![]()
|
|
||||||||
From the
The biological function of the trehalose-degrading yeast enzyme
neutral trehalase consists of the control of the concentration of
trehalose, which is assumed to play a role in thermotolerance, in
germination of spores, and in other life functions of yeast.
Resequencing of the neutral trehalase gene NTH1 on chromosome
IV resulted in the observation of two possible start codons (Kopp, M.,
Nwaka, S., and Holzer, H. (1994) Gene (Amst.) 150,
403-404). We show here that only the most upstream start codon
which initiates translation of the longest possible ORF is used for
expression of NTH1 in vivo. A gene with 77% identity with
NTH1, YBR0106, which was discovered during sequencing
of chromosome II (Wolfe, K. H., and Lohan, A. J. E. (1994) Yeast 10, S41-S46), is shown here to be expressed into mRNA.
Experiments with a mutant disrupted in the YBR0106 ORF showed,
in contrast to a NTH1 deletion mutant, no changes in trehalase
activity and in trehalose concentration. However, similar to the
NTH1 gene a requirement of the intact YBR0106 gene
for thermotolerance is demonstrated in experiments with the respective
mutants. This indicates that the products of the likely duplicated
YBR0106 gene and the NTH1 gene serve a heat shock
protein function. In case of the YBR0106 gene, this is the
only phenotypic feature found at present.
Trehalose is thought to play a role in thermotolerance and in
desiccation tolerance of yeast. It is furthermore supposed to serve as
a reserve carbohydrate during starvation and for germination of spores
(for reviews, see Refs. 1 and 2). Trehalose-hydrolyzing enzyme activity
in yeast was first described by Fischer
(3) . A ``neutral
trehalase'' with a pH optimum at 7 localized in the cytosol was
characterized by Londesborough and Varimo
(4) and isolated by
App and Holzer
(5) . The corresponding gene NTH1 was
cloned from Saccharomyces cerevisiae and sequenced by Kopp
et al. (6) . An ``acid trehalase'' with a pH
optimum at 4.5 localized in the vacuole was purified and characterized
by Mittenbühler and Holzer
(7) . The biological function of
trehalase assists in control of trehalose concentration via degradation
of trehalose. The rapid degradation of trehalose in intact cells when
recovering from heat stress
(8, 9, 10) is not
observed in mutant cells carrying a disrupted or a deleted gene of
neutral trehalase ( nth1
Recently,
Wolfe and Lohan
(11) described a gene, YBR0106,
located on chromosome II, whose predicted amino acid sequence showed
77% identity with the amino acid sequence predicted from the NTH1 gene published by Kopp et al. (6, 12) .
Because of the high identity of the predicted NTH1 and
YBR0106 gene products as well as the high homology of the
YBR0106 gene product to other trehalase sequences from a
variety of animals and bacteria, the YBR0106 gene was
designated a trehalase gene
(11) . However, expression and
function of the YBR0106 gene was not studied.
In the
present paper, we present studies on the expression of the YBR0106 gene. Furthermore, a role of the two genes NTH1 and
YBR0106 in thermotolerance is shown.
Yeast cells were grown on YEP medium (2% bacto-peptone
and 1% yeast extract) and supplemented with a carbon source as
indicated. Synthetic medium was prepared according to the method
described by Sherman et al. (13) . Escherichia coli (DH5
This plasmid was digested with
BglII, which has a unique site in this plasmid (at position
1.154 kb of the YBR0106 ORF). The URA3 gene isolated
as a BamHI fragment from plasmid YDpU
(18) was
inserted into the BglII site. The resulting plasmid bearing
the disruption of the YBR0106 ORF was digested with
HindIII prior to transformation into the wild type yeast
strains YS18 and YSN1 ( nth1
For overexpression
studies, the ORF previously reported for NTH1 (6) and
the corrected sequence
(12) were amplified by PCR using
synthetic oligonucleotide primers with BamHI recognition
sequences at the 5` ends. The sequence of forward primer for the
corrected NTH1 ORF sequence
(12) is
5`CGGGATCCATGAGTCAAGTTAATACAAGCCAAG3` and of the reverse primer is
5`CGGGATCCCTATAGTCCATAGAGGTTTCTTTCT3`. The sequence of the forward
primer for the previously reported NTH1 ORF
(6) is
5`CGGGATCCATGAGTGTTTTCGATAATGTATCTC3` and of the reverse primer is the
same as used for the corrected sequence above. In a PCR reaction, using
the above primers and plasmid pTZ18R
(6) (containing the
NTH1 gene and its flanking sequences as a 6-kb SalI
DNA fragment), fragments of 2.253 kb and 2.079 kb were generated as
seen on agarose gels. Similarly, the YBR0106 ORF was amplified
by PCR from genomic DNA of nth1
Thermotolerance abilities of cells were also checked on liquid
culture: the cells were grown to stationary phase on YEPD for 48 h at
30 °C, and an aliquot was taken for determination of cell survival.
The cells were then shifted to 50 °C for 20 min, and, after this
time, an aliquot was removed for determination of cell survival. Equal
dilutions of stationary cells before and after heat shock (50 °C
for 20 min) were plated onto YEPD plates and kept at 30 °C. After 3
days, the cells were counted and the percentage of survival was
calculated using the survival of non-heat-shocked cells as 100%
control.
To check a possible influence of the YBR0106 gene
on neutral trehalase activity and on trehalose metabolism, a disruption
of the YBR0106 gene was introduced into a wild type strain
YS18 as well as into strain YSN1 ( nth1
As expected from previous work
(5) , neutral
trehalase in wild type cells (SEY6211) showed a 3- to 10-fold increased
activity after preincubation of the extracts with cAMP/ATP. Neutral
trehalase activity in cells with a NTH1 deletion is not
detectable (, line 2). The strain YSN1A/p2.079 exhibits no
detectable activity (, line 4), while the strain
YSN1A/p2.253 showed several times higher activity under all conditions
studied when compared to the wild type (, line 3). Similar
results were also obtained using strains WCG4a/p2.253 and wild type
WCG4a (data not shown). Furthermore, we constructed the strain
YSN1A/pYBR and induced the overexpression of the YBR0106 gene
by growth on galactose. Consistent with the idea that the possible
YBR0106 gene product has no neutral trehalase activity, we
could not detect any significant neutral trehalase activity in
YSN1A/pYBR strain (, line 5).
Neutral trehalase (NTH) and acid trehalase (ATH)
specific activity in stationary cells of YS18 (wild type), YSN1
( nth1
Trehalose concentration
in exponentially growing cells of wild type YS18, YSN01
( ybr0106::URA3), YSN1 ( nth1
Neutral trehalase (NTH) specific activity in
exponentially growing cells of wild type SEY6211, YSN1A
( nth1
Thanks are due to Drs. Dieter Wolf, Wolfgang
Heinemeyer, Nikolaus Pfanner, Ernest Kun, and Bernd Mechler for
critical reading of the manuscript; to Drs. Daniel Klionsky, Monika
Destruelle, Dieter Wolf, and Wolfgang Heinemeyer for the gift of
strains; and to Dr. Kenneth Wolfe for the gift of plasmids. We also
thank Markus Burgert for technical assistance and Wolfgang Fritz for
help with the figures.
Volume 270,
Number 17,
Issue of April 28, pp. 10193-10198, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)
(6, 8) . Because
nth1 mutants show high activity of acid trehalase, this is
strong evidence for neutral trehalase, and not acid trehalase, being
the catalyst of hydrolysis of trehalose in intact cells.
Reagents
DNA restriction and modifying enzymes
were purchased from Boehringer Mannheim, Germany.
[
-P]dCTP and random priming kit were from
Amersham Buchler, Braunschweig, Germany and the U. S. Biochemicals
Corp. Biochemical reagents were purchased from Sigma, Deisenhofen, and
Boehringer Mannheim, Germany. Growth media were purchased from Difco
Laboratories.
Strains, Media, and Growth Conditions
The
genotypes and source of all strains used in this work are shown in
.
) strain was grown on LB medium (0.5% yeast extract, 1%
NaCl, 1% bacto-tryptone) and supplemented as required.
Plasmids, Gene Disruption, Overexpression Strategy, and
Yeast Strain Construction
Standard molecular and recombinant DNA
techniques were applied as described by Sambrook et al. (14) . Competent yeast cells were prepared by lithium
acetate, and transformation was as described by Ito et al. (15) . All plasmids were amplified in E. coli (DH5
) as described by Mandel and Higa
(16) . The
YBR0106 ORF was disrupted according to the one-step disruption
protocol described by Rothstein
(17) , using a
3.8-kb
(
)HindIII fragment (containing
2.37 kb from the 5`-noncoding region, plus a 1.43-kb 5` part of the
2.34-kb YBR0106 ORF) in pBluescript (a gift from Dr. K. Wolfe,
University of Dublin).
LEU2)
(8) to yield
strains YSN01 ( ybr0106::URA3) and YSN1-01
( nth1
LEU2/ybr0106::URA3), respectively. The disruption
was confirmed in uracil prototrophic transformants by Southern blot
analysis using HindIII-digested chromosomal DNA from these
strains and a 728-bp ( SfuI/BstEII) fragment from the
YBR0106 gene as a radiolabeled probe.
strain (YSN1) using the
following synthetic oligonucleotide primers,
5`CGGGATCCATGGTAGATTTTTTACCAAAAGTAACG3` and
5`CGGGATCCTAGGTAATACAATTTTTTCTCAGAGGGTTTC3` as forward and reverse
primers, respectively. These were subcloned behind the inducible
GAL1 promoter in a high copy 2µ-based plasmid (pYES2,
purchased from Invitrogen) to generate p2.253 (for the corrected
NTH1 ORF
(12) ), p2.079 (for the previously reported
NTH1 ORF
(6) ), and pYBR (for the YBR0106 ORF).
The sequence of the PCR cloned fragments was verified by sequence
analysis according to Ref. 19. A schematic representation of the
overexpression strategy is shown in Fig. 1.
Figure 1:
Strategy for overexpression of the
NTH1 and YBR0106 genes. The previously reported
NTH1 ORF (6), the corrected NTH1 ORF (12), and the
YBR0106 ORF (11) were amplified by PCR and cloned behind the
GAL1 promoter in the high copy plasmid pYES2 to give p2.079,
p2.253, and pYBR for the respective ORFs. These plasmids were
subsequently introduced into various strains as described under
``Materials and Methods.''
We introduced the
NTH1 deletion into SEY6211 (which is GAL)
according to Ref. 8 to get YSN1A ( nth1
LEU2) and
transformed it with p2.253, p2.079, and pYBR to get YSN1A/p2.253,
YSN1A/p2.079, and YSN1A/pYBR, respectively. Transformation was also
done in WCG4a to get WCG4a/p2.253, WCG4a/p2.079, and WCG4a/pYBR.
Blotting Procedure
For Southern blot analysis,
yeast cells were grown to stationary phase on YEPD. The cells were
converted to spheroplasts as described
(20) , lysed by SDS and
potassium acetate, and the DNA was precipitated and washed after RNase
digestion. The DNA was digested, subjected to agarose gel
electrophoresis, and blotted onto Amersham Hybond Hmembrane according to the manufacturer's instruction. For
Northern blot analysis, total RNA was isolated from exponential and
stationary phase cells according to Chirgwin et al. (21) . The total RNA was separated on a 1%
formaldehyde-agarose gel and transferred onto a Hybond
nylon membrane according to the manufacturer's instruction.
The DNA probes for Southern and Northern blot analysis were labeled
with [
-P]dCTP by the random priming method
(22) .
Trehalase and Trehalose Assay
For measurement of
trehalase activity, both the overlay assay on plates and assay with
samples from crude extracts were performed. The neutral trehalase
overlay assay was performed as described before
(6) . The acid
trehalase overlay assay was performed using the same method as for
neutral trehalase except that sodium citrate, 5 mM EDTA
buffer, pH 4.5, at 37 °C instead of 50 mM imidazole
chloride, pH 7.0, was used and there was no activation by the cAMP,
ATP, and MgCl
mixture
(5, 6, 7) .
Trehalase assay from crude extracts of the two enzymes was performed
according to Refs. 5 and 7, and total protein concentration was
determined by the method of Lowry et al. (23) .
Trehalose assay in boiled extracts from exponentially growing yeast
cells and heat-stressed cells was performed by using acid trehalase,
according to Kienle et al. (24) .
Heat Shock Treatment, Thermotolerance, and Determination
of Cell Survival
Yeast strains to be tested were streaked on
YEPD plates and incubated at 30 °C for 3 days. The cells were then
replica-plated onto fresh YEPD plates and transferred immediately to a
temperature of 50 °C for 7 h to 10 h. After this time, the cells
were shifted back to 30 °C, and growth was monitored daily. The
replica-plated cells treated at 45 °C for 2 days and shifted back
to 30 °C ( cf. Ref. 25) gave similar results as those cells
which underwent a 50 °C treatment for 7 h to 10 h.
Expression and Disruption of the YBR0106
Gene
Expression of the YBR0106 gene was checked by
Northern blot analysis using total RNA prepared from the NTH1 deletion mutant strain YSN1 ( nth1
LEU2). Using a
728-bp ( SfuI/ BstEII) fragment from the YBR0106 gene
(11) as a radiolabeled probe, a signal of about 2.6
kb was detected ( upper part of Fig. 2). The rRNA run in
parallel verified equal total RNA loaded on the gel ( lower part of Fig. 2).
Figure 2:
Northern blot analysis of the YBR0106 gene. Total RNA was prepared from NTH1 deletion strain
(YSN1) at two time points from exponentially growing cells on YEPD
( lane 1, OD= 1.5; lane 2,
OD
= 2.5) and stationary phase cells ( lane
3, OD
= 6; lane 4, OD
= 8). Using a 728-bp ( SfuI /BstEII)
fragment from YBR0106 (11) as a radiolabeled probe, a
YBR0106-specific RNA, corresponding to 2.6 kb can be seen in
the upper panel of the figure. The locations of 25 S (3.4 kb)
and 18 S (1.7 kb) rRNA species as visualized by ethidium bromide
staining are shown as control on the lower panel to confirm
that an equal concentration of RNA was loaded on the gel. Extraction of
RNA and Northern blot analysis were performed as described under
``Materials and Methods.''
This fits with the size of the ORF of the
YBR0106 gene (2.34 kb according to Ref. 11) plus possible
polyadenylation signals. It can also be seen from Fig. 2that the
expression of YBR0106 gene is low in exponential phase and
high in stationary or late exponential phase of cells growing on
glucose.
LEU2) to yield
strains YSN01 ( ybr0106::URA3) and YSN1-01
( nth1
LEU2/ybr0106::URA3), respectively. The disruption
was constructed in pBluescript containing a 3.8-kb HindIII DNA
fragment (part of which is a 1.43-kb 5` part of the YBR0106 gene). A 1.1-kb URA3 marker with BamHI ends
(18) was subcloned into the unique BglII site in the
YBR0106 gene part of the plasmid as described under
``Materials and Methods.'' Prior to introduction into the
respective yeast strains, the disruption plasmid was digested with
HindIII (to generate a 4.9-kb fragment containing the original
3.8-kb HindIII DNA fragment plus the 1.1-kb URA3 gene). In a Southern blot analysis, using
HindIII-digested genomic DNA from the mutant strains YSN01 and
YSN1-01 and control strain YSN1, and using a 728-bp
( SfuI/ BstEII) fragment from the part of the
YBR0106 gene in pBluescript as a radiolabeled probe, a
bandshift corresponding to the size of the URA3 marker was
seen in the mutants carrying the disrupted gene as compared to the
control strain.
Neutral Trehalase and Acid Trehalase Activity in ybr0106
Disruption Mutants
Activity of neutral trehalase with and
without preincubation with cAMP/ATP and of acid trehalase was assayed
in crude extracts of mutant cells and wild type cells after growth to
the late exponential phase. It can be seen from that
disruption of the YBR0106 gene has no influence on neutral
trehalase activity as compared to the wild type. In contrast, the
nth1 deletion mutant as well as a nth1/ybr0106 double
mutant, show no detectable neutral trehalase activity. As shown
previously
(5) , phosphorylation with cAMP/ATP increases neutral
trehalase activity in extracts from late stationary cells 2- to 3-fold
as expected. Acid trehalase activity is not changed by deletion of the
NTH1 gene
(6) ; the activity increases, however, 2-fold
in cells carrying the ybr0106 disruption. Consistent with
Wolfe and Lohan
(11) , we consider the YBR0106 gene not
to be the structural gene for acid trehalase. It might, however, be
that the YBR0106 gene is a negative regulatory factor for
expression of acid trehalase activity. In summary, it may be concluded
that the YBR0106 gene is transcribed to the corresponding
mRNA; however, its predicted translation product has no detectable
neutral trehalase activity at pH 7. The ``increased sensitivity to
heat shock'' of the ybr0106::URA3 described below
indicates, however, a translation product with possible heat shock
protein function.
Trehalose Concentration in Wild Type, ybr0106 Mutants,
and nth1 Mutants
Expression and function of the genes NTH1 and YBR0106 were also studied in intact cells by
measuring the degradation of trehalose upon shift of cells from the
heat stress at 40 °C (at which cells accumulate trehalose) to the
normal growth temperature of 30 °C
(8, 9, 10) . It may be seen from I
that trehalose degradation takes place in the ybr0106 disruption mutant to the same extent as in the wild type, whereas
in the nth1 deletion mutant as well as in the nth1/ybr0106 double mutant only a slight or no trehalose disappearance is
observed. These experiments with intact cells support the results
observed using cell extracts () showing that a ybr0106 disruption has no influence on neutral trehalase activity.
Overproduction of the Neutral Trehalase from
p2.253
Due to the close proximity of the start codon previously
reported for the NTH1 gene
(6) to the one found in the
corrected sequence of the NTH1 gene
(12) , we decided
to check (i) whether both start codons can be used for translation of
the NTH1 mRNA (translation of a gene from two neighbored
possible start codons has been shown before
(26, 27) )
or (ii) whether the N-terminal region of the gene is necessary for
activity of neutral trehalase. We therefore constructed the strains
YSN1A/p2.253 and YSN1A/p2.079. For definition of p2.253 and p2.079, see
``Materials and Methods.'' Neutral trehalase activities (with
and without preincubation with cAMP/ATP) of exponentially growing cells
on YEPGal medium (to induce the production of neutral trehalase from
the GAL1 promoter by galactose
(28) ) are presented in
.
Thermotolerance of the Trehalase Mutants under Heat
Shock
A possible role of the trehalase genes, YBR0106 and NTH1, in the heat shock response was analyzed both on
plates and in liquid cultures of stationary growing yeast cells. It can
be seen in Fig. 3, that stationary phase cells of wild type YS18
and mutants YSN01 ( ybr0106::URA3), YSN1
( nth1
LEU2), and YSN1-01
( nth1
LEU2/ybr0106::URA3) on YEPD plates treated at 50
°C for 7 h showed different growth or recovery patterns when
shifted back from 50 °C to 30 °C. A similar effect was seen
when the cells were treated at 45 °C for 2 days and shifted back
from 45 °C to 30 °C. These differences in recovery from the
high temperature treatment correlates to the presence or lack of either
the NTH1 gene or the YBR0106 gene or both. After
treatment at 50 °C for 7 h, wild type cells resume growth at 30
°C at a rate cells do without 50 °C treatment. In contrast, the
strains YSN1 ( nth1
LEU2), YSN01 ( ybr0106::URA3),
and YSN1-01 ( nth1
LEU2/ybr0106::URA3) showed an obvious
delay in resumption of normal growth. The thermotolerance of these
strains was also analyzed in liquid culture of stationary cells grown
on YEPD (for details, see ``Materials and Methods''). The
survival data are 50-59% for the single mutants, 42% for the
double mutants, and 77% for the wild type cells, which is in agreement
with the result of the experiments done on solid medium. It may be
emphasized that increased sensitivity to heat shock, i.e. a
heat shock protein function, is the only phenotypic property known at
present for the YBR0106 ``trehalase'' gene.
Figure 3:
Role of intact NTH1 and
YBR0106 genes for recovery after heat shock. The master plate,
represented with the number 1 (shown at the top of
the figure and used for all replica plating), contains cells grown on
YEPD to stationary phase of wild type YS18; YSN1
( nth1
LEU2); YSN1-01
( nth1
LEU2/ybr0106::URA3), two independent disruptants;
YSN01 ( ybr0106::URA3), two independent disruptants. The master
plate was replica-plated onto another YEPD plate (represented with the
number 2 at the bottom of the figure) and then
shifted to 50 °C for 7 h. After this time, the plates were shifted
back to 30 °C for 2 to 3 days.
A
similar result was recorded for exponentially growing NTH1 deletion mutant cells pretreated at 40 °C for 40 min and
heat-shocked at 50 °C for 10 or 20 min when wild type YS18 and
strain YSN1 ( nth1
LEU2) were compared (see in
Ref. 8).
Expression of NTH1 Gene
Discovery of a
N-terminal extension
(11, 12) of the previously
described gene NTH1 (6) raised the question whether
the corrected ORF with the nucleotide extension or the previous ORF
without extension was expressed in vivo. Experiments with the
corresponding plasmids show that only the corrected NTH1 ORF
is expressed yielding a protein with catalytic neutral trehalase
activity (). We therefore identify the nucleotide sequence
of the corrected ORF with `` NTH1'' (see the
registration at the GenBank/EMBL Data Bank, accession
number X65925). A strong overexpression of neutral trehalase activity
was observed in the transformed strain YSN1A/p2.253 (see
). This feature may be useful for preparation of neutral
trehalase with probably higher yield than in previous preparations from
the ABYS mutant strain
(5) . The existence of two
phosphorylation sites close to the N terminus are, in addition to the
high identity of 77% of the amino acid sequence and 72% at nucleotide
sequence level (according to computer analysis), characteristic
properties indicating similarity of YBR0106 and NTH1.
These similarities, as well as the localization of the two genes
adjacent to the centromeres on the right arm of chromosomes II and IV,
respectively, support the proposal of origination of the central parts
of chromosomes II and IV from duplication of an ancestral chromosome
(11) .
Expression of YBR0106 Gene
As shown with Northern
blot analysis, expression of YBR0106 clearly leads to the
corresponding mRNA under glucose derepressing conditions
(Fig. 2). Whether a catalytically active trehalose-degrading
protein, the enzyme trehalase, is actually formed by translation of the
mRNA is very questionable: a ybr0106::URA3 disruption mutant
strain does not show any change in trehalose degradation or in
trehalose levels as compared to the wild type strain under different
conditions. The only phenotypic characteristic for the YBR0106 disruption mutant discovered, until now, is an increased
sensitivity against heat shock at 50 °C as compared to wild type
(see Fig. 3). The decreased thermotolerance, i.e. the
heat shock protein function of the YBR0106 gene, may perhaps
be used for screening of YBR0106 suppressors.
Catabolite Repression of YBR0106 Gene
From the
Northern blots shown in Fig. 2, it may be seen that expression of
mRNA transcribed from YBR0106 is much higher in stationary
phase cells as compared to exponentially growing cells. The dependence
of gene expression on the presence of glucose in the culture medium is
typical for genes which are under control of ``catabolite
repression'' also called ``glucose repression''
(29, 30, 31) . In yeast, besides several key
enzymes of gluconeogenesis
(31) , neutral trehalase
(5) and acid trehalase
(7) also are subject to
catabolite repression. Repression by glucose generally points to a
biologically significant function of the respective enzymes in glucose
metabolism. A biological function of the glucose regulated
``silent trehalase'' YBR0106 may consist of making
glucose available from trehalose or other carbohydrates under special
growth conditions. We are planning more detailed experiments on
catabolite repression and catabolite inactivation
(32) of the
predicted YBR0106 gene product. Because up to now no influence
of YBR0106 on trehalose levels could be detected, we also
intend to search for hydrolytic activity of the predicted YBR0106 protein with substrates other than trehalose under varying
conditions.
Influence of the Genes NTH1 and YBR0106 on
Thermotolerance
The results shown in Fig. 3clearly
demonstrate that the trehalase genes NTH1 and YBR0106 may play an important role in thermotolerance as well as in aiding
yeast cells for fast recovery from heat shock. This role of the
trehalases in enhanced thermotolerance does not occur via trehalose
accumulation, otherwise one would have seen the opposite effect in the
NTH1 defective mutant (which does not hydrolyze trehalose)
when compared to the wild type or in the YBR0106 defective
mutant which behaves like wild type in terms of trehalose hydrolysis.
Although stationary phase cells are thermotolerant and show high
trehalose concentration
(8, 9, 10) , they also
exhibit high neutral trehalase activity and a high mRNA expression of
the YBR0106 gene (Fig. 2). Therefore, the ability to
acquire thermotolerance of the strains shown in Fig. 3can only
be correlated to the trehalases and not to the trehalose concentration.
This is another example of lack of correlation between trehalose
concentration and increase in thermotolerance
(8, 33) .
In this context, it may be of interest that the newly described
stress-regulated element called STRE (CCCCT)
(34, 35, 36) exists in the promoter region of the NTH1 and the
YBR0106 genes which are induced at heat stress
(41) .
This element alone has been shown to regulate the stress-induced
expression of the CTT1 gene
(35) , DDR2 gene
(34) , and TPS2 gene
(36) . Hottiger et al. (37) have proposed a possible interaction between neutral
trehalase and heat shock protein 70 (Hsp70) under heat shock conditions
as a mechanism that protects neutral trehalase from thermal
denaturation and misfolding. Therefore, it may be that interaction of
the trehalases with heat shock proteins is part of the stress response
mechanism.
Table:
Neutral trehalase and
acid trehalase activity in ybr0106 mutants compared to nth1 mutants and
wild type YS18
LEU2), YSN01 ( ybr0106::URA3), and
YSN1-01 ( nth1
LEU2/ybr0106::URA3). NTH
activity assay was done with and without preincubation with a cAMP/ATP
mixture at pH 7, while ATH assay was done without preincubation with of
a cAMP/ATP mixture at pH 4.5. Details concerning growth conditions,
preparation of crude extract, and assay conditions are as described
under ``Materials and Methods.'' Activity of purified NTH (5)
at pH 4.5 is <1% of the activity at pH 7. Activity of purified ATH
(7) at pH 7 is <5% of the activity at pH 4.5.
Table:
Change in trehalose concentration at recovery
(30 °C) from mild heat stress (40 °C) in ybr0106 mutants
compared to nth1 mutants and wild type YS18
LEU2), and
YSN1-01 ( nth1
LEU2/ybr0106::URA3) at mild
heat stress and recovery from stress at 30 °C. Details concerning
growth conditions, heat treatment, extraction of trehalose, and
trehalose assay are as described under ``Materials and
Methods.''
Table:
Neutral trehalase activity in
exponentially growing wild type and cells transformed with p2.253,
p2.079, and pYBR
LEU2), YSN1A/p2.253
( nth1
LEU2+p2.253), YSN1A/p2.079
( nth1
LEU2+p2.079), and YSN1A/pYBR
( nth1
LEU2+pYBR) on galactose before and
after preincubation with cAMP/ATP mix. Details concerning growth
conditions, preparation of crude extract, and neutral trehalase assay
conditions are as described under ``Materials and Methods.''
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. Jules, G. Beltran, J. Francois, and J. L. Parrou New Insights into Trehalose Metabolism by Saccharomyces cerevisiae: NTH2 Encodes a Functional Cytosolic Trehalase, and Deletion of TPS1 Reveals Ath1p-Dependent Trehalose Mobilization Appl. Envir. Microbiol., February 1, 2008; 74(3): 605 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Conlin and H. C. M. Nelson The Natural Osmolyte Trehalose Is a Positive Regulator of the Heat-Induced Activity of Yeast Heat Shock Transcription Factor Mol. Cell. Biol., February 15, 2007; 27(4): 1505 - 1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jules, V. Guillou, J. Francois, and J.-L. Parrou Two Distinct Pathways for Trehalose Assimilation in the Yeast Saccharomyces cerevisiae Appl. Envir. Microbiol., May 1, 2004; 70(5): 2771 - 2778. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sahara, T. Goda, and S. Ohgiya Comprehensive Expression Analysis of Time-dependent Genetic Responses in Yeast Cells to Low Temperature J. Biol. Chem., December 13, 2002; 277(51): 50015 - 50021. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Alvarez-Peral, O. Zaragoza, Y. Pedreno, and J.-C. Arguelles Protective role of trehalose during severe oxidative stress caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans Microbiology, August 1, 2002; 148(8): 2599 - 2606. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hohmann Osmotic Stress Signaling and Osmoadaptation in Yeasts Microbiol. Mol. Biol. Rev., June 1, 2002; 66(2): 300 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iwahashi, S. Nwaka, and K. Obuchi Evidence for Contribution of Neutral Trehalase in Barotolerance of Saccharomyces cerevisiae Appl. Envir. Microbiol., December 1, 2000; 66(12): 5182 - 5185. [Abstract] [Full Text] |
||||
![]() |
P. Lucero, E. Peñalver, E. Moreno, and R. Lagunas Internal Trehalose Protects Endocytosis from Inhibition by Ethanol in Saccharomyces cerevisiae Appl. Envir. Microbiol., October 1, 2000; 66(10): 4456 - 4461. [Abstract] [Full Text] |
||||
![]() |
M. Rep, M. Krantz, J. M. Thevelein, and S. Hohmann The Transcriptional Response of Saccharomyces cerevisiae to Osmotic Shock. Hot1p AND Msn2p/Msn4p ARE REQUIRED FOR THE INDUCTION OF SUBSETS OF HIGH OSMOLARITY GLYCEROL PATHWAY-DEPENDENT GENES J. Biol. Chem., March 17, 2000; 275(12): 8290 - 8300. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iwahashi, S. Nwaka, K. Obuchi, and Y. Komatsu Evidence for the Interplay between Trehalose Metabolism and Hsp104 in Yeast Appl. Envir. Microbiol., November 1, 1998; 64(11): 4614 - 4617. [Abstract] [Full Text] |
||||
![]() |
J. Cansado, T. Soto, J. Fernandez, J. Vicente-Soler, and M. Gacto Characterization of Mutants Devoid of Neutral Trehalase Activity in the Fission Yeast Schizosaccharomyces pombe: Partial Protection from Heat Shock and High-Salt Stress J. Bacteriol., March 1, 1998; 180(5): 1342 - 1345. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |