![]()
|
|
||||||||
From the
T cells express multiple isotypes of protein kinase C (PKC) and
although it is well accepted that PKCs have an important role in T cell
activation, little is known about the function of individual PKC
isotypes. To address this issue, mutationally active PKC-
T cell activation via the T cell antigen receptor is associated
with the hydrolysis of inositol phospholipids and the resultant
production of inositol polyphosphates and diacylglycerols that regulate
intracellular calcium and protein kinase C (PKC),
PKC can regulate T cell activation
genes via control of transcription factors. For example, in the
interleukin 2 gene enhancer, the PKC responsive elements include sites
for NF-KB, AP-1, and nuclear factor of activated T cells, NF-AT-1
(2, 7) . The PKC controlled signaling pathways that
regulate these transcription factors are not fully characterized but
may involve the guanine nucleotide binding protein p21, and the
mitogen-activated protein kinases such as ERK2 and JNK1
(8, 9) . T cells express multiple isotypes of PKC
including PKC-
One
approach to explore the role of a signaling molecule in T cells is to
look at the functional consequences of transfecting cells with mutated
constitutively active signal transduction molecules
(12, 13, 14) . PKC consists of a
carboxyl-terminal catalytic domain and an NH
Accordingly, to examine the role of PKC in T cell activation, we
have determined the consequences of expressing pseudosubstrate mutated
PKC-
In an attempt to identify which isotype of PKC
could be involved in the induction of the CD69 molecule in T cells,
plasmids encoding the different PKC mutants were transfected in Jurkat
cells and the expression of CD69 monitored by FACS analysis. Results of
a representative experiment are shown in Fig. 5. Optimal
conditions to follow the induction of CD69 by a transfected plasmid
were established by using the constitutively active v -src construct. Fig. 5 a shows that the JH6.2 subclone of
Jurkat does not express CD69 in the absence of stimulus but PDBu is
able to induce CD69 expression. In cells transfected with v -src, a subpopulation of cells can be seen to express CD69 to levels
comparable to that seen in the PDBu-stimulated cells. Phorbol esters
will activate all of the Jurkat cells, whereas the efficiency in
transient transfection protocols means that only a subpopulation of
cells will express the activated Src mutants. Thus in each experiment,
cells were transfected with an expression construct encoding a
truncated rat CD2 antigen as a surface tag. The transfection efficiency
can then be estimated by fluorescence analysis of rat CD2 expression.
In the experiment shown in Fig. 5, the transfection efficiency
from the CD2 analysis was 35% (Fig. 5 b) and in the
v- src transfected cells (Fig. 5 c), a comparable
percentage of the cells became CD69 positive, with a mean fluorescence
intensity similar to that seen with PDBu-stimulated cells
(Fig. 5 a). Expression of activated p21 also induced CD69
expression (Fig. 5 d) so that approximately 15% of cells
became CD69 positive. CD3 expression was not affected by transfection
of v -src or v-Ha -ras (data not shown). The weaker
effect of v-Ha -ras compared to v -src was consistently
observed in seven experiments. There was no synergy between phorbol
ester and ionomycin or activated Ras and ionomycin for CD69 expression.
CD69 induction was never observed in response to PKC-
The present series of experiments have explored the ability
of constitutively active pseudosubstrate mutated variants of PKC-
One aim of the present study was to see whether PKC-
In T cells, phorbol
esters and DAGs stimulate the accumulation of ``active''
p21-GTP complexes in a PKC-dependent response
(32) . This
observation, combined with a requirement for Ras function for phorbol
ester regulation of interleukin 2 gene expression
(8) led to
the idea that PKC functioned upstream of p21 in T lymphocytes. The
relationship between PKC and Ras in other cell lineages is more
complicated, particularily in fibroblasts, where it has been suggested
that PKC may function both upstream and downstream of Ras. In the
present study, we have compared the effect of a constitutively active
Ras protein and constitutively active PKC-
p21 controlled signaling pathways are
necessary for regulating surface levels of the CD69 antigen and thus
transfection of p21
In conclusion, it has been known for several years
that T cells express multiple isoforms of PKC. The present study has
shown that phorbol ester regulation of the transcriptional factors AP-1
and NF-AT-1 can be mimicked by constitutively active PKC-
Volume 270,
Number 17,
Issue of April 28, pp. 9833-9839, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
, -
, and -
in T Cell Activation
(*)
, -,
or -
have been transfected into T cells and the consequences for T
cell activation determined. p21 plays an essential role in T cell
activation. Accordingly, the effects of the constitutively active PKCs
were compared to the effects of mutationally activated p21. The data
indicate that PKC-
and, to a lesser extent PKC-
but not
-, can regulate the transcription factors AP-1 and nuclear factor
of activated T cells (NF-AT-1). The ability of PKC-
to induce
transactivation of NF-AT-1 and AP-1 was similar to the stimulatory
effect of a constitutively activated p21. PKC-
, but not PKC-
nor activated p21, was able to induce NF-KB activity. Phorbol esters
induce expression of CD69 whereas none of the activated PKC isotypes
tested were able to have this effect. Activated Src and p21 were able
to induce CD69 expression. These results indicate selective functions
for different PKC isotypes in T cells. Moreover, the data comparing the
effects of activated Ras and PKC mutants suggest that PKC-
, p21,
and PKC- are not positioned linearly on a single signal
transduction pathway.
(
)
respectively
(1, 2) . The term PKC refers to
a family of closely related serine/threonine protein kinases for which
at least 11 isotypes have been described
(3) . These isotypes
can be classified according to their structure and cofactor
requirements for activation. They are all activated by phospholipids
and, with notable exceptions, diacylglycerol (DAG) via an allosteric
mechanism. However, they differ markedly in their sensitivity to
Ca. PKC-
, -
1, -
2, and - are
dependent on Ca
for activity, whereas PKC-
,
-
, -
, and -
are not. PKC-
typifies a third group
of PKC isotypes (
,
,
) which also structurally belong to
the PKC family, but atypically are not activated by phorbol esters or
DAGs
(4) . A fourth group of enzymes has been described recently
that bind DAG/phorbol esters and have structural homologies with the
PKC family, but have unusual catalytic domains
(5, 6) .
PKC isotypes have different substrate specificity in vitro suggesting that a particular PKC isotype may have a precise
cellular function that reflects its cellular localization and substrate
preferences in vivo.
, -
1 (not -
2), -, -
, -
,
-
, and -
(3, 10) and understanding the role
of these different isotypes of PKC in transcription factor regulation
is a major challenge. In particular, one complication is that most
conclusions regarding the role of PKC in T cell activation are based on
experiments that examine the effects of phorbol esters or synthetic
DAGs which simultaneously activate multiple isotypes of PKC. Moreover,
it cannot be excluded that phorbol esters may activate directly non-PKC
signaling pathways. For example, phorbol esters can bind to molecules
other than PKCs such as n-chimaerin
(11) .
-terminal
regulatory domain. The activity of the catalytic domain is inhibited by
a pseudosubstrate motif within the regulatory domain
(15) .
Mutational activation of PKC by complete truncation of the regulatory
domain generates a constitutively active PKC that can contribute to T
cell activation
(14) but has lost substrate specificity
(4) . A more refined mechanism for mutationally activating PKC
is to make a single point mutation in the PKC pseudosubstrate sequence
(16) that disrupts the interaction between the catalytic site
and the pseudosubstrate sequence, but retains the regulatory domain
that helps determine substrate specificity. Such PKC mutants can be
used to examine directly the functional effects of an individual PKC
isotype, independent of the effects of phorbol esters or DAGs.
, PKC-, and PKC-
. These three isotypes were selected
because they are representative of the three major subdivisions in the
PKC family. As well, analysis of PKC translocation has suggested that
both PKC-
and PKC- are regulated during T cell activation by
phorbol esters
(17) . Of the many diverse PKC responses that
could be explored in this type of analysis, we chose to look at the
regulation of three transcription factors that appear PKC responsive on
the basis of phorbol ester experiments: AP-1, NF-AT-1, and NF-KB. We
also looked at the effects of the different PKC isotypes on expression
of the cell surface antigen CD69. Finally, the effects of the PKC
mutants in T cells was compared with the effects of v -src, a
constitutively active tyrosine kinase, and constitutively active p21,
v-Ha -ras.
Reagents
Ionomycin (Casalt)
and phorbol 12,13-dibutyrate were from Calbiochem Corp. (United
Kingdom). UCHT-1 (reactive with CD3) was used at 10 µg/ml in
culture. [
C]Acetyl coenzyme A (at 50-60
mCi/mmol) was from Amersham International (Buckinghamshire, UK). Other
reagents were from Sigma. Specific antisera against the different PKC
isotypes were raised against the COOH-terminal peptide from the
proteins. Monoclonal antibodies against rat CD2 (OX-34) or p85 were
purified from hybridoma supernatants. Rabbit anti-mouse and goat
anti-rabbit antibodies were from Amersham International. Fluorescein
isothiocyanate-labeled monoclonal antibodies anti-CD69
(Leu-FITC, IgG
) are from Becton Dickinson
(Mountain View, CA).
Plasmid Constructs
Reporter constructs; NF-KB-CAT:
contains 3 copies of the sequence for the NF site
(AGCTTGGGACTTTCCATGGGACTTTCCTAGGGATTCCCC), and AP-1-CAT contains 3
copies of the sequence for the AP-1 site
(AGCTATGAGTCTCAGTGATCAGTGAGTCA). These sequences have been inserted in
pBLCAT2 to generate NF-KB-CAT and AP-1-CAT, respectively
(18) .
NF-AT-CAT contains 3 copies of the sequence 5` corresponding to the
sequence from positions 284 to
258 relative to the start
of transcription of the interleukin 2 gene, upstream of the interleukin
2 minimal promoter driving the reporter gene CAT. This sequence has
been identified as the binding site for NF-AT-1, the ARRE-2 site of the
human interleukin 2 enhancer
(19) .
PKC Mutants and Active Oncogene Containing
Plasmids
The pMT-2 vector was used to express PKC-
(20) and PKC-
(21) and the pCO
vector
was used to express PKC-
(22) . The constitutively active
PKC clones are full-length
, , and
cDNAs with a single
point mutation in their inhibitory pseudosubstrate sequences within the
regulatory domain. Mutants in the pseudosubstrate sequence were
generated by substitution of a glutamic acid for an alanine in position
25 (PKC-
E25), position 159 for PKC- (PKC-
E159), and
position 119 for PKC-
(PKC-
E119). The PKC-
and PKC-
mutants are known to be constitutively active in vivo and
in vitro (16, 23, 24) . The wild type
(wt) counterparts of these mutants PKC-
wt, PKC- wt, and
PKC-
wt, were included in the experiments as controls. Other
plasmids directing expression of constitutively active p21
(pEF Ras), v -raf (pEF Raf), and v -src (pEF Src)
were used and are described elsewhere
(13) . The CMVrCD2
construct contains a cytoplasmic domain truncated version of the rat
CD2 gene
(25) . All plasmids were purified by equilibrium
centrifugation in CsCl/ethidium bromide gradients using standard
procedures.
Cells and Transfections
JH6.2, a subline of the
human T acute lymphocytic lymphoma cell line Jurkat
(26) , was
maintained in RPMI supplemented with 10% heat inactivated fetal calf
serum, at 37 °C in 5% C0
in humidified air. Cells were
transfected via electroporation (gene pulser: Bio-Rad, UK) according to
the manufacturer's instructions. Briefly, cells were pulsed
(10
cells/0.5 ml) in complete medium at 960 microfarads and
340 mV. Cells transfected with similar plasmid mixtures were pooled and
re-aliquoted before stimulation. Transfected cultures were cultured and
stimulated as indicated. Conditions and quantities of DNA for
transfection were optimized for each plasmid and each plasmid
preparation. Transfection efficiencies ranged from 20 to 35%. For the
reporter constructs AP-1, NF-KB, and NF-AT-1, between 0.5 and 20 µg
of DNA/10
cells was used. For v -src and
v-Ha- ras and PKC expression constructs, 5-25 µg of
DNA/10
cells was used.
Western Blots Analysis
Total cell lysates were
resolved on SDS-polyacrylamide gel electrophoresis. Proteins were
transferred to polyvinylidine difluoride membranes (Immobilon,
Millipore) by overnight Western blot. Membranes were immersed in
PBS/Tween 20, 0.5%, (PBST) plus 5% milk for 2 h to block nonspecific
binding. Anti-PKC isotype antisera or p85
antibodies were diluted
1/3,000 to 1/5,000 in PBST + 1% milk and were allowed to react
with the membrane overnight at 4 °C. After extensive washes,
membranes were incubated with a 1/15,000 dilution of goat anti-rabbit
IgG antibodies (for PKC immunsera) or rabbit anti-mouse Ig (for p85
antibodies) in PBST for 1 h at room temperature. After the washes in
PBST and PBS, membrane bound antibodies were visualized by use of ECL
Western blotting detection reagents (Amersham) and Kodak XS1 films.
CAT Assays
CAT assays were performed as described
previously
(12) . Briefly, 10
cells were lysed in 50
µl of 0.5% Nonidet P-40, 10 mM Tris, pH 8, 1 mM
EDTA, 150 mM NaCl for 10 min on ice. Cellular debris as
pelleted and the lysates heated at 68 °C for 10 min before use.
Assay conditions were 150 mM Tris, pH 8, 0.05 µCi of
[
C]acetyl coenzyme A, and 2 mM
chloramphenicol. Chloramphenicol was extracted with ethyl acetate, and
the amount of radioactivity in the acetylated products and
nonacetylated substrate of each reaction was determined by liquid
scintillation counting of organic and aqueous phases, respectively. The
percentage of chloramphenicol acetylation is calculated and results are
presented as such or as -fold increase of the control response.
FACS Analysis
Cells were incubated with
FITC-conjugated Leuantibodies (human CD69) for 30 min at
4 °C and then washed three times in PBS containing 4% fetal calf
serum prior to analysis with a FACScan fluorocytometer (Becton
Dickinson). For analysis of rat CD2 and human CD3 antigens, cells were
incubated with 5 µg/ml OX-34 (rat CD2) or UCHT-1 (human CD3)
antibodies for 30 min at 4 °C, washed, and thereafter incubated
with fluorescein isothiocyanate-conjugated rabbit anti-mouse
immunoglobulin for 30 min at 4 °C, prior to FACS analysis.
Propidium iodide was used to exclude dead cells from analysis.
PKC-
In fibroblasts, expression of
pseudosubstrate mutated PKC-
and PKC- Are Able to Induce AP-1
Activity in Jurkat Cells
has been shown to induce AP-1
activity
(16) . To assess the ability of the mutated
constitutively active PKC-
, -, and -
to induce the
transcription factor AP-1 in T cells, we employed transient
transfection protocols and quantitation of the expression of a CAT
reporter gene whose activity is regulated by a trimer of the AP-1
binding site. Jurkat cells were cotransfected with the AP-1-CAT
construct plus one of the expression constructs encoding the different
PKC isotypes. The samples were harvested 18 h after transfection and
the induction of AP-1-CAT activity was determined (Fig. 1). Basal
AP-1 activity measured in T cells, in the absence of stimulus, is low
and PDBu induced a 6-8-fold increase in the AP-1 activity
(Fig. 1 A). In parallel experiments and as a positive
control, cotransfection of a constitutively active Ras mutant,
p21
, induced a level of AP-1 activity comparable to the
level of PDBu induced AP-1 activity. Similarily cotransfection of
v -src, a constitutively active protein tyrosine kinase
resulted in transactivation of AP-1 (Fig. 1 A). When PKC
mutants were cotransfected with AP-1 in an identical procedure,
PKC-
E159 and PKC-
E25 were found to transactivate the AP-1-CAT
reporter construct. PKC-E159 induced a level of AP-1-CAT
comparable to that seen in phorbol ester-stimulated cells, whereas
PKC-
E25 was consistently less effective (Fig. 1 B).
The data in Fig. 1 C compare the kinetics of AP-1
induction in response to PKC-
E25 and PKC-E159 mutants and
show that the kinetics of AP-1 induction by the two isotypes are
similar in Jurkat cells. AP-1-CAT activity was not regulated by the
PKC-
E119 mutant nor by cotransfection of expression plasmid
encoding wild type PKC-
, -, or -
. Increasing the amount
of the PKC-
E119 expression vector used in the experiments had no
effect on AP-1 activity at any time point tested (data not shown).
Figure 1:
The effect
of PKC-E159, PKC-
E25, and PKC-119 on AP-1
transcriptional activity. A, 10
Jurkat cells were
cotransfected by electroporation with the AP-1-CAT reporter construct
and the empty vector or a v -src or v-Ha -ras containing plasmids as described under ``Experimental
Procedures.'' Cells transfected with the empty vector were either
left unstimulated, or stimulated with 50 ng/ml PDBu immediately after
transfection for 18 h before extracts were made, and CAT reporter gene
activity was assessed. Data show fold increase of the control response
is the ratio of activity calculated as the percentage of conversion of
CAT activity in PDBu-stimulated cells, cells transfected with v -src or v-Ha -ras versus control unstimulated cells
transfected with the empty vector. Results from one experiment
representative of four are presented. B, the experiment was
carried out as in A except that one of a PKC-
, -,
-
mutant or wild type PKCs was cotransfected together with
AP-1-CAT reporter gene. The data shown are from one experiment
representative of seven experiments. For these seven experiments the
mean fold increase of the control response for PDBu-, PKC-
E25-,
and PKC-E159-treated cells was 10, 3, and 5, respectively.
C, cells were cotransfected with the AP-1-CAT reporter
construct and empty vector or PKC-
E25 or PKC-E159 plasmids.
Cells were either left unstimulated, or stimulated with 50 ng/ml PDBu
immediately after transfection. Cells were harvested at different time
points after transfection and the data show the CAT activity as
percentage conversion monitored from cell
extracts.
To determine whether the failure of the PKC-E119 mutant to
transactivate AP-1 was due to insufficient expression of the enzyme,
Western blot analysis of PKC isotypes in transfected cells was
performed. JH6.2 cells constitutively express PKC-
, -, and
-
. The point mutated PKC isotypes will migrate at a similar
molecular weight as the endogenous isotypes and have an identical
immunoreactivity as the endogenous enzyme. However, an increase in the
total cellular levels of the particular PKC isotype is an indication
that the transfected gene is efficiently transcribed and translated
into the final PKC product. The Western blots in Fig. 2show that
endogenous PKC-
, detected in control empty vector transfected
cells, migrates as an 80-kDa band. PKC-
E119 levels increased with
the time after transfection to reach a maximum level 16 h
post-transfection. This level was maintained for at least 24 h. The
failure of the PKC-
E119 mutant to transactivate AP-1 was thus not
due to insufficient expression of the enzyme.
Figure 2:
PKC-E119 is expressed in
pCO
-PKC-E119 transfected Jurkat cells. 10
Jurkat cells were transfected with PKC-E119 or the empty
vector and total cellular extracts prepared at the indicated time after
transfection. Western blots were performed as described under
``Experimental Procedures.'' The expression of the p85
subunit of phosphatidylinositol 3-kinase kinase, monitored to control
the loading of the gel, is shown in the bottom
panel.
Jurkat cells
constitutively express PKC-
and -. The functional effects of
the mutated PKC-
E25 and PKC-E159 were easy to demonstrate but
no increases in the total level of PKC-
and - were detected
in cells transfected with the PKC-
E25 and PKC-E159 mutants
(data not shown). Endogenous PKC-
and - are expressed at high
levels in Jurkat cells and these data suggest that the activated
mutants are expressed at a low level relative to the endogenous wild
type enzyme.
PKC-
The transcriptional factor NF-AT-1 is a complex of AP-1
and NF-ATp
(7) . There is a two-signal requirement for NF-AT-1
activation which reflects that calcium regulated signals induce NF-ATp
translocation from the cytosol to the nucleus, whereas PKC or p21 is
proposed to induce AP-1. The data in Fig. 3 A show that
the calcium ionophore ionomycin alone has a weak inductive effect on
NF-AT-1 but ionomycin and PDBu synergize for maximal activation.
Expression of v -src can substitute for both ionomycin and PDBu
signals and transactivate NF-AT-CAT. The constitutively active Ras
mutant, v-Ha -ras alone, has no inductive effect on NF-AT-1,
but can synergize with ionomycin for NF-AT-1 induction
(Fig. 3 A). To study the role of PKC in the induction of
an active NF-AT-1 complex, cotransfection experiments were carried out
using the PKC-
and PKC- Are Able to Induce NF-AT-1
Activity
E159, PKC-
E25, and PKC-E119 mutants. The
data in Fig. 3 B show that the PKC-
E159 and
PKC-
E25 mutants alone had no effect on NF-AT-1 activity but were
able to induce NF-AT-1 in the presence of ionomycin. Neither
PKC-E119, nor the wild type PKC-
, -, and -
isotypes
were able to induce significant NF-AT-CAT activity, either alone or in
combination with ionomycin. PKC is proposed to regulate NF-AT-1 via
effects on AP-1. The PKC-
E159 mutant was repeatedly more effective
than PKC-
E25 for NF-AT-1 induction, which is consistent with the
relative potency of these constructs on AP-1 activity shown in
Fig. 1
. In kinetic experiments, the synergy between ionomycin and
PKC-E159 and PKC-
E25 mutants for NF-AT-CAT induction were
readily detected 2 h after stimulation (Fig. 3 C).
Figure 3:
Constitutively active PKC-E159 and
PKC-
E25 but not PKC- 119 are able to synergize with ionomycin
to induce NF-AT-1 transcriptional activity. A,
10
Jurkat cells were cotransfected with NF-AT-CAT and either
the empty vector or v -src or v-Ha -ras expression
plasmids. After 12 h cells transfected with the empty vector were then
either left unstimulated or stimulated with 50 ng/ml PDBu and/or 0.5
µg/ml ionomycin for 8 h, before extracts were made and CAT reporter
gene activity was assessed. B, the experiment was carried out
as in A except that one of the PKC-
, -, -
mutant or wild type expression vector were cotransfected with NF-AT-CAT
as indicated. The data show CAT activity as percentage conversion and
are one representative experiment out of seven. C, cells were
cotransfected with the NF-AT-CAT reporter construct and PKC-
E25 or
PKC-E159 or PKC-
E119 plasmids. Cells were allowed to express
the PKC gene for 12 h and stimuli were then applied. Cells transfected
with the empty vector were either left unstimulated, or stimulated with
50 ng/ml PDBu plus ionomycin, while ionomycin alone was then added to
cells transfected with the PKCs mutants. Cells were harvested and
extracts made at different time points after stimulation. Results from
one representative experiment are presented.
PKC-
NF-KB,
a PKC-regulated transcription factor, is a heterodimer composed of 2
DNA binding subunits which are members of the rel family
(27) . To assess the ability of the different PKC isotypes to
transactivate NF-KB, PKC- Is Able to Induce NF-KB Activity
E159, PKC-
E25, and PKC-E119
expression constructs were cotransfected with an NF-KB-CAT construct.
The samples were harvested 18 h after transfection and CAT activity was
determined. As controls, cotransfection experiments were performed with
constitutively activated Ras, v-Ha -ras, and an activated
protein tyrosine kinase, v -src. The data in
Fig. 4
a show that NF-KB-CAT activity in unstimulated JH6.2 cells
can be increased 3-4-fold with phorbol ester stimulation.
Cotransfection of an activated tyrosine kinase v -src was also
able to increase NF-KB activity 2-3-fold, but constitutively
active v-Ha -ras had no significant effect. This was in marked
contrast to the strong transactivating effect of the Ras mutant on AP-1
and NF-AT-1 (Figs. 1 A and 3 A). As shown in
Fig. 4B, only PKC-
E159 was able to induce NF-KB
activity, and cotransfections carried out with the PKC-
E25 or
PKC-E119 mutants had no detectable effect on NF-KB-CAT activity.
In kinetic experiments, NF-KB activity was detected between 2 and 4 h
after transfection of PKC-
E159, whereas no significant effect of
PKC-
E25 or PKC-E119 mutants was detected at any time point
(Fig. 4 C).
Figure 4:
The effect of PKC-
, -, and
-
on NF-KB induction. A, 10
Jurkat cells were
cotransfected with NF-KB-CAT reporter construct and empty vector or
v -src or v-Ha -ras containing plasmids. Cells
transfected with the empty vector were either left unstimulated, or
stimulated with 50 ng/ml PDBu immediately after transfection for 18 h,
before extracts were made, and CAT reporter gene activity was assessed.
The data show fold increase in CAT activity relative to the control
response calculated as described in the legend to Fig. 1. Results from
one representative experiment are presented. B, the experiment
was carried out as in A except that PKC mutant or wild type
expression plasmids were cotransfected with NF-KB CAT. The data shown
are one representative experiment out of five. For these five
experiments the mean fold increase of the control response for PDBu or
PKC-E159 was 3- and 4-fold, respectively. C, cells were
cotransfected with NF-KB-CAT reporter construct and empty vector or
PKC-
E25 or PKC-E159 plasmids. Cells transfected with the
empty vector were either left unstimulated, or stimulated with 50 ng/ml
PDBu immediately after transfection. Cells were harvested at different
time points after transfection and CAT activity was
determined.
PKC-
The CD69 antigen is rapidly expressed at the cell
surface in response to triggering of the T cell receptor or activation
of T cells with phorbol esters
(28) . The effects of phorbol
ester led to the conclusion that PKC controls the surface expression of
CD69. It is now also recognized that p21 is involved in CD69 induction.
Thus transfection of a constitutively active Ras mutant into Jurkat
cells induces CD69 expression, whereas transfection of a dominant
negative Ras mutant prevents phorbol ester regulation of this surface
antigen
(25) .
, PKC-, PKC-
Are Unable to Induce CD69
Expression
E25,
PKC-E159, or PKC-
E119, either alone or in combination, or in
cells transfected with PKC mutants in combination with
v-Ha -ras. However, cells transfected with any PKC construct,
either active PKC or wt PKC, were still able to induce CD69 upon PDBu
treatment or T cell receptor-CD3 complex ligation (data not shown). In
all these experiments, the expression of functional constitutively
active PKC-
E25 or PKC-E159 was monitored by transactivation
of an AP-1-CAT reporter gene. It has been suggested that signals from
PKC and p21 converge to control the activity of the protein
serine/threonine kinase Raf-1
(29) ; we therefore examined the
functional effect of expressing a constitutively active Raf kinase,
partly to determine whether there were any intrinsic difficulties in
using activated protein serine/threonine kinases for the CD69 induction
assay. Preliminary experiments confirmed that a truncated Raf protein,
v -raf, could replace activated p21 or phorbol esters for
induction of AP-1 and NF-AT-1 in CAT assays. Expression of v -raf could also mimic the effect of v-Ha -ras for CD69
induction (Fig. 5 e).
Figure 5:
The effect of PKC-
, -, and
-
on CD69 expression. 10
Jurkat cells were transfected
with one of the expression vectors containing either a mutant or a wild
type PKC-
, -, -
, v -src, v-Ha -ras, rat
CD2, or with the empty vector. After transfection, cells were either
left unstimulated or stimulated with 50 ng/ml PDBu, 4 h after
transfection for 18 h. Cells were harvested, washed, and stained for
CD69 expression and histogram analysis of CD69 induction on the cell
surface are shown. Log of fluorescence intensity is measured on the
x axis and cell number on the y axis. Jurkat cells
transfected with rat CD2 were analyzed for rat CD2 expression in
b, while cells were stained with anti-CD69 antibodies in
panels a and c-h. Unstimulated cells transfected with
the empty vector are shown in the white histogram while cells
stimulated with PDBu ( a) or transfected with an active plasmid
( c-h) are shown in the black histogram. Staining is shown with
Jurkat cells transfected with the empty vector and with PDBu
stimulation ( a); c, cells transfected with
v -src; d, with v-Ha -ras; e, with
PKC-
E25 mutant; f, with PKC-E25 mutant; g,
with PKC-
E119 mutant. The data from one experiment are shown but
seven experiments were performed. The transfection efficiency based on
rat CD2 expression ranged from 30 to 38%; 33.5 ± 2.2% CD69
positive cells were induced in response to transfection with
v -src; 16.3 ± 6.3% CD69 positive cells were induced in
response to transfection with v-Ha -ras; 11.9 ± 1.3%
CD69 positive cells were induced in response to transfection with
v -raf; 1.2 ± 1.8% CD69 positive cells induced in
response to transfection with PKC-
E25; 1.5 ± 1.9% CD69
positive cells induced in response to transfection with PKC-E159;
2.2 ± 2.1% CD69 positive cells induced in response to
transfection with PKC-
E119.
,
PKC-, or PKC-
to regulate the activity of the transcriptional
factors AP-1, NF-AT-1, and NF-KB. Phorbol esters can stimulate AP-1
activity in T cells and synergize with calcium signals to regulate
NF-AT-1. The data show that the constitutively active mutants of
PKC-
and -, PKC-
E25, PKC-E159, can mimic phorbol
esters for both AP-1 and NF-AT-1 induction. However, the phorbol ester
effect on AP-1 and NF-AT-1 was not mimicked by mutated PKC-
.
Moreover, expression of the constitutively active PKC-
E119 alone
was not sufficient to induce any of the T cell responses examined and
this enzyme must therefore have a different role in T cells than the
phorbol ester/DAG regulated PKC isotypes such as PKC-
or -.
The failure of the activated PKC-
mutant to mimic phorbol ester in
T cell activation is not unexpected since this enzyme is not regulated
by phorbol esters, either in vitro or in vivo. However, the lack of response of PKC-
to phorbol esters does
not preclude that this enzyme might have some functional effects on T
cell activation which could reflect its involvement in the signal
transduction pathways controlled by other lipid second messengers. For
example, in vitro, PKC-
shares with other PKC isotypes
the ability to be regulated by the D-3 phosphoinositide
phosphatidylinositol 3,4,5-trisphosphate
(30) . As well,
experiments in fibroblasts using dominant negative mutants of PKC-
or overexpression of PKC-
wt have suggested a role for this PKC
isotype in NF-KB induction
(31) . The expression of
constitutively active PKC-
or the overexpression of PKC-
wt is
not sufficient for NF-KB transactivation in T cells which could reflect
that the mechanisms of NF-KB regulation in T cell and fibroblasts
differ.
and - have different functional effects in T cells. The data show
that the constitutively active PKC-
E25 and PKC-E159 have
similar effects on AP-1 and NF-AT-1 induction, but are different in
that PKC-
E159 could transactivate an NF-KB reporter gene, whereas
PKC-
E25 could not. PKC-
E25 was consistently less efficient
than PKC-E159 for transactivation of NF-AT-1 or AP-1. The
explanation for this difference is not known and it is possible that it
reflects that PKC-
E25 is less efficiently expressed than
PKC-E159, possibly due to intrinsic differences in the stability
of these two mutated PKC isotypes. This point was difficult to assess
since transfected PKC-
E25 and PKC-E159 could not be
dissociated from their endogenous (wild type) counterparts in Western
blot analysis. However, the differences between PKC-
E25 compared
to PKC-E159 for AP-1 and NF-AT-1 activation were at most 2-fold.
The sensitivity of the NF-KB assay would have allowed the detection of
a 2-fold difference in the effect of PKC-
E25 and PKC-E159.
Accordingly, it would seem that there is a real difference in the
relative ability of PKC-
E25 and PKC-E159 to regulate the AP-1
and NF-KB family of transcriptional factors.
and - mutants on T
cell responses. If either of these isotypes functioned directly
upstream or downstream of p21, then it would be expected that the
functional effects of the active PKC mutants, PKC-
E25 and
PKC-E159, would be the same as the effects of an
``activated'' Ras protein, p21
. For AP-1 and
NF-AT-1 induction, p21
, PKC-
E25, or PKC-E159
have comparable effects and can mimic the effect of phorbol esters.
However, PKC-
E159 could stimulate NF-KB, whereas the activated Ras
mutant could not, which indicates clearly that not all PKC functions in
T cells are mediated by p21.
alone into Jurkat cells results in
the expression of CD69
(25) . If PKC-
or - function
upstream of p21 then it would be predicted that cells transfected with
activated mutants of PKC would also express CD69. The data in the
present report show that phorbol ester treatment of T cells induces
CD69 as does transfection of v -src. Transfection of
v-Ha -ras is also able to induce CD69 in JH6.2 cells, although
consistently to a lesser extent than v -src. In contrast,
expression of PKC-
E25 and PKC-E159 failed to induce CD69
expression. The implication from these data are that phorbol ester
induction of CD69 is not mediated by PKC-
or PKC-, and
therefore is likely to be regulated by another PKC isotype or,
alternatively by another phorbol ester-dependent effector. Moreover,
the data suggest that neither PKC-
nor PKC- regulate the
activity of p21. In this context, p21 functions upstream of the protein
serine/threonine kinase Raf-1 in many cells, and thus cells expressing
constitutively activated Ras and Raf proteins have a similar phenotype.
In the present report, v-Ha -ras and v -raf have a
comparable effect on CD69 expression which illustrates that there is no
intrinsic problem associated with the induction of CD69 by a
constitutively active protein serine/threonine kinase. Thus the
simplest interpretation of differences between the functional effects
of v-Ha -ras and PKC-
E25 or PKC-E159 with regard to
CD69 induction is that these molecules are not positioned linearily in
the same signaling pathway. Nevertheless, their similar effects on AP-1
and NF-AT-1 induction indicated that there must be some point of
convergence of Ras and PKC-
/ signals. One such convergence
point for Ras and PKC could be at the level of the extracellular
signal-regulated or mitogen-activated protein kinase (ERKs/MAPKs)
cascade
(33, 34) . T cells express more than one member
of the mitogen-activated protein kinase family including ERK-2 and
JNK-1
(34, 35) . It is thus possible that p21 and
PKC-
and - activate AP-1 and NF-AT-1 via parallel pathways
that use different members of the mitogen-activated protein kinase
family. The point of convergence of the signaling pathways would thus
be in the nucleus at the level of transcriptional factor
phosphorylation.
and
-. PKC-
can transactivate NF-KB whereas PKC-
could not.
PKC- had no effect on AP-1, NF-AT-1, or NF-KB transactivation and
its role in T cells is not yet discovered. These experiments indicate
that different PKC isotypes may have selective physiological functions
in T cell responses.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
F. Maingrette, L. Li, and G. Renier C-reactive protein enhances macrophage lipoprotein lipase expression J. Lipid Res., September 1, 2008; 49(9): 1926 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Madgwick, M. Levasseur, and K. T. Jones Calmodulin-dependent protein kinase II, and not protein kinase C, is sufficient for triggering cell-cycle resumption in mammalian eggs J. Cell Sci., September 1, 2005; 118(17): 3849 - 3859. [Abstract] [Full Text] |
||||
![]() |
D. A. Dean Nonviral gene transfer to skeletal, smooth, and cardiac muscle in living animals Am J Physiol Cell Physiol, August 1, 2005; 289(2): C233 - C245. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tourkina, P. Gooz, J. Pannu, M. Bonner, D. Scholz, S. Hacker, R. M. Silver, M. Trojanowska, and S. Hoffman Opposing Effects of Protein Kinase C{alpha} and Protein Kinase C{epsilon} on Collagen Expression by Human Lung Fibroblasts Are Mediated via MEK/ERK and Caveolin-1 Signaling J. Biol. Chem., April 8, 2005; 280(14): 13879 - 13887. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cippitelli, C. Fionda, D. Di Bona, M. Piccoli, L. Frati, and A. Santoni Hyperthermia Enhances CD95-Ligand Gene Expression in T Lymphocytes J. Immunol., January 1, 2005; 174(1): 223 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Bogatkevich, E. Gustilo, J. C. Oates, C. Feghali-Bostwick, R. A. Harley, R. M. Silver, and A. Ludwicka-Bradley Distinct PKC isoforms mediate cell survival and DNA synthesis in thrombin-induced myofibroblasts Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L190 - L201. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Park, H. Wu, C. E. Killoran, and B. A. Gilchrest The receptor for activated C-kinase-I (RACK-I) anchors activated PKC-{beta} on melanosomes J. Cell Sci., July 15, 2004; 117(16): 3659 - 3668. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tourkina, P. Gooz, J. C. Oates, A. Ludwicka-Bradley, R. M. Silver, and S. Hoffman Curcumin-Induced Apoptosis in Scleroderma Lung Fibroblasts: Role of Protein Kinase C{epsilon} Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 28 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Bilyeu, G. R. Panta, L. G. Cavin, C. M. Barrett, E. J. Turner, T. W. Sweatman, M. Israel, L. Lothstein, and M. Arsura Circumvention of Nuclear Factor {kappa}B-Induced Chemoresistance by Cytoplasmic-Targeted Anthracyclines Mol. Pharmacol., April 1, 2004; 65(4): 1038 - 1047. [Abstract] [Full Text] |
||||
![]() |
J. Pardo, M. Buferne, M.-J. Martinez-Lorenzo, J. Naval, A.-M. Schmitt-Verhulst, C. Boyer, and A. Anel Differential implication of protein kinase C isoforms in cytotoxic T lymphocyte degranulation and TCR-induced Fas ligand expression Int. Immunol., December 1, 2003; 15(12): 1441 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Deeds, S. Teodorescu, M. Chu, Q. Yu, and C.-Y. Chen A p53-independent G1 Cell Cycle Checkpoint Induced by the Suppression of Protein Kinase C {alpha} and {theta} Isoforms J. Biol. Chem., October 10, 2003; 278(41): 39782 - 39793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Trushin, K. N. Pennington, E. M. Carmona, S. Asin, D. N. Savoy, D. D. Billadeau, and C. V. Paya Protein Kinase C{alpha} (PKC{alpha}) Acts Upstream of PKC{theta} To Activate I{kappa}B Kinase and NF-{kappa}B in T Lymphocytes Mol. Cell. Biol., October 1, 2003; 23(19): 7068 - 7081. [Abstract] [Full Text] [PDF] |
||||
|
|