JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nwaka, S.
Right arrow Articles by Holzer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nwaka, S.
Right arrow Articles by Holzer, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 17, Issue of April 28, pp. 10193-10198, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Expression and Function of the Trehalase Genes NTH1 and YBR0106 in Saccharomyces cerevisiae(*)

Solomon Nwaka , Meinrad Kopp , Helmut Holzer (§)

From the (1) Biochemisches Institut, Universität Freiburg, Hermann-Herder-Strasse 7, D79104 Freiburg, Germany

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The biological function of the trehalose-degrading yeast enzyme neutral trehalase consists of the control of the concentration of trehalose, which is assumed to play a role in thermotolerance, in germination of spores, and in other life functions of yeast. Resequencing of the neutral trehalase gene NTH1 on chromosome IV resulted in the observation of two possible start codons (Kopp, M., Nwaka, S., and Holzer, H. (1994) Gene (Amst.) 150, 403-404). We show here that only the most upstream start codon which initiates translation of the longest possible ORF is used for expression of NTH1 in vivo. A gene with 77% identity with NTH1, YBR0106, which was discovered during sequencing of chromosome II (Wolfe, K. H., and Lohan, A. J. E. (1994) Yeast 10, S41-S46), is shown here to be expressed into mRNA. Experiments with a mutant disrupted in the YBR0106 ORF showed, in contrast to a NTH1 deletion mutant, no changes in trehalase activity and in trehalose concentration. However, similar to the NTH1 gene a requirement of the intact YBR0106 gene for thermotolerance is demonstrated in experiments with the respective mutants. This indicates that the products of the likely duplicated YBR0106 gene and the NTH1 gene serve a heat shock protein function. In case of the YBR0106 gene, this is the only phenotypic feature found at present.


INTRODUCTION

Trehalose is thought to play a role in thermotolerance and in desiccation tolerance of yeast. It is furthermore supposed to serve as a reserve carbohydrate during starvation and for germination of spores (for reviews, see Refs. 1 and 2). Trehalose-hydrolyzing enzyme activity in yeast was first described by Fischer (3) . A ``neutral trehalase'' with a pH optimum at 7 localized in the cytosol was characterized by Londesborough and Varimo (4) and isolated by App and Holzer (5) . The corresponding gene NTH1 was cloned from Saccharomyces cerevisiae and sequenced by Kopp et al. (6) . An ``acid trehalase'' with a pH optimum at 4.5 localized in the vacuole was purified and characterized by Mittenbühler and Holzer (7) . The biological function of trehalase assists in control of trehalose concentration via degradation of trehalose. The rapid degradation of trehalose in intact cells when recovering from heat stress (8, 9, 10) is not observed in mutant cells carrying a disrupted or a deleted gene of neutral trehalase ( nth1) (6, 8) . Because nth1 mutants show high activity of acid trehalase, this is strong evidence for neutral trehalase, and not acid trehalase, being the catalyst of hydrolysis of trehalose in intact cells.

Recently, Wolfe and Lohan (11) described a gene, YBR0106, located on chromosome II, whose predicted amino acid sequence showed 77% identity with the amino acid sequence predicted from the NTH1 gene published by Kopp et al. (6, 12) . Because of the high identity of the predicted NTH1 and YBR0106 gene products as well as the high homology of the YBR0106 gene product to other trehalase sequences from a variety of animals and bacteria, the YBR0106 gene was designated a trehalase gene (11) . However, expression and function of the YBR0106 gene was not studied.

In the present paper, we present studies on the expression of the YBR0106 gene. Furthermore, a role of the two genes NTH1 and YBR0106 in thermotolerance is shown.


MATERIALS AND METHODS

Reagents

DNA restriction and modifying enzymes were purchased from Boehringer Mannheim, Germany. [-P]dCTP and random priming kit were from Amersham Buchler, Braunschweig, Germany and the U. S. Biochemicals Corp. Biochemical reagents were purchased from Sigma, Deisenhofen, and Boehringer Mannheim, Germany. Growth media were purchased from Difco Laboratories.

Strains, Media, and Growth Conditions

The genotypes and source of all strains used in this work are shown in .

Yeast cells were grown on YEP medium (2% bacto-peptone and 1% yeast extract) and supplemented with a carbon source as indicated. Synthetic medium was prepared according to the method described by Sherman et al. (13) . Escherichia coli (DH5) strain was grown on LB medium (0.5% yeast extract, 1% NaCl, 1% bacto-tryptone) and supplemented as required.

Plasmids, Gene Disruption, Overexpression Strategy, and Yeast Strain Construction

Standard molecular and recombinant DNA techniques were applied as described by Sambrook et al. (14) . Competent yeast cells were prepared by lithium acetate, and transformation was as described by Ito et al. (15) . All plasmids were amplified in E. coli (DH5) as described by Mandel and Higa (16) . The YBR0106 ORF was disrupted according to the one-step disruption protocol described by Rothstein (17) , using a 3.8-kb()HindIII fragment (containing 2.37 kb from the 5`-noncoding region, plus a 1.43-kb 5` part of the 2.34-kb YBR0106 ORF) in pBluescript (a gift from Dr. K. Wolfe, University of Dublin).

This plasmid was digested with BglII, which has a unique site in this plasmid (at position 1.154 kb of the YBR0106 ORF). The URA3 gene isolated as a BamHI fragment from plasmid YDpU (18) was inserted into the BglII site. The resulting plasmid bearing the disruption of the YBR0106 ORF was digested with HindIII prior to transformation into the wild type yeast strains YS18 and YSN1 ( nth1LEU2) (8) to yield strains YSN01 ( ybr0106::URA3) and YSN1-01 ( nth1LEU2/ybr0106::URA3), respectively. The disruption was confirmed in uracil prototrophic transformants by Southern blot analysis using HindIII-digested chromosomal DNA from these strains and a 728-bp ( SfuI/BstEII) fragment from the YBR0106 gene as a radiolabeled probe.

For overexpression studies, the ORF previously reported for NTH1 (6) and the corrected sequence (12) were amplified by PCR using synthetic oligonucleotide primers with BamHI recognition sequences at the 5` ends. The sequence of forward primer for the corrected NTH1 ORF sequence (12) is 5`CGGGATCCATGAGTCAAGTTAATACAAGCCAAG3` and of the reverse primer is 5`CGGGATCCCTATAGTCCATAGAGGTTTCTTTCT3`. The sequence of the forward primer for the previously reported NTH1 ORF (6) is 5`CGGGATCCATGAGTGTTTTCGATAATGTATCTC3` and of the reverse primer is the same as used for the corrected sequence above. In a PCR reaction, using the above primers and plasmid pTZ18R (6) (containing the NTH1 gene and its flanking sequences as a 6-kb SalI DNA fragment), fragments of 2.253 kb and 2.079 kb were generated as seen on agarose gels. Similarly, the YBR0106 ORF was amplified by PCR from genomic DNA of nth1 strain (YSN1) using the following synthetic oligonucleotide primers, 5`CGGGATCCATGGTAGATTTTTTACCAAAAGTAACG3` and 5`CGGGATCCTAGGTAATACAATTTTTTCTCAGAGGGTTTC3` as forward and reverse primers, respectively. These were subcloned behind the inducible GAL1 promoter in a high copy 2µ-based plasmid (pYES2, purchased from Invitrogen) to generate p2.253 (for the corrected NTH1 ORF (12) ), p2.079 (for the previously reported NTH1 ORF (6) ), and pYBR (for the YBR0106 ORF). The sequence of the PCR cloned fragments was verified by sequence analysis according to Ref. 19. A schematic representation of the overexpression strategy is shown in Fig. 1.


Figure 1: Strategy for overexpression of the NTH1 and YBR0106 genes. The previously reported NTH1 ORF (6), the corrected NTH1 ORF (12), and the YBR0106 ORF (11) were amplified by PCR and cloned behind the GAL1 promoter in the high copy plasmid pYES2 to give p2.079, p2.253, and pYBR for the respective ORFs. These plasmids were subsequently introduced into various strains as described under ``Materials and Methods.''



We introduced the NTH1 deletion into SEY6211 (which is GAL) according to Ref. 8 to get YSN1A ( nth1LEU2) and transformed it with p2.253, p2.079, and pYBR to get YSN1A/p2.253, YSN1A/p2.079, and YSN1A/pYBR, respectively. Transformation was also done in WCG4a to get WCG4a/p2.253, WCG4a/p2.079, and WCG4a/pYBR.

Blotting Procedure

For Southern blot analysis, yeast cells were grown to stationary phase on YEPD. The cells were converted to spheroplasts as described (20) , lysed by SDS and potassium acetate, and the DNA was precipitated and washed after RNase digestion. The DNA was digested, subjected to agarose gel electrophoresis, and blotted onto Amersham Hybond Hmembrane according to the manufacturer's instruction. For Northern blot analysis, total RNA was isolated from exponential and stationary phase cells according to Chirgwin et al. (21) . The total RNA was separated on a 1% formaldehyde-agarose gel and transferred onto a Hybondnylon membrane according to the manufacturer's instruction. The DNA probes for Southern and Northern blot analysis were labeled with [-P]dCTP by the random priming method (22) .

Trehalase and Trehalose Assay

For measurement of trehalase activity, both the overlay assay on plates and assay with samples from crude extracts were performed. The neutral trehalase overlay assay was performed as described before (6) . The acid trehalase overlay assay was performed using the same method as for neutral trehalase except that sodium citrate, 5 mM EDTA buffer, pH 4.5, at 37 °C instead of 50 mM imidazole chloride, pH 7.0, was used and there was no activation by the cAMP, ATP, and MgClmixture (5, 6, 7) . Trehalase assay from crude extracts of the two enzymes was performed according to Refs. 5 and 7, and total protein concentration was determined by the method of Lowry et al. (23) . Trehalose assay in boiled extracts from exponentially growing yeast cells and heat-stressed cells was performed by using acid trehalase, according to Kienle et al. (24) .

Heat Shock Treatment, Thermotolerance, and Determination of Cell Survival

Yeast strains to be tested were streaked on YEPD plates and incubated at 30 °C for 3 days. The cells were then replica-plated onto fresh YEPD plates and transferred immediately to a temperature of 50 °C for 7 h to 10 h. After this time, the cells were shifted back to 30 °C, and growth was monitored daily. The replica-plated cells treated at 45 °C for 2 days and shifted back to 30 °C ( cf. Ref. 25) gave similar results as those cells which underwent a 50 °C treatment for 7 h to 10 h.

Thermotolerance abilities of cells were also checked on liquid culture: the cells were grown to stationary phase on YEPD for 48 h at 30 °C, and an aliquot was taken for determination of cell survival. The cells were then shifted to 50 °C for 20 min, and, after this time, an aliquot was removed for determination of cell survival. Equal dilutions of stationary cells before and after heat shock (50 °C for 20 min) were plated onto YEPD plates and kept at 30 °C. After 3 days, the cells were counted and the percentage of survival was calculated using the survival of non-heat-shocked cells as 100% control.


RESULTS

Expression and Disruption of the YBR0106 Gene

Expression of the YBR0106 gene was checked by Northern blot analysis using total RNA prepared from the NTH1 deletion mutant strain YSN1 ( nth1LEU2). Using a 728-bp ( SfuI/ BstEII) fragment from the YBR0106 gene (11) as a radiolabeled probe, a signal of about 2.6 kb was detected ( upper part of Fig. 2). The rRNA run in parallel verified equal total RNA loaded on the gel ( lower part of Fig. 2).


Figure 2: Northern blot analysis of the YBR0106 gene. Total RNA was prepared from NTH1 deletion strain (YSN1) at two time points from exponentially growing cells on YEPD ( lane 1, OD= 1.5; lane 2, OD= 2.5) and stationary phase cells ( lane 3, OD= 6; lane 4, OD= 8). Using a 728-bp ( SfuI /BstEII) fragment from YBR0106 (11) as a radiolabeled probe, a YBR0106-specific RNA, corresponding to 2.6 kb can be seen in the upper panel of the figure. The locations of 25 S (3.4 kb) and 18 S (1.7 kb) rRNA species as visualized by ethidium bromide staining are shown as control on the lower panel to confirm that an equal concentration of RNA was loaded on the gel. Extraction of RNA and Northern blot analysis were performed as described under ``Materials and Methods.''



This fits with the size of the ORF of the YBR0106 gene (2.34 kb according to Ref. 11) plus possible polyadenylation signals. It can also be seen from Fig. 2that the expression of YBR0106 gene is low in exponential phase and high in stationary or late exponential phase of cells growing on glucose.

To check a possible influence of the YBR0106 gene on neutral trehalase activity and on trehalose metabolism, a disruption of the YBR0106 gene was introduced into a wild type strain YS18 as well as into strain YSN1 ( nth1LEU2) to yield strains YSN01 ( ybr0106::URA3) and YSN1-01 ( nth1LEU2/ybr0106::URA3), respectively. The disruption was constructed in pBluescript containing a 3.8-kb HindIII DNA fragment (part of which is a 1.43-kb 5` part of the YBR0106 gene). A 1.1-kb URA3 marker with BamHI ends (18) was subcloned into the unique BglII site in the YBR0106 gene part of the plasmid as described under ``Materials and Methods.'' Prior to introduction into the respective yeast strains, the disruption plasmid was digested with HindIII (to generate a 4.9-kb fragment containing the original 3.8-kb HindIII DNA fragment plus the 1.1-kb URA3 gene). In a Southern blot analysis, using HindIII-digested genomic DNA from the mutant strains YSN01 and YSN1-01 and control strain YSN1, and using a 728-bp ( SfuI/ BstEII) fragment from the part of the YBR0106 gene in pBluescript as a radiolabeled probe, a bandshift corresponding to the size of the URA3 marker was seen in the mutants carrying the disrupted gene as compared to the control strain.

Neutral Trehalase and Acid Trehalase Activity in ybr0106 Disruption Mutants

Activity of neutral trehalase with and without preincubation with cAMP/ATP and of acid trehalase was assayed in crude extracts of mutant cells and wild type cells after growth to the late exponential phase. It can be seen from that disruption of the YBR0106 gene has no influence on neutral trehalase activity as compared to the wild type. In contrast, the nth1 deletion mutant as well as a nth1/ybr0106 double mutant, show no detectable neutral trehalase activity. As shown previously (5) , phosphorylation with cAMP/ATP increases neutral trehalase activity in extracts from late stationary cells 2- to 3-fold as expected. Acid trehalase activity is not changed by deletion of the NTH1 gene (6) ; the activity increases, however, 2-fold in cells carrying the ybr0106 disruption. Consistent with Wolfe and Lohan (11) , we consider the YBR0106 gene not to be the structural gene for acid trehalase. It might, however, be that the YBR0106 gene is a negative regulatory factor for expression of acid trehalase activity. In summary, it may be concluded that the YBR0106 gene is transcribed to the corresponding mRNA; however, its predicted translation product has no detectable neutral trehalase activity at pH 7. The ``increased sensitivity to heat shock'' of the ybr0106::URA3 described below indicates, however, a translation product with possible heat shock protein function.

Trehalose Concentration in Wild Type, ybr0106 Mutants, and nth1 Mutants

Expression and function of the genes NTH1 and YBR0106 were also studied in intact cells by measuring the degradation of trehalose upon shift of cells from the heat stress at 40 °C (at which cells accumulate trehalose) to the normal growth temperature of 30 °C (8, 9, 10) . It may be seen from I that trehalose degradation takes place in the ybr0106 disruption mutant to the same extent as in the wild type, whereas in the nth1 deletion mutant as well as in the nth1/ybr0106 double mutant only a slight or no trehalose disappearance is observed. These experiments with intact cells support the results observed using cell extracts () showing that a ybr0106 disruption has no influence on neutral trehalase activity.

Overproduction of the Neutral Trehalase from p2.253

Due to the close proximity of the start codon previously reported for the NTH1 gene (6) to the one found in the corrected sequence of the NTH1 gene (12) , we decided to check (i) whether both start codons can be used for translation of the NTH1 mRNA (translation of a gene from two neighbored possible start codons has been shown before (26, 27) ) or (ii) whether the N-terminal region of the gene is necessary for activity of neutral trehalase. We therefore constructed the strains YSN1A/p2.253 and YSN1A/p2.079. For definition of p2.253 and p2.079, see ``Materials and Methods.'' Neutral trehalase activities (with and without preincubation with cAMP/ATP) of exponentially growing cells on YEPGal medium (to induce the production of neutral trehalase from the GAL1 promoter by galactose (28) ) are presented in .

As expected from previous work (5) , neutral trehalase in wild type cells (SEY6211) showed a 3- to 10-fold increased activity after preincubation of the extracts with cAMP/ATP. Neutral trehalase activity in cells with a NTH1 deletion is not detectable (, line 2). The strain YSN1A/p2.079 exhibits no detectable activity (, line 4), while the strain YSN1A/p2.253 showed several times higher activity under all conditions studied when compared to the wild type (, line 3). Similar results were also obtained using strains WCG4a/p2.253 and wild type WCG4a (data not shown). Furthermore, we constructed the strain YSN1A/pYBR and induced the overexpression of the YBR0106 gene by growth on galactose. Consistent with the idea that the possible YBR0106 gene product has no neutral trehalase activity, we could not detect any significant neutral trehalase activity in YSN1A/pYBR strain (, line 5).

Thermotolerance of the Trehalase Mutants under Heat Shock

A possible role of the trehalase genes, YBR0106 and NTH1, in the heat shock response was analyzed both on plates and in liquid cultures of stationary growing yeast cells. It can be seen in Fig. 3, that stationary phase cells of wild type YS18 and mutants YSN01 ( ybr0106::URA3), YSN1 ( nth1LEU2), and YSN1-01 ( nth1LEU2/ybr0106::URA3) on YEPD plates treated at 50 °C for 7 h showed different growth or recovery patterns when shifted back from 50 °C to 30 °C. A similar effect was seen when the cells were treated at 45 °C for 2 days and shifted back from 45 °C to 30 °C. These differences in recovery from the high temperature treatment correlates to the presence or lack of either the NTH1 gene or the YBR0106 gene or both. After treatment at 50 °C for 7 h, wild type cells resume growth at 30 °C at a rate cells do without 50 °C treatment. In contrast, the strains YSN1 ( nth1LEU2), YSN01 ( ybr0106::URA3), and YSN1-01 ( nth1LEU2/ybr0106::URA3) showed an obvious delay in resumption of normal growth. The thermotolerance of these strains was also analyzed in liquid culture of stationary cells grown on YEPD (for details, see ``Materials and Methods''). The survival data are 50-59% for the single mutants, 42% for the double mutants, and 77% for the wild type cells, which is in agreement with the result of the experiments done on solid medium. It may be emphasized that increased sensitivity to heat shock, i.e. a heat shock protein function, is the only phenotypic property known at present for the YBR0106 ``trehalase'' gene.


Figure 3: Role of intact NTH1 and YBR0106 genes for recovery after heat shock. The master plate, represented with the number 1 (shown at the top of the figure and used for all replica plating), contains cells grown on YEPD to stationary phase of wild type YS18; YSN1 ( nth1LEU2); YSN1-01 ( nth1LEU2/ybr0106::URA3), two independent disruptants; YSN01 ( ybr0106::URA3), two independent disruptants. The master plate was replica-plated onto another YEPD plate (represented with the number 2 at the bottom of the figure) and then shifted to 50 °C for 7 h. After this time, the plates were shifted back to 30 °C for 2 to 3 days.



A similar result was recorded for exponentially growing NTH1 deletion mutant cells pretreated at 40 °C for 40 min and heat-shocked at 50 °C for 10 or 20 min when wild type YS18 and strain YSN1 ( nth1LEU2) were compared (see in Ref. 8).


DISCUSSION

Expression of NTH1 Gene

Discovery of a N-terminal extension (11, 12) of the previously described gene NTH1 (6) raised the question whether the corrected ORF with the nucleotide extension or the previous ORF without extension was expressed in vivo. Experiments with the corresponding plasmids show that only the corrected NTH1 ORF is expressed yielding a protein with catalytic neutral trehalase activity (). We therefore identify the nucleotide sequence of the corrected ORF with `` NTH1'' (see the registration at the GenBank/EMBL Data Bank, accession number X65925). A strong overexpression of neutral trehalase activity was observed in the transformed strain YSN1A/p2.253 (see ). This feature may be useful for preparation of neutral trehalase with probably higher yield than in previous preparations from the ABYS mutant strain (5) . The existence of two phosphorylation sites close to the N terminus are, in addition to the high identity of 77% of the amino acid sequence and 72% at nucleotide sequence level (according to computer analysis), characteristic properties indicating similarity of YBR0106 and NTH1. These similarities, as well as the localization of the two genes adjacent to the centromeres on the right arm of chromosomes II and IV, respectively, support the proposal of origination of the central parts of chromosomes II and IV from duplication of an ancestral chromosome (11) .

Expression of YBR0106 Gene

As shown with Northern blot analysis, expression of YBR0106 clearly leads to the corresponding mRNA under glucose derepressing conditions (Fig. 2). Whether a catalytically active trehalose-degrading protein, the enzyme trehalase, is actually formed by translation of the mRNA is very questionable: a ybr0106::URA3 disruption mutant strain does not show any change in trehalose degradation or in trehalose levels as compared to the wild type strain under different conditions. The only phenotypic characteristic for the YBR0106 disruption mutant discovered, until now, is an increased sensitivity against heat shock at 50 °C as compared to wild type (see Fig. 3). The decreased thermotolerance, i.e. the heat shock protein function of the YBR0106 gene, may perhaps be used for screening of YBR0106 suppressors.

Catabolite Repression of YBR0106 Gene

From the Northern blots shown in Fig. 2, it may be seen that expression of mRNA transcribed from YBR0106 is much higher in stationary phase cells as compared to exponentially growing cells. The dependence of gene expression on the presence of glucose in the culture medium is typical for genes which are under control of ``catabolite repression'' also called ``glucose repression'' (29, 30, 31) . In yeast, besides several key enzymes of gluconeogenesis (31) , neutral trehalase (5) and acid trehalase (7) also are subject to catabolite repression. Repression by glucose generally points to a biologically significant function of the respective enzymes in glucose metabolism. A biological function of the glucose regulated ``silent trehalase'' YBR0106 may consist of making glucose available from trehalose or other carbohydrates under special growth conditions. We are planning more detailed experiments on catabolite repression and catabolite inactivation (32) of the predicted YBR0106 gene product. Because up to now no influence of YBR0106 on trehalose levels could be detected, we also intend to search for hydrolytic activity of the predicted YBR0106 protein with substrates other than trehalose under varying conditions.

Influence of the Genes NTH1 and YBR0106 on Thermotolerance

The results shown in Fig. 3clearly demonstrate that the trehalase genes NTH1 and YBR0106 may play an important role in thermotolerance as well as in aiding yeast cells for fast recovery from heat shock. This role of the trehalases in enhanced thermotolerance does not occur via trehalose accumulation, otherwise one would have seen the opposite effect in the NTH1 defective mutant (which does not hydrolyze trehalose) when compared to the wild type or in the YBR0106 defective mutant which behaves like wild type in terms of trehalose hydrolysis. Although stationary phase cells are thermotolerant and show high trehalose concentration (8, 9, 10) , they also exhibit high neutral trehalase activity and a high mRNA expression of the YBR0106 gene (Fig. 2). Therefore, the ability to acquire thermotolerance of the strains shown in Fig. 3can only be correlated to the trehalases and not to the trehalose concentration. This is another example of lack of correlation between trehalose concentration and increase in thermotolerance (8, 33) . In this context, it may be of interest that the newly described stress-regulated element called STRE (CCCCT) (34, 35, 36) exists in the promoter region of the NTH1 and the YBR0106 genes which are induced at heat stress (41) . This element alone has been shown to regulate the stress-induced expression of the CTT1 gene (35) , DDR2 gene (34) , and TPS2 gene (36) . Hottiger et al. (37) have proposed a possible interaction between neutral trehalase and heat shock protein 70 (Hsp70) under heat shock conditions as a mechanism that protects neutral trehalase from thermal denaturation and misfolding. Therefore, it may be that interaction of the trehalases with heat shock proteins is part of the stress response mechanism.

  
Table: Strains used


  
Table: Neutral trehalase and acid trehalase activity in ybr0106 mutants compared to nth1 mutants and wild type YS18

Neutral trehalase (NTH) and acid trehalase (ATH) specific activity in stationary cells of YS18 (wild type), YSN1 ( nth1 LEU2), YSN01 ( ybr0106::URA3), and YSN1-01 ( nth1 LEU2/ybr0106::URA3). NTH activity assay was done with and without preincubation with a cAMP/ATP mixture at pH 7, while ATH assay was done without preincubation with of a cAMP/ATP mixture at pH 4.5. Details concerning growth conditions, preparation of crude extract, and assay conditions are as described under ``Materials and Methods.'' Activity of purified NTH (5) at pH 4.5 is <1% of the activity at pH 7. Activity of purified ATH (7) at pH 7 is <5% of the activity at pH 4.5.


  
Table: Change in trehalose concentration at recovery (30 °C) from mild heat stress (40 °C) in ybr0106 mutants compared to nth1 mutants and wild type YS18

Trehalose concentration in exponentially growing cells of wild type YS18, YSN01 ( ybr0106::URA3), YSN1 ( nth1 LEU2), and YSN1-01 ( nth1 LEU2/ybr0106::URA3) at mild heat stress and recovery from stress at 30 °C. Details concerning growth conditions, heat treatment, extraction of trehalose, and trehalose assay are as described under ``Materials and Methods.''


  
Table: Neutral trehalase activity in exponentially growing wild type and cells transformed with p2.253, p2.079, and pYBR

Neutral trehalase (NTH) specific activity in exponentially growing cells of wild type SEY6211, YSN1A ( nth1 LEU2), YSN1A/p2.253 ( nth1 LEU2+p2.253), YSN1A/p2.079 ( nth1 LEU2+p2.079), and YSN1A/pYBR ( nth1 LEU2+pYBR) on galactose before and after preincubation with cAMP/ATP mix. Details concerning growth conditions, preparation of crude extract, and neutral trehalase assay conditions are as described under ``Materials and Methods.''



FOOTNOTES

*
This work was supported by the Deutsche Forschungsgemeinschaft, Sonderforschungsbereich 206, Bonn, the Fonds der Chemischen Industrie, Frankfurt/Main, and Wissenschaftliche Gesellschaft zu Freiburg im Breisgau. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence and reprint requests should be addressed: Tel.: 49-761-203-5250; Fax: 49-761-203-5253.

The abbreviations used are: kb, kilobase pair(s); bp, base pair(s); PCR, polymerase chain reaction.


ACKNOWLEDGEMENTS

Thanks are due to Drs. Dieter Wolf, Wolfgang Heinemeyer, Nikolaus Pfanner, Ernest Kun, and Bernd Mechler for critical reading of the manuscript; to Drs. Daniel Klionsky, Monika Destruelle, Dieter Wolf, and Wolfgang Heinemeyer for the gift of strains; and to Dr. Kenneth Wolfe for the gift of plasmids. We also thank Markus Burgert for technical assistance and Wolfgang Fritz for help with the figures.


REFERENCES
  1. Thevelein, J. M. (1984) Microbiol. Rev. 48, 42-59 [Free Full Text]
  2. Thevelein, J. M. (1988) Exp. Mycol. 12, 1-12
  3. Fischer, E. (1895) Ber. Dtsch. Chem. Ges. 28, 1429-1438
  4. Londesborough, J., and Varimo, K. (1984) Biochem. J. 219, 511-518 [Medline] [Order article via Infotrieve]
  5. App, H., and Holzer, H. (1989) J. Biol. Chem. 264, 17583-17588 [Abstract/Free Full Text]
  6. Kopp, M., Müller, H., and Holzer, H. (1993) J. Biol. Chem. 268, 4766-4774 [Abstract/Free Full Text]
  7. Mittenbühler, K., and Holzer, H. (1988) J. Biol. Chem. 263, 8537-8543 [Abstract/Free Full Text]
  8. Nwaka, S., Kopp, M., Burgert, M., Deuchler, I., Kienle, I., and Holzer, H. (1994) FEBS Lett. 344, 225-228 [CrossRef][Medline] [Order article via Infotrieve]
  9. Attfield, P. V. (1987) FEBS Lett. 225, 259-263 [CrossRef][Medline] [Order article via Infotrieve]
  10. Hottiger, T., Schmutz, P., and Wiemken, A. (1987) J. Bacteriol. 169, 5518-5522 [Abstract/Free Full Text]
  11. Wolfe, K. H., and Lohan, A. J. E. (1994) Yeast 10, S41-S46
  12. Kopp, M., Nwaka, S., and Holzer, H. (1994) Gene (Amst.) 150, 403-404 [Medline] [Order article via Infotrieve]
  13. Sherman, F., Fink, G. R., and Hicks, J. B. (1986) Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  14. Sambrook, J., Maniatis, T., and Fritsch, E. F. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  15. Ito, H., Murata, K., and Kimura, A. (1984) Agric. Biol. Chem. 48, 175-179
  16. Mandel, M., and Higa, A. (1970) J. Mol. Biol. 53, 159-162 [CrossRef][Medline] [Order article via Infotrieve]
  17. Rothstein, R. J. (1983) Methods Enzymol. 101, 202-211 [Medline] [Order article via Infotrieve]
  18. Berben, G., Dumont, J., Gilliquet, V., Bolle, P. A., and Higler, F. (1991) Yeast 7, 475-477 [CrossRef][Medline] [Order article via Infotrieve]
  19. Igloi, G. L., and Schiefmermayr, E. (1993) Biotechnique 15, 486-497 [Medline] [Order article via Infotrieve]
  20. Wolska-Mitaszko, B., Jakubowicz, T., Kucharzweska, T., and Gasior, E. (1981) Anal. Biochem. 116, 241-247 [Medline] [Order article via Infotrieve]
  21. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  22. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  23. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275 [Free Full Text]
  24. Kienle, I., Burgert, M., and Holzer, H. (1993) Yeast 9, 607-611 [CrossRef][Medline] [Order article via Infotrieve]
  25. Toh-E, A., Yasunaga, S., Nisogi, H., Tanaka, K., Oguchi, T., and Matsui, Y. (1993) Yeast 9, 481-494 [CrossRef][Medline] [Order article via Infotrieve]
  26. Northemann, W., Shiels, B. R., Braciak, T. A., Hanson, R. W., Heinrich, P. C., and Fey, G. H. (1988) Biochemistry 27, 9194-9203 [CrossRef][Medline] [Order article via Infotrieve]
  27. Northemann, W., Braciak, T. A., Hattori, M., Lee, F., and Fey, G. H. (1989) J. Biol. Chem. 264, 16072-16082 [Abstract/Free Full Text]
  28. Johnston, M. (1987) Microbiol. Rev. 51, 458-476 [Free Full Text]
  29. Monod, J. (1947) Growth 11, 223-289
  30. Magasanik, B. (1961) Cold Spring Harbor Symp. Quant. Biol. 26, 249-256 [Abstract/Free Full Text]
  31. Holzer, H. (1989) Cell Biol. Rev. 21, 305-319
  32. Holzer, H. (1976) Trends Biochem. Sci. 1, 178-181
  33. Winkler, K., Kienle, I., Burgert, M., Wagner, J. C., and Holzer, H. (1991) FEBS Lett. 291, 261-272
  34. Kobayashi, N., and McEntee, K. (1993) Mol. Cell. Biol. 13, 248-256 [Abstract/Free Full Text]
  35. Marchler, G., Schüller, C., Adam, G., and Ruis, H. (1993) EMBO J. 12, 1997-2003 [Medline] [Order article via Infotrieve]
  36. Gounalaki, N., and Thireos, G. (1994) EMBO J. 13, 4036-4041 [Medline] [Order article via Infotrieve]
  37. Hottiger, T., De Virgilio, C., Bell, W., Boller, T., and Wiemken, A. (1992) Eur. J. Biochem. 210, 125-132 [Medline] [Order article via Infotrieve]
  38. Hirsch, H. H., Schiffer, H. H., and Wolf, D. (1992) Eur. J. Biochem. 207, 867-876 [Medline] [Order article via Infotrieve]
  39. Robinson, J. S., Klionsky, D. J., Banta, L. M., and Emr, S. D. (1988) Mol. Cell. Biol. 8, 4936-4948 [Abstract/Free Full Text]
  40. Heinemeyer, W., Gruhler, A., Möhrle, V., Mahe, Y., and Wolf, D. (1993) J. Biol. Chem. 268, 5115-5120 [Abstract/Free Full Text]
  41. Nwaka, S., Mechler, B., Destruelle, M., and Holzer, H. (1995) FEBS Lett. 360, 286-290 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
M. Jules, G. Beltran, J. Francois, and J. L. Parrou
New Insights into Trehalose Metabolism by Saccharomyces cerevisiae: NTH2 Encodes a Functional Cytosolic Trehalase, and Deletion of TPS1 Reveals Ath1p-Dependent Trehalose Mobilization
Appl. Envir. Microbiol., February 1, 2008; 74(3): 605 - 614.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. K. Conlin and H. C. M. Nelson
The Natural Osmolyte Trehalose Is a Positive Regulator of the Heat-Induced Activity of Yeast Heat Shock Transcription Factor
Mol. Cell. Biol., February 15, 2007; 27(4): 1505 - 1515.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
M. Jules, V. Guillou, J. Francois, and J.-L. Parrou
Two Distinct Pathways for Trehalose Assimilation in the Yeast Saccharomyces cerevisiae
Appl. Envir. Microbiol., May 1, 2004; 70(5): 2771 - 2778.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Sahara, T. Goda, and S. Ohgiya
Comprehensive Expression Analysis of Time-dependent Genetic Responses in Yeast Cells to Low Temperature
J. Biol. Chem., December 13, 2002; 277(51): 50015 - 50021.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
F. J. Alvarez-Peral, O. Zaragoza, Y. Pedreno, and J.-C. Arguelles
Protective role of trehalose during severe oxidative stress caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans
Microbiology, August 1, 2002; 148(8): 2599 - 2606.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. Hohmann
Osmotic Stress Signaling and Osmoadaptation in Yeasts
Microbiol. Mol. Biol. Rev., June 1, 2002; 66(2): 300 - 372.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
H. Iwahashi, S. Nwaka, and K. Obuchi
Evidence for Contribution of Neutral Trehalase in Barotolerance of Saccharomyces cerevisiae
Appl. Envir. Microbiol., December 1, 2000; 66(12): 5182 - 5185.
[Abstract] [Full Text]


Home page
Appl. Environ. Microbiol.Home page
P. Lucero, E. Peñalver, E. Moreno, and R. Lagunas
Internal Trehalose Protects Endocytosis from Inhibition by Ethanol in Saccharomyces cerevisiae
Appl. Envir. Microbiol., October 1, 2000; 66(10): 4456 - 4461.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Rep, M. Krantz, J. M. Thevelein, and S. Hohmann
The Transcriptional Response of Saccharomyces cerevisiae to Osmotic Shock. Hot1p AND Msn2p/Msn4p ARE REQUIRED FOR THE INDUCTION OF SUBSETS OF HIGH OSMOLARITY GLYCEROL PATHWAY-DEPENDENT GENES
J. Biol. Chem., March 17, 2000; 275(12): 8290 - 8300.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
H. Iwahashi, S. Nwaka, K. Obuchi, and Y. Komatsu
Evidence for the Interplay between Trehalose Metabolism and Hsp104 in Yeast
Appl. Envir. Microbiol., November 1, 1998; 64(11): 4614 - 4617.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
J. Cansado, T. Soto, J. Fernandez, J. Vicente-Soler, and M. Gacto
Characterization of Mutants Devoid of Neutral Trehalase Activity in the Fission Yeast Schizosaccharomyces pombe: Partial Protection from Heat Shock and High-Salt Stress
J. Bacteriol., March 1, 1998; 180(5): 1342 - 1345.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nwaka, S.
Right arrow Articles by Holzer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nwaka, S.
Right arrow Articles by Holzer, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.