this CRE alone is not sufficient to mediate a
response to NGF when separated from other sequences in this region,
although it can produce a response to cyclic AMP in these
circumstances.
In our previous experiments
(19) we used calcium
phosphate-mediated transfection to show that a construct (calgcat 4)
containing the region of the CGRP gene from -140 to +9
relative to the transcriptional start site contains all the sequences
required to mediate NGF inducibility in adult DRG neurons. To delineate
the elements required further, another construct calgcat 10 containing
sequences from -88 to +8 was prepared. When transfected into
DRG neurons, this construct showed no statistically significant
difference in activity in the presence or absence of NGF, although it
did give a basal activity above the background level of the parental
GCATG vector
(25) which lacks any promoter element driving the
CAT gene (Fig. 1). Hence the sequences mediating NGF inducibility must
lie, at least in part, between -140 and -88, although
sequences downstream of -88 constitute a functional promoter.
We therefore prepared a construct containing the sequence of the
CGRP promoter from -140 to -72 so as to include this
upstream region together with any regulatory elements which might span
the -88 end point of calgcat 10. As this upstream fragment will
evidently lack the CGRP basal promoter, its effect was tested by
cloning it at position -105 upstream of the herpes simplex virus
thymidine kinase promoter in the pBL CAT 2 vector
(24) . This
construct, calgcat 9 showed a statistically significant increase in
activity in the presence of NGF ( p = 0.05), although
its basal activity was similar to the pBL CAT 2 vector (Fig. 2).
As the parental pBL CAT 2 vector is not affected by NGF, this indicates
that the region from -140 to -72 constitutes an
NGF-inducible enhancer element which mediates the activation of the
CGRP promoter by NGF and which can also act on a heterologous promoter
to render it NGF-inducible.
The minimal NGF-inducible CGRP promoter (-140 to
+8) which we defined in our previous work
(19) contains
both a CRE at -103 to -109 and an element related to the
consensus binding site for the heat shock transcription factor which is
located between -58 to -45 relative to the transcriptional
start site. Although a similar heat shock element-like sequence has
been suggested to mediate the NGF inducibility of the substance P gene
in PC12 cells
(31, 32) , we find no evidence that the
related element in the CGRP promoter is involved in its NGF
inducibility. Thus, this heat shock element-like sequence cannot confer
NGF inducibility when linked to the thymidine kinase
promoter,
Rather the NGF inducibility of the CGRP
promoter is dependent upon the CRE and is associated with the
NGF-induced phosphorylation of CREB on serine 133. Although the
phosphorylation of CREB at this position also occurs in response to
cyclic AMP
(28, 29, 30) , the isolated CRE is
not sufficient to mediate the NGF response whereas it can confer
responsiveness to cyclic AMP. This difference may be related to other
post-translational changes in CREB which occur in response to cyclic
AMP but not NGF or vice versa. Thus, for example, it has been
shown that calcium/calmodulin-dependent protein kinase type II
phosphorylates CREB on serine 133 and serine 142 and does not activate
transcription via a CRE, whereas calcium/calmodulin-dependent protein
kinase type IV phosphorylates only on serine 133 and activates
transcription
(33) .
It is also possible, however, that this
effect is related to differences in the modulation of other non DNA
binding accessory molecules which interact with CREB and are required
for transcriptional activation. Thus the CREB-binding protein binds
specifically to phosphorylated CREB
(34) and is itself
activated in response to cyclic AMP
(35) . It is possible
therefore that following NGF treatment this or other changes in
accessory factors do not occur and that promoter activation therefore
requires not only CREB but also another DNA-binding protein which binds
in the region from -140 to -72 but not to the 18-base pair
element containing the CRE. A similar situation occurs in the response
of the NGFI-A promoter to treatment with granulocyte-macrophage
colony-stimulating factor and interleukin-3. Thus although the CRE in
the promoter is required for activation by these factors, it is not
itself sufficient, and induction also required an adjacent serum
response element
(36) .
Interestingly the CRE in the
c- fos promoter has also been shown to be necessary but not
sufficient for an NGF response, whereas NGF treatment of these cells
has been shown to result in CREB phosphorylation on serine 133 by a
novel Ras-dependent kinase
(37) . In this case also promoter
activation requires an adjacent serum response element in addition to
the CRE binding site for phosphorylated CREB
(37) , indicating
that serum response element-binding protein(s) such as the serum
response factor cooperate with phosphorylated CREB to produce the
response.
These considerations support a model in which induction of
the CGRP promoter in response to NGF requires both phosphorylated CREB
and another factor binding to an adjacent site within the -140 to
-72 region. This region does not contain any serum response
elements, suggesting that another factor modulated by NGF is involved
in this case. Indeed this would be predicted from the fact that, unlike
the c- fos promoter, the minimal CGRP promoter in calgcat 4 is
not induced by NGF in PC12 cells
(19) . Hence the second factor
binding to the -140 to -72 region is likely to be
DRG-specific in either its activation or response to NGF. This would
account for the requirement in PC12 cells for a region further upstream
for NGF inducibility if this upstream region bound an NGF-modulated
factor which was present in PC12 cells and could cooperate with CREB.
These considerations focus attention on the nature of the second
factor which binds to the -140 to -72 region. We are
currently carrying out DNA mobility shift assays to identify proteins
other that CREB which bind in this region as well as deletion mapping
the region to identify the minimal sequence which can produce NGF
inducibility.
Whatever the precise identity of this factor, our
studies indicate the necessity to confirm results obtained in PC12
cells using primary neuronal material, since there are clear
dissimilarities as well as similarities between the regulatory pathways
in the two cell types. Moreover, they identify the CRE in the CGRP
promoter as being necessary but not sufficient for NGF inducibility,
although it is both necessary and sufficient for inducibility by cyclic
AMP.
We thank Giles Kendall, Aviva Symes, Janet Winter, and
John Wood for helpful discussions.
Volume 270,
Number 16,
Issue of April 21, pp. 9655-9660, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(
)
has a number
of effects on specific neuronal cells promoting both survival and
differentiation
(1, 2) . Such effects are mediated via
the binding of NGF to the TrkA surface receptor which has a tyrosine
kinase activity that is stimulated by NGF binding
(3, 4) . The signaling cascade which is activated by
this process ends in the nucleus with the activation of specific genes
whose protein products are involved in mediating the cellular changes
which occur in response to NGF.
Adult Dorsal Root Ganglion Cultures
Cultures
were prepared from adult Wistar rats. Spinal ganglia were removed
aseptically, digested with 0.3% collagenase (Boehringer Mannheim) for
90 min, then mechanically dissociated through a 1-ml Gilson tip. Cells
were plated for at least 2 h in the absence of NGF on
polyornithine-coated 35-mm tissue culture Petri dishes. Lightly
adherent neurons were separated from more adherent non-neuronal cells
using a stream of medium from a 1-ml Gilson pipette. To further purify
the neurons they were then pelleted at 120 g through fetal calf serum.
Neurons were replated in the absence of NGF onto 35-mm tissue culture
Petri dishes coated with poly-
L-lysine at a density of
10
cells/dish and grown in F-14 medium with 4% Ultraser G
(Life Technologies, Inc.), 100 mg/ml streptomycin and 100 units/ml
penicillin in the presence of the mitotic inhibitor cytosine
arabinoside at 10 µ
M. Cells for histochemical staining
were grown in 10 mm Lab-Tec Chamber slides (Nunc) at a density of 1000
cells/well. When appropriate either 2.5 S NGF (Promega) to a final
concentration of 5 ng/ml or dibutyryl cyclic AMP to 50 µ
M was added to the cultures.
Transfection
At least 8 h after plating the
neuronally enriched cultures, DNA transfections were performed using
the calcium phosphate procedure with 10 µg/ml plasmid DNA
essentially as described by Gorman
(21) and Gabellini et
al.
(20) , but with the following modifications
(19) . Transfection was performed in the presence of 10
µg/ml polyornithine for 7 h followed by a 30% Me
SO
shock for 4 min at room temperature
(22) . Cells were left for
36 h after transfection before the addition of NGF then left for a
further 48 h before harvesting. Neuronal cell networks free from
residual non-neuronal cells were removed from the
poly-
L-lysine as described in the cell culture section and
assayed for CAT activity. PC12 cells were transfected in the absence of
polyornithine and were not subjected to a Me
SO shock. NGF
was added immediately after transfection.
Plasmid DNAs
The calgcat 4 plasmid (see
Fig. 3a) contains 140 bases of the 5`-upstream region of
the human calcitonin/CGRP gene together with the first 8 bases of exon
1 fused to the CAT gene
(23) .
Figure 3:
a, position of the CRE in the CGRP
promoter constructs used in this study. The position of a heat
shock-like element ( HSE) discussed in the text is also
indicated. b, consensus cyclic AMP response element (38)
compared with the sequence in the CGRP promoter. The mutations made in
the CGRP CRE are also indicated. The 2 bases altered are absolutely
conserved in the 15 CRE motifs on which the consensus is based
(38).
Calgcat 9
(Fig. 3 a) was made by polymerase chain reaction
amplification of calgcat 3
(23) using synthetic oligonucleotide
primers 5` primer (TGCTGGATCCTCCAGGTTCTG) and 3` primer
(TATCTAGACCAATGGGCGGAGGGGTCC); the amplified fragment was cloned into
the T Vector plasmid (Promega) and sequenced. The 68-base pair fragment
containing the CGRP promoter from -140 to -72 was then
removed using BamHI- Sau3A and cloned into the
BamHI site of pBLCAT2
(24) . Calgcat 10
(Fig. 3 a) was made by polymerase chain reaction
amplification of calgcat 3
(23) using synthetic oligonucleotide
primers 5` primer (TAGGATCCGACCCCTCCGCCCATTGGTT) and 3` primer
(TACTGCAGTCTCTGATGCCTCCCAGCGC); the amplified fragment was cloned into
the T Vector plasmid (Promega) and sequenced. The 97-base pair fragment
containing the CGRP promoter from -88 to +9 was then ligated
into BamHI- PstI-digested GCATG
(25) . The CRE
in calgcat 4 was mutated to TGGAGCA using the pAlter vector (Promega).
Mutated bases are underlined. All constructs were sequenced using the
Sequenase kit (U. S. Biochemical Corp.).
CAT Assay
Assays of CAT activity were carried out
as described by Gorman
(21) with extracts which were equalized
for protein content, as determined by the method of Bradford
(26) . The values of CAT activity obtained in this way were
subsequently equalized for differences in the efficiency of plasmid DNA
uptake between samples as determined by dot blot hybridization of the
DNA in an aliquot of the cell extract using a probe derived from the
CAT gene
(27) .
Phospho-CREB Immunostaining
DRG neurons were
treated with 5 ng/ml NGF for 24 h or left untreated. Cells were then
fixed in methanol and then stained with anti-phospho-CREB (Santa Cruz
Biotechnology Ltd.) using a rhodamine-conjugated secondary antibody
(Dako).
Figure 2:
CAT assay of DRG neuronal cultures
transfected with either the calgcat 9 construct containing CGRP
promoter sequences from -140 to -72 cloned upstream of the
thymidine kinase promoter in the vector pBL CAT 2 or the empty pBL CAT2
vector and either treated with NGF or left untreated. Values are
normalized to that obtained with unstimulated cells transfected with
calgcat 9 and are the mean of three independent transfections whose
standard deviation is shown by the
bars.
Inspection of the DNA sequence of this
region revealed a sequence at -103 to -109 showing a close
relationship to the consensus sequence of a cyclic AMP response element
(Fig. 3, CRE) which mediates gene activation in cells
treated with cyclic AMP
(28) . In agreement with this, both
calgcat 9 (Fig. 4) and calgcat 4 (Fig. 5 a) showed a
statistically significant increase in activity upon treatment of DRG
neurons with 50 µ
M dibutyryl cyclic AMP ( p = 0.05 for calgcat 9 and p = 0.01 for
calgcat 4). In order to test the role of the CRE in mediating the
response to NGF, we used site-directed mutagenesis to inactivate it by
altering two central bases (Fig. 3) within the context of calgcat
4. This mutation rendered the construct nonresponsive to both cyclic
AMP (Fig. 5 a) and NGF (Fig. 5 b) with no
statistically significant change in activity being observed following
either of these treatments. However, as expected from our previous work
(19) the parental calgcat 4 construct was clearly inducible by
NGF (Fig. 5 b, p = 0.01) as well as by
cyclic AMP. Hence the CRE motif in the CGRP promoter is required not
only for its response to cyclic AMP but also for its NGF inducibility.
Figure 4:
CAT
assay of DRG neuronal cultures transfected with calgcat 9 or pBL CAT2
and either left untreated or treated with dibutyryl cyclic AMP. Values
are normalized relative to the level obtained with unstimulated cells
transfected with pBL CAT2 and are the average of three determinations
whose standard deviation is shown by the
bars.
Figure 5:
CAT assay of DRG neuronal cultures
transfected with calgcat 4 containing CGRP promoter sequences from
-140 to +8 or the same construct in which 2 bases in the CRE
have been mutated as indicated in Fig. 3. a shows the results
of treatment with cyclic AMP and b of treatment with NGF. In
each case, values are expressed relative to the activity obtained with
calgcat 4 in unstimulated cells and are the average of three
determinations whose standard deviation is shown by the
bars.
To extend these observations we investigated whether the CRE from
the CGRP promoter could mediate cyclic AMP and NGF inducibility when
isolated from the other sequences between -140 to -72. An
18-base pair oligonucleotide derived from CGRP promoter sequences and
consisting of the CRE and 6 flanking bases on either side was therefore
cloned into the same site at -105 in the thymidine kinase
promoter used to clone the -140 to -72 fragment. A
statistically significant increase in activity of this construct was
observed following cyclic AMP treatment (Fig. 6 a, p = 0.05). Hence the isolated CGRP CRE is able to confer
cyclic AMP inducibility on the thymidine kinase promoter in agreement
with previous results using the CRE motifs from other promoters
(29) . In contrast this motif is not sufficient to confer
responsiveness to NGF on the thymidine kinase promoter with no
statistically significant increase in activity of the construct being
observed following NGF treatment (Fig. 6 b). Hence this motif
is necessary and sufficient for the response to cyclic AMP and is
necessary but not sufficient for the NGF response.
Figure 6:
CAT assay of DRG neuronal cultures
transfected with either pBL CAT 2 vector or the same vector containing
a cloned 18-base pair oligonucleotide from the CGRP promoter containing
the CRE and flanking bases. a shows the results of treatment
with cyclic AMP and b of treatment with NGF. In each case,
values are expressed relative to the activity obtained with pBL CAT 2
in unstimulated cells and are the average of three determination whose
standard deviation is shown by the
bars.
It is known that
cyclic AMP activates transcription through the CRE by phosphorylating
the CREB transcription factor on serine 133
(29) . This
stimulates the activity of the CREB transcriptional activation domain
allowing DNA-bound CREB to activate transcription
(30) . To test
whether NGF also stimulated phosphorylation of CREB, we used an
antibody which specifically recognizes CREB only when it is
phosphorylated on serine 133. In these experiments this antibody
detected phosphorylated CREB in DRG neurons that had been treated with
NGF for 24 h but not in cultures maintained in the absence of NGF
(Fig. 7). Hence the necessity for an intact CRE to allow an NGF
response in the CGRP promoter is likely to be dependent on the ability
of NGF to induce phosphorylation of CREB. Moreover the inability of the
isolated CRE to mediate the NGF response in the absence of other
sequences is not explained by the absence of appropriately
phosphorylated CREB in NGF-treated cells.
Figure 7:
Immunofluorescent staining of dorsal root
ganglion cells maintained in the absence (-) ( a) or
presence (+) ( b) of nerve growth factor. The antibody
specifically recognizes the form of the CREB transcription factor which
is phosphorylated on serine 133.
(
)
whereas the calgcat 9 construct
consisting of sequences from -88 to +8 contains this element
and is not NGF inducible.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
P. Lanlua, P.R.R. Gangula, G. Taglialatela, and C. Yallampalli Gestational Changes in Calcitonin Gene-Related Peptide, Nerve Growth Factor, and Its Receptors in Rat Dorsal Root Ganglia Biol Reprod, November 1, 2001; 65(5): 1601 - 1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Shadiack, Y. Sun, and R. E. Zigmond Nerve Growth Factor Antiserum Induces Axotomy-Like Changes in Neuropeptide Expression in Intact Sympathetic and Sensory Neurons J. Neurosci., January 15, 2001; 21(2): 363 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Z. Liu, J. C. Chrivia, and D. S. Latchman Nerve Growth Factor Up-regulates the Transcriptional Activity of CBP through Activation of the p42/p44MAPK Cascade J. Biol. Chem., December 4, 1998; 273(49): 32400 - 32407. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ai, S. E. MacPhedran, and A. K. Hall Depolarization Stimulates Initial Calcitonin Gene-Related Peptide Expression by Embryonic Sensory Neurons In Vitro J. Neurosci., November 15, 1998; 18(22): 9294 - 9302. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Durham and A. F. Russo Serotonergic Repression of Mitogen-Activated Protein Kinase Control of the Calcitonin Gene-Related Peptide Enhancer Mol. Endocrinol., July 1, 1998; 12(7): 1002 - 1009. [Abstract] [Full Text] |
||||
![]() |
S. Ahn, M. Olive, S. Aggarwal, D. Krylov, D. D. Ginty, and C. Vinson A Dominant-Negative Inhibitor of CREB Reveals that It Is a General Mediator of Stimulus-Dependent Transcription of c-fos Mol. Cell. Biol., February 1, 1998; 18(2): 967 - 977. [Abstract] [Full Text] |
||||
![]() |
T. M. Lanigan and A. F. Russo Binding of Upstream Stimulatory Factor and a Cell-specific Activator to the Calcitonin/Calcitonin Gene-related Peptide Enhancer J. Biol. Chem., July 18, 1997; 272(29): 18316 - 18324. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |