![]()
|
|
||||||||
From the
Poliovirus protein 2C is involved in poliovirus RNA replication,
although the exact function of 2C is still unknown. Recently, it was
shown that 2C can be purified to high levels when expressed as a fusion
protein with maltose-binding protein (MBP). Evidence was presented that
2C has ATPase and GTPase activities; preliminary results also indicated
that 2C interacts with RNA (Rodrguez, P. L., and Carrasco, L. (1993)
J. Biol. Chem. 268, 8105-8110). In the present study, 20
variants of 2C have been generated, and their NTPase and RNA binding
activities were analyzed. Moreover, an easy procedure to obtain genuine
2C after factor Xa cleavage of an MBP
The 11 mature proteins that are encoded by the RNA poliovirus
genome arise by cleavage of a polyprotein that is initially processed
at the polysomal level to generate three polypeptides, P1-P3
(1, 2) . Further cleavage of P1 produces the four
structural proteins that form part of mature virus particles
(3) , whereas hydrolysis of P2 and P3 generates seven
polypeptides that are involved in poliovirus vegetative functions
(4, 5) . The first cleavage of P2 gives rise to
2A
Poliovirus
protein 2C is a 329-amino acid polypeptide that contains a typical
NTP-binding domain
(9) . The sequence GSPGTGKS (amino acids
129-136) forms the A site that is involved in the interaction of
the protein with phosphate. The B site, comprising the DD motif at
amino acids 176-177, could interact with magnesium. Point
mutations expressed in these two sites of protein 2C lead to an
impairment of viral RNA replication and are thus lethal for poliovirus
(10, 11) . Biochemical studies using isolated poliovirus
protein 2C have shown that this protein possesses NTPase activity
(10, 12) . Moreover, there is some evidence that
suggests that 2C is an RNA-binding protein since gel retardation
experiments indicate that it interacts with a partial double-stranded
RNA molecule
(12) . The exact function that 2C plays in the
poliovirus replication cycle remains to be determined. Two lines of
evidence suggest that the activity of 2C is necessary for viral genome
replication. Mutant forms of this protein are unable to synthesize
viral RNA
(11, 13, 14) . In addition, guanidine,
a compound that selectively blocks poliovirus RNA synthesis, interferes
with the mode of action of 2C
(15) , although the mechanism(s)
underlying this effect have not been elucidated. It has been suggested,
however, that guanidine hinders the conformational change that normally
follows the NTP binding and/or hydrolysis carried out by 2C
(16) . Alternatively, the compound may block the interaction of
2C with vesicular membranes
(17) . In accord with this idea,
there are indications that 2C might attach the poliovirus replication
complexes to membranous vesicles that proliferate during poliovirus
infection
(17, 18) . For example, isolation of
poliovirus RNA replication complexes from infected cells provides a
membranous system that actively synthesizes viral RNA
(4) .
Detergent treatment of this complex reduces its RNA synthetic activity
although 2C-related proteins still remain attached to the RNA
(18) , thus suggesting that 2C or 2BC can interact directly with
the viral genome and that membranes play an important part in
poliovirus genome replication. In fact, inhibition of lipid synthesis
or interference with the vesicular system profoundly depresses
poliovirus RNA synthesis
(19, 20, 21) . The
addition of cerulenin, an inhibitor of phospholipid synthesis, or
brefeldin A, a macrolide antibiotic that interferes with the vesicular
system, immediately arrests poliovirus genome replication in infected
cells
(19, 20, 22) . Therefore, membrane
proliferation and vesicular traffic are both necessary for the
replication of poliovirus nucleic acids. We have already suggested that
2C could mediate the traffic of viral RNA through the vesicular system
(12) , and we now provide evidence that two specific regions
within the protein control its interaction with viral RNA.
General Recombinant DNA Protocols Plasmids encoding the different fusion proteins between MBP
Since 2C is also endowed with ATPase and GTPase
activities
(12) , the different protein variants used in this
work were tested for these activities. Fig. 2shows that 2C
mutants lacking 32 or 74 amino acids from the carboxyl terminus still
retain NTPase activity. A similar effect is observed by deleting the
first 16 or 20 amino acids located at the amino terminus, whereas
longer deletions of 41 or 100 residues in this region abolish the
NTPase activities of 2C. Therefore, sequences located between residues
21 and 255 of 2C are essential for NTPase activity, and these results
agree well with the fact that the GKS motif is located at positions
134-136 of 2C, whereas the DD motif is located at positions
176-177.
Proteins endowed with RNA binding activity are involved in
different biological functions including the metabolism of nucleic
acids and the regulation of gene expression
(36, 37) .
This diverse group of proteins comprises at least nine families that
have been distinguished on the basis of their RNA recognition motifs
(38) . Most of the RNA-binding proteins thus far identified
contain more than one binding domain
(37) . Some of them,
including the small nuclear RNP U1A protein, have two domains located
one at each end of the molecule. Functional and structural aspects of
the RNA-protein interaction are exemplified by protein U1A, which
contains an RNA-binding motif variously termed the ribonucleoprotein
consensus sequence, the RNA-binding domain, or the RNA recognition
motif. This RNA-binding domain is
Our present results indicate that 2C
belongs to the group of proteins that bind RNA and that it contains two
regions, one NH
Therefore,
poliovirus protein resembles forceps when interacting with RNA in the
sense that two RNA-binding domains are located one at each end of the
molecule. The NH
The second region of 2C that is implicated in RNA binding is located
at the COOH terminus and comprises the last COOH-terminal 96 amino
acids (234-329). Our data show that this 96-amino acid sequence
confers RNA binding capacity to the fusion protein
MBP-2C-(234-329). The former sequence has an arginine-rich
COOH-terminal region between amino acids 312 and 319 (NERNRRSN). A
deletion mutant ending at amino acid 313 does not bind RNA, whereas
full binding is observed with protein 2C ending at amino acid 319,
indicating an essential requirement for residues 312-319 in this
phenomenon. RNA binding assays using short peptides that together cover
the sequences in these two regions of protein 2C could locate more
precisely the residues involved in RNA binding.
For defining the
exact function of protein 2C in the virus replication cycle, we need to
consider the two known biochemical roles of this protein, i.e. the NTPase
(10, 12) and RNA binding activities.
Viral proteins that interact with RNA may participate in replication,
recombination, or transcription of viral RNA genomes; the formation of
virions; and the transport of genomes via virus-encoded movement
proteins
(43, 44) . Several suggestions implicating
poliovirus protein 2C in some of these processes have been advanced.
Such functions require NTPase and RNA binding activities, and these may
participate in RNA helicase action, traffic of viral RNA through the
vesicular system, or virion morphogenesis
(10, 12, 14) . In fact, genetic evidence
suggests that 2C may be a multifunctional protein with an involvement
in several processes during virus growth
(5) . However, these
genetic data could also be explained if 2C has a single biochemical
function whose alteration causes pleiotropic effects in the viral life
cycle. Certainly, 2C is involved in poliovirus RNA replication, and
this protein might perhaps participate in the structural organization
of the replication complex by attaching the viral RNA to membranes of
the vesicular system, where viral RNA replication takes place
(18) .
Movement of plant viruses from cell to cell is
mediated by the so-called movement proteins
(43, 44) .
These proteins bind RNA when assayed either as such or as fusion
proteins with MBP
(45) . The function of these proteins in plant
virus replication is still obscure, although it has been speculated
that they can either transport the viral RNA genome through
plasmodesmata or suppress the host responses that limit virus
replication
(44) . Some of these proteins share structural and
functional properties with picornavirus 2C. Thus, for some plant
viruses, there are relatively small (28-38 kDa) nonstructural
transport proteins
(44) . Of these, one of the best studied is
the movement protein of tobacco mosaic virus, known as p30. Binding of
p30 to viral nucleic acid involves two RNA-binding domains and causes
unfolding of the RNA and formation of long complexes
(28) .
Moreover, potex-, hordei-, and furoviruses constitute a plant virus
group whose members possess movement proteins that contain an
NTP-binding motif similar to that of 2C
(44) . Homology of the
NTP-binding motif has been also observed among the CI proteins of
potyvirus, the 58-kDa B-RNA coded protein of cowpea mosaic virus, and
picornavirus protein 2C
(46) . Even though the transport
function has been assigned to proteins other than CI and the 58 kDa
B-RNA coded protein in potyvirus and comovirus, the possibility that
the CI and 58-kDa proteins are involved in genome transport has not
been ruled out. Clearly, animal viruses do not need
``plant-like'' transport proteins to transmit the infection
from cell to cell. However, it seems plausible to suggest that viral
proteins exist that would mediate the traffic of genomes
intracellularly. 2C has several properties that are presumably
necessary for such a function including RNA affinity, NTPase activity,
and its compartmentalization and association with the vesicular
membranes, where the replication of genomes takes place.
The expert technical assistance of M. A. Sanz is
acknowledged.
Volume 270,
Number 17,
Issue of April 28, pp. 10105-10112, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-2C fusion protein is
described. This work has determined that 2C has two regions involved in
RNA binding: a NH
-terminal region located between amino
acids 21 and 45 and a COOH-terminal region involving an Arg-rich region
located between amino acids 312 and 319. Deletion of either the
NH
- or COOH-terminal RNA-binding region abolishes RNA
binding. Deletion of an internal region of protein 2C that includes the
nucleotide-binding motif does not affect RNA binding, whereas this
deletion destroys ATPase and GTPase activities. Therefore, the NTPase
activity and the RNA binding capacity of protein 2C are located in
different regions of the molecule.
and the precursor 2BC, and the latter is then further
hydrolyzed to produce 2B and 2C
(2) . In addition to forming the
mature products 2B and 2C, the precursor 2BC may itself participate in
certain processes in the poliovirus replication cycle
(5) .
Support for this idea comes from experiments that show that the
insertion of the encephalomyocarditis virus 5`-untranslated region
between 2B and 2C is lethal for poliovirus. In contrast, if the same
region is inserted between 2A
and 2B, a viable
poliovirus-encephalomyocarditis hybrid is formed
(5, 6) . The precise functions of 2B and 2BC in the
poliovirus replication cycle remain to be defined, although it is known
that poliovirus with mutations in the 2B gene is defective in its
ability to replicate the poliovirus genome
(7, 8) . Some
2B mutants cannot be complemented in trans and even interfere
with wild-type poliovirus, thus suggesting that the mutated 2B protein
can override the normal functioning of 2B
(8) .
(
)
and 2C or its variants were constructed by standard
molecular cloning procedures
(23) . The methods used for the
generation and purification of polymerase chain reaction products were
performed as described previously
(12) , and the template pT7XLD
was used throughout, except where otherwise indicated. The 5`-primers
contain different coding sequences for 2C (sense primers). The
different sequences of 2C encoded by the 3`-primers are complementary
to the coding sequence (antisense primers). The 3`-primers add two stop
codons (boldface (see sequences below)) and a HindIII site
(underlined) to the sequence that ends at the indicated nucleotide of
the 2C gene. The regions of 2C amplified by PCR were sequenced by the
dideoxynucleotide chain termination method
(23) . Construction of pMal-c.2C Plasmids for the Expression of Poliovirus
Protein 2C Deletion Mutants in the Form of MBP-2C Fusion Proteins Plasmids encoding the different fusion proteins were constructed using
the pMal-c vector. The construction of pMal-c.2C has been described
previously
(12) . Construction of 2C Variants with Carboxyl-terminal Deletions MBP-2C-(1-161)-A DNA fragment encompassing nucleotides
4124-4606 of the 2C gene was generated by PCR. The 5`-primer
used, with the SmaI site underlined, was 5`-2C.B2 (5`-GGC CGG
CCCGGG GAC AGT TGG TTG AAG AAG
). The
3`-primer used,with the HindIII site underlined and stop
codons in boldface, was 3`-2C.4606 (5`-GGG CCC AAGCTT
ACTAT
GGA TCC GGG GGTAGC GAG TAC
).
The PCR product was subjected to SmaI- HindIII double
digestion and ligated to StuI- HindIII-digested
pMal-c. MBP-2C-(1-255)-This construction has been described
previously
(12) . Briefly, pMal-c.2C was digested with
XbaI and treated with Klenow enzyme. This generates a deletion
mutant of MBP-2C with the relevant gene containing a serine codon and a
nonsense codon added after that coding for amino acid 255 of 2C. MBP-2C-(1-297)-A DNA fragment encompassing nucleotides
4424-5014 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4424
(5`-A
TACAGAAACTAGAGCATACT
). The 3`-primer
used was 3`-2C.5014
(5`-GGGCCCAAGCTTACTAG
GAAGATTTGTCCATTAATTG
).
The PCR product was subjected to XbaI- HindIII double
digestion and ligated to XbaI- HindIII-digested
pMal-c.2C. MBP-2C-(1-319)-A DNA fragment encompassing nucleotides
4424-5080 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4424. The 3`-primer used, with the HindIII site
underlined, was 3`-2C.5080 (5`-GGG CCC AAG CTT ACT AG
TTG GATCTT CTG TTT CTC TCA TT
). The PCR product
was subjected to XbaI- HindIII double digestion and
ligated to XbaI- HindIII-digested pMal-c.2C Construction of 2C Variants with Amino-terminal Deletions MBP-2C-(17-329) and MBP-2C-(21-329)-These mutants were
constructed by digesting pMal-c.2C with SphI followed by
treatment for different periods of time (30, 60, and 90 s) with Bal-31
nuclease
(47) . Deletions with
60 nucleotides removed were
selected after analysis with restriction enzymes. After transformation
of Escherichia coli DH5 cells, clones that express proteins
with a slight but appreciable difference in mobility with respect to
that of MBP-2C were isolated. After sequencing of such clones, two
mutants were selected with 16 and 20 amino acids, respectively, deleted
from the NH
terminus. MBP-2C-(42-329)-A DNA fragment encompassing nucleotides
4246-4606 of the 2C gene was generated by PCR. The 5`-primer
used, with the SacI site underlined, was 5`-2C.4246 (5`-GGC
CGG GAG-CTC AGAT AAG TTG GAA TTC GTA A
CA
). The boldface C at position 4261 is a silent change
from T to C that introduces a new EcoRI site. The 3`-primer
used was 3`-2C.4606. The PCR product was subjected to
SacI- BamHI double digestion and ligated to
SacI- BamHI-digested pMal-c.2C. MBP-2C-(101-329)-A DNA fragment encompassing nucleotides
4424-5110 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4424. The 3`-primer used was 3`-2C.B2 (5`-GGG CCCAAG CTT
ACT AT
TGA AAC AAA GCC TCC ATA C
).
The PCR product was blunt-ended with Klenow enzyme, further digested
with HindIII, and ligated to
StuI- HindIII-digested pMal-c. MBP-2C-(173-329)-A DNA fragment encompassing nucleotides
4640-5110 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4640 (5`-G
TGATT
ATGGTCGACCTGAAT
). The boldface T at position 4650
is a change from A to T that introduces a new SalI site and
generates the mutation D176V. The 3`-primer used was 3`-2C.B2. The PCR
product was blunt-ended with Klenow enzyme, further digested with
HindIII, and ligated to
StuI- HindIII-digested pMal-c. MBP-2C-(201-329)-A DNA fragment encompassing nucleotides
4724-5110 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4724
(5`-C
CACCCATGGCATCCCTGGAGGAGAAAG
).The
3`-primer used was 3`-2C.B2. The PCR product was blunt-ended with
Klenow enzyme, further digested with HindIII, and ligated to
StuI- HindIII-digested pMal-c. MBP-2C-(234-329)-A DNA fragment encompassing nucleotides
4823-5110 of the 2C gene was generated by PCR. The 5`-primer used
was 5`-2C.4823
(5`-C
ACAGTGATGCATTAGCCAGGCGCTTTGCGTTCG
).
The 3`-primer used was 3`-2C.B2. The PCR product was blunt-ended with
Klenow enzyme, further digested with HindIII, and ligated to
StuI- HindIII-digested pMal-c. Construction of NH
-terminal Deletions from
MBP-2C-(1-161) MBP-2C-(21-161)-PCR was carried out with malE primer (New England Biolabs Inc.) and 3`-2C.4606 using
pMBP-2C-(21-329) as template. The PCR product was digested with
BamHI and ligated to pMBP-2C-(1-161) previously digested
with BamHI and treated with calf intestinal alkaline
phosphatase. MBP-2C-(45-161)-PCR was carried out with malE primer and 3`-2C.4606 using pMBP-2C-(42-329) as template.
The PCR product was EcoRI- HindIII-digested and
ligated to pMal-c previously digested with the same enzymes. MBP-2C-(101-161)-PCR was carried out with malE primer and 3`-2C.4606 using pMBP-2C-(101-329) as template.
The PCR product was digested with BamHI and ligated to
pMBP-2C-(1-161) previously digested with BamHI and
treated with calf intestinal alkaline phosphatase. Construction of pMal-c2.2C pMal-c2.2C is an expression plasmid encoding an MBP
-2C
fusion protein that, upon cleavage with factor Xa, renders 2C with five
extra glycines at the NH
terminus. The pMal-c2 vector was
purchased from New England Biolabs Inc. The 2C coding region was
amplified by PCR. The 5`-primer used was 5`-2C.B3
(5`-GGTGGTGGTGGTGGTGGTGACAGTTGGTTGAAGAAG
).
This primer contains five GGT codons, encoding five Gly residues,
placed in frame with the first codon of 2C. The 3`-primer used was
3`-2C.B2. The PCR product was blunt-ended with Klenow enzyme, further
digested with HindIII, and finally cloned into
XmnI- HindIII-digested pMal-c2. Construction of Internal Deletions from pMal-c2.2C MBP
-2C-(
161-188)-pMal-c2.2C was
digested with XmnI and BamHI, blunt-ended with
Klenow, and self-ligated. MBP
-2C-(
129-172)-This plasmid was
constructed using the methodology of overlap extension described by
Higuchi et al. (48) . Three different PCRs were carried
out. PCR1 was carried out with primers 5`-2C.B2 and
3`-2C.D129-172
(5`-CAGGTCGACCATAATCAC
-A
TGTACTAGCAAACATAC
).
PCR2 was carried out with primers 5`-2C.4640 and 3`-2C.B2. The overlap
created by PCR1 + PCR2 was extended in a PCR3 carried out with
primers 5`-2C.B2 and 3`-2C.B2. This PCR3 product was
SphI- XbaI-digested and ligated to pMal-c2.2C
previously digested with the same enzymes. Construction of pMal-c2.2C Plasmids for the Expression of
MBP
-2C-(1-313),
MBP -2C-(1-315), and
MBP
-2C-(1-319) Fusion Proteins A DNA fragment encompassing nucleotides 4424-5080 of the 2C
gene was generated by PCR. The 5`-primer used was 5`-2C.4424. The
3`-primer used was 3`-2C.5080Stop
(5`-GGGCCCAAGCTTACTAG
TTGGATC(A/T)TC(A/T)GTTTC(A/T)CTCATT
).
This primer is an oligonucleotide mixture that introduces stop codons
in place of arginines at residues 314, 316, and 317 of 2C. The PCR
product was submitted to XbaI- HindIII double
digestion and ligated to XbaI- HindIII-digested
pMal-c2.2C Purification of the Fusion Proteins and Cleavage with Factor Xa E. coli DH5 cells, transformed with the plasmids encoding the
different deletion mutants, were grown in 20 ml of LB medium containing
0.2% glucose and 100 mg/ml ampicillin to an absorbance at 600 nm of
0.6. Induction and purification of the fusion proteins were as
described
(12, 24) . MBP
-2C and its
derivatives were cleaved by following two approaches. After elution,
the purified proteins were cleaved in the elution buffer containing 1
mM CaCl
at a factor Xa/fusion protein ratio of
1:100. Alternatively, MBP
-2C was cleaved while it was
attached to the amylose resin. For this purpose, instead of eluting the
fusion protein with maltose, the 1.5 ml of amylose resin (to which the
fusion protein had been bound as described above) was resuspended in
factor Xa cleavage buffer containing 1 mM CaCl
and
5 µg of factor Xa. The reaction mixture was incubated by rocking in
an Eppendorf tube at 4 °C for 2 h. Then it was transferred to the
column. The amylose resin was washed with factor Xa cleavage buffer and
with factor Xa cleavage buffer containing 10 mM maltose.
Although this protocol might have provided a single-step purification
of 2C, after its cleavage, the protein eluted with factor Xa cleavage
buffer containing 10 mM maltose, thereby indicating that MBP
and uncleaved MBP
-2C were also present. The noncanonical
products resulting from cleavage with factor Xa were also present in
this eluate. Nonradioactive Northwestern Assay The purified proteins were submitted to SDS-PAGE under standard
conditions
(25) . Electrophoresis was performed on 15% acrylamide gels at a constant current of 30 mA applied for
6 h.
The proteins were transferred overnight from the gel to a
nitrocellulose membrane using the wet electrotransfer protocol as
described
(25) . The details of the nonradioactive Northwestern
and Western immunoblot assays have been described recently
(24) . ATPase and GTPase Activity Assays Assays were performed as described previously
(12) using 0.3
µg of the different purified fusion proteins.
Expression of Poliovirus Protein 2C and 2C Deletion
Mutants in the Form of MBP-2C Fusion Proteins
The DNA sequence
encoding poliovirus protein 2C was cloned into the pMal-c vector in
order to generate a fusion protein between 2C and maltose-binding
protein (MBP-2C) as described
(12) . A number of poliovirus
protein 2C deletion mutants were generated as depicted in
Fig. 6A. Most of the mutants were made by employing PCR
and using the primers and procedures detailed under ``Materials
and Methods.'' Two mutants, MBP-2C-(17-329) and
MBP-2C-(21-329), were obtained by Bal-31 nuclease digestion. One
mutant, MBP-2C-(1-255), was obtained from pMal-c.2C as detailed
under ``Materials and Methods.''
Figure 6:
A, schematic diagram of the poliovirus
protein 2C deletion mutants expressed in E. coli as MBP-2C
fusion proteins: summary of their ability to bind RNA and NTPase
activity. ND, not determined. B, mutants expressed as
MBP
-2C fusion proteins: summary of their ability to bind
RNA. C, linear map of poliovirus protein 2C. Putative
amphipathic regions (41), the NTP-binding motif ( NTPBM), the
position of guanidine mutants with a change at Asn( Gua), and the Arg-rich region at the COOH terminus are
indicated. The Arg-rich regions located at the COOH termini of the
following picornaviral 2C proteins are indicated: bovine enterovirus
( BEV); rhinovirus ( HRV) types 89, 2, and 1B;
encephalomyocarditis virus type b ( EMCVb); and coxsackie b
virus type 1 ( COXb1).
The different MBP-2C
mutants were expressed in E. coli, and the corresponding
fusion proteins were purified as described under ``Materials and
Methods.'' Fig. 1( A and B) illustrates
Ponceau S staining (after SDS-PAGE and transfer to nitrocellulose) of
the different MBP-2C fusion proteins. A major protein band is observed
in each case that has a calculated molecular weight that corresponds to
that of MBP-2C or its variants. The major bands react with an antiserum
prepared against 2C, indicating that they contain 2C-related sequences
that are immunologically recognized within the fusion protein (data not
shown).
Figure 1:
RNA binding
activity of poliovirus protein 2C deletion mutants expressed in E.
coli as fusion proteins with MBP. A, Ponceau S staining
after wet electrotransfer of proteins to nitrocellulose sheets;
B, same procedure described in A carried out with
NH
-terminal truncations; C, Northwestern binding
assay using biotin-labeled poliovirus (amino acids 2099-4600) RNA
as the probe; D, same assay described in C carried
out with NH
-terminal
truncations.
RNA Binding Activity of 2C Mutants
When 2C is
expressed as a fusion protein with maltose-binding protein, it gives
rise to a retardation complex after association with a partially
double-stranded RNA substrate
(12) . Although the fusion protein
MBP-2C, which contains genuine poliovirus protein 2C, can be shown by
this assay to bind RNA, MBP alone is devoid of this activity.
Furthermore, the deletion mutant MBP-2C-(1-255), lacking the
COOH-terminal region between amino acids 256 and 329, also loses the
capacity to interact with RNA
(12) . Since these results
indicate that protein 2C has at least one region that is involved in
RNA binding, we have extended this analysis in order to define more
precisely where this region(s) is located by employing a Northwestern
assay (see ``Materials and Methods'') recently developed in
our laboratory
(24) . Tests on the RNA binding capacities of the
different 2C deletion mutants generated (see Fig. 1, C and D) revealed that deletions of 32 or 74 amino acids
(mutants 1-297 and 1-255, respectively) at the carboxyl
terminus rendered 2C variants incapable of binding RNA. Therefore, it
appears that the last 32 amino acids of the carboxyl terminus control
the interaction of 2C with RNA. A smaller deletion of 10 amino acids
has no influence on the RNA binding capacity of 2C, thereby locating
the RNA binding activity to residues 298-319. A larger deletion
at the COOH terminus (mutant 1-161) restores the capacity of
protein 2C to bind RNA. This finding agrees well with the RNA binding
properties of other proteins of the RNA-binding family, where small
deletions abrogate RNA binding, but larger deletions restore this
activity
(26, 27, 28) . On the other hand,
deletion of the first 16 or 20 residues from the amino terminus of 2C
does not abolish RNA binding; longer deletions of 41, 100, or 172
residues at this terminus completely destroy this capacity. These
findings suggest that two regions in 2C participate in RNA binding: one
located at the amino terminus and the other located at the carboxyl
terminus. Additional evidence for the existence of two regions within
2C that have RNA binding activity comes from results obtained with
MBP-2C-(21-161), MBP-2C-(1-161), MBP-2C-(201-329),
and MBP-2C-(234-329). The first 161 amino acids of 2C confer RNA
binding ability upon the fusion protein MBP-2C-(1-161), showing
that this amino-terminal segment of 2C participates in RNA binding.
Moreover, deletion of the first 20 amino acids (MBP-2C-(21-161))
does not affect this property. The carboxyl terminus of 2C is also
involved in the phenomenon since the last 129 and 96 amino acids of 2C
also confer RNA binding activity to the fusion proteins
MBP-2C-(201-329) and MBP-2C-(234-329), respectively. These
results are in agreement with other findings on RNA-binding proteins.
MBP alone does not bind RNA, but it acquires this ability if it is
fused with the heterogeneous nuclear RNP U protein or with a smaller
fragment of this protein containing only 110 amino acids located at the
carboxyl terminus
(27) . Eukaryotic initiation factor 4B,
expressed as a fusion protein with glutathione S-transferase,
also binds RNA
(29) , as does delta hepatitis antigen fused with
TrpE
(30) .
Figure 2:
NTPase activity of poliovirus protein 2C
deletion mutants expressed in E. coli as fusion proteins with
MBP. A, ATPase activity; B, GTPase activity. Lane 1, MBP-2C-(1-255); lane 2,
MBP-2C-(1-297); lane 3, MBP-2C-(1-319);
lane 4, MBP-2C; lane 5,
MBP-2C-(17-329); lane 6, MBP-2C-(21-329);
lane 7, MBP-2C-(42-329); lane 8, MBP-2C-(101-329); lane 9,
MBP-2C-(173-329); lane 10,
MBP-2C-(201-329); lane 11,
MBP-2C-(234-329).
Cloning and Expression of an MBP
We previously reported that cleavage of MBP-2C by
protease Xa gives rise to a cleaved product of 2C since factor Xa
recognizes, with high efficiency, an internal region of 2C, rather than
the MBP-2C junction
(12, 49) , despite the fact that 2C
does not contain the IEGR tetrapeptide that is normally required for
protease Xa activity
(31) . We reasoned that the addition of a
less structured sequence adjacent to the correct recognition site would
increase the accessibility of the protease to this position. For
example, improved thrombin cleavage occurs after the addition of five
glycines after the cleavage site
(32) . Similarly, specific
cleavage of MBP-2C by factor Xa might be enhanced by connecting the two
proteins MBP and 2C by a glycine-rich arm. To test if such an MBP-2C
fusion protein would liberate 2C upon Xa cleavage, the construction
indicated in Fig. 3was made. Cleavage of MBP
-2C
Variant Fusion Protein That Is Cleaved to Generate Genuine
2C
-2C
produces a significant amount of 2C (Fig. 3 B) that
migrates electrophoretically in the same way as genuine 2C made in
poliovirus-infected cells and is recognized by specific antiserum
against 2C (Fig. 3 C). This new cloning strategy allows a
rapid assay for the RNA binding capacity of the proteins expressed
because in the RNA binding assay described in this work, the proteins
are separated by SDS-PAGE. This enables rapid analysis of the different
mutated 2C proteins not only in fusion with other proteins, but also as
isolated individual components.
Figure 3:
A, construction of pMal-c2.2C; B,
MBP
-2C liberates 2C upon factor Xa cleavage. The
MBP
-2C fusion protein was cleaved with factor Xa while it
was attached to the amylose resin as described under ``Materials
and Methods.'' Lanes 1-3 contain 1, 0.5, and 0.25
µg of MBP
, respectively. Lanes 4-6 are
individual fractions eluted from the amylose resin column after factor
Xa cleavage. Broken and unbroken arrows indicate the
products obtained after canonical and noncanonical cleavage of factor
Xa, respectively. C, Western immunoblot assay carried out with
anti-2C antiserum (kindly provided by Dr. Wimmer). Lane 1, analysis of fraction 5 from B; lane
M, biotinylated standard (45 kDa); lane PV, proteins from
poliovirus-infected cells.
Internal Deletions of
MBP
Since poliovirus protein 2C is an
NTPase containing the A and B sites that are involved in nucleotide
interaction, two internal deletions of MBP
-2C
-2C were
generated that lacked these motifs (see Fig. 6 B). Both
constructions rendered fusion proteins that were efficiently cleaved by
factor Xa (Fig. 4, A and B). Cleavage of the
fusion protein MBP
-2C or its variants is achieved after a
1-h incubation, and longer incubation times do not increase the amount
of 2C generated (Fig. 4 A). Factor Xa digestion of
MBP
-2C liberates 2C, and several minor components are
formed as a result of internal cleavages (Fig. 4, A and
B). Genuine 2C (but containing five extra glycines at the
amino terminus) possesses RNA binding capacity
(Fig. 4 C). Both of the 2C deletion mutants, one lacking
amino acids 129-172 and the other lacking amino acids
161-188, were similar to 2C with respect to their interaction
with RNA (Fig. 4 C). However, the 2C mutant that lacks
amino acids 129-172 has background ATPase activity only, whereas
this activity in the variant that lacks amino acids 161-188 is
residual but reproducible (Fig. 4 D). Further experiments
are required to define with more precision the role that the DD motif
plays in ATPase activity. Nevertheless, the results obtained with the
2C mutant lacking amino acids 129-172 indicate that 2C can bind
RNA in the absence of NTPase activity.
Figure 4:
Internal deletions of MBP
-2C.
A, Western immunoblot assay carried out with anti-2C
antiserum. MBP
-2C, MBP
-2C-(
161-188),
and MBP
-2C-(
129-172) were submitted to digestion
with factor Xa for different time periods (1, 3, or 8 h) as described
under ``Material and Methods.'' Lane PV,
proteins from poliovirus-infected cells. B, Coomassie Blue
staining of the proteins obtained after an 8-h digestion with factor Xa
of MBP
-2C, MBP
-2C-(
161-188), and
MBP
-2C-(
129-172) ( lanes 1-3,
respectively). Lane M, molecular weight standards. C,
Northwestern assay; D, ATPase
assay.
Involvement of the NERNRR Motif in the Binding of RNA by
Poliovirus Protein 2C
The results described above identify a
region at the carboxyl terminus of 2C, located between residues 297 and
319, that is involved in RNA binding. There is a sequence in this
region that is rich in arginines and resembles, in this respect, the
RNA-binding domains described for other proteins that are endowed with
this activity
(27, 30, 33, 34, 35) .
Therefore, we decided to mutate the sequence NERNRR (amino acids
312-317) in order to determine its importance for RNA binding. To
this end, an oligonucleotide mixture was synthesized that contained
several stop codons in place of arginines (Fig. 5 A).
After PCR amplification with this oligonucleotide mixture followed by
cloning and sequencing of the different clones, three variants of 2C
were obtained: one without arginines in this motif (mutant
1-313), one with a single arginine (mutant 1-315), and one
with three arginines (mutant 1-319). The corresponding fusion
proteins of these mutants were obtained and purified as described
above. The purified fusion proteins were digested with factor Xa,
separated by SDS-PAGE, and assayed for their RNA binding capacity and,
subsequently, their reactivity with anti-2C antibodies.
Fig. 5F shows that all these fusion proteins are
efficiently cleaved by factor Xa to yield significant amounts of the
corresponding 2C variants. The mutant that contains no arginines in the
COOH-terminal region is devoid of RNA binding capacity; some binding is
detected with mutant 1-315, which contains one arginine; and full
RNA binding capacity is observed with mutant 1-319, which
contains three arginines (Fig. 5, C and E).
These findings suggest that the region between residues 313 and 319 of
2C is essential for RNA binding. The motif NERNRR of 2C is similar in
sequence to those described in other proteins with RNA binding
properties (see below). Moreover, analogous sequences rich in basic
amino acids are not only located in this region of poliovirus protein
2C, but are found in other picornaviruses, suggesting, again, an
involvement of such sequences in RNA binding activity
(Fig. 6 C).
Figure 5:
Schematic diagram and RNA binding activity
of poliovirus protein 2C deletion mutants from the Arg-rich
COOH-terminal region. A, schematic diagram of the
constructions ( nt, nucleotides; aa, amino acid);
B, Ponceau S staining after wet electrotransfer of proteins to
nitrocellulose sheets. Lane 1,
MBP
-2C-(1-313); lane 2,
MBP
-2C-(1-315); lane 3,
MBP
-2C-(1-319); lane 4,
MBP
-2C-(1-329). C, Northwestern assay of the
fusion proteins indicated in B; D, Western immunoblot
assay carried out with anti-2C antiserum. The nitrocellulose membrane
containing the MBP
-2C fusion proteins, which were analyzed
in the Northwestern RNA binding assay shown in C, was
subsequently analyzed in the Western immunoblot assay. E,
Northwestern assay carried out as described for C. The fusion
proteins were partially cleaved with factor Xa as described under
``Materials and Methods.'' The positions of
MBP
-2C and 2C are indicated ( arrows). F,
Western immunoblot assay carried out as described for
D.
90 amino acids long and contains
two conserved sequences (RNP1 and RNP2) that are separated by
30
amino acids
(39) . Both basic and aromatic amino acids are
present in RNP1 and RNP2, and they may form a complementary surface to
allow interaction with RNA
(37, 38, 39) . The
arginine-rich sequence is another well established RNA-binding motif
that is found in several viral, bacterial, and ribosomal RNA-binding
proteins
(33) . Two viral members of this family are the human
immunodeficiency virus Tat and Rev proteins. A short cluster of
arginine residues within the human immunodeficiency virus type 1 Tat
protein can directly bind a specific RNA sequence, denominated TAR, and
a single arginine in that cluster is responsible for direct interaction
of the protein with the phosphate backbone of TAR RNA
(34) .
Another viral protein that contains arginine-rich motifs is typified by
delta hepatitis antigen
(30) . Arginine residues are also
present in the RGG box, and it has been suggested that these are
responsible for RNA binding activity
(27) . These RGG boxes have
a strong positive charge, but the RNA binding capacity is lost if the
arginines are replaced by lysines, so this property is not acquired
simply by the presence of a positively charged region. Aromatic
residues are also present in RGG motifs, and these could contribute to
hydrophobic stacking interactions with RNA bases
(27, 38) .
-terminal and the other COOH-terminal, that
have been implicated in this property. Deletion of either 42 amino
acids at the NH
terminus or 16 amino acids at the COOH
terminus abolishes RNA binding. Thus, both RNA-binding regions seem to
act in concert to bind RNA, in agreement with other findings on
RNA-binding proteins. For example, RNA binding of delta hepatitis
antigen involves at least two arginine motifs, and deletion of either
results in total loss of RNA binding activity in vitro (30) . Similarly, the protein kinase DAI (double-stranded
RNA activated inhibitor) contains two copies of an RNA-binding motif.
Deletion of either of the two motifs prevents the binding of RNA
(40) . For other RNA-binding proteins, large truncations cause
an unpredictable perturbation in the tertiary structure of the
RNA-binding site of the protein; thus, even though the primary
sequences responsible for RNA binding are still contained in some
deletion mutants, they give negative results when assayed for RNA
binding
(26, 28) . For example, deletion of 174 residues
from the 54-kDa protein of the signal recognition particle generates a
330-amino acid protein devoid of RNA binding, but an additional
deletion of 122 amino acids renders the resulting 208-amino acid
carboxyl-terminal protein capable of interacting with RNA
(26) .
This might be the case for certain 2C mutants. Thus, a short deletion
at the COOH terminus (mutant 1-297) renders a 2C variant devoid
of RNA binding activity, but a longer deletion (mutant 1-161)
restores the ability of protein 2C to interact with RNA. This finding
is rather common among RNA-binding proteins
(26, 27, 28) . A short deletion of 16 amino
acids at the COOH terminus abolishes RNA binding, but not NTPase
activity (data not shown), favoring the hypothesis that the
COOH-terminal RNA-binding region acts in concert with the
NH
-terminal RNA-binding region to bind RNA.
-terminal RNA-binding region spans amino
acids 21-161, with the RNA binding capacity being tentatively
assigned to residues 21-45. The amino acid sequence between
residues 5 and 19 of 2C contains some homology to a double-stranded
RNA-binding consensus sequence
(41, 42) . However, the
double-stranded RNA-binding consensus sequence comprises
60-70 amino acids, and residues 5-19 of protein 2C
only partially match the COOH-terminal part of the consensus sequence.
Moreover, our result with mutant 21-161 does not agree with the
idea that residues 5-19 are required for RNA binding. To our
knowledge, the rest of the 2C sequence (amino acids 20-161) does
not contain significant homology to any previously identified
RNA-binding motif. The overall region has a basic isoelectric point and
is rich in lysine residues. The existence of an amphipathic helix at
the amino terminus of 2C comprising residues 10-27 has been
predicted
(41) . On the basis of similarities between this
putative helix of 2C and apolipoprotein C-III, the possibility that
this region of 2C is involved in membrane interaction has been advanced
(41) . Several poliovirus mutants have been engineered in this
region
(41) . Two such mutants, designated N2 (I25K) and N3
(K16T, K24T), show diminished 2C and 3AB synthesis due to polyprotein
misprocessing. These mutants are nonviable, but it remains uncertain if
the lack of viral RNA replication was directly caused by a failure of
mutated 2C to participate in RNA synthesis or resulted from a secondary
defect involving misprocessing of the viral proteins. Finally,
mutations resulting in the conversion of two conserved glutamic acid
residues (Glu
and Glu
) to valines in this
region produces a viable mutant with a small plaque phenotype,
suggesting that the amino-terminal region plays a part in virus growth.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
A. M. De Palma, W. Heggermont, K. Lanke, B. Coutard, M. Bergmann, A.-M. Monforte, B. Canard, E. De Clercq, A. Chimirri, G. Purstinger, et al. The Thiazolobenzimidazole TBZE-029 Inhibits Enterovirus Replication by Targeting a Short Region Immediately Downstream from Motif C in the Nonstructural Protein 2C J. Virol., May 15, 2008; 82(10): 4720 - 4730. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Belsham and P. Normann Dynamics of picornavirus RNA replication within infected cells J. Gen. Virol., February 1, 2008; 89(2): 485 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yin, Y. Liu, E. Wimmer, and A. V. Paul Complete protein linkage map between the P2 and P3 non-structural proteins of poliovirus J. Gen. Virol., August 1, 2007; 88(8): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-F. Tang, S.-Y. Yang, B.-W. Wu, J.-R. Jheng, Y.-L. Chen, C.-H. Shih, K.-H. Lin, H.-C. Lai, P. Tang, and J.-T. Horng Reticulon 3 Binds the 2C Protein of Enterovirus 71 and Is Required for Viral Replication J. Biol. Chem., February 23, 2007; 282(8): 5888 - 5898. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takano-Maruyama, Y. Ohara, K. Asakura, and T. Okuwa Theiler's Murine Encephalomyelitis Virus Leader Protein Amino Acid Residue 57 Regulates Subgroup-Specific Virus Growth on BHK-21 Cells J. Virol., December 15, 2006; 80(24): 12025 - 12031. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Teterina, E. Levenson, M. S. Rinaudo, D. Egger, K. Bienz, A. E. Gorbalenya, and E. Ehrenfeld Evidence for functional protein interactions required for poliovirus RNA replication. J. Virol., June 1, 2006; 80(11): 5327 - 5337. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. DeStefano and O. Titilope Poliovirus Protein 3AB Displays Nucleic Acid Chaperone and Helix-Destabilizing Activities J. Virol., February 15, 2006; 80(4): 1662 - 1671. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Brown, C. T. Cornell, G. P. Tran, J. H. C. Nguyen, and B. L. Semler An Authentic 3' Noncoding Region Is Necessary for Efficient Poliovirus Replication J. Virol., September 15, 2005; 79(18): 11962 - 11973. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Harris and V. R. Racaniello Amino Acid Changes in Proteins 2B and 3A Mediate Rhinovirus Type 39 Growth in Mouse Cells J. Virol., May 1, 2005; 79(9): 5363 - 5373. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Brunner, J. H. C. Nguyen, H. H. Roehl, T. V. Ho, K. M. Swiderek, and B. L. Semler Functional Interaction of Heterogeneous Nuclear Ribonucleoprotein C with Poliovirus RNA Synthesis Initiation Complexes J. Virol., March 15, 2005; 79(6): 3254 - 3266. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Banerjee, M. K. Weidman, A. Echeverri, P. Kundu, and A. Dasgupta Regulation of Poliovirus 3C Protease by the 2C Polypeptide J. Virol., September 1, 2004; 78(17): 9243 - 9256. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Crotty, M.-C. Saleh, L. Gitlin, O. Beske, and R. Andino The Poliovirus Replication Machinery Can Escape Inhibition by an Antiviral Drug That Targets a Host Cell Protein J. Virol., April 1, 2004; 78(7): 3378 - 3386. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Teterina, M. S. Rinaudo, and E. Ehrenfeld Strand-Specific RNA Synthesis Defects in a Poliovirus with a Mutation in Protein 3A J. Virol., December 1, 2003; 77(23): 12679 - 12691. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sasaki, S. Nagashima, and K. Taniguchi Aichi Virus Leader Protein Is Involved in Viral RNA Replication and Encapsidation J. Virol., October 15, 2003; 77(20): 10799 - 10807. [Abstract] [Full Text] [PDF] |
||||