JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiue, L.
Right arrow Articles by Brugge, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiue, L.
Right arrow Articles by Brugge, J. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 18, Issue of May 5, pp. 10498-10502, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Syk Is Activated by Phosphotyrosine-containing Peptides Representing the Tyrosine-based Activation Motifs of the High Affinity Receptor for IgE(*)

Lily Shiue , Mark J. Zoller , Joan S. Brugge (§)

From the (1) From ARIAD Phamaceuticals, Inc., Cambridge, Massachusetts 02139

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Engagement of the high affinity receptor for immunoglobulin E (FcRI) on the surface of mast cells induces tyrosine phosphorylation of numerous cellular proteins. Syk, one of several non-receptor protein tyrosine kinases implicated in FcRI signaling, is activated following receptor cross-linking and associates with phosphorylated subunits of FcRI. We previously showed that the Src homology 2 (SH2) domains of Syk bind with high affinity to the conserved tyrosine-based activation motif (TAM) of the subunit in vitro. In this report, we show that a tyrosine-phosphorylated TAM peptide induced tyrosine phosphorylation of Syk in RBL-2H3 cell lysates and stimulated Syk kinase activity 10-fold in vitro, with half-maximal activation at 1-2 µM. A similar subunit TAM peptide showed much lower stimulation of Syk tyrosine phosphorylation and kinase activity. Phosphopeptide-induced activation was inhibited by an antiserum to the carboxyl-terminal tail of Syk, suggesting that those amino acids are also involved in Syk activation. These results indicate that the catalytic domain of Syk may be regulated by intramolecular interactions with adjacent domains and suggest that Syk binding to phosphorylated subunits following FcRI engagement in vivo stimulates Syk kinase activity.


INTRODUCTION

Aggregation of the high affinity receptor for immunoglobulin E (FcRI)() on basophils and mast cells results in the activation of many biochemical events, culminating in the extracellular release of various immune response mediators (1) . Tyrosine phosphorylation of numerous cellular proteins, including FcRI subunits, is an early and essential event in receptor-mediated signaling (2, 3, 4) . FcRI is a member of the multisubunit antigen receptor family, whose members lack intrinsic tyrosine kinase activity and therefore rely on recruitment and activation of non-receptor protein tyrosine kinases for signal transduction (5) . The conserved tyrosine-based activation motifs (TAMs) identified in the cytoplasmic tails of several subunits of this receptor family, with the general consensus of D/E-X-Y-X-L/I-X-Y-X-L/I, have been shown to be of critical importance for receptor-mediated activation (6, 7) . Many of the receptors in this family harbor multiple TAMs. FcRI, a tetrameric complex, contains three: one in the subunit and one in each of the two subunits (8) .

When TAM-containing cytoplasmic domains are expressed as chimeric receptors with a heterologous extracellular domain, they can elicit the full spectrum of responses seen with cross-linking of complete multimeric receptors. Cross-linking of chimeric receptors containing the cytoplasmic portions of the T cell receptor subunits and or the subunit of FcRI activates calcium influx, cytolytic activity, and interleukin-2 production in T cells (9, 10, 11, 12, 13) . Similarly, in RBL-2H3 cells, which are derived from a rat basophilic leukemia, cross-linking of chimeric receptors containing the cytoplasmic tails of and induces increased tyrosine phosphorylation, calcium influx, and degranulation (14, 15) . Mutation of the conserved tyrosine or leucine residues or alteration of the spacing between the Y XX(L/I) motifs of the TAMs abolishes signal transduction (9, 13, 14). Y XX(L/I) motifs, when phosphorylated on tyrosine, represent high affinity binding sites for some Src homology 2 (SH2) domains, including those of the Src and Syk families of protein tyrosine kinases (16, 17) . The dual Y XXLs of the TAMs are potential binding sites for proteins such as the Syk and ZAP-70 tyrosine kinases, which contain two SH2 domains amino-terminal of a catalytic domain (18, 19) .

In RBL cells, both Src family kinases and Syk associate with FcRI and are activated following receptor aggregation (20, 21, 22) . Syk becomes tyrosine-phosphorylated and associates with tyrosine-phosphorylated FcRI subunits, predominantly with subunits (23) . We showed previously that Syk was the major protein affinity-isolated from RBL cell lysates by phosphorylated TAM peptide ligand (24) . Together, the above data suggest that Syk binding of the phosphorylated TAM is involved in FcRI-mediated signaling. However, the mechanism of Syk activation following receptor cross-linking is still unknown.

In this report, we have investigated whether Syk binding of tyrosine-phosphorylated TAMs can stimulate the catalytic activity of Syk. We found that a peptide representing the tyrosine-phosphorylated subunit TAM induced tyrosine phosphorylation of Syk in cytosolic lysates of RBL cells. In addition, Syk kinase activity was greatly increased in response to incubation with the phosphorylated TAM peptide but not with a similar subunit TAM peptide. Phosphopeptide stimulation of kinase activity was inhibited by an antibody directed against the carboxyl-terminal amino acids of Syk. These results suggest that phospholigand binding by the Syk SH2 domains can stimulate the catalytic domain and that activation of catalytic activity also involves the carboxyl-terminal tail of Syk.


MATERIALS AND METHODS

Cell Culture and Lysis

RBL-2H3 cells were cultured, activated with IgE against 2,4-dinitrophenol (DNP) and 1 µg/ml DNP conjugated to bovine serum albumin, and lysed in 1% Nonidet P-40 containing buffer as described previously. Hypotonic lysis and isolation of the cytosolic of RBLs were also previously described (24) .

For peptide addition to cytosol, cytosolic lysates were incubated at 30 °C for 15 min in a final buffer of 150 mM NaCl, 10 mM KCl, 20 mM Tris, pH 7.5, 0.6 mM MgCl, 0.6 mM MnCl, 50 µM ATP, 0.5 mM EGTA, 2 mM dithiothreitol, 5 mM sodium fluoride, 1 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 10 units/ml aprotinin, 50 µg/ml leupeptin, 100 µg/ml soybean trypsin inhibitor, with or without 5 µM peptides. Reactions were terminated by addition of Nonidet P-40 to a final concentration of 1%.

Immunoprecipitations

4G10 antibody to phosphotyrosine was the gift of Tom Roberts and Brian Drucker. BR15 antibody to Syk, similar to that previously described (25) , was from Joseph Bolen and Bruce Rowley. Syk2 antibody to the peptide sequence CAVELRLRNYYYDVVN of Syk was obtained from Reuben Siraganian (22) . AR21 antibody was made as described previously to the peptide sequence EPTGGAWGPDRGLC of Syk (23) .

Immunoprecipitations of 0.5 mg of total cellular protein were incubated for 3-12 h at 4 °C, and immune complexes were collected with protein A-Sepharose beads (Pierce). SDS-polyacrylamide gel electrophoresis and Western blotting were performed as described previously (24) .

Peptide Synthesis

Peptides were synthesized as described previously (24) . Peptides were dissolved in 25 mM HEPES, pH 7.4, 10 mM MgCl, and 100 µg/ml bovine serum albumin and diluted as indicated.

In Vitro Kinase Assays

For in vitro kinase assays, immunoprecipitates were washed three times with Nonidet P-40 lysis buffer and then once with buffer containing 150 mM NaCl, 50 mM HEPES, pH 7.5, 1 mM sodium vanadate, and 1 mM phenylmethylsulfonyl fluoride. Pellets were resuspended in kinase buffer (10 mM MgCl, 2 mM MnCl, 30 mM HEPES, pH 7.5, 1 µM ATP, 2 µg of GST-band 3, 5 µCi of [-P]ATP, and 1 mM sodium orthovanadate) with or without peptides and incubated at 30 °C for 10 min. Reactions were terminated by addition of sample buffer.

Kinase reaction products were separated by 10% SDS-polyacrylamide gel electrophoresis, fixed in a solution of 40% methanol and 10% acetic acid, and then treated with 1 M KOH at 55 °C for 1 h. Treated gels were dried and exposed to Hyperfilm-MP (Amersham Corp.) or quantitatively analyzed by PhosphorImaging.

GST-Band 3 Substrate Protein

The protein substrate for Syk phosphorylation was a fusion of amino acids 1-18 (MEELQDDYEDMMEENLEQ) of human band 3 (26, 27) and GST. The fusion protein was expressed in Escherichia coli from the vector pGEX-band 3, constructed by cloning a synthetic DNA fragment into BamHI- and EcoRI-digested pGEX-KT. The DNA fragment encoding human band 3 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18) was prepared by annealing two synthetic oligonucleotides: band3Top (5`GATCCGGTATGGAAGAACTGCAGGACGACTACGAAGACATGA-TGGAAGAAAACCTGGAACAGTAATGAG) and band3Bottom (5`AAT-TCTCATTACTGTTCCAGGTTTTCTTCCATCATGTCTTCGTAGTCG-TCCTGCAGTTCTTCCATACCG). Expression and purification of GST-band 3 was accomplished by a modification of Smith and Johnson (28) involving affinity purification on a glutathione-agarose matrix (Sigma) and dialysis against 25 mM NaCl, 25 mM HEPES, 0.5 mM EDTA.


RESULTS AND DISCUSSION

Following FcRI cross-linking by antigen, Syk becomes tyrosine-phosphorylated and exhibits increased catalytic activity (22, 23) . The mechanism of Syk activation following receptor engagement is not clear, but Syk recruitment to activated receptors may be important, since Syk associates with tyrosine-phosphorylated subunits in activated RBL-2H3 cell lysates (22) . We investigated whether Syk interaction with tyrosine-phosphorylated TAMs could stimulate tyrosine phosphorylation and catalytic activity of Syk using peptides derived from the FcRI and subunit TAMs (Fig. 1 A). To examine the effect of phosphopeptides on Syk phosphorylation in the absence of membrane-associated proteins, we utilized the cytosolic fraction of RBL cells, which contains the majority of cellular Syk (24) . Cytosolic lysates of RBL cells were incubated with 5 µM peptides and kinase buffer (containing 50 µM ATP, 0.6 mM MgCl, and 0.6 mM MnCl). Syk was then immunoprecipitated and analyzed by anti-phosphotyrosine immunoblotting. Syk becomes tyrosine-phosphorylated after receptor aggregation (Fig. 1 B, upperpanel, lane1) (23, 24) , while in cytosolic lysates of unstimulated RBLs, Syk is unphosphorylated ( lane2). When cytosolic lysates of unstimulated cells were incubated with kinase buffer and 5 µM phospho- TAM peptide, there was a significant stimulation of Syk phosphorylation on tyrosine ( lane7). This effect was dependent on tyrosine phosphorylation of the TAM peptide as an unphosphorylated peptide had no effect ( lane8). Incubation of cytosolic lysates with 5 µM phospho- TAM peptide induced little tyrosine phosphorylation ( lane6), indicating that the Syk activation was selective for the phospho- TAM at this peptide concentration. No change in tyrosine phosphorylation of Syk was detected in lysates incubated with 5 µM phospho- or TAM peptide alone or with kinase buffer alone ( lanes 3-5). We could not readily determine whether the phospho- TAM peptide effect on Syk phosphorylation was direct. However, examination of the total phosphotyrosine content of treated lysates showed that the phospho- TAM peptide did not generally increase tyrosine phosphorylation of lysate proteins, suggesting that the peptide may specifically affect Syk (data not shown). In addition to the increase in tyrosine phosphorylation, Syk protein exhibited a shift in electrophoretic mobility to a more slowly migrating species, revealed by reprobing the same blot with anti-Syk antiserum (Fig. 1 B, bottompanel, lane7). Following receptor engagement in RBL cells, a fraction of cellular Syk becomes phosphorylated and mobility-shifted (23) (undetectable in lane1). Thus, the effects of the phospho- TAM peptide on Syk are consistent with a model where Syk phosphorylation is stimulated by the binding of phosphorylated TAMs on aggregated receptors.


Figure 1: Phospho- TAM peptide stimulates tyrosine phosphorylation of Syk in cytosolic lysates of RBLs. A, sequence of the human TAM peptides employed in this report. Y XX(L/I) motifs are underlined, and the positions of phosphorylated tyrosines are indicated. B, cytosolic lysates were incubated with peptides and buffer as described under ``Materials and Methods.'' Syk was immunoprecipitated and analyzed by Western blotting with anti-phosphotyrosine antibody ( toppanel). Syk from lysates of DNP-stimulated cells ( lane1), from unstimulated cell lysates ( lane2), from unstimulated lysates incubated with either phospho- TAM ( lane3) or phospho- TAM peptide ( lane4) alone, from unstimulated lysates incubated with kinase buffer alone ( lane5), with both kinase buffer and phospho- TAM peptide ( lane6), with kinase buffer and phospho- TAM peptide ( lane7), and with kinase buffer and unphosphorylated TAM peptide ( lane8) is shown. The same blot was analyzed by anti-Syk Western blotting ( bottompanel). Only the Syk portion of the lanes is shown. The arrows indicate the position of the Syk bands.



Tyrosine phosphorylation of Syk following receptor aggregation correlates with its increased kinase activity in several systems (22, 29, 30) . Therefore, we examined whether phospho- TAM peptide could stimulate Syk catalytic activity. Syk immunoprecipitated from detergent lysates of unactivated RBL cells was incubated with 5 µM peptides in the presence of kinase assay buffer and exogenous substrate. The substrate employed was a GST fusion protein containing a peptide from the cytoplasmic portion of the band 3 protein, a substrate of Syk identified in erythrocytes (27) . At 5 µM phospho- TAM peptide, Syk kinase activity toward the GST-band 3 substrate was increased 5-fold, while the same concentration of phospho- TAM or hemi-phosphorylated TAM peptides induced 2-fold or less activation (Fig. 2, A and B). This effect was dose-dependent; phospho- TAM peptide stimulated a maximal 10-fold increase in Syk kinase activity at about 25 µM, with half-maximal activation at 1-2 µM (Fig. 2 C). In contrast, the phospho- TAM peptide induced activation only at much higher concentrations and showed a lower peak activation in the concentration range tested. This peptide-induced activation was not an effect of the immunoprecipitating antiserum, as experiments with partially purified human Syk produced in baculovirus-infected insect cells showed similar kinetics of kinase activity stimulation with phospho- and TAM peptides.() A second antiserum, directed against a peptide epitope from the ``spacer'' region between the Syk C-SH2 domain and the catalytic domain (see ``Materials and Methods''), gave similar results in the in vitro kinase assay (Fig. 3, spacer; compare with Fig. 2B). These results show that tyrosine-phosphorylated FcRI TAM peptides, which have been shown to bind to the Syk SH2 domains (24) , can stimulate Syk catalytic activity.


Figure 2: Tyrosine-phosphorylated TAM peptides stimulate the kinase activity of Syk. A, autoradiograph of a Syk kinase assay in the presence of 5 µM TAM peptides. Syk was immunoprecipitated from Nonidet P-40 lysates of antigen-activated (+ DNP) or unstimulated cells (- DNP) and assayed with 5 µM of the indicated peptides. The positions of Syk and of the exogenous substrate, GST-band 3, are indicated. B, bargraph showing the relative Syk kinase activity after incubation with TAM peptides. Tyrosine kinase activity toward the exogenous substrate GST-band 3 was quantitated by PhosphorImager, and the activity relative to that of Syk from unstimulated cells (-DNP) was graphed. The data shown are the average of two experiments with similar data. C, dose-response of Syk kinase activity with increasing phospho-TAM peptide. Circles, phospho- TAM peptide; triangles, phospho- TAM peptide. Tyrosine kinase activity toward the exogenous substrate GST-band 3 was quantitated by PhosphorImager analysis, and the data were plotted as -fold increase in activity. Each point is the average of at least three data points culled from a total of six separate experiments.




Figure 3: An antibody to the carboxyl-terminal amino acids of Syk inhibits phosphopeptide-induced activation of Syk kinase activity. Syk immunoprecipitated from antigen-activated (+ DNP) or unstimulated (- DNP) lysates with either an antiserum directed against a peptide epitope of the region between the C-SH2 domain and the kinase domain ( spacer, hatchedbars) or an antiserum raised against the carboxyl-terminal 16 amino acids of Syk (syk2, filled bars) was subjected to kinase assays in the presence of 5 µM peptides indicated. Tyrosine kinase activity toward the exogenous substrate GST-band 3 was quantitated by PhosphorImager, and the data were plotted as in Fig. 2 B. The data shown are the average of two experiments with similar data.



It is unclear how ligand binding by the Syk SH2 domains might modulate catalytic activity. In vitro kinase assay results with a third antiserum, raised against the carboxyl-terminal 16 amino acids of Syk, suggest further complexity to Syk activation by phospholigand binding. Phospho-TAM peptides were not able to stimulate the kinase activity of Syk immunoprecipitated with this antiserum (syk2) from unstimulated RBLs, in contrast to the in vitro kinase assays performed with the antisera described above (Fig. 3). This was not due to general repression of kinase activity, as Syk immunoprecipitated with syk2 from lysates of activated RBLs displayed elevated kinase activity relative to Syk from unstimulated lysates, as previously shown (Fig. 3, syk2, -/+ DNP) (22) . Rather, the syk2 antibody appears to interfere with phospholigand activation of Syk during the in vitro kinase assay. Similar to the other antisera, syk2 immunoprecipitates of Syk from activated RBL lysates did show an increase in kinase activity in the presence of phospho- TAM peptide (+ DNP, phospho- TAM). Thus, activation of RBL cells prior to Syk immunoprecipitation appears to abrogate syk2-mediated inhibition of phosphopeptide-stimulated kinase activity. The results obtained with the syk2 antiserum suggest that the carboxyl-terminal amino acids participate in activation of the Syk catalytic domain.

The data in this report provide evidence that the tyrosine phosphorylation and catalytic activity of Syk are stimulated by tyrosine-phosphorylated FcRI TAM sequences. Cross-linking of chimeric receptors containing the cytoplasmic portion of the subunit of FcRI is sufficient to induce effector functions associated with cross-linking of the multimeric receptor (14, 15) . In contrast, similar chimeras of the subunit are unable to signal (31) . We previously showed that the phosphorylated TAM exhibited a 40-fold higher relative affinity than the phosphorylated TAM for the SH2 domains of the 72-kilodalton protein tyrosine kinase Syk (24) . In this report, we show that both the tyrosine phosphorylation and catalytic activity of Syk are increased by incubation with phospho- TAM peptides, while phospho- TAM peptides had little effect. These and other results suggest that binding of Syk to the phosphorylated TAM following receptor engagement is important for activation, while the lower affinity of the TAM for the Syk SH2 domains may preclude its interaction with Syk in vivo.

The differential activities of phospho- and - TAM peptides in the assays described in this report correlate with their relative affinities for the tandem SH2 domains of Syk. As expected, the doubly phosphorylated TAM, in comparison with the hemi-phosphorylated version, exhibits increased affinity for the tandem Syk SH2 domains, probably due to its ability to occupy both SH2 domains. The basis for the lower affinity of the doubly phosphorylated TAM is not well defined, but sequence differences at the non-conserved positions of the TAMs and the difference in spacing between the two Y XXL motifs of the compared with the TAM are likely to be important. Further studies with mutant TAMs will be aimed at defining the relationship between Syk SH2 domain occupation and stimulation of kinase activity.

The mechanism by which Syk catalytic activity is stimulated by phospho-TAM peptides is not clear. Binding of phosphopeptide ligands to the SH2 domains of the protein tyrosine phosphatases SH-PTP1 and SH-PTP2 and phosphatidylinositol 3-kinase have been shown to stimulate their respective catalytic activities (32, 33, 34, 35, 36) . Syk SH2 domain binding of ligand may relieve repression of catalytic activity by an intramolecular interaction. Alternatively, occupation of the SH2 domain binding sites may switch the kinase domain into an active conformation via allosteric interactions. For SH-PTP1 and SH-PTP2, the two SH2 domains exert a negative regulatory influence on the catalytic domain (37, 38) . Preliminary data suggest that the tandem SH2 domains of Syk also play an inhibitory role. A proteolytic fragment of Syk containing only the kinase domain exhibits elevated catalytic activity relative to the wild-type protein and does not respond to phospho- TAM peptide with an increase in activity. Like the SH-PTPs, Syk is not basally phosphorylated on tyrosine so the autoinhibitory influence of the SH2 domains would appear to be independent of intramolecular SH2-phosphotyrosine interactions, as has been described for Src (39) . Future studies with mutant Syk proteins will be aimed at understanding how the SH2 domains regulate the catalytic domain of Syk.

Our data further suggest that the carboxyl-terminal residues of Syk may be involved in regulation of Syk kinase activity. Phospho- TAM peptides were not able to stimulate the kinase activity of Syk immunoprecipitated with an antiserum against the carboxyl-terminal tail of Syk. This is in contrast to results obtained with partially purified baculovirus-produced Syk and with Syk immunoprecipitated with other antisera, suggesting that antibody bound to the carboxyl-terminal amino acids somehow blocks phospholigand activation of Syk. However, phospho- TAM peptide did increase the kinase activity of Syk immunoprecipitated from antigen-activated RBL lysates. These results suggest one possible model for phospholigand activation of Syk catalytic activity, where the carboxyl-terminal tail participates in an initial step required for activation of the catalytic domain, such as residue modifications or a conformational change. Syk immunoprecipitated from lysates of antigen-activated RBL lysates is already in an ``active'' configuration, and its kinase domain would no longer be affected by antibody bound to the carboxyl-terminal tail. Our data suggest that stimulation of Syk catalytic activity by phospholigand binding to the Syk SH2 domains involves the carboxyl-terminal tail of Syk.

The carboxyl-terminal sequences of a number of protein kinases, including myosin light chain kinase and calmodulin-dependent kinase, have been shown to exert an autoinhibitory effect (40) . The recent crystal structure of the twitchin kinase shows that the carboxyl-terminal residues responsible for autoinhibition directly contact the kinase domain and block access to the catalytic cleft (41) . The carboxyl-terminal tails of both SH-PTP1 and SH-PTP2 have also been implicated in negative regulation of their respective catalytic activities by the amino-terminal SH2 domains of each protein (35, 42) . These and other data suggest that Syk and the SH-PTPs may be regulated by a common mechanism. Studies with mutant Syk proteins are in progress to further probe the mechanism of inhibition and to determine the contributions of specific residues to regulation of catalytic activity.

Previous studies have demonstrated preferential association of Syk with the subunit of FcRI (23, 24, 43) . Extrapolating to the events that take place following receptor engagement in mast cells, these data imply that the interaction of Syk with phosphorylated TAM motifs of the subunit of FcRI is involved in receptor-mediated activation of Syk. Binding of Syk to FcRI via the phosphorylated TAMs may serve both to localize Syk to the plasma membrane and as an ``on'' switch for its catalytic activity. Activation of Syk molecules localized to aggregated receptors would facilitate tyrosine phosphorylation of critical substrates coclustered within the receptor complex. As Syk has been shown to couple with multimeric antigen receptors in several cell types (23, 29, 44) this may represent a general mechanism for Syk activation in this receptor family. Similarly, it has been shown that ZAP-70 recruitment to phosphorylated subunits is a critical step in the T cell receptor signaling cascade (13, 45, 46) .

Although our data suggest that binding of Syk to the tyrosine-phosphorylated TAM is sufficient to stimulate catalytic activity, we cannot rule out the possibility that other proteins may also be involved in Syk activation. While, at least in vitro, autophosphorylation is an integral part of catalytic activation for many tyrosine kinases, phosphorylation of Syk in vivo probably involves multiple sites, some of which may require the activity of heterologous kinases. Specific tyrosine-phosphorylated residues may play different roles in Syk-mediated signaling, contributing either to further enhance catalytic activity or possibly as binding sites for the SH2 domains of other signaling proteins. Cotransfection experiments in COS cells suggest that Src family kinases can activate Syk, possibly through a direct interaction (25, 30) . Lyn is also coclustered within the FcRI complex and may therefore interact with Syk during receptor-mediated signaling (20) . Experiments are in progress to further define the interactions between Syk, Lyn, and the TAM that are critical for Syk activation.

In conclusion, we report that phospho- TAM peptide stimulates the tyrosine phosphorylation and increases the kinase activity of Syk. Peptides with lower affinity for the Syk SH2 domains induced a correspondingly lower stimulation of catalytic activity. Finally, the carboxyl-terminal tail of Syk may also participate in phospholigand-induced activation. These results suggest a model where the SH2 domains of Syk are involved in autoregulatory interactions with the catalytic domain that are influenced by phospholigand binding. In mast cells and in basophils, binding of the Syk SH2 domains to the tyrosine-phosphorylated TAM of the subunit would presumably stimulate Syk catalytic activity and thus represent a critical event in the FcRI-mediated signaling cascade.


FOOTNOTES

*
This work was supported in part by National Institutes of Health Grant CA27951 from the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: ARIAD Phamaceuticals, Inc., 26 Landsdowne St., Cambridge, MA 02139. Tel.: 617-494-0400 (ext. 204); Fax: 617-494-0208.

The abbreviations used are: FcRI, the high affinity receptor for immunoglobulin E; SH2, Src homology 2; TAM, tyrosine-based activation motif; RBL, rat basophilic leukemia; GST, glutathione S-transferase; DNP, 2,4-dinitrophenol.

L. Zydowsky, M. Taylor, M. Botfield, J. Karas, and M. Zoller, unpublished observations.


ACKNOWLEDGEMENTS

We thank J. Green and O. M. Green for providing phosphorylated peptides; Wes Yonemoto, Tom Roberts, Brian Drucker, Joseph Bolen, Bruce Rowley, and Reuben Siraganian for providing the antibodies used in this report; Lynne Zydowsky, Martyn Botfield, Jenny Karas, Manfred Weigele, and Marta Taylor for helpful discussions; and Grant Hartzog, Ken Kaplan, Peter Hecht, Ed Clark, and Vic Rivera for critical reading of the manuscript.

Note Added in Proof-Rowley et al. (Rowley, B. R., Burkhardt, A. L., Chao, H-G., Matsueda, G. R., and Bolen, J. B. (1995) J. Biol. Chem. 270, in press) have detected similar activation of Syk by TAM phosphopeptides from the IgM receptor.


REFERENCES
  1. Beaven, M. A., and Metzger, H. (1993) Immunol. Today 14, 222-226 [CrossRef][Medline] [Order article via Infotrieve]
  2. Paolini, R., Numerof, R., and Kinet, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10733-10737 [Abstract/Free Full Text]
  3. Li, W., Deanin, G. G., Margolis, B., Schlessinger, J., and Oliver, J. M. (1992) Mol. Cell. Biol. 12, 3176-3182 [Abstract/Free Full Text]
  4. Stephan, V., Benhamou, M., Gutkind, S. J., Robbins, K. C., and Siraganian, R. P. (1992) J. Biol. Chem. 267, 5434-5441 [Abstract/Free Full Text]
  5. Keegan, A. D., and Paul, W. E. (1992) Immunol. Today 13, 63-68 [CrossRef][Medline] [Order article via Infotrieve]
  6. Reth, M. (1989) Nature 338, 383-384 [Medline] [Order article via Infotrieve]
  7. Samelson, L. E., and Klausner, R. D. (1992) J. Biol. Chem. 267, 24913-24916 [Free Full Text]
  8. Kinet, J. P. (1990) Curr. Opin. Immunol. 2, 499-505
  9. Romeo, C., Amiot, M., and Seed, B. (1992) Cell 68, 889-897 [CrossRef][Medline] [Order article via Infotrieve]
  10. Letourneur, F., and Klausner, R. D. (1992) Science 255, 79-82 [Abstract/Free Full Text]
  11. Irving, B. A., Chan, A. C., and Weiss, A. (1993) J. Exp. Med. 177, 1093-1103 [Abstract/Free Full Text]
  12. Straus, D. B., and Weiss, A. (1993) J. Exp. Med. 178, 1523-1530 [Abstract/Free Full Text]
  13. Koyasu, S., Tse, A. G. D., Moingeon, P., Hussey, R., Mildonian, A., Hannisian, J., Clayton, L. K., and Reinherz, E. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 6693-6697 [Abstract/Free Full Text]
  14. Letourneur, F., and Klausner, R. D. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8905-8909 [Abstract/Free Full Text]
  15. Eiseman, E., and Bolen, J. B. (1992) J. Biol. Chem. 267, 21027-21032 [Abstract/Free Full Text]
  16. Songyang, Z., Shoelson, S. E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J., Neel, B. G., Birge, R. B., Fajardo, J. E., Chou, M. M., Hanafusa, H., Schaffhausen, B., and Cantley, L. C. (1993) Cell 72, 767-778 [CrossRef][Medline] [Order article via Infotrieve]
  17. Songyang, Z., Shoelson, S. E., McGlade, J., Olivier, P., Pawson, T., Bustelo, X. R., Barbacid, M., Sabe, H., Hanafusa, H., Yi, T., Ren, R., Baltimore, D., Ratnofsky, S., Feldman, R. A., and Cantley, L. C. (1994) Mol. Cell. Biol. 14, 2777-2785 [Abstract/Free Full Text]
  18. Chan, A. C., Iwashima, M., Turck, C. W., and Weiss, A. (1992) Cell 71, 649-662 [CrossRef][Medline] [Order article via Infotrieve]
  19. Taniguchi, T., Kobayashi, T., Kondo, J., Takahashi, K., Nakamura, H., Suzuki, J., Nagai, K., Yamada, T., Nakamura, S., and Yamamura, H. (1991) J. Biol. Chem. 266, 15790-15796 [Abstract/Free Full Text]
  20. Eiseman, E., and Bolen, J. B. (1992) Nature 355, 78-80 [CrossRef][Medline] [Order article via Infotrieve]
  21. Hutchcroft, J. E., Geahlen, R. L., Deanin, G. G., and Oliver, J. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9107-9111 [Abstract/Free Full Text]
  22. Minoguchi, K., Benhamou, M., Swaim, W. D., Kawakami, Y., Kawakami, T., and Siraganian, R. P. (1994) J. Biol. Chem. 269, 16902-16908 [Abstract/Free Full Text]
  23. Benhamou, M., Ryba, N. J. P., Kihara, H., Nishikata, H., and Siraganian, R. P. (1993) J. Biol. Chem. 268, 23318-23324 [Abstract/Free Full Text]
  24. Shiue, L., Green, J., Green, O. M., Karas, J. L., Morgenstern, J. P., Ram, M. K., Taylor, M. K., Zoller, M. J., Zydowsky, L. D., Bolen, J. B., and Brugge, J. S. (1995) Mol. Cell. Biol. 15, 272-281 [Abstract]
  25. Couture, C., Baier, G., Altman, A., and Mustelin, T. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5301-5305 [Abstract/Free Full Text]
  26. Tanner, M. J. A., Martin, P. G., and High, S. (1988) Biochem. J. 256, 703-712 [Medline] [Order article via Infotrieve]
  27. Harrison, M. L., Isaacson, C. C., Burg, D. L., Geahlen, R. L., and Low, P. S. (1994) J. Biol. Chem. 269, 955-959 [Abstract/Free Full Text]
  28. Smith, D. B., and Johnson, K. S. (1988) Gene ( Amst.) 67, 31-40 [CrossRef][Medline] [Order article via Infotrieve]
  29. Hutchcroft, J. E., Harrison, M. L., and Geahlen, R. L. (1992) J. Biol. Chem. 267, 8613-8619 [Abstract/Free Full Text]
  30. Kurosaki, T., Takata, M., Yamanashi, Y., Inazu, T., Taniguchi, T., Yamamoto, T., and Yamamura, H. (1994) J. Exp. Med. 179, 1725-1729 [Abstract/Free Full Text]
  31. Jouvin, M-H. E., Adamczewski, M., Numerof, R., Letourneur, O., Valle, A., and Kinet, J. P. (1994) J. Biol. Chem. 269, 5918-5925 [Abstract/Free Full Text]
  32. Backer, J. M., Myers, M. G., Jr., Shoelson, S. E., Chin, D. J., Sun, X-J., Miralpeix, M., Hu, P., Margolis, B., Skolnik, E. Y., Schlessinger, J., and White, M. F. (1992) EMBO J. 11, 3469-3479 [Medline] [Order article via Infotrieve]
  33. Carpenter, C. L., Auger, K. R., Chanudhuri, M., Yoakim, M., Schaffhausen, B., Shoelson, S., and Cantley, L. C. (1993) J. Biol. Chem. 268, 9478-9483 [Abstract/Free Full Text]
  34. Lechleider, R. J., Sugimoto, S., Bennett, A. M., Kashishian, A. S., Cooper, J. A., Shoelson, S. E., Walsh, C. T., and Benjamin, G. N. (1993) J. Biol. Chem. 268, 21478-21481 [Abstract/Free Full Text]
  35. Sugimoto, S., Wandless, T. J., Shoelson, S. E., Neel, B. G., and Walsh, C. T. (1994) J. Biol. Chem. 269, 13614-13622 [Abstract/Free Full Text]
  36. Pluskey, S., Wandless, T. J., Walsh, C. T., and Shoelson, S. E. (1995) J. Biol. Chem. 270, 2897-2900 [Abstract/Free Full Text]
  37. Townley, R., Shen, S. H., Banville, D., and Ramachandran, C. (1993) Biochemistry 32, 13414-13418 [CrossRef][Medline] [Order article via Infotrieve]
  38. Dechert, U., Adam, M., Harder, K. W., Clark-Lewis, I., and Jirik, F. (1994) J. Biol. Chem. 269, 5602-5611 [Abstract/Free Full Text]
  39. Roussel, R. R., Brodeur, S. R., Shalloway, D., and Laudano, A. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 88, 10696-10700 [Abstract/Free Full Text]
  40. Kemp, B. E., Parker, M. W., Hu, S.-H., Tiganis, T., and House, C. (1994) Trends Biochem. Sci. 19, 440-444 [CrossRef][Medline] [Order article via Infotrieve]
  41. Hu, S.-H., Parker, M. J., Lei, J. Y., Wilce, M. C. J., Benlan, G. M., and Kemp, B. E. (1994) Nature 369, 581-584 [CrossRef][Medline] [Order article via Infotrieve]
  42. Zhao, Z., Bouchard, P., Diltz, C. D., Shen, S. H., and Fischer, E. H. (1993) J. Biol. Chem. 268, 2816-2820 [Abstract/Free Full Text]
  43. Kihara, H., and Siraganian, R. P. (1994) J. Biol. Chem. 269, 22427-22432 [Abstract/Free Full Text]
  44. Chan, A. C., van Oers, N. S. C., Tran, A., Turka, L., Law, C. L., Ryan, J. C., Clark, E. A., and Weiss, A. (1994) J. Immunol. 152, 4758-4766
  45. Chan, A., Irving, B. A., Fraser, J. D., and Weiss, A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9166-9170 [Abstract/Free Full Text]
  46. Iwashima, M., Irving, B. A., van Oers, N. S. C., Chan, A. C., and Weiss, A. (1994) Science 263, 1136-1139 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. S. Gounni
The high-affinity IgE receptor (Fc{epsilon}RI): a critical regulator of airway smooth muscle cells?
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L312 - L321.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Simon, L. Vanes, R. L. Geahlen, and V. L. J. Tybulewicz
Distinct Roles for the Linker Region Tyrosines of Syk in Fc{epsilon}RI Signaling in Primary Mast Cells
J. Biol. Chem., February 11, 2005; 280(6): 4510 - 4517.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Hernandez-Hansen, A. J. Smith, Z. Surviladze, A. Chigaev, T. Mazel, J. Kalesnikoff, C. A. Lowell, G. Krystal, L. A. Sklar, B. S. Wilson, et al.
Dysregulated Fc{epsilon}RI Signaling and Altered Fyn and SHIP Activities in Lyn-Deficient Mast Cells
J. Immunol., July 1, 2004; 173(1): 100 - 112.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Charles, R. C. Monteiro, and M. Benhamou
p28, a Novel IgE Receptor-associated Protein, Is a Sensor of Receptor Occupation by Its Ligand in Mast Cells
J. Biol. Chem., March 26, 2004; 279(13): 12312 - 12318.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. Qu, K. Sada, S. Kyo, K. Maeno, S. M. S. Miah, and H. Yamamura
Negative regulation of Fc{epsilon}RI-mediated mast cell activation by a ubiquitin-protein ligase Cbl-b
Blood, March 1, 2004; 103(5): 1779 - 1786.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Krishnan, D. L. Farber, and G. C. Tsokos
T Cell Rewiring in Differentiation and Disease
J. Immunol., October 1, 2003; 171(7): 3325 - 3331.
[Full Text] [PDF]


Home page
Sci SignalHome page
J. Schlessinger and M. A. Lemmon
SH2 and PTB Domains in Tyrosine Kinase Signaling
Sci. Signal., July 15, 2003; 2003(191): re12 - re12.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. P. Nambiar, C. U. Fisher, A. Kumar, C. G. Tsokos, V. G. Warke, and G. C. Tsokos
Forced Expression of the Fc Receptor {gamma}-Chain Renders Human T Cells Hyperresponsive to TCR/CD3 Stimulation
J. Immunol., March 15, 2003; 170(6): 2871 - 2876.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Zhang, E. Berenstein, and R. P. Siraganian
Phosphorylation of Tyr342 in the Linker Region of Syk Is Critical for Fc{varepsilon}RI Signaling in Mast Cells
Mol. Cell. Biol., December 1, 2002; 22(23): 8144 - 8154.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. G. Woodside, A. Obergfell, A. Talapatra, D. A. Calderwood, S. J. Shattil, and M. H. Ginsberg
The N-terminal SH2 Domains of Syk and ZAP-70 Mediate Phosphotyrosine-independent Binding to Integrin beta Cytoplasmic Domains
J. Biol. Chem., October 11, 2002; 277(42): 39401 - 39408.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Paar, N. T. Harris, D. Holowka, and B. Baird
Bivalent Ligands with Rigid Double-Stranded DNA Spacers Reveal Structural Constraints on Signaling by Fc{epsilon}RI
J. Immunol., July 15, 2002; 169(2): 856 - 864.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
D. G. Woodside
Dancing with Multiple Partners
Sci. Signal., March 19, 2002; 2002(124): pe14 - pe14.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Lara, E. Ortega, I. Pecht, J. R. Pfeiffer, A. M. Martinez, R. J. Lee, Z. Surviladze, B. S. Wilson, and J. M. Oliver
Overcoming the Signaling Defect of Lyn-Sequestering, Signal-Curtailing Fc{epsilon}RI Dimers: Aggregated Dimers Can Dissociate from Lyn and Form Signaling Complexes with Syk
J. Immunol., October 15, 2001; 167(8): 4329 - 4337.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Sada, J. Zhang, and R. P. Siraganian
SH2 domain-mediated targeting, but not localization, of Syk in the plasma membrane is critical for Fc{epsilon}RI signaling
Blood, March 1, 2001; 97(5): 1352 - 1359.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. A. Field, J. R. Apgar, E. Hong-Geller, R. P. Siraganian, B. Baird, and D. Holowka
Mutant RBL Mast Cells Defective in Fcepsilon RI Signaling and Lipid Raft Biosynthesis Are Reconstituted by Activated Rho-family GTPases
Mol. Biol. Cell, October 1, 2000; 11(10): 3661 - 3673.
[Abstract] [Full Text]


Home page
J. Cell Biol.Home page
B. S. Wilson, J. R. Pfeiffer, and J. M. Oliver
Observing Fc{epsilon}RI Signaling from the Inside of the Mast Cell Membrane
J. Cell Biol., May 29, 2000; 149(5): 1131 - 1142.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Murakami, S. Sato, S. Nagasawa, and T. Yamashita
Regulation of mast cell signaling through high-affinity IgE receptor by CD45 protein tyrosine phosphatase
Int. Immunol., February 1, 2000; 12(2): 169 - 176.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Sada, J. Zhang, and R. P. Siraganian
Point Mutation of a Tyrosine in the Linker Region of Syk Results in a Gain of Function
J. Immunol., January 1, 2000; 164(1): 338 - 344.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Zhang and R. P. Siraganian
CD45 Is Essential for Fc{epsilon}RI Signaling by ZAP70, But Not Syk, in Syk-Negative Mast Cells
J. Immunol., September 1, 1999; 163(5): 2508 - 2516.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Wofsy, B. M. Vonakis, H. Metzger, and B. Goldstein
One Lyn molecule is sufficient to initiate phosphorylation of aggregated high-affinity IgE receptors
PNAS, July 20, 1999; 96(15): 8615 - 8620.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Weil, J.-P. Levraud, M. D. Dodon, C. Bessia, U. Hazan, P. Kourilsky, and A. Israël
Altered Expression of Tyrosine Kinases of the Src and Syk Fam