|
|
||||||||
From the
Engagement of the high affinity receptor for immunoglobulin E
(Fc
Aggregation of the high affinity receptor for immunoglobulin E
(Fc
When TAM-containing
cytoplasmic domains are expressed as chimeric receptors with a
heterologous extracellular domain, they can elicit the full spectrum of
responses seen with cross-linking of complete multimeric receptors.
Cross-linking of chimeric receptors containing the cytoplasmic portions
of the T cell receptor subunits
In RBL cells, both Src family kinases and Syk associate with
Fc
In this report, we have investigated
whether Syk binding of tyrosine-phosphorylated TAMs can stimulate the
catalytic activity of Syk. We found that a peptide representing the
tyrosine-phosphorylated
For peptide addition to cytosol, cytosolic lysates
were incubated at 30 °C for 15 min in a final buffer of 150
mM NaCl, 10 mM KCl, 20 mM Tris, pH 7.5, 0.6
mM MgCl
Immunoprecipitations of 0.5 mg of total cellular protein were
incubated for 3-12 h at 4 °C, and immune complexes were
collected with protein A-Sepharose beads (Pierce). SDS-polyacrylamide
gel electrophoresis and Western blotting were performed as described
previously
(24) .
Kinase reaction products were separated by 10% SDS-polyacrylamide
gel electrophoresis, fixed in a solution of 40% methanol and 10% acetic
acid, and then treated with 1 M KOH at 55 °C for 1 h.
Treated gels were dried and exposed to Hyperfilm-MP (Amersham Corp.) or
quantitatively analyzed by PhosphorImaging.
Following Fc
The data in this report provide evidence that the
tyrosine phosphorylation and catalytic activity of Syk are stimulated
by tyrosine-phosphorylated Fc
The differential
activities of phospho-
The
mechanism by which Syk catalytic activity is stimulated by phospho-TAM
peptides is not clear. Binding of phosphopeptide ligands to the SH2
domains of the protein tyrosine phosphatases SH-PTP1 and SH-PTP2 and
phosphatidylinositol 3-kinase have been shown to stimulate their
respective catalytic activities
(32, 33, 34, 35, 36) . Syk SH2
domain binding of ligand may relieve repression of catalytic activity
by an intramolecular interaction. Alternatively, occupation of the SH2
domain binding sites may switch the kinase domain into an active
conformation via allosteric interactions. For SH-PTP1 and SH-PTP2, the
two SH2 domains exert a negative regulatory influence on the catalytic
domain
(37, 38) . Preliminary data suggest that the
tandem SH2 domains of Syk also play an inhibitory role. A proteolytic
fragment of Syk containing only the kinase domain exhibits elevated
catalytic activity relative to the wild-type protein and does not
respond to phospho-
Our data further suggest that the carboxyl-terminal residues of Syk
may be involved in regulation of Syk kinase activity. Phospho-
The carboxyl-terminal sequences of a
number of protein kinases, including myosin light chain kinase and
calmodulin-dependent kinase, have been shown to exert an autoinhibitory
effect
(40) . The recent crystal structure of the twitchin
kinase shows that the carboxyl-terminal residues responsible for
autoinhibition directly contact the kinase domain and block access to
the catalytic cleft
(41) . The carboxyl-terminal tails of both
SH-PTP1 and SH-PTP2 have also been implicated in negative regulation of
their respective catalytic activities by the amino-terminal SH2 domains
of each protein
(35, 42) . These and other data suggest
that Syk and the SH-PTPs may be regulated by a common mechanism.
Studies with mutant Syk proteins are in progress to further probe the
mechanism of inhibition and to determine the contributions of specific
residues to regulation of catalytic activity.
Previous studies have
demonstrated preferential association of Syk with the
Although our data suggest that
binding of Syk to the tyrosine-phosphorylated
In conclusion, we report that
phospho-
We thank J. Green and O. M. Green for providing
phosphorylated peptides; Wes Yonemoto, Tom Roberts, Brian Drucker,
Joseph Bolen, Bruce Rowley, and Reuben Siraganian for providing the
antibodies used in this report; Lynne Zydowsky, Martyn Botfield, Jenny
Karas, Manfred Weigele, and Marta Taylor for helpful discussions; and
Grant Hartzog, Ken Kaplan, Peter Hecht, Ed Clark, and Vic Rivera for
critical reading of the manuscript.
Note Added in
Proof-Rowley et al. (Rowley, B. R., Burkhardt, A.
L., Chao, H-G., Matsueda, G. R., and Bolen, J. B. (1995) J. Biol.
Chem.
270, in press) have detected similar activation of
Syk by TAM phosphopeptides from the IgM receptor.
Volume 270,
Number 18,
Issue of May 5, pp. 10498-10502, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
RI) on the surface of mast cells induces tyrosine
phosphorylation of numerous cellular proteins. Syk, one of several
non-receptor protein tyrosine kinases implicated in Fc
RI
signaling, is activated following receptor cross-linking and associates
with phosphorylated
subunits of Fc
RI. We previously showed
that the Src homology 2 (SH2) domains of Syk bind with high affinity to
the conserved tyrosine-based activation motif (TAM) of the
subunit in vitro. In this report, we show that a
tyrosine-phosphorylated
TAM peptide induced tyrosine
phosphorylation of Syk in RBL-2H3 cell lysates and stimulated Syk
kinase activity 10-fold in vitro, with half-maximal activation
at 1-2 µM. A similar
subunit TAM peptide
showed much lower stimulation of Syk tyrosine phosphorylation and
kinase activity. Phosphopeptide-induced activation was inhibited by an
antiserum to the carboxyl-terminal tail of Syk, suggesting that those
amino acids are also involved in Syk activation. These results indicate
that the catalytic domain of Syk may be regulated by intramolecular
interactions with adjacent domains and suggest that Syk binding to
phosphorylated subunits following Fc
RI engagement in
vivo stimulates Syk kinase activity.
RI)
(
)
on basophils and mast cells results
in the activation of many biochemical events, culminating in the
extracellular release of various immune response mediators
(1) .
Tyrosine phosphorylation of numerous cellular proteins, including
FcRI subunits, is an early and essential event in
receptor-mediated signaling
(2, 3, 4) .
Fc
RI is a member of the multisubunit antigen receptor family,
whose members lack intrinsic tyrosine kinase activity and therefore
rely on recruitment and activation of non-receptor protein tyrosine
kinases for signal transduction
(5) . The conserved
tyrosine-based activation motifs (TAMs)
identified in the cytoplasmic tails of several subunits of this
receptor family, with the general consensus of D/E-X
-Y-X
-L/I-X-Y-X
-L/I,
have been shown to be of critical importance for receptor-mediated
activation
(6, 7) . Many of the receptors in this family
harbor multiple TAMs. FcRI, a tetrameric
![]()
![]()
complex, contains three: one in the
subunit and one in each
of the two subunits
(8) .
and
or the
subunit of
Fc
RI activates calcium influx, cytolytic activity, and
interleukin-2 production in T cells
(9, 10, 11, 12, 13) . Similarly,
in RBL-2H3 cells, which are derived from a rat basophilic leukemia,
cross-linking of chimeric receptors containing the cytoplasmic tails of
and
induces increased tyrosine phosphorylation, calcium
influx, and degranulation
(14, 15) . Mutation of the
conserved tyrosine or leucine residues or alteration of the spacing
between the Y XX(L/I) motifs of the TAMs abolishes signal
transduction (9, 13, 14). Y XX(L/I) motifs, when
phosphorylated on tyrosine, represent high affinity binding sites for
some Src homology 2 (SH2) domains, including those of the Src and Syk
families of protein tyrosine kinases
(16, 17) . The dual
Y XXLs of the TAMs are potential binding sites for proteins
such as the Syk and ZAP-70 tyrosine kinases, which contain two SH2
domains amino-terminal of a catalytic domain
(18, 19) .
RI and are activated following receptor aggregation
(20, 21, 22) . Syk becomes
tyrosine-phosphorylated and associates with tyrosine-phosphorylated
Fc
RI subunits, predominantly with
subunits
(23) . We
showed previously that Syk was the major protein affinity-isolated from
RBL cell lysates by phosphorylated
TAM peptide ligand
(24) . Together, the above data suggest that Syk binding of the
phosphorylated
TAM is involved in Fc
RI-mediated signaling.
However, the mechanism of Syk activation following receptor
cross-linking is still unknown.
subunit TAM induced tyrosine
phosphorylation of Syk in cytosolic lysates of RBL cells. In addition,
Syk kinase activity was greatly increased in response to incubation
with the phosphorylated
TAM peptide but not with a similar
subunit TAM peptide. Phosphopeptide stimulation of kinase activity was
inhibited by an antibody directed against the carboxyl-terminal amino
acids of Syk. These results suggest that phospholigand binding by the
Syk SH2 domains can stimulate the catalytic domain and that activation
of catalytic activity also involves the carboxyl-terminal tail of Syk.
Cell Culture and Lysis
RBL-2H3 cells were
cultured, activated with IgE against 2,4-dinitrophenol (DNP) and 1
µg/ml DNP conjugated to bovine serum albumin, and lysed in 1%
Nonidet P-40 containing buffer as described previously. Hypotonic lysis
and isolation of the cytosolic of RBLs were also previously described
(24) .
, 0.6 mM MnCl
, 50
µM ATP, 0.5 mM EGTA, 2 mM
dithiothreitol, 5 mM sodium fluoride, 1 mM sodium
pyrophosphate, 1 mM sodium orthovanadate, 1 mM
phenylmethylsulfonyl fluoride, 10 units/ml aprotinin, 50 µg/ml
leupeptin, 100 µg/ml soybean trypsin inhibitor, with or without 5
µM peptides. Reactions were terminated by addition of
Nonidet P-40 to a final concentration of 1%.
Immunoprecipitations
4G10 antibody to
phosphotyrosine was the gift of Tom Roberts and Brian Drucker. BR15
antibody to Syk, similar to that previously described
(25) , was
from Joseph Bolen and Bruce Rowley. Syk2 antibody to the peptide
sequence CAVELRLRNYYYDVVN of Syk was obtained from Reuben Siraganian
(22) . AR21 antibody was made as described previously to the
peptide sequence EPTGGAWGPDRGLC of Syk
(23) .
Peptide Synthesis
Peptides were synthesized as
described previously
(24) . Peptides were dissolved in 25
mM HEPES, pH 7.4, 10 mM MgCl
, and 100
µg/ml bovine serum albumin and diluted as indicated.
In Vitro Kinase Assays
For in vitro kinase assays, immunoprecipitates were washed three times with
Nonidet P-40 lysis buffer and then once with buffer containing 150
mM NaCl, 50 mM HEPES, pH 7.5, 1 mM sodium
vanadate, and 1 mM phenylmethylsulfonyl fluoride. Pellets were
resuspended in kinase buffer (10 mM MgCl
, 2
mM MnCl
, 30 mM HEPES, pH 7.5, 1
µM ATP, 2 µg of GST-band 3, 5 µCi of
[-
P]ATP, and 1 mM sodium
orthovanadate) with or without peptides and incubated at 30 °C for
10 min. Reactions were terminated by addition of sample buffer.
GST-Band 3 Substrate Protein
The protein substrate
for Syk phosphorylation was a fusion of amino acids 1-18
(MEELQDDYEDMMEENLEQ) of human band 3
(26, 27) and GST.
The fusion protein was expressed in Escherichia coli from the
vector pGEX-band 3, constructed by cloning a synthetic DNA fragment
into BamHI- and EcoRI-digested pGEX-KT. The DNA
fragment encoding human band 3
(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18) was prepared by annealing two synthetic oligonucleotides:
band3Top
(5`GATCCGGTATGGAAGAACTGCAGGACGACTACGAAGACATGA-TGGAAGAAAACCTGGAACAGTAATGAG)
and band3Bottom
(5`AAT-TCTCATTACTGTTCCAGGTTTTCTTCCATCATGTCTTCGTAGTCG-TCCTGCAGTTCTTCCATACCG).
Expression and purification of GST-band 3 was accomplished by a
modification of Smith and Johnson
(28) involving affinity
purification on a glutathione-agarose matrix (Sigma) and dialysis
against 25 mM NaCl, 25 mM HEPES, 0.5 mM
EDTA.
RI cross-linking by antigen, Syk becomes
tyrosine-phosphorylated and exhibits increased catalytic activity
(22, 23) . The mechanism of Syk activation following
receptor engagement is not clear, but Syk recruitment to activated
receptors may be important, since Syk associates with
tyrosine-phosphorylated
subunits in activated RBL-2H3 cell
lysates
(22) . We investigated whether Syk interaction with
tyrosine-phosphorylated TAMs could stimulate tyrosine phosphorylation
and catalytic activity of Syk using peptides derived from the Fc
RI
and
subunit TAMs (Fig. 1 A). To examine the
effect of phosphopeptides on Syk phosphorylation in the absence of
membrane-associated proteins, we utilized the cytosolic fraction of RBL
cells, which contains the majority of cellular Syk
(24) .
Cytosolic lysates of RBL cells were incubated with 5 µM
peptides and kinase buffer (containing 50 µM ATP, 0.6
mM MgCl
, and 0.6 mM MnCl
).
Syk was then immunoprecipitated and analyzed by anti-phosphotyrosine
immunoblotting. Syk becomes tyrosine-phosphorylated after receptor
aggregation (Fig. 1 B, upperpanel,
lane1)
(23, 24) , while in cytosolic
lysates of unstimulated RBLs, Syk is unphosphorylated ( lane2). When cytosolic lysates of unstimulated cells were
incubated with kinase buffer and 5 µM phospho- TAM
peptide, there was a significant stimulation of Syk phosphorylation on
tyrosine ( lane7). This effect was dependent on
tyrosine phosphorylation of the
TAM peptide as an
unphosphorylated peptide had no effect ( lane8).
Incubation of cytosolic lysates with 5 µM phospho-
TAM peptide induced little tyrosine phosphorylation ( lane6), indicating that the Syk activation was selective for
the phospho- TAM at this peptide concentration. No change in
tyrosine phosphorylation of Syk was detected in lysates incubated with
5 µM phospho-
or
TAM peptide alone or with
kinase buffer alone ( lanes 3-5). We could not readily
determine whether the phospho- TAM peptide effect on Syk
phosphorylation was direct. However, examination of the total
phosphotyrosine content of treated lysates showed that the
phospho-
TAM peptide did not generally increase tyrosine
phosphorylation of lysate proteins, suggesting that the peptide may
specifically affect Syk (data not shown). In addition to the increase
in tyrosine phosphorylation, Syk protein exhibited a shift in
electrophoretic mobility to a more slowly migrating species, revealed
by reprobing the same blot with anti-Syk antiserum
(Fig. 1 B, bottompanel, lane7). Following receptor engagement in RBL cells, a
fraction of cellular Syk becomes phosphorylated and mobility-shifted
(23) (undetectable in lane1). Thus, the
effects of the phospho-
TAM peptide on Syk are consistent with a
model where Syk phosphorylation is stimulated by the binding of
phosphorylated
TAMs on aggregated receptors.
Figure 1:
Phospho- TAM peptide stimulates
tyrosine phosphorylation of Syk in cytosolic lysates of RBLs.
A, sequence of the human TAM peptides employed in this report.
Y XX(L/I) motifs are underlined, and the positions of
phosphorylated tyrosines are indicated. B, cytosolic lysates
were incubated with peptides and buffer as described under
``Materials and Methods.'' Syk was immunoprecipitated and
analyzed by Western blotting with anti-phosphotyrosine antibody
( toppanel). Syk from lysates of DNP-stimulated cells
( lane1), from unstimulated cell lysates ( lane2), from unstimulated lysates incubated with either
phospho-
TAM ( lane3) or phospho-
TAM
peptide ( lane4) alone, from unstimulated lysates
incubated with kinase buffer alone ( lane5), with
both kinase buffer and phospho-
TAM peptide ( lane6), with kinase buffer and phospho- TAM peptide
( lane7), and with kinase buffer and unphosphorylated
TAM peptide ( lane8) is shown. The same blot
was analyzed by anti-Syk Western blotting ( bottompanel). Only the Syk portion of the lanes is
shown. The arrows indicate the position of the Syk
bands.
Tyrosine
phosphorylation of Syk following receptor aggregation correlates with
its increased kinase activity in several systems
(22, 29, 30) . Therefore, we examined whether
phospho- TAM peptide could stimulate Syk catalytic activity. Syk
immunoprecipitated from detergent lysates of unactivated RBL cells was
incubated with 5 µM peptides in the presence of kinase
assay buffer and exogenous substrate. The substrate employed was a GST
fusion protein containing a peptide from the cytoplasmic portion of the
band 3 protein, a substrate of Syk identified in erythrocytes
(27) . At 5 µM phospho-
TAM peptide, Syk
kinase activity toward the GST-band 3 substrate was increased 5-fold,
while the same concentration of phospho-
TAM or
hemi-phosphorylated TAM peptides induced 2-fold or less
activation (Fig. 2, A and B). This effect was
dose-dependent; phospho-
TAM peptide stimulated a maximal 10-fold
increase in Syk kinase activity at about 25 µM, with
half-maximal activation at 1-2 µM
(Fig. 2 C). In contrast, the phospho-
TAM peptide
induced activation only at much higher concentrations and showed a
lower peak activation in the concentration range tested. This
peptide-induced activation was not an effect of the immunoprecipitating
antiserum, as experiments with partially purified human Syk produced in
baculovirus-infected insect cells showed similar kinetics of kinase
activity stimulation with phospho- and
TAM
peptides.
(
)
A second antiserum, directed against
a peptide epitope from the ``spacer'' region between the Syk
C-SH2 domain and the catalytic domain (see ``Materials and
Methods''), gave similar results in the in vitro kinase
assay (Fig. 3, spacer; compare with
Fig. 2B). These results show that
tyrosine-phosphorylated FcRI TAM peptides, which have been shown
to bind to the Syk SH2 domains
(24) , can stimulate Syk
catalytic activity.
Figure 2:
Tyrosine-phosphorylated TAM peptides
stimulate the kinase activity of Syk. A, autoradiograph of a
Syk kinase assay in the presence of 5 µM TAM peptides. Syk
was immunoprecipitated from Nonidet P-40 lysates of antigen-activated
(+ DNP) or unstimulated cells (- DNP) and
assayed with 5 µM of the indicated peptides. The positions
of Syk and of the exogenous substrate, GST-band 3, are indicated.
B, bargraph showing the relative Syk kinase
activity after incubation with TAM peptides. Tyrosine kinase activity
toward the exogenous substrate GST-band 3 was quantitated by
PhosphorImager, and the activity relative to that of Syk from
unstimulated cells (-DNP) was graphed. The data shown are the
average of two experiments with similar data. C, dose-response
of Syk kinase activity with increasing phospho-TAM peptide.
Circles, phospho- TAM peptide; triangles,
phospho-
TAM peptide. Tyrosine kinase activity toward the
exogenous substrate GST-band 3 was quantitated by PhosphorImager
analysis, and the data were plotted as -fold increase in activity. Each
point is the average of at least three data points culled from
a total of six separate experiments.
Figure 3:
An antibody to the carboxyl-terminal amino
acids of Syk inhibits phosphopeptide-induced activation of Syk kinase
activity. Syk immunoprecipitated from antigen-activated
(+ DNP) or unstimulated (- DNP) lysates with
either an antiserum directed against a peptide epitope of the region
between the C-SH2 domain and the kinase domain ( spacer,
hatchedbars) or an antiserum raised against the
carboxyl-terminal 16 amino acids of Syk (syk2, filled bars) was
subjected to kinase assays in the presence of 5 µM
peptides indicated. Tyrosine kinase activity toward the exogenous
substrate GST-band 3 was quantitated by PhosphorImager, and the data
were plotted as in Fig. 2 B. The data shown are the average of
two experiments with similar data.
It is unclear how ligand binding by the Syk SH2
domains might modulate catalytic activity. In vitro kinase
assay results with a third antiserum, raised against the
carboxyl-terminal 16 amino acids of Syk, suggest further complexity to
Syk activation by phospholigand binding. Phospho-TAM peptides were not
able to stimulate the kinase activity of Syk immunoprecipitated with
this antiserum (syk2) from unstimulated RBLs, in contrast to the in
vitro kinase assays performed with the antisera described above
(Fig. 3). This was not due to general repression of kinase
activity, as Syk immunoprecipitated with syk2 from lysates of activated
RBLs displayed elevated kinase activity relative to Syk from
unstimulated lysates, as previously shown (Fig. 3, syk2,
-/+ DNP)
(22) . Rather, the syk2 antibody
appears to interfere with phospholigand activation of Syk during the
in vitro kinase assay. Similar to the other antisera, syk2
immunoprecipitates of Syk from activated RBL lysates did show an
increase in kinase activity in the presence of phospho- TAM
peptide (+ DNP, phospho-
TAM). Thus, activation of
RBL cells prior to Syk immunoprecipitation appears to abrogate
syk2-mediated inhibition of phosphopeptide-stimulated kinase activity.
The results obtained with the syk2 antiserum suggest that the
carboxyl-terminal amino acids participate in activation of the Syk
catalytic domain.
RI TAM sequences. Cross-linking of
chimeric receptors containing the cytoplasmic portion of the
subunit of Fc
RI is sufficient to induce effector functions
associated with cross-linking of the multimeric receptor
(14, 15) . In contrast, similar chimeras of the
subunit are unable to signal
(31) . We previously showed that
the phosphorylated TAM exhibited a 40-fold higher relative
affinity than the phosphorylated
TAM for the SH2 domains of the
72-kilodalton protein tyrosine kinase Syk
(24) . In this report,
we show that both the tyrosine phosphorylation and catalytic activity
of Syk are increased by incubation with phospho- TAM peptides,
while phospho-
TAM peptides had little effect. These and other
results suggest that binding of Syk to the phosphorylated TAM
following receptor engagement is important for activation, while the
lower affinity of the
TAM for the Syk SH2 domains may preclude
its interaction with Syk in vivo.
and - TAM peptides in the assays
described in this report correlate with their relative affinities for
the tandem SH2 domains of Syk. As expected, the doubly phosphorylated
TAM, in comparison with the hemi-phosphorylated version, exhibits
increased affinity for the tandem Syk SH2 domains, probably due to its
ability to occupy both SH2 domains. The basis for the lower affinity of
the doubly phosphorylated
TAM is not well defined, but sequence
differences at the non-conserved positions of the TAMs and the
difference in spacing between the two Y XXL motifs of the
compared with the TAM are likely to be important. Further studies
with mutant TAMs will be aimed at defining the relationship between Syk
SH2 domain occupation and stimulation of kinase activity.
TAM peptide with an increase in
activity.
Like the SH-PTPs, Syk is not basally
phosphorylated on tyrosine so the autoinhibitory influence of the SH2
domains would appear to be independent of intramolecular
SH2-phosphotyrosine interactions, as has been described for Src
(39) . Future studies with mutant Syk proteins will be aimed at
understanding how the SH2 domains regulate the catalytic domain of Syk.
TAM
peptides were not able to stimulate the kinase activity of Syk
immunoprecipitated with an antiserum against the carboxyl-terminal tail
of Syk. This is in contrast to results obtained with partially purified
baculovirus-produced Syk and with Syk immunoprecipitated with other
antisera, suggesting that antibody bound to the carboxyl-terminal amino
acids somehow blocks phospholigand activation of Syk. However,
phospho-
TAM peptide did increase the kinase activity of Syk
immunoprecipitated from antigen-activated RBL lysates. These results
suggest one possible model for phospholigand activation of Syk
catalytic activity, where the carboxyl-terminal tail participates in an
initial step required for activation of the catalytic domain, such as
residue modifications or a conformational change. Syk
immunoprecipitated from lysates of antigen-activated RBL lysates is
already in an ``active'' configuration, and its kinase domain
would no longer be affected by antibody bound to the carboxyl-terminal
tail. Our data suggest that stimulation of Syk catalytic activity by
phospholigand binding to the Syk SH2 domains involves the
carboxyl-terminal tail of Syk.
subunit of
Fc
RI
(23, 24, 43) . Extrapolating to the
events that take place following receptor engagement in mast cells,
these data imply that the interaction of Syk with phosphorylated TAM
motifs of the
subunit of Fc
RI is involved in
receptor-mediated activation of Syk. Binding of Syk to Fc
RI via
the phosphorylated
TAMs may serve both to localize Syk to the
plasma membrane and as an ``on'' switch for its catalytic
activity. Activation of Syk molecules localized to aggregated receptors
would facilitate tyrosine phosphorylation of critical substrates
coclustered within the receptor complex. As Syk has been shown to
couple with multimeric antigen receptors in several cell types
(23, 29, 44) this may represent a general
mechanism for Syk activation in this receptor family. Similarly, it has
been shown that ZAP-70 recruitment to phosphorylated
subunits is
a critical step in the T cell receptor signaling cascade
(13, 45, 46) .
TAM is sufficient
to stimulate catalytic activity, we cannot rule out the possibility
that other proteins may also be involved in Syk activation. While, at
least in vitro, autophosphorylation is an integral part of
catalytic activation for many tyrosine kinases, phosphorylation of Syk
in vivo probably involves multiple sites, some of which may
require the activity of heterologous kinases. Specific
tyrosine-phosphorylated residues may play different roles in
Syk-mediated signaling, contributing either to further enhance
catalytic activity or possibly as binding sites for the SH2 domains of
other signaling proteins. Cotransfection experiments in COS cells
suggest that Src family kinases can activate Syk, possibly through a
direct interaction
(25, 30) . Lyn is also coclustered
within the Fc
RI complex and may therefore interact with Syk during
receptor-mediated signaling
(20) . Experiments are in progress
to further define the interactions between Syk, Lyn, and the
TAM
that are critical for Syk activation.
TAM peptide stimulates the tyrosine phosphorylation and
increases the kinase activity of Syk. Peptides with lower affinity for
the Syk SH2 domains induced a correspondingly lower stimulation of
catalytic activity. Finally, the carboxyl-terminal tail of Syk may also
participate in phospholigand-induced activation. These results suggest
a model where the SH2 domains of Syk are involved in autoregulatory
interactions with the catalytic domain that are influenced by
phospholigand binding. In mast cells and in basophils, binding of the
Syk SH2 domains to the tyrosine-phosphorylated TAM of the
subunit
would presumably stimulate Syk catalytic activity and thus represent a
critical event in the Fc
RI-mediated signaling cascade.
RI, the high affinity receptor for
immunoglobulin E; SH2, Src homology 2; TAM, tyrosine-based activation
motif; RBL, rat basophilic leukemia; GST, glutathione
S-transferase; DNP, 2,4-dinitrophenol.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
A. S. Gounni The high-affinity IgE receptor (Fc{epsilon}RI): a critical regulator of airway smooth muscle cells? Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L312 - L321. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Simon, L. Vanes, R. L. Geahlen, and V. L. J. Tybulewicz Distinct Roles for the Linker Region Tyrosines of Syk in Fc{epsilon}RI Signaling in Primary Mast Cells J. Biol. Chem., February 11, 2005; 280(6): 4510 - 4517. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hernandez-Hansen, A. J. Smith, Z. Surviladze, A. Chigaev, T. Mazel, J. Kalesnikoff, C. A. Lowell, G. Krystal, L. A. Sklar, B. S. Wilson, et al. Dysregulated Fc{epsilon}RI Signaling and Altered Fyn and SHIP Activities in Lyn-Deficient Mast Cells J. Immunol., July 1, 2004; 173(1): 100 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Charles, R. C. Monteiro, and M. Benhamou p28, a Novel IgE Receptor-associated Protein, Is a Sensor of Receptor Occupation by Its Ligand in Mast Cells J. Biol. Chem., March 26, 2004; 279(13): 12312 - 12318. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Qu, K. Sada, S. Kyo, K. Maeno, S. M. S. Miah, and H. Yamamura Negative regulation of Fc{epsilon}RI-mediated mast cell activation by a ubiquitin-protein ligase Cbl-b Blood, March 1, 2004; 103(5): 1779 - 1786. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Krishnan, D. L. Farber, and G. C. Tsokos T Cell Rewiring in Differentiation and Disease J. Immunol., October 1, 2003; 171(7): 3325 - 3331. [Full Text] [PDF] |
||||
![]() |
J. Schlessinger and M. A. Lemmon SH2 and PTB Domains in Tyrosine Kinase Signaling Sci. Signal., July 15, 2003; 2003(191): re12 - re12. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Nambiar, C. U. Fisher, A. Kumar, C. G. Tsokos, V. G. Warke, and G. C. Tsokos Forced Expression of the Fc Receptor {gamma}-Chain Renders Human T Cells Hyperresponsive to TCR/CD3 Stimulation J. Immunol., March 15, 2003; 170(6): 2871 - 2876. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, E. Berenstein, and R. P. Siraganian Phosphorylation of Tyr342 in the Linker Region of Syk Is Critical for Fc{varepsilon}RI Signaling in Mast Cells Mol. Cell. Biol., December 1, 2002; 22(23): 8144 - 8154. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Woodside, A. Obergfell, A. Talapatra, D. A. Calderwood, S. J. Shattil, and M. H. Ginsberg The N-terminal SH2 Domains of Syk and ZAP-70 Mediate Phosphotyrosine-independent Binding to Integrin beta Cytoplasmic Domains J. Biol. Chem., October 11, 2002; 277(42): 39401 - 39408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Paar, N. T. Harris, D. Holowka, and B. Baird Bivalent Ligands with Rigid Double-Stranded DNA Spacers Reveal Structural Constraints on Signaling by Fc{epsilon}RI J. Immunol., July 15, 2002; 169(2): 856 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Woodside Dancing with Multiple Partners Sci. Signal., March 19, 2002; 2002(124): pe14 - pe14. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lara, E. Ortega, I. Pecht, J. R. Pfeiffer, A. M. Martinez, R. J. Lee, Z. Surviladze, B. S. Wilson, and J. M. Oliver Overcoming the Signaling Defect of Lyn-Sequestering, Signal-Curtailing Fc{epsilon}RI Dimers: Aggregated Dimers Can Dissociate from Lyn and Form Signaling Complexes with Syk J. Immunol., October 15, 2001; 167(8): 4329 - 4337. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sada, J. Zhang, and R. P. Siraganian SH2 domain-mediated targeting, but not localization, of Syk in the plasma membrane is critical for Fc{epsilon}RI signaling Blood, March 1, 2001; 97(5): 1352 - 1359. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Field, J. R. Apgar, E. Hong-Geller, R. P. Siraganian, B. Baird, and D. Holowka Mutant RBL Mast Cells Defective in Fcepsilon RI Signaling and Lipid Raft Biosynthesis Are Reconstituted by Activated Rho-family GTPases Mol. Biol. Cell, October 1, 2000; 11(10): 3661 - 3673. [Abstract] [Full Text] |
||||
![]() |
B. S. Wilson, J. R. Pfeiffer, and J. M. Oliver Observing Fc{epsilon}RI Signaling from the Inside of the Mast Cell Membrane J. Cell Biol., May 29, 2000; 149(5): 1131 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Murakami, S. Sato, S. Nagasawa, and T. Yamashita Regulation of mast cell signaling through high-affinity IgE receptor by CD45 protein tyrosine phosphatase Int. Immunol., February 1, 2000; 12(2): 169 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sada, J. Zhang, and R. P. Siraganian Point Mutation of a Tyrosine in the Linker Region of Syk Results in a Gain of Function J. Immunol., January 1, 2000; 164(1): 338 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang and R. P. Siraganian CD45 Is Essential for Fc{epsilon}RI Signaling by ZAP70, But Not Syk, in Syk-Negative Mast Cells J. Immunol., September 1, 1999; 163(5): 2508 - 2516. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wofsy, B. M. Vonakis, H. Metzger, and B. Goldstein One Lyn molecule is sufficient to initiate phosphorylation of aggregated high-affinity IgE receptors PNAS, July 20, 1999; 96(15): 8615 - 8620. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Weil, J.-P. Levraud, M. D. Dodon, C. Bessia, U. Hazan, P. Kourilsky, and A. Israël Altered Expression of Tyrosine Kinases of the Src and Syk Fam |