![]()
|
|
||||||||
From the
Bovine seminal ribonuclease (BS-RNase) is a homolog of RNase A
with special biological properties that include specific antitumor,
aspermatogenic, and immunosuppressive activities. Unlike RNase A,
BS-RNase is a dimer cross-linked by disulfide bonds between Cys
Bovine seminal ribonuclease (EC 3.1.27.5,
BS-RNase,
In dimers of BS-RNase, the
subunits are cross-linked by two disulfide bonds between Cys
We recently described the synthesis of
a gene that codes for BS-RNase, the expression of this gene in
Escherichia coli, and the isolation of active dimers of
BS-RNase (Kim and Raines, 1993a, 1994). To illuminate the role of the
two intersubunit disulfide bonds of BS-RNase, we have now prepared
mutants of BS-RNase (C31S BS-RNase and C32S BS-RNase) that lack 1 of
the 2 cysteine residues. We then used these mutant proteins to answer
the questions: 1) can an M=M dimer form with only one
intersubunit disulfide bond? 2) If so, to what extent and at what rate
is this M=M dimer converted to an M
Materials RNase A was from Boehringer Mannheim GmbH (Hamburg, Germany). E.
coli strain BL21(DE3) was from Novagen (Madison, WI). Reagents for
DNA synthesis were from Applied Biosystems (Foster City, CA) except for
acetonitrile, which was from Baxter Healthcare (McGaw Park, IL).
Restriction endonucleases and T4 DNA ligase were from Promega (Madison,
WI). T7 DNA polymerase was from New England Biolabs (Beverly, MA).
[6-
Ultraviolet absorbance measurements
were made on a Cary model 3 spectrophotometer equipped with a Cary
temperature controller. Ribonuclease concentrations were determined by
using an absorption coefficient of
The M form of wild-type BS-RNase
was stabilized by alkylating the sulfhydryl groups of Cys
Cells (10
In dimers of
wild-type BS-RNase, the two intersubunit disulfide bonds have a higher
(that is, less negative) reduction potential than do the eight
intrasubunit disulfide bonds (D'Alessio et al., 1975).
The intersubunit bonds can be reduced selectively by treating the
dimers with a 10-fold molar excess of reduced dithiothreitol. Upon
reduction, the monomers from M=M dissociate but those from
M
Many enzymes exist as multimers composed of identical
subunits. Some of these homomultimers have active sites that are
located at an interface between subunits. For example, the active site
residues in dimers of HIV-1 protease are contributed by different
subunits (Wlodawer et al., 1989). This enzyme loses all
catalytic activity upon dimer dissociation. The active site residues in
dimers of triosephosphate isomerase are contributed by one subunit, but
residues adjacent to those in the active site are contributed by the
other subunit (Banner et al., 1975). Like HIV-1 protease,
triosephosphate isomerase loses all activity upon dimer dissociation.
(Recently, Borchert et al. (1994) created a mutant of
triosephosphate isomerase that loses only 10
BS-RNase differs in a significant
way from HIV-1 protease, triosephosphate isomerase, and all other
multimeric enzymes with composite active sites. BS-RNase exists in two
distinct quaternary forms. The interconversion of these two forms
requires regional unfolding and movement of the NH
Site-directed
mutagenesis was used to alter the relative free energy of M=M
and M
We used wild-type and mutant BS-RNases, which
differ in their equilibrium populations of the M
The
immunosuppressive activity of the various forms of BS-RNase and of
RNase A exceeded the antitumor activity. All dimeric forms were active
inhibitors of lymphocyte proliferation at a concentration of 12.5
µg/ml, and monomers of wild-type BS-RNase and RNase A inhibited
proliferation at a concentration of 100 µg/mL (Fig. 6). This
result is consistent with our previous finding that angiogenin, a
monomeric homolog of RNase A, exhibits an immunosuppressive activity
but not an antitumor or aspermatogenic activity (Matou&;ek
et al., 1992). These results intimate a physiological role for
BS-RNase. The marked immunosuppressive activity of BS-RNase, which
constitutes 3% of the protein in bull seminal plasma, may protect sperm
cells from the cow immune system (James and Hargreave, 1984). In
humans, immunosuppression by humanized BS-RNase could be of use in
evoking tissue tolerance during transplantation surgery.
The results
of our biological assays suggest that the M
What is the molecular basis for the different cytotoxicity of
the two quaternary forms of BS-RNase? The M
We suggest that the
difference in the cytotoxicity of the two forms derives from their
different fate inside the cell. The basis of our separation of
M
The dimeric form of BS-RNase has a distinct attribute
that is likely to be critical for its cytotoxic activity. The cytosolic
ribonuclease inhibitor protein (Kobe and Deisenhofer, 1995) binds
tightly to monomers but not dimers of BS-RNase (Murthy and Sirdeshmukh,
1992). We therefore propose that the ability of BS-RNase (and of an
RNase A mutant (Di Donato et al., 1994)) to maintain a dimeric
form in vivo leads to its special biological properties
because only the dimer is resistant to cytosolic ribonuclease
inhibitor. Onconase, a monomeric homolog of RNase A, may be cytotoxic
for similar reasons ( Youle et al., 1993).
Other workers
have proposed that the unusual features of catalysis by BS-RNase are
responsible for its special biological properties. Dimers of BS-RNase
or RNase A, but not monomers of RNase A, catalyze the cleavage of
double-stranded RNA (Libonati and Floridi, 1969; Libonati et
al., 1976). Additionally, catalysis of the hydrolysis of
nucleoside 2`,3`-cyclic phosphodiesters by dimers but not monomers of
BS-RNase or RNase A is regulated allosterically (Piccoli and
D'Alessio, 1989; Piccoli et al., 1988; Tamburrini et
al., 1989). The physiological significance of these enzymatic
properties has been the object of much speculation (D'Alessio
et al., 1991). Most recently, Eisenberg and co-workers
(Bennett et al., 1994) suggested that the M
Our results make predictions about
the structure and function of the mammalian seminal ribonucleases from
deer, giraffe, and sheep (Breukelman et al., 1993).
On-line formulae not verified for accuracy M
Parameters were calculated by fitting the data in Fig. 2 to the
equation (% M=M)
We thank B. R. Kelemen and D. M. Nierengarten for
assistance in protein purification and protein chemistry.
Volume 270,
Number 18,
Issue of May 5, pp. 10525-10530, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
of one subunit and Cys
of the other. At equilibrium,
this dimer is a mixture of two distinct quaternary forms, M=M
and M
M. The conversion of M=M to M
M entails the
exchange of NH
-terminal
-helices between subunits.
Here, the cytotoxic activities of purified MM were shown to be
greater than those of purified M=M, despite extensive
equilibration of M=M and M
M during the time course of the
assays. Replacing Cys
or Cys
with a serine
residue did not compromise the enzymatic activity of dimeric BS-RNase,
but reduced both the fraction of M
M at equilibrium and the
cytotoxicity. We conclude that the M
M form is responsible for
the special biological properties of BS-RNase. Since cytosolic
ribonuclease inhibitor binds tightly to monomeric but not dimeric
BS-RNase and only the M
M form can remain dimeric in the reducing
environment of the cytosol, we propose that BS-RNase has evolved its
M
M form to retain its lethal enzymatic activity in
vivo.
(
)
) is a homolog of bovine pancreatic
ribonuclease A (RNase A). Eighty % of the amino acid sequences of the
two proteins is identical (Suzuki et al., 1987). Like RNase A,
BS-RNase catalyzes the cleavage of RNA after pyrimidine residues.
Unlike RNase A, BS-RNase has specific antitumor, aspermatogenic, and
immunosuppressive activities (Dostál and Matou&;ek,
1973; Matou&;ek, 1973; Sou&;ek et al.,
1986; Tamburrini et al., 1990; D'Alessio et
al., 1991; Laccetti et al., 1992; D'Alessio, 1993).
These special biological properties correlate with the oligomerization
state assumed by BS-RNase, which is isolated from bull seminal plasma
as a dimer. For example, artificial dimers of RNase A also have
antitumor activity, although to a lesser extent than does BS-RNase
(Bartholeyns and Baudhuin, 1976; Vescia et al., 1980).
Similarly, artificial monomers of BS-RNase lack these activities
(Tamburrini et al., 1990).
of one subunit and Cys
of the other subunit. These
cross-linked dimers exist in two distinct quaternary forms, designated
as M
M and M=M (Piccoli et al., 1992). In the
major form, M
M, the NH
-terminal tail (residues
1-17) of one subunit stretches out from the COOH-terminal body of
the same subunit and interacts with the body of the other subunit
(Fig. 1). The noncovalent interaction between the monomers in
MM is probably similar to that between S-peptide (residues
1-20) and S-protein (residues 21-124) in RNase S (Kim
et al., 1992; Kim and Raines, 1993b). In the minor form,
M=M, this exchange does not occur. Refolding studies have shown
that BS-RNase first folds into a monomer (M), which dimerizes to form
M=M and is then slowly converted to an equilibrium mixture in
which M
M/M=M has been reported to be approximately 2:1
(Piccoli et al., 1992). D'Alessio and co-workers
(Piccoli et al., 1993) have suggested that the two quaternary
forms may differ in their enzymatic and biological properties.
Figure 1:
Structure of the crystalline MM
form of wild-type BS-RNase (Mazzarella et al., 1987). Only
-carbons are shown. The chains are drawn in black or
gray. The intersubunit disulfide bonds, active site histidine
residues, and NH
and COOH termini are
indicated.
Bovine seminal ribonuclease is the only known dimeric ribonuclease.
Although no other seminal ribonucleases have been isolated, homologs of
the gene that codes for BS-RNase were discovered recently in deer,
giraffe, and sheep (Breukelman et al., 1993).
(
)
The DNA sequence of each of these genes indicates that the
residue corresponding to Cys in the encoded protein is
replaced by a phenylalanine. This mutation eliminates one of the two
intersubunit disulfide bonds.
M dimer? 3) What are
the consequences of these mutations on the antitumor, aspermatogenic,
and immunosuppressive activities of BS-RNase?
H]Thymidine (980 GBq/mmol) was from the
Institute for the Research, Development and Application of
Radioisotopes (Prague, Czech Republic). Bacto tryptone and Bacto yeast
extract were from Difco (Detroit, MI). Ampicillin (sodium salt) was
from International Biotechnologies (New Haven, CT). All other chemicals
and reagents were of commercial reagent grade or better and were used
without further purification. Methods DNA oligonucleotides were synthesized on an Applied Biosystems model 392
DNA/RNA synthesizer by using the
-cyanoethyl phosphoramidite
method (Sinha et al., 1984). DNA sequences were determined
with the Sequenase Version 2.0 kit from United States Biochemical Corp.
(Cleveland, OH). Other manipulations of DNA were performed as described
(Ausubel et al., 1989).
= 0.465 at 278 nm for all forms of BS-RNase (D'Alessio
et al., 1972) and
=
0.72 at 277.5 nm for RNase A (Sela et al., 1957). Enzymatic
activity was assayed by the method of Kunitz (1946). Isoelectric points
were determined with a model 111 Mini IEF cell from Bio-Rad and pH
8-10.5 carrier ampholytes from Pharmacia LKB Biotechnol
(Piscataway, NJ).
Mutagenesis
The construction of plasmid pLSR1 for the
expression of BS-RNase in E. coli was described previously
(Kim and Raines, 1994). Site-directed mutagenesis was performed by the
method of Kunkel (1987). Oligonucleotide C31S.41
(ACACTTACCTTGGGTCATCTTTCTACAAGACATCATCAAGT) was used to change the TGT
codon of Cys to the TCT codon of serine. Oligonucleotide
C32S.39 (ACACTTACCTTGGGTCATCTTTCTAGAACACATCATCAA) was used to change
the TGT codon for Cys
to the TCT codon of serine. The
resulting plasmids, pLSR31 and pLSR32, were used to produce C31S
BS-RNase and C32S BS-RNase, respectively.
Production and Purification of M, M=M, C31S, and
C32S from E. coli
Wild-type and mutant BS-RNases were produced
in E. coli and partially purified as described (Kim and
Raines, 1993a). Folding-oxidation was performed as described (di Nigris
et al., 1993) with minor modification. Here, denatured and
reduced protein was oxidized for 24 h at a concentration of 0.7 mg/ml
in 0.1 M Tris-AcOH buffer, pH 8.5, containing glutathione (3.0
mM oxidized, 0.6 mM reduced). The resulting solution
was concentrated by ultrafiltration on an Amicon YM10 membrane, and the
concentrate was loaded onto a fast protein liquid chromatography
HiLoad26/60 Superdex
75 gel filtration column
that had been equilibrated with 50 mM sodium acetate buffer,
pH 5.0, containing NaCl (0.1 M). Fractions containing
monomeric BS-RNase (M) were collected and concentrated. Any
glutathionine was removed by selective reduction with a 5-fold molar
excess of dithiothreitol, after the addition of 0.1 volume of 1.0
M Tris-HCl buffer, pH 8.5.
and Cys
with iodoacetamide as described
(D'Alessio et al., 1975). Alternatively, the M=M
form of wild-type, C31S, and C32S BS-RNase was prepared from M that had
not been treated with iodoacetamide. Then, the M form was air-oxidized
by dialysis for 24 h versus 0.05 M Tris-AcOH buffer,
pH 8.5. The dialyzed protein was concentrated and subjected to gel
filtration chromatography as described above. Fractions containing
dimeric BS-RNase (M=M) were collected, pooled, and stored at
-70 °C. Purification of M=M and M
M from Seminal
Plasma-Wild-type BS-RNase (which is an equilibrium mixture of
M=M and M
M) was purified to >95% homogeneity from bull
seminal plasma as described by Dostál and Matou&;ek
(1973) or Kim and Raines (1993a). The intersubunit disulfide bonds of
the purified enzyme were reduced with a 10-fold molar excess of reduced
dithiothreitol, and the resulting protein was subjected to gel
filtration chromatography to separate M from the noncovalent dimer
(NCD). The M=M form was prepared by air oxidation of M and
purified by gel filtration chromatography. Similarly, the M
M
form was prepared by air oxidation of NCD and purified by gel
filtration chromatography. This method of purification yielded
M=M and M
M that were >90% free of the other form, as
judged by selective reduction followed by gel filtration
chromatography. The purified M=M and M
M forms were stored
at -70 °C, at which temperature their interconversion was
undetectable.
Source of Protein for Assays
The source of the
ribonuclease used in a particular assay was based on the composition
(bull seminal plasma contains an equilibrium mixture of M=M and
MM while E. coli produces M that can be oxidized to
M=M) and the yield ( E. coli
bull seminal plasma)
of available protein. Thus in the conversion assay (which requires 10
mg of protein), all three M=M forms were from E. coli.
In the biological assays, ribonucleases labeled
``wild-type,'' ``M=M,'' and
``M
M'' were prepared from bull seminal plasma, and
ribonucleases labeled ``C31S'' and C32S`` were the
M=M forms prepared from E. coli. The buffer of the
various ribonucleases was changed by gel filtration chromatography to
0.1 M Tris-HCl buffer, pH 8.0, containing EDTA (1 mM)
for the conversion assay or to 10 mM sodium phosphate buffer,
pH 7.0, containing NaCl (0.1 M) for the antitumor,
aspermatogenic, and immunosuppressive activity assays. Wild-type
BS-RNase prepared from bull seminal plasma, and that from E. coli (which has an additional NH
-terminal methionine
residue) had identical enzymatic activity (Kim and Raines, 1993a; Kim
et al., 1995) and antitumor activity (data not shown). Conversion of M=M to MM-Solutions of purified
M=M form (1.0 mg/ml) in 0.1 M Tris-HCl buffer, pH 8.0,
containing EDTA (1 mM) were incubated at 37 °C. Aliquots
(1.0 mg, 36 nmol) were withdrawn at various times and treated with
enough reduced dithiothreitol (56 µg, 360 nmol) to reduce only the
intersubunit disulfide bonds (D'Alessio et al., 1975).
The fraction of M=M that had been converted to M
M was
determined by selective reduction of the intersubunit disulfide bonds
with a 10-fold molar excess of reduced dithiothreitol, and separation
of M from NCD by gel filtration chromatography as described above. The
percent M=M was determined by integration of the gel filtration
profile obtained at 280 nm.
Antitumor Activity Assay
The effect of various
ribonucleases on the proliferation of cell lines K-562 and ML-1 (which
derive from human erythroid leukemia cells and human myeloid leukemia
cells, respectively) was assessed as follows. Cultures (0.2 ml) were
established in microtitration plates (NUNC, FB type) and cultivated at
37 °C in RPMI 1640 medium supplemented with fetal calf serum (10%
v/v) under a humidified atmosphere containing CO
(5% v/v).
A known concentration of RNase was added to each of three cultures.
After 3 days, the ability of cells to proliferate was assessed by
measuring the incorporation of [6-
H]thymidine
into newly synthesized DNA. Briefly,
[6-
H]thymidine (24 kBq) was added to each
culture. After 4 h of additional cultivation, cells were collected with
a Scatron harvester, and incorporated radioactivity was evaluated with
a Beckman scintillation counter. The mean value for the three cultures
containing a particular ribonuclease was compared with that for
untreated cells.
Aspermatogenic Activity Assay
The effect of
various ribonucleases on the production of sperm in mice was assessed
as follows (Matou&;ek, 1994). The left testes of CBA mice
(five animals/group) were injected with an RNase (50 µl of a 1.0
mg/ml solution). After 10 days, the testes were isolated, weighed,
stained with hemeatoxylin and eosin, and subjected to histological
examination. Aspermatogenic activity was assessed by measuring the
diameter of seminiferous tubules, the index weight (which is the
10
testes weight/body weight), and the width of
spermatogenic layers. Results were recorded as the mean ±
standard error of the mean (S.E.), and compared to the untreated right
testes of the same mice.
Immunosuppressive Activity Assay
The effect of
various RNases on the proliferation of human lymphocytes stimulated by
MLC was assessed as follows (Berger, 1979). Lymphocytes from the
heparinized peripheral blood of two normal allogenic humans were
isolated separately on a density gradient ( d = 1.077)
of Ficoll-Paque solution gradient as described by Sou&;ek
et al. (1986). The cells from the interface were aspirated,
washed three times with phosphate-buffered saline, and resuspended in
RPMI 1640 medium containing inactivated pooled human AB serum (20%
v/v), L-glutamine (2 mM), penicillin (100 units/ml),
and streptomycin (50 µg/ml). The resulting preparations contained
>98% mononuclear cells with <2% neutrophils or erythrocytes.
) from the two preparations were mixed 1:1. MLC
cultures (0.2 ml) were established in microtitration plates (NUNC, U
type) and cultivated at 37 °C in RPMI 1640 medium under a
humidified atmosphere containing CO
(5% v/v). A known
concentration of RNase was added to each of three cultures. After 6
days, the ability of treated cells to proliferate was assessed by
measuring the incorporation of [6-
H]thymidine
into newly synthesized DNA, as described in the antitumor activity
assay. The mean value for the three cultures containing a particular
ribonuclease was compared that for untreated cells. The
immunosuppressive activity assay was also performed on a preparation of
human lymphocytes stimulated with either phytohemagglutinin or
concanavalin A.
Preparation of Wild-type and Mutant BS-RNase
Two
cysteine residues form intersubunit disulfide bonds in the native dimer
of BS-RNase. Oligonucleotide-mediated site-directed mutagenesis was
used to change the codon for each of these residues to a codon for
serine. Monomers of wild-type, C31S, and C32S BS-RNase were prepared
from E. coli as described (Kim and Raines, 1993a; de Nigris
et al., 1993). Interconversion of M=M and MM-M=M form of
wild-type, C31S, and C32S BS-RNase was prepared in a two-step
oxidation. In the first oxidation step, protein was refolded and
oxidized in the presence of glutathione to yield monomer (M). Since
glutathione can form a mixed disulfide with the sulfydryl group of
Cys
and Cys
(Smith et al., 1978),
each M was treated with a 5-fold molar excess of dithiothreitol and
then dialyzed at pH 8.5 to allow for dimer formation by air oxidation.
After dialysis for 24 h, >70% of each BS-RNase was isolable as an
M=M (>90%) or M
M (<10%) dimer. The ability of
dimeric C31S and C32S BS-RNase to catalyze the degradation of RNA was
identical (±5%) to that of the wild-type enzyme.
M remain associated as a NCD due to extensive noncovalent
interactions between the two subunits. The interaction between the
monomers in NCD is probably similar to that between S-peptide (residues
1-20) and S-protein (residues 21-124) in RNase S (Kim
et al., 1992; Kim and Raines, 1993b). Selective reduction
followed by gel filtration chromatography thus allowed us to
distinguish M=M from M
M, as shown in Fig. 2. The
M=M and M
M forms comigrated on an isoelectric focusing
gel, with p I = 10.3.
Figure 2:
Analysis of the quaternary structure of
BS-RNase by gel filtration chromatography. The M=M form of
wild-type BS-RNase was allowed to equilibrate at 37 °C with the
MM form. At various times, aliquots were withdrawn, and the
intersubunit disulfide bonds were reduced selectively, thereby
converting the M=M form to monomer (M) and any M
M form to
NCD. These forms were then separated by gel filtration chromatography
and quantified by A
.
We used the selective
reduction-gel filtration chromatography method to follow the time
course of the interconversion of the M=M and MM forms of
wild-type, C31S, and C32S BS-RNase. The M=M form of wild-type
BS-RNase equilibrated with the M
M form over several days, as
shown in Fig. 3. Numerical analysis of the data in
Fig. 3
gave the kinetic and thermodynamic parameters in
. At equilibrium, 57% (=
k
/( k
+
k)) of the wild-type dimer was present as the
M
M form, indicating that the M
M form is slightly more
stable than is the M=M form of wild-type BS-RNase. The
M=M form of the C31S and C32S enzymes interconverted more slowly
with the M
M form than did the wild-type enzyme. At equilibrium,
only 23% of the C31S dimer and 29% of the C32S dimer were present as
the M
M form, indicating that the M=M form is more stable
than is the M
M form in the C31S and C32S enzymes.
Figure 3:
Time course for the equilibration of the
M=M and MM forms of wild-type ( G), C31S
( C), and C32S ( S) BS-RNase at 37 °C. The two
forms were separated by selective reduction of the intersubunit
disulfide bond(s) followed by gel filtration chromatography. The
ordinate is (% M=M) = [M/(M +
NCD)]
100%. The gel filtration profiles for the wild-type
enzyme at 0, 2, 4, 6, and 8 days are shown in Fig.
2.
Antitumor Activity
Previously, we reported that
wild-type BS-RNase inhibits the proliferation of 20 human tumor cell
lines to different extents (Sou&;ek and Matou&;ek,
1993). Now, we have determined the ability of various forms of BS-RNase
(monomeric BS-RNase, C31S BS-RNase, C32S BS-RNase, M=M BS-RNase,
MM BS-RNase, and wild-type BS-RNase (which is an equilibrium
mixture of the M=M and M
M forms)) and of RNase A to
inhibit the proliferation of two of these lines: K-562 and ML-1. C32S
BS-RNase, M=M BS-RNase, wild-type BS-RNase, and M
M
BS-RNase were highly toxic to K-562 cells, as shown in
Fig. 4A. The C31S BS-RNase had a modest cytotoxic
effect. Monomeric BS-RNase and RNase A showed no measurable effect on
the proliferation of K-562 cells.
Figure 4:
Effect of
various forms of BS-RNase and of RNase A on the proliferation in
culture of human tumor cell lines K-562 ( A) and ML-1
( B). Proliferation was evaluated by the incorporation of
[6-
H]thymidine into cellular DNA. Values are the
mean from three cultures and are reported as a percent of the control,
which was the mean value from medium containing no exogenous
ribonuclease. Data were recorded 3 days after addition of ribonuclease
to the culture.
All ribonucleases had a weaker
effect on the proliferation of ML-1 cells than on that of K-562 cells,
as shown in Fig. 4 B. The weaker response of the ML-1
cell line allowed us to better compare the toxicity of the various
forms of BS-RNase. The cytotoxic effect of the various other forms of
BS-RNase increased in the order C31S < C32S < M=M <
wild-type < MM. Again, monomeric BS-RNase and RNase A showed
no measurable effect on cell proliferation.
Aspermatogenic Activity
Wild-type BS-RNase induces
reversible infertility in rodents (Dostál and
Matou&;ek, 1973). We determined the aspermatogenic activity
of various forms of BS-RNase and of RNase A by injecting the
ribonucleases into one testis of five mice and recording after 10 days
the diameter of seminiferous tubules, the weight of the testes, and the
width of spermatogenic layers. The mean values of these three
parameters are reported in Fig. 5relative to that of the
non-injected testes of the same mice. Wild-type BS-RNase and the
MM form were the most aspermatogenic of the ribonucleases
tested. C32S BS-RNase and M=M had modest aspermatogenic
activity. RNase A, monomeric BS-RNase, and C31S RNase A displayed no
significant activity.
Figure 5:
Effect of various forms of BS-RNase and of
RNase A on mouse spermatogenesis. Each value is an average from five
injected testes and is reported as a percent of the control, which was
from the non-injected testes of the same five mice. Data were recorded
10 days after injection.
Immunosuppressive Activity
Previously, we reported
that wild-type BS-RNase displayed a remarkable immunosuppressive
activity both in vitro and in vivo (Sou&;ek
et al., 1983, 1986). Now, we have determined the ability of
various forms of BS-RNase and of RNase A to inhibit the proliferation
of normal human lymphocytes stimulated in MLC. The inhibitory effect of
BS-RNase mutants on the proliferation of lymphocytes was much more
pronounced than that on the proliferation of tumor cells. A
concentration of only 12.5 µg/ml of M=M BS-RNase, wild-type
BS-RNase, or MM BS-RNase caused approximately 90% inhibition, as
shown in Fig. 6. The effects of C32S and C31S BS-RNase were more
modest, whereas monomeric BS-RNase and RNase A were ineffective. At
higher concentrations, monomeric ribonucleases did cause inhibition,
but this inhibition was at least 10-fold weaker than that exhibited by
the various dimeric forms. The relative inhibitory effect of the
ribonucleases on the proliferation of phytohemagglutinin- or
concanavalin A-stimulated human lymphocytes (data not shown) was
similar to that on cells in an MLC: (M, RNase A) < C31S < C32S
< (M=M, wild-type, M
M).
Figure 6:
Effect various forms of BS-RNase and of
RNase A on the proliferation in culture of MLC-stimulated human
lymphocytes. Proliferation was evaluated by the incorporation of
[6-
H]thymidine into cellular DNA. Values are the
mean from three cultures and are reported as a percent of the control,
which was the mean value from cultures containing no exogenous
ribonuclease. Data were recorded 6 days after addition of ribonuclease
to the culture.
-fold in
activity upon dimer dissociation.)
-terminal
-helix of each monomer. Under severe conditions (such as
lyophilization from 50% v/v acetic acid), RNase A forms a dimer in
which the active sites are composite and thus similar to the active
sites in the MM form of BS-RNase (Crestfield et al.,
1962). In contrast, BS-RNase undergoes this conversion in physiological
conditions. Here, we have illuminated the molecular basis and
biological consequences of this conversion.
M. In effect, we replaced the two intersubunit disulfide
bonds of native BS-RNase (C31-C32` and C32-C31`) with a single
nonnative disulfide bond (C31-C31` in C32S BS-RNase or C32-C32` in C31S
BS-RNase). The resulting mutant enzymes retained full enzymatic
activity. The extent of their conversion to the M
M form was,
however, reduced significantly. Each cysteine to serine mutation made
the conversion of M=M to M
M approximately 2-fold slower
and the conversion of M
M to M=M approximately 2-fold
faster ().
M form, to
correlate quaternary structure with cytotoxic activity. In previous
experiments, we found that individual cell lines respond differently to
wild-type BS-RNase (Sou&;ek and Matou&;ek, 1993).
For example, the proliferation of myeloid tumor cells was less
inhibited than was that of lymphoid tumor cells. In the present study,
we used the less sensitive myeloid cell line ML-1 to distinguish
between the antitumor activity of various forms of BS-RNase
(Fig. 4 B). The antitumor activity increased as C32S <
M=M < wild-type < M
M. We were not able to use the
more sensitive lymphoid cell line K-562 to distinguish between the
various forms of BS-RNase (Fig. 4 A). Still, monomers of
wild-type BS-RNase and RNase A were ineffective inhibitors of
proliferation, and C31S BS-RNase showed only marginal activity.
M form of BS-RNase
has significantly more cytotoxic activity than does the M=M form
(Figs. 4-6). Still, these results are difficult to interpret. The
problem is that the M=M and M
M forms of wild-type
BS-RNase equilibrate with t
=
ln2/( k
+ k) =
1.9 days. The antitumor assay takes 3 days, the immunosuppression
assays takes 6 days, and the aspermatogenesis assay takes 10 days. The
two forms of BS-RNase therefore largely equilibrate during the course
of the biological assays. The mutant enzymes enabled us to solve this
dilemma. The C31S and C32S enzymes contain far less M
M at
equilibrium than does wild-type BS-RNase ( Fig. 3and
). In the biological assays, these mutant enzymes are the
best available representatives of the M=M form. The cytotoxic
activities of the mutant enzymes increased as C31S < C32S <
wild-type (Figs. 4-6). This same order described the fraction of
the enzymes that existed at equilibrium as the M
M form. This
correlation suggests that the diminished cytotoxicity of C31S and C32S
BS-RNases arises from a decreased fraction of the more potent M
M
form.
M and M=M
forms are identical in amino acid sequence and disulfide bonding
pattern. Each form has a p I = 10.3, which is the same
as that of BS-RNase isolated from seminal plasma (D'Alessio
et al., 1972). The two forms comigrate during gel filtration
chromatography (Kim and Raines, 1993a, 1994), suggesting that the
native proteins have similar Stokes radii. Thus, the overall physical
properties of the M
M and M=M forms are indistinguishable.
Further, the existence of a cellular receptor, which could in theory
distinguish the two forms of BS-RNase, is unlikely (Mancheo et
al., 1994).
(
)
M and M=M is the ability of M
M but not M=M
to remain dimeric in the presence of a reducing agent. The reduction
potential in the cytosol of mammalian cells (Hwang et al.,
1992) quickly reduces the intersubunit but not the intrasubunit
disulfide bonds of BS-RNase (data not shown). In this environment,
M
M but not M=M will remain dimeric. The M
M form of
BS-RNase, with its extensive noncovalent intersubunit interactions
(Fig. 1), can therefore maintain the enzyme as a dimer in
vivo.
M form of
BS-RNase evolved because of its unique allosteric properties. In
contrast, we believe that the unusual features of catalysis by BS-RNase
are only artifacts of its quaternary structure. All of the special
biological properties of BS-RNase result from its cytotoxicity, and the
uninhibited degradation of cellular RNA (whether single-stranded or
double-stranded) by an invasive enzyme (whether nonallosteric or
allosteric) is likely to be cytotoxic (Saxena et al., 1991;
Newton et al., 1994).
Although these enzymes have yet to be isolated, they are likely
to exist as dimers cross-linked by a disulfide bond between Cys of each subunit. Since these enzymes lack a cysteine residue at
position 31, the major form of these enzymes is likely to be
M=M. Accordingly, these enzymes may display only a fraction of
the special biological properties of BS-RNase.
Table:
Kinetic and thermodynamic parameters for the M
= M
M
interconversion of wild-type and mutant BS-RNase at 37 °C
= ( k
+
k
e
M, homodimeric BS-RNase
in which the NH
-terminal tail of each subunit interacts
with the COOH-terminal body of the other subunit; M=M,
homodimeric BS-RNase in which the NH
-terminal tail of each
subunit interacts with the COOH-terminal body of the same subunit;
RNase A, bovine pancreatic ribonuclease A; MLC, mixed lymphocyte
culture; NCD, noncovalent dimer.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
H. A. Erickson, M. D. Jund, and C. A. Pennell Cytotoxicity of human RNase-based immunotoxins requires cytosolic access and resistance to ribonuclease inhibition Protein Eng. Des. Sel., January 1, 2006; 19(1): 37 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sica, A. Di Fiore, A. Merlino, and L. Mazzarella Structure and Stability of the Non-covalent Swapped Dimer of Bovine Seminal Ribonuclease: AN ENZYME TAILORED TO EVADE RIBONUCLEASE PROTEIN INHIBITOR J. Biol. Chem., August 27, 2004; 279(35): 36753 - 36760. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Haigis and R. T. Raines Secretory ribonucleases are internalized by a dynamin-independent endocytic pathway J. Cell Sci., January 15, 2003; 116(2): 313 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Russo, A. Antignani, C. Giancola, and G. D'Alessio Engineering the Refolding Pathway and the Quaternary Structure of Seminal Ribonuclease by Newly Introduced Disulfide Bridges J. Biol. Chem., December 6, 2002; 277(50): 48643 - 48649. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sevcik, L. Urbanikova, P. A. Leland, and R. T. Raines X-ray Structure of Two Crystalline Forms of a Streptomycete Ribonuclease with Cytotoxic Activity J. Biol. Chem., November 27, 2002; 277(49): 47325 - 47330. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Bretscher, R. L. Abel, and R. T. Raines A Ribonuclease A Variant with Low Catalytic Activity but High Cytotoxicity J. Biol. Chem., March 31, 2000; 275(14): 9893 - 9896. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Piccoli, C. De Lorenzo, F. Dal Piaz, P. Pucci, and G. D'Alessio Trypsin Sheds Light on the Singular Case of Seminal RNase, a Dimer with Two Quaternary Conformations J. Biol. Chem., March 10, 2000; 275(11): 8000 - 8006. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Oupicky, K. Ulbrich, and B. Rihova Conjugates of Semitelechelic Poly[N-(2-Hydroxypropyl)Methacrylamide] with Enzymes for Protein Delivery Journal of Bioactive and Compatible Polymers, May 1, 1999; 14(3): 213 - 231. [Abstract] [PDF] |
||||
![]() |
P. A. Leland, L. W. Schultz, B.-M. Kim, and R. T. Raines Ribonuclease A variants with potent cytotoxic activity PNAS, September 1, 1998; 95(18): 10407 - 10412. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.C. Yang, S.C.M. Kwok, S. Leshin, E. Bollo, and W.I. Li Purified Porcine Seminal Plasma Protein Enhances In Vitro Immune Activities of Porcine Peripheral Lymphocytes Biol Reprod, July 1, 1998; 59(1): 202 - 207. [Abstract] [Full Text] |
||||
![]() |
R. T. Raines, M. P. Toscano, D. M. Nierengarten, J. H. Ha, and R. Auerbach Replacing a Surface Loop Endows Ribonuclease A with Angiogenic Activity J. Biol. Chem., July 21, 1995; 270(29): 17180 - 17184. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, S. K. Saxena, W. Ardelt, M. Gadina, S. M. Mikulski, C. D. Lorenzo, G. D'Alessio, and R. J. Youle A Study of the Intracellular Routing of Cytotoxic Ribonucleases J. Biol. Chem., July 21, 1995; 270(29): 17476 - 17481. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||