JBC Biosymposia, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Genot, E. M.
Right arrow Articles by Cantrell, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Genot, E. M.
Right arrow Articles by Cantrell, D. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 17, Issue of April 28, pp. 9833-9839, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Analysis of the Role of Protein Kinase C-, -, and - in T Cell Activation (*)

Elisabeth M. Genot (1)(§), Peter J. Parker (2), Doreen A. Cantrell (1)(¶)

From the (1) Laboratories of Lymphocyte Activation and (2) Protein Phosphorylation, Imperial Cancer Research Fund, P. O. 123, Lincoln's Inn Fields, London WC2A 3PX, United Kingdom

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

T cells express multiple isotypes of protein kinase C (PKC) and although it is well accepted that PKCs have an important role in T cell activation, little is known about the function of individual PKC isotypes. To address this issue, mutationally active PKC-, -, or - have been transfected into T cells and the consequences for T cell activation determined. p21 plays an essential role in T cell activation. Accordingly, the effects of the constitutively active PKCs were compared to the effects of mutationally activated p21. The data indicate that PKC- and, to a lesser extent PKC- but not -, can regulate the transcription factors AP-1 and nuclear factor of activated T cells (NF-AT-1). The ability of PKC- to induce transactivation of NF-AT-1 and AP-1 was similar to the stimulatory effect of a constitutively activated p21. PKC-, but not PKC- nor activated p21, was able to induce NF-KB activity. Phorbol esters induce expression of CD69 whereas none of the activated PKC isotypes tested were able to have this effect. Activated Src and p21 were able to induce CD69 expression. These results indicate selective functions for different PKC isotypes in T cells. Moreover, the data comparing the effects of activated Ras and PKC mutants suggest that PKC-, p21, and PKC- are not positioned linearly on a single signal transduction pathway.


INTRODUCTION

T cell activation via the T cell antigen receptor is associated with the hydrolysis of inositol phospholipids and the resultant production of inositol polyphosphates and diacylglycerols that regulate intracellular calcium and protein kinase C (PKC),() respectively (1, 2) . The term PKC refers to a family of closely related serine/threonine protein kinases for which at least 11 isotypes have been described (3) . These isotypes can be classified according to their structure and cofactor requirements for activation. They are all activated by phospholipids and, with notable exceptions, diacylglycerol (DAG) via an allosteric mechanism. However, they differ markedly in their sensitivity to Ca. PKC-, -1, -2, and - are dependent on Cafor activity, whereas PKC-, -, -, and - are not. PKC- typifies a third group of PKC isotypes (, , ) which also structurally belong to the PKC family, but atypically are not activated by phorbol esters or DAGs (4) . A fourth group of enzymes has been described recently that bind DAG/phorbol esters and have structural homologies with the PKC family, but have unusual catalytic domains (5, 6) . PKC isotypes have different substrate specificity in vitro suggesting that a particular PKC isotype may have a precise cellular function that reflects its cellular localization and substrate preferences in vivo.

PKC can regulate T cell activation genes via control of transcription factors. For example, in the interleukin 2 gene enhancer, the PKC responsive elements include sites for NF-KB, AP-1, and nuclear factor of activated T cells, NF-AT-1 (2, 7) . The PKC controlled signaling pathways that regulate these transcription factors are not fully characterized but may involve the guanine nucleotide binding protein p21, and the mitogen-activated protein kinases such as ERK2 and JNK1 (8, 9) . T cells express multiple isotypes of PKC including PKC-, -1 (not -2), -, -, -, -, and - (3, 10) and understanding the role of these different isotypes of PKC in transcription factor regulation is a major challenge. In particular, one complication is that most conclusions regarding the role of PKC in T cell activation are based on experiments that examine the effects of phorbol esters or synthetic DAGs which simultaneously activate multiple isotypes of PKC. Moreover, it cannot be excluded that phorbol esters may activate directly non-PKC signaling pathways. For example, phorbol esters can bind to molecules other than PKCs such as n-chimaerin (11) .

One approach to explore the role of a signaling molecule in T cells is to look at the functional consequences of transfecting cells with mutated constitutively active signal transduction molecules (12, 13, 14) . PKC consists of a carboxyl-terminal catalytic domain and an NH-terminal regulatory domain. The activity of the catalytic domain is inhibited by a pseudosubstrate motif within the regulatory domain (15) . Mutational activation of PKC by complete truncation of the regulatory domain generates a constitutively active PKC that can contribute to T cell activation (14) but has lost substrate specificity (4) . A more refined mechanism for mutationally activating PKC is to make a single point mutation in the PKC pseudosubstrate sequence (16) that disrupts the interaction between the catalytic site and the pseudosubstrate sequence, but retains the regulatory domain that helps determine substrate specificity. Such PKC mutants can be used to examine directly the functional effects of an individual PKC isotype, independent of the effects of phorbol esters or DAGs.

Accordingly, to examine the role of PKC in T cell activation, we have determined the consequences of expressing pseudosubstrate mutated PKC-, PKC-, and PKC-. These three isotypes were selected because they are representative of the three major subdivisions in the PKC family. As well, analysis of PKC translocation has suggested that both PKC- and PKC- are regulated during T cell activation by phorbol esters (17) . Of the many diverse PKC responses that could be explored in this type of analysis, we chose to look at the regulation of three transcription factors that appear PKC responsive on the basis of phorbol ester experiments: AP-1, NF-AT-1, and NF-KB. We also looked at the effects of the different PKC isotypes on expression of the cell surface antigen CD69. Finally, the effects of the PKC mutants in T cells was compared with the effects of v -src, a constitutively active tyrosine kinase, and constitutively active p21, v-Ha -ras.


EXPERIMENTAL PROCEDURES

Reagents

Ionomycin (Casalt) and phorbol 12,13-dibutyrate were from Calbiochem Corp. (United Kingdom). UCHT-1 (reactive with CD3) was used at 10 µg/ml in culture. [C]Acetyl coenzyme A (at 50-60 mCi/mmol) was from Amersham International (Buckinghamshire, UK). Other reagents were from Sigma. Specific antisera against the different PKC isotypes were raised against the COOH-terminal peptide from the proteins. Monoclonal antibodies against rat CD2 (OX-34) or p85 were purified from hybridoma supernatants. Rabbit anti-mouse and goat anti-rabbit antibodies were from Amersham International. Fluorescein isothiocyanate-labeled monoclonal antibodies anti-CD69 (Leu-FITC, IgG) are from Becton Dickinson (Mountain View, CA).

Plasmid Constructs

Reporter constructs; NF-KB-CAT: contains 3 copies of the sequence for the NF site (AGCTTGGGACTTTCCATGGGACTTTCCTAGGGATTCCCC), and AP-1-CAT contains 3 copies of the sequence for the AP-1 site (AGCTATGAGTCTCAGTGATCAGTGAGTCA). These sequences have been inserted in pBLCAT2 to generate NF-KB-CAT and AP-1-CAT, respectively (18) . NF-AT-CAT contains 3 copies of the sequence 5` corresponding to the sequence from positions 284 to 258 relative to the start of transcription of the interleukin 2 gene, upstream of the interleukin 2 minimal promoter driving the reporter gene CAT. This sequence has been identified as the binding site for NF-AT-1, the ARRE-2 site of the human interleukin 2 enhancer (19) .

PKC Mutants and Active Oncogene Containing Plasmids

The pMT-2 vector was used to express PKC- (20) and PKC- (21) and the pCOvector was used to express PKC- (22) . The constitutively active PKC clones are full-length , , and cDNAs with a single point mutation in their inhibitory pseudosubstrate sequences within the regulatory domain. Mutants in the pseudosubstrate sequence were generated by substitution of a glutamic acid for an alanine in position 25 (PKC-E25), position 159 for PKC- (PKC-E159), and position 119 for PKC- (PKC-E119). The PKC- and PKC- mutants are known to be constitutively active in vivo and in vitro (16, 23, 24) . The wild type (wt) counterparts of these mutants PKC- wt, PKC- wt, and PKC- wt, were included in the experiments as controls. Other plasmids directing expression of constitutively active p21(pEF Ras), v -raf (pEF Raf), and v -src (pEF Src) were used and are described elsewhere (13) . The CMVrCD2 construct contains a cytoplasmic domain truncated version of the rat CD2 gene (25) . All plasmids were purified by equilibrium centrifugation in CsCl/ethidium bromide gradients using standard procedures.

Cells and Transfections

JH6.2, a subline of the human T acute lymphocytic lymphoma cell line Jurkat (26) , was maintained in RPMI supplemented with 10% heat inactivated fetal calf serum, at 37 °C in 5% C0in humidified air. Cells were transfected via electroporation (gene pulser: Bio-Rad, UK) according to the manufacturer's instructions. Briefly, cells were pulsed (10cells/0.5 ml) in complete medium at 960 microfarads and 340 mV. Cells transfected with similar plasmid mixtures were pooled and re-aliquoted before stimulation. Transfected cultures were cultured and stimulated as indicated. Conditions and quantities of DNA for transfection were optimized for each plasmid and each plasmid preparation. Transfection efficiencies ranged from 20 to 35%. For the reporter constructs AP-1, NF-KB, and NF-AT-1, between 0.5 and 20 µg of DNA/10cells was used. For v -src and v-Ha- ras and PKC expression constructs, 5-25 µg of DNA/10cells was used.

Western Blots Analysis

Total cell lysates were resolved on SDS-polyacrylamide gel electrophoresis. Proteins were transferred to polyvinylidine difluoride membranes (Immobilon, Millipore) by overnight Western blot. Membranes were immersed in PBS/Tween 20, 0.5%, (PBST) plus 5% milk for 2 h to block nonspecific binding. Anti-PKC isotype antisera or p85 antibodies were diluted 1/3,000 to 1/5,000 in PBST + 1% milk and were allowed to react with the membrane overnight at 4 °C. After extensive washes, membranes were incubated with a 1/15,000 dilution of goat anti-rabbit IgG antibodies (for PKC immunsera) or rabbit anti-mouse Ig (for p85 antibodies) in PBST for 1 h at room temperature. After the washes in PBST and PBS, membrane bound antibodies were visualized by use of ECL Western blotting detection reagents (Amersham) and Kodak XS1 films.

CAT Assays

CAT assays were performed as described previously (12) . Briefly, 10cells were lysed in 50 µl of 0.5% Nonidet P-40, 10 mM Tris, pH 8, 1 mM EDTA, 150 mM NaCl for 10 min on ice. Cellular debris as pelleted and the lysates heated at 68 °C for 10 min before use. Assay conditions were 150 mM Tris, pH 8, 0.05 µCi of [C]acetyl coenzyme A, and 2 mM chloramphenicol. Chloramphenicol was extracted with ethyl acetate, and the amount of radioactivity in the acetylated products and nonacetylated substrate of each reaction was determined by liquid scintillation counting of organic and aqueous phases, respectively. The percentage of chloramphenicol acetylation is calculated and results are presented as such or as -fold increase of the control response.

FACS Analysis

Cells were incubated with FITC-conjugated Leuantibodies (human CD69) for 30 min at 4 °C and then washed three times in PBS containing 4% fetal calf serum prior to analysis with a FACScan fluorocytometer (Becton Dickinson). For analysis of rat CD2 and human CD3 antigens, cells were incubated with 5 µg/ml OX-34 (rat CD2) or UCHT-1 (human CD3) antibodies for 30 min at 4 °C, washed, and thereafter incubated with fluorescein isothiocyanate-conjugated rabbit anti-mouse immunoglobulin for 30 min at 4 °C, prior to FACS analysis. Propidium iodide was used to exclude dead cells from analysis.


RESULTS

PKC- and PKC- Are Able to Induce AP-1 Activity in Jurkat Cells

In fibroblasts, expression of pseudosubstrate mutated PKC- has been shown to induce AP-1 activity (16) . To assess the ability of the mutated constitutively active PKC-, -, and - to induce the transcription factor AP-1 in T cells, we employed transient transfection protocols and quantitation of the expression of a CAT reporter gene whose activity is regulated by a trimer of the AP-1 binding site. Jurkat cells were cotransfected with the AP-1-CAT construct plus one of the expression constructs encoding the different PKC isotypes. The samples were harvested 18 h after transfection and the induction of AP-1-CAT activity was determined (Fig. 1). Basal AP-1 activity measured in T cells, in the absence of stimulus, is low and PDBu induced a 6-8-fold increase in the AP-1 activity (Fig. 1 A). In parallel experiments and as a positive control, cotransfection of a constitutively active Ras mutant, p21, induced a level of AP-1 activity comparable to the level of PDBu induced AP-1 activity. Similarily cotransfection of v -src, a constitutively active protein tyrosine kinase resulted in transactivation of AP-1 (Fig. 1 A). When PKC mutants were cotransfected with AP-1 in an identical procedure, PKC-E159 and PKC-E25 were found to transactivate the AP-1-CAT reporter construct. PKC-E159 induced a level of AP-1-CAT comparable to that seen in phorbol ester-stimulated cells, whereas PKC-E25 was consistently less effective (Fig. 1 B). The data in Fig. 1 C compare the kinetics of AP-1 induction in response to PKC-E25 and PKC-E159 mutants and show that the kinetics of AP-1 induction by the two isotypes are similar in Jurkat cells. AP-1-CAT activity was not regulated by the PKC-E119 mutant nor by cotransfection of expression plasmid encoding wild type PKC-, -, or -. Increasing the amount of the PKC-E119 expression vector used in the experiments had no effect on AP-1 activity at any time point tested (data not shown).


Figure 1: The effect of PKC-E159, PKC-E25, and PKC-119 on AP-1 transcriptional activity. A, 10Jurkat cells were cotransfected by electroporation with the AP-1-CAT reporter construct and the empty vector or a v -src or v-Ha -ras containing plasmids as described under ``Experimental Procedures.'' Cells transfected with the empty vector were either left unstimulated, or stimulated with 50 ng/ml PDBu immediately after transfection for 18 h before extracts were made, and CAT reporter gene activity was assessed. Data show fold increase of the control response is the ratio of activity calculated as the percentage of conversion of CAT activity in PDBu-stimulated cells, cells transfected with v -src or v-Ha -ras versus control unstimulated cells transfected with the empty vector. Results from one experiment representative of four are presented. B, the experiment was carried out as in A except that one of a PKC-, -, - mutant or wild type PKCs was cotransfected together with AP-1-CAT reporter gene. The data shown are from one experiment representative of seven experiments. For these seven experiments the mean fold increase of the control response for PDBu-, PKC-E25-, and PKC-E159-treated cells was 10, 3, and 5, respectively. C, cells were cotransfected with the AP-1-CAT reporter construct and empty vector or PKC-E25 or PKC-E159 plasmids. Cells were either left unstimulated, or stimulated with 50 ng/ml PDBu immediately after transfection. Cells were harvested at different time points after transfection and the data show the CAT activity as percentage conversion monitored from cell extracts.



To determine whether the failure of the PKC-E119 mutant to transactivate AP-1 was due to insufficient expression of the enzyme, Western blot analysis of PKC isotypes in transfected cells was performed. JH6.2 cells constitutively express PKC-, -, and -. The point mutated PKC isotypes will migrate at a similar molecular weight as the endogenous isotypes and have an identical immunoreactivity as the endogenous enzyme. However, an increase in the total cellular levels of the particular PKC isotype is an indication that the transfected gene is efficiently transcribed and translated into the final PKC product. The Western blots in Fig. 2show that endogenous PKC-, detected in control empty vector transfected cells, migrates as an 80-kDa band. PKC-E119 levels increased with the time after transfection to reach a maximum level 16 h post-transfection. This level was maintained for at least 24 h. The failure of the PKC-E119 mutant to transactivate AP-1 was thus not due to insufficient expression of the enzyme.


Figure 2: PKC-E119 is expressed in pCO-PKC-E119 transfected Jurkat cells. 10Jurkat cells were transfected with PKC-E119 or the empty vector and total cellular extracts prepared at the indicated time after transfection. Western blots were performed as described under ``Experimental Procedures.'' The expression of the p85 subunit of phosphatidylinositol 3-kinase kinase, monitored to control the loading of the gel, is shown in the bottom panel.



Jurkat cells constitutively express PKC- and -. The functional effects of the mutated PKC-E25 and PKC-E159 were easy to demonstrate but no increases in the total level of PKC- and - were detected in cells transfected with the PKC-E25 and PKC-E159 mutants (data not shown). Endogenous PKC- and - are expressed at high levels in Jurkat cells and these data suggest that the activated mutants are expressed at a low level relative to the endogenous wild type enzyme.

PKC- and PKC- Are Able to Induce NF-AT-1 Activity

The transcriptional factor NF-AT-1 is a complex of AP-1 and NF-ATp (7) . There is a two-signal requirement for NF-AT-1 activation which reflects that calcium regulated signals induce NF-ATp translocation from the cytosol to the nucleus, whereas PKC or p21 is proposed to induce AP-1. The data in Fig. 3 A show that the calcium ionophore ionomycin alone has a weak inductive effect on NF-AT-1 but ionomycin and PDBu synergize for maximal activation. Expression of v -src can substitute for both ionomycin and PDBu signals and transactivate NF-AT-CAT. The constitutively active Ras mutant, v-Ha -ras alone, has no inductive effect on NF-AT-1, but can synergize with ionomycin for NF-AT-1 induction (Fig. 3 A). To study the role of PKC in the induction of an active NF-AT-1 complex, cotransfection experiments were carried out using the PKC-E159, PKC-E25, and PKC-E119 mutants. The data in Fig. 3 B show that the PKC-E159 and PKC-E25 mutants alone had no effect on NF-AT-1 activity but were able to induce NF-AT-1 in the presence of ionomycin. Neither PKC-E119, nor the wild type PKC-, -, and - isotypes were able to induce significant NF-AT-CAT activity, either alone or in combination with ionomycin. PKC is proposed to regulate NF-AT-1 via effects on AP-1. The PKC-E159 mutant was repeatedly more effective than PKC-E25 for NF-AT-1 induction, which is consistent with the relative potency of these constructs on AP-1 activity shown in Fig. 1 . In kinetic experiments, the synergy between ionomycin and PKC-E159 and PKC-E25 mutants for NF-AT-CAT induction were readily detected 2 h after stimulation (Fig. 3 C).


Figure 3: Constitutively active PKC-E159 and PKC-E25 but not PKC- 119 are able to synergize with ionomycin to induce NF-AT-1 transcriptional activity. A, 10Jurkat cells were cotransfected with NF-AT-CAT and either the empty vector or v -src or v-Ha -ras expression plasmids. After 12 h cells transfected with the empty vector were then either left unstimulated or stimulated with 50 ng/ml PDBu and/or 0.5 µg/ml ionomycin for 8 h, before extracts were made and CAT reporter gene activity was assessed. B, the experiment was carried out as in A except that one of the PKC-, -, - mutant or wild type expression vector were cotransfected with NF-AT-CAT as indicated. The data show CAT activity as percentage conversion and are one representative experiment out of seven. C, cells were cotransfected with the NF-AT-CAT reporter construct and PKC-E25 or PKC-E159 or PKC-E119 plasmids. Cells were allowed to express the PKC gene for 12 h and stimuli were then applied. Cells transfected with the empty vector were either left unstimulated, or stimulated with 50 ng/ml PDBu plus ionomycin, while ionomycin alone was then added to cells transfected with the PKCs mutants. Cells were harvested and extracts made at different time points after stimulation. Results from one representative experiment are presented.



PKC- Is Able to Induce NF-KB Activity

NF-KB, a PKC-regulated transcription factor, is a heterodimer composed of 2 DNA binding subunits which are members of the rel family (27) . To assess the ability of the different PKC isotypes to transactivate NF-KB, PKC-E159, PKC-E25, and PKC-E119 expression constructs were cotransfected with an NF-KB-CAT construct. The samples were harvested 18 h after transfection and CAT activity was determined. As controls, cotransfection experiments were performed with constitutively activated Ras, v-Ha -ras, and an activated protein tyrosine kinase, v -src. The data in Fig. 4 a show that NF-KB-CAT activity in unstimulated JH6.2 cells can be increased 3-4-fold with phorbol ester stimulation. Cotransfection of an activated tyrosine kinase v -src was also able to increase NF-KB activity 2-3-fold, but constitutively active v-Ha -ras had no significant effect. This was in marked contrast to the strong transactivating effect of the Ras mutant on AP-1 and NF-AT-1 (Figs. 1 A and 3 A). As shown in Fig. 4B, only PKC-E159 was able to induce NF-KB activity, and cotransfections carried out with the PKC-E25 or PKC-E119 mutants had no detectable effect on NF-KB-CAT activity. In kinetic experiments, NF-KB activity was detected between 2 and 4 h after transfection of PKC-E159, whereas no significant effect of PKC-E25 or PKC-E119 mutants was detected at any time point (Fig. 4 C).


Figure 4: The effect of PKC-, -, and - on NF-KB induction. A, 10Jurkat cells were cotransfected with NF-KB-CAT reporter construct and empty vector or v -src or v-Ha -ras containing plasmids. Cells transfected with the empty vector were either left unstimulated, or stimulated with 50 ng/ml PDBu immediately after transfection for 18 h, before extracts were made, and CAT reporter gene activity was assessed. The data show fold increase in CAT activity relative to the control response calculated as described in the legend to Fig. 1. Results from one representative experiment are presented. B, the experiment was carried out as in A except that PKC mutant or wild type expression plasmids were cotransfected with NF-KB CAT. The data shown are one representative experiment out of five. For these five experiments the mean fold increase of the control response for PDBu or PKC-E159 was 3- and 4-fold, respectively. C, cells were cotransfected with NF-KB-CAT reporter construct and empty vector or PKC-E25 or PKC-E159 plasmids. Cells transfected with the empty vector were either left unstimulated, or stimulated with 50 ng/ml PDBu immediately after transfection. Cells were harvested at different time points after transfection and CAT activity was determined.



PKC-, PKC-, PKC- Are Unable to Induce CD69 Expression

The CD69 antigen is rapidly expressed at the cell surface in response to triggering of the T cell receptor or activation of T cells with phorbol esters (28) . The effects of phorbol ester led to the conclusion that PKC controls the surface expression of CD69. It is now also recognized that p21 is involved in CD69 induction. Thus transfection of a constitutively active Ras mutant into Jurkat cells induces CD69 expression, whereas transfection of a dominant negative Ras mutant prevents phorbol ester regulation of this surface antigen (25) .

In an attempt to identify which isotype of PKC could be involved in the induction of the CD69 molecule in T cells, plasmids encoding the different PKC mutants were transfected in Jurkat cells and the expression of CD69 monitored by FACS analysis. Results of a representative experiment are shown in Fig. 5. Optimal conditions to follow the induction of CD69 by a transfected plasmid were established by using the constitutively active v -src construct. Fig. 5 a shows that the JH6.2 subclone of Jurkat does not express CD69 in the absence of stimulus but PDBu is able to induce CD69 expression. In cells transfected with v -src, a subpopulation of cells can be seen to express CD69 to levels comparable to that seen in the PDBu-stimulated cells. Phorbol esters will activate all of the Jurkat cells, whereas the efficiency in transient transfection protocols means that only a subpopulation of cells will express the activated Src mutants. Thus in each experiment, cells were transfected with an expression construct encoding a truncated rat CD2 antigen as a surface tag. The transfection efficiency can then be estimated by fluorescence analysis of rat CD2 expression. In the experiment shown in Fig. 5, the transfection efficiency from the CD2 analysis was 35% (Fig. 5 b) and in the v- src transfected cells (Fig. 5 c), a comparable percentage of the cells became CD69 positive, with a mean fluorescence intensity similar to that seen with PDBu-stimulated cells (Fig. 5 a). Expression of activated p21 also induced CD69 expression (Fig. 5 d) so that approximately 15% of cells became CD69 positive. CD3 expression was not affected by transfection of v -src or v-Ha -ras (data not shown). The weaker effect of v-Ha -ras compared to v -src was consistently observed in seven experiments. There was no synergy between phorbol ester and ionomycin or activated Ras and ionomycin for CD69 expression. CD69 induction was never observed in response to PKC-E25, PKC-E159, or PKC-E119, either alone or in combination, or in cells transfected with PKC mutants in combination with v-Ha -ras. However, cells transfected with any PKC construct, either active PKC or wt PKC, were still able to induce CD69 upon PDBu treatment or T cell receptor-CD3 complex ligation (data not shown). In all these experiments, the expression of functional constitutively active PKC-E25 or PKC-E159 was monitored by transactivation of an AP-1-CAT reporter gene. It has been suggested that signals from PKC and p21 converge to control the activity of the protein serine/threonine kinase Raf-1 (29) ; we therefore examined the functional effect of expressing a constitutively active Raf kinase, partly to determine whether there were any intrinsic difficulties in using activated protein serine/threonine kinases for the CD69 induction assay. Preliminary experiments confirmed that a truncated Raf protein, v -raf, could replace activated p21 or phorbol esters for induction of AP-1 and NF-AT-1 in CAT assays. Expression of v -raf could also mimic the effect of v-Ha -ras for CD69 induction (Fig. 5 e).


Figure 5: The effect of PKC-, -, and - on CD69 expression. 10Jurkat cells were transfected with one of the expression vectors containing either a mutant or a wild type PKC-, -, -, v -src, v-Ha -ras, rat CD2, or with the empty vector. After transfection, cells were either left unstimulated or stimulated with 50 ng/ml PDBu, 4 h after transfection for 18 h. Cells were harvested, washed, and stained for CD69 expression and histogram analysis of CD69 induction on the cell surface are shown. Log of fluorescence intensity is measured on the x axis and cell number on the y axis. Jurkat cells transfected with rat CD2 were analyzed for rat CD2 expression in b, while cells were stained with anti-CD69 antibodies in panels a and c-h. Unstimulated cells transfected with the empty vector are shown in the white histogram while cells stimulated with PDBu ( a) or transfected with an active plasmid ( c-h) are shown in the black histogram. Staining is shown with Jurkat cells transfected with the empty vector and with PDBu stimulation ( a); c, cells transfected with v -src; d, with v-Ha -ras; e, with PKC-E25 mutant; f, with PKC-E25 mutant; g, with PKC-E119 mutant. The data from one experiment are shown but seven experiments were performed. The transfection efficiency based on rat CD2 expression ranged from 30 to 38%; 33.5 ± 2.2% CD69 positive cells were induced in response to transfection with v -src; 16.3 ± 6.3% CD69 positive cells were induced in response to transfection with v-Ha -ras; 11.9 ± 1.3% CD69 positive cells were induced in response to transfection with v -raf; 1.2 ± 1.8% CD69 positive cells induced in response to transfection with PKC-E25; 1.5 ± 1.9% CD69 positive cells induced in response to transfection with PKC-E159; 2.2 ± 2.1% CD69 positive cells induced in response to transfection with PKC-E119.




DISCUSSION

The present series of experiments have explored the ability of constitutively active pseudosubstrate mutated variants of PKC-, PKC-, or PKC- to regulate the activity of the transcriptional factors AP-1, NF-AT-1, and NF-KB. Phorbol esters can stimulate AP-1 activity in T cells and synergize with calcium signals to regulate NF-AT-1. The data show that the constitutively active mutants of PKC- and -, PKC-E25, PKC-E159, can mimic phorbol esters for both AP-1 and NF-AT-1 induction. However, the phorbol ester effect on AP-1 and NF-AT-1 was not mimicked by mutated PKC-. Moreover, expression of the constitutively active PKC-E119 alone was not sufficient to induce any of the T cell responses examined and this enzyme must therefore have a different role in T cells than the phorbol ester/DAG regulated PKC isotypes such as PKC- or -. The failure of the activated PKC- mutant to mimic phorbol ester in T cell activation is not unexpected since this enzyme is not regulated by phorbol esters, either in vitro or in vivo. However, the lack of response of PKC- to phorbol esters does not preclude that this enzyme might have some functional effects on T cell activation which could reflect its involvement in the signal transduction pathways controlled by other lipid second messengers. For example, in vitro, PKC- shares with other PKC isotypes the ability to be regulated by the D-3 phosphoinositide phosphatidylinositol 3,4,5-trisphosphate (30) . As well, experiments in fibroblasts using dominant negative mutants of PKC- or overexpression of PKC-wt have suggested a role for this PKC isotype in NF-KB induction (31) . The expression of constitutively active PKC- or the overexpression of PKC-wt is not sufficient for NF-KB transactivation in T cells which could reflect that the mechanisms of NF-KB regulation in T cell and fibroblasts differ.

One aim of the present study was to see whether PKC- and - have different functional effects in T cells. The data show that the constitutively active PKC-E25 and PKC-E159 have similar effects on AP-1 and NF-AT-1 induction, but are different in that PKC-E159 could transactivate an NF-KB reporter gene, whereas PKC-E25 could not. PKC-E25 was consistently less efficient than PKC-E159 for transactivation of NF-AT-1 or AP-1. The explanation for this difference is not known and it is possible that it reflects that PKC-E25 is less efficiently expressed than PKC-E159, possibly due to intrinsic differences in the stability of these two mutated PKC isotypes. This point was difficult to assess since transfected PKC-E25 and PKC-E159 could not be dissociated from their endogenous (wild type) counterparts in Western blot analysis. However, the differences between PKC-E25 compared to PKC-E159 for AP-1 and NF-AT-1 activation were at most 2-fold. The sensitivity of the NF-KB assay would have allowed the detection of a 2-fold difference in the effect of PKC-E25 and PKC-E159. Accordingly, it would seem that there is a real difference in the relative ability of PKC-E25 and PKC-E159 to regulate the AP-1 and NF-KB family of transcriptional factors.

In T cells, phorbol esters and DAGs stimulate the accumulation of ``active'' p21-GTP complexes in a PKC-dependent response (32) . This observation, combined with a requirement for Ras function for phorbol ester regulation of interleukin 2 gene expression (8) led to the idea that PKC functioned upstream of p21 in T lymphocytes. The relationship between PKC and Ras in other cell lineages is more complicated, particularily in fibroblasts, where it has been suggested that PKC may function both upstream and downstream of Ras. In the present study, we have compared the effect of a constitutively active Ras protein and constitutively active PKC- and - mutants on T cell responses. If either of these isotypes functioned directly upstream or downstream of p21, then it would be expected that the functional effects of the active PKC mutants, PKC-E25 and PKC-E159, would be the same as the effects of an ``activated'' Ras protein, p21. For AP-1 and NF-AT-1 induction, p21, PKC-E25, or PKC-E159 have comparable effects and can mimic the effect of phorbol esters. However, PKC-E159 could stimulate NF-KB, whereas the activated Ras mutant could not, which indicates clearly that not all PKC functions in T cells are mediated by p21.

p21 controlled signaling pathways are necessary for regulating surface levels of the CD69 antigen and thus transfection of p21 alone into Jurkat cells results in the expression of CD69 (25) . If PKC- or - function upstream of p21 then it would be predicted that cells transfected with activated mutants of PKC would also express CD69. The data in the present report show that phorbol ester treatment of T cells induces CD69 as does transfection of v -src. Transfection of v-Ha -ras is also able to induce CD69 in JH6.2 cells, although consistently to a lesser extent than v -src. In contrast, expression of PKC-E25 and PKC-E159 failed to induce CD69 expression. The implication from these data are that phorbol ester induction of CD69 is not mediated by PKC- or PKC-, and therefore is likely to be regulated by another PKC isotype or, alternatively by another phorbol ester-dependent effector. Moreover, the data suggest that neither PKC- nor PKC- regulate the activity of p21. In this context, p21 functions upstream of the protein serine/threonine kinase Raf-1 in many cells, and thus cells expressing constitutively activated Ras and Raf proteins have a similar phenotype. In the present report, v-Ha -ras and v -raf have a comparable effect on CD69 expression which illustrates that there is no intrinsic problem associated with the induction of CD69 by a constitutively active protein serine/threonine kinase. Thus the simplest interpretation of differences between the functional effects of v-Ha -ras and PKC-E25 or PKC-E159 with regard to CD69 induction is that these molecules are not positioned linearily in the same signaling pathway. Nevertheless, their similar effects on AP-1 and NF-AT-1 induction indicated that there must be some point of convergence of Ras and PKC-/ signals. One such convergence point for Ras and PKC could be at the level of the extracellular signal-regulated or mitogen-activated protein kinase (ERKs/MAPKs) cascade (33, 34) . T cells express more than one member of the mitogen-activated protein kinase family including ERK-2 and JNK-1 (34, 35) . It is thus possible that p21 and PKC- and - activate AP-1 and NF-AT-1 via parallel pathways that use different members of the mitogen-activated protein kinase family. The point of convergence of the signaling pathways would thus be in the nucleus at the level of transcriptional factor phosphorylation.

In conclusion, it has been known for several years that T cells express multiple isoforms of PKC. The present study has shown that phorbol ester regulation of the transcriptional factors AP-1 and NF-AT-1 can be mimicked by constitutively active PKC- and -. PKC- can transactivate NF-KB whereas PKC- could not. PKC- had no effect on AP-1, NF-AT-1, or NF-KB transactivation and its role in T cells is not yet discovered. These experiments indicate that different PKC isotypes may have selective physiological functions in T cell responses.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
A member of INSERM.

To whom correspondence should be sent. Tel.: 071-269-3231; Fax: 071-269-3417.

The abbreviations used are: PKC, protein kinase C; DAG, diacylglycerol; PDBu, phorbol 12,13-dibutyrate, NF-AT-1, nuclear factor of activated T cells; NF-ATp, pre-existing factor of the NF-AT-1 complex; AP-1 activating protein-1; NF-KB, nuclear factor binding to KB sites; CAT, chloramphenicol acetyltransferase; ERK, extracellular signal-regulated protein kinase; wt, wild type; PBS, phosphate-buffered saline.


REFERENCES
  1. Weiss, A., and Littman, D. R. (1994) Cell 76, 263-274 [CrossRef][Medline] [Order article via Infotrieve]
  2. Berry, N., and Nishizuka, Y. (1990) Eur. J. Biochem. 189, 205-214 [Medline] [Order article via Infotrieve]
  3. Hug, H., and Sarre, T. F. (1993) Biochem. J. 291, 329-343
  4. Dekker, L. V., and Parker, P. J. (1994) Trends Biochem. Sci. 19, 73-77 [CrossRef][Medline] [Order article via Infotrieve]
  5. Johannes, F. J., Pretle, J., Eis, S., Oberhagemann, P., and Pfizenmaier, K. (1994) J. Biol. Chem. 269, 6140-6148 [Abstract/Free Full Text]
  6. Valverde, A. M., Sinnett-Smith, J., Van Lint, J., and Rozengurt, E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8572-8576 [Abstract/Free Full Text]
  7. Rao, A. (1994) Immunol. Today 15, 274-281 [CrossRef][Medline] [Order article via Infotrieve]
  8. Rayter, S., Woodrow, M., Lucas, S. C., Cantrell, D., and Downward, J. (1992) EMBO J. 11, 4549-4556 [Medline] [Order article via Infotrieve]
  9. Davis, R. J. (1994) Trends Biochem. Sci. 227, 470-473
  10. Baier, G., Telford, D., Giampa, L., Coggeshall, K. M., Baier- Bitterlich, G., Isakov, N., and Altman, A. (1993) J. Biol. Chem. 268, 4997-5004 [Abstract/Free Full Text]
  11. Ahmed, S., Kozma, R., Lee, J., Monfries, C., Harden, N., and Lim, L. (1991) Biochem. J. 280, 233-241
  12. Woodrow, M., Clipstone, N. A., and Cantrell, D. (1993) J. Exp. Med. 178, 1517-1522 [Abstract/Free Full Text]
  13. Wotton, D., Ways, D. K., Parker, P. J., and Owen, M. (1993) J. Biol. Chem. 268, 17975-17982 [Abstract/Free Full Text]
  14. Muramatsu, M. A., Kaibuchi, K., and Arai, K. I. (1989) Mol. Cell. Biol. 9, 831-836 [Abstract/Free Full Text]
  15. Orr, J. W., Keranen, L. M., and Newton, A. C. (1992) J. Biol. Chem. 267, 15263-15266 [Abstract/Free Full Text]
  16. Pears, C. J., Kour, G., House, C., Kemp, B. E., and Parker, P. J. (1990) Eur. J. Biochem. 194, 89-94 [Medline] [Order article via Infotrieve]
  17. Tsutsumi, A., Kubo, M., Fujii, H., Freire-Moar, J., Turck, C. W., and Ransom, J. T. (1993) J. Immunol. 150, 1754-1756
  18. Williams, D. M., Teffery, L. T., and Murray, E. T. (1992) Biochim. Biophys. Acta 1180, 9-14 [Medline] [Order article via Infotrieve]
  19. Schreiber, S. L., and Crabtree, G. R. (1992) Immunol. Today 13, 136-142 [CrossRef][Medline] [Order article via Infotrieve]
  20. Parker, P. J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen, E., Stabel, S., Waterfield, M. D., and Ullrich, A. (1986) Science 233, 853-859 [Abstract/Free Full Text]
  21. Schaap, D., Parker, P. J., Bristol, A., Kriz, R., and Knopf, J. (1989) FEBS Lett. 243, 352-357
  22. Ono, Y., Fuiji, T., and Ogika, K. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3099-3103 [Abstract/Free Full Text]
  23. Goode, N. T., and Parker, P. J. (1994) FEBS Lett. 340, 145-150 [CrossRef][Medline] [Order article via Infotrieve]
  24. Decock, J. B. J., Parker, P. J., Sugden, P. H., and Fuller, S. J. (1994) FEBS Lett. 356, 275-278 [CrossRef][Medline] [Order article via Infotrieve]
  25. D'Ambrosio, D., Cantrell, D. A., Frati, L., Santoni, A., and Testi, R. (1994) Eur. J. Immunol. 24, 616-620 [Medline] [Order article via Infotrieve]
  26. Nunès, J., Klasen, S., Ragueneau, M., Pavon, C., Couez, D., Mawas, C., and Olive, D. (1993) Int. Immunol. 5, 311-315 [Abstract/Free Full Text]
  27. Grimm, S., and Bauerle, P. A. (1993) Biochem. J. 290, 297-308
  28. Hara, T., Jung, J. M., Bjorndahl, S. M., and Fu, S. M. (1986) J. Exp. Med. 164, 1988-1999 [Abstract/Free Full Text]
  29. Daum, G., Eisenmann-Tappe, I., Fries, H. W., Troppmair, J., and Rapp, U. R. (1994) Trends Biochem. Sci. 227, 474-480
  30. Liscovitch, M., and Cantley, L. C. (1994) Cell 77, 329-334 [CrossRef][Medline] [Order article via Infotrieve]
  31. Berra, E., Diaz-Meco, M. T., Dominguez, I., Municio, M. M., Sanz, L., Lozano, J., Chapkin, R. S., and Moscat, J. (1993) Cell 74, 555-563 [CrossRef][Medline] [Order article via Infotrieve]
  32. Izquierdo, M., Downward, J., Graves, J. D., and Cantrell, D. A. (1992) Mol. Cell. Biol. 12, 3305-3312 [Abstract/Free Full Text]
  33. Pulverer, B. J., Hughes, K., Franklin, C. C., Kraft, A. S., Leevers, S. J., and Woodgett, J. R. (1993) Oncogene 8, 407-415 [Medline] [Order article via Infotrieve]
  34. Dérijard, B., Hibi, M., Wu, I.-H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R. J. (1994) Cell 76, 1025-1037 [CrossRef][Medline] [Order article via Infotrieve]
  35. Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Ben-Neriah, Y. (1994) Cell 77, 727-736 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
F. Maingrette, L. Li, and G. Renier
C-reactive protein enhances macrophage lipoprotein lipase expression
J. Lipid Res., September 1, 2008; 49(9): 1926 - 1935.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Madgwick, M. Levasseur, and K. T. Jones
Calmodulin-dependent protein kinase II, and not protein kinase C, is sufficient for triggering cell-cycle resumption in mammalian eggs
J. Cell Sci., September 1, 2005; 118(17): 3849 - 3859.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. A. Dean
Nonviral gene transfer to skeletal, smooth, and cardiac muscle in living animals
Am J Physiol Cell Physiol, August 1, 2005; 289(2): C233 - C245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Tourkina, P. Gooz, J. Pannu, M. Bonner, D. Scholz, S. Hacker, R. M. Silver, M. Trojanowska, and S. Hoffman
Opposing Effects of Protein Kinase C{alpha} and Protein Kinase C{epsilon} on Collagen Expression by Human Lung Fibroblasts Are Mediated via MEK/ERK and Caveolin-1 Signaling
J. Biol. Chem., April 8, 2005; 280(14): 13879 - 13887.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Cippitelli, C. Fionda, D. Di Bona, M. Piccoli, L. Frati, and A. Santoni
Hyperthermia Enhances CD95-Ligand Gene Expression in T Lymphocytes
J. Immunol., January 1, 2005; 174(1): 223 - 232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. S. Bogatkevich, E. Gustilo, J. C. Oates, C. Feghali-Bostwick, R. A. Harley, R. M. Silver, and A. Ludwicka-Bradley
Distinct PKC isoforms mediate cell survival and DNA synthesis in thrombin-induced myofibroblasts
Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L190 - L201.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H.-Y. Park, H. Wu, C. E. Killoran, and B. A. Gilchrest
The receptor for activated C-kinase-I (RACK-I) anchors activated PKC-{beta} on melanosomes
J. Cell Sci., July 15, 2004; 117(16): 3659 - 3668.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
E. Tourkina, P. Gooz, J. C. Oates, A. Ludwicka-Bradley, R. M. Silver, and S. Hoffman
Curcumin-Induced Apoptosis in Scleroderma Lung Fibroblasts: Role of Protein Kinase C{epsilon}
Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 28 - 35.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. D. Bilyeu, G. R. Panta, L. G. Cavin, C. M. Barrett, E. J. Turner, T. W. Sweatman, M. Israel, L. Lothstein, and M. Arsura
Circumvention of Nuclear Factor {kappa}B-Induced Chemoresistance by Cytoplasmic-Targeted Anthracyclines
Mol. Pharmacol., April 1, 2004; 65(4): 1038 - 1047.
[Abstract] [Full Text]


Home page
Int ImmunolHome page
J. Pardo, M. Buferne, M.-J. Martinez-Lorenzo, J. Naval, A.-M. Schmitt-Verhulst, C. Boyer, and A. Anel
Differential implication of protein kinase C isoforms in cytotoxic T lymphocyte degranulation and TCR-induced Fas ligand expression
Int. Immunol., December 1, 2003; 15(12): 1441 - 1450.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Deeds, S. Teodorescu, M. Chu, Q. Yu, and C.-Y. Chen
A p53-independent G1 Cell Cycle Checkpoint Induced by the Suppression of Protein Kinase C {alpha} and {theta} Isoforms
J. Biol. Chem., October 10, 2003; 278(41): 39782 - 39793.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. A. Trushin, K. N. Pennington, E. M. Carmona, S. Asin, D. N. Savoy, D. D. Billadeau, and C. V. Paya
Protein Kinase C{alpha} (PKC{alpha}) Acts Upstream of PKC{theta} To Activate I{kappa}B Kinase and NF-{kappa}B in T Lymphocytes
Mol. Cell. Biol., October 1, 2003; 23(19): 7068 - 7081.
[Abstract] [Full Text] [PDF]