Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plaschke-Schlütter, A.
Right arrow Articles by Birchmeier, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plaschke-Schlütter, A.
Right arrow Articles by Birchmeier, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 2, Issue of January 13, 1995 pp. 830-836
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Characterization of the Scatter Factor/Hepatocyte Growth Factor Gene Promoter
POSITIVE AND NEGATIVE REGULATORY ELEMENTS DIRECT GENE EXPRESSION TO MESENCHYMAL CELLS (*)

(Received for publication, April 12, 1994; and in revised form, November 7, 1994)

Antje Plaschke-Schlütter Jürgen Behrens Ermanno Gherardi (1) Walter Birchmeier

From the Max-Delbrück-Center for Molecular Medicine, Robert-Rössle-Strabetae 10, 13125 Berlin, Germany and ICRF, Cell Interaction Laboratory, Cambridge University Medical School, Cambridge CB2 2QH, United Kingdom

ABSTRACT
INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Scatter factor/hepatocyte growth factor (SF/HGF) and its receptor c-Met represent a paracrine signaling system involved in mesenchymal-epithelial interactions during development and during tumor progression. We have examined the promoters of the mouse and human SF/HGF genes by deletion mapping followed by CAT assays as well as by gel retardation and footprinting analysis. The promoter sequences are highly conserved (89.5% identity) up to position -453 from the major transcription start site but diverged considerably further upstream. Both promoters are active in mesenchymal but not epithelial cells thus reflecting the expression pattern of the SF/HGF gene in cells in vitro and in vivo. We have here identified two regulatory sequences in the SF/HGF promoter: a negative element at positions -239 to -258 and a positive element near the major transcription start site; specific deletions destroyed the activities of these elements. We were not able to localize elements on the SF/HGF promoter region that mediate the previously described effects of transforming growth factor beta, 12-O-tetradecanoylphorbol-13-acetate, and coculture of epithelial cells on SF/HGF gene expression. This study represents a first step toward understanding the intricately regulated and cell type-specific expression of the paracrine acting SF/HGF.


INTRODUCTION

Mesenchymal-epithelial interactions are essential for organ development and regenerative processes in vertebrates, and disturbances of these interactions play a major role in various diseases including cancer. The biology of mesenchymal-epithelial interactions have been extensively studied, and it is recognized that a variety of mesenchymal factors participate in the regulation of epithelial cell growth, differentiation, and morphogenesis(1, 2) . Less is known, however, about the molecular nature of the signals between mesenchyme and epithelium; these may involve cell adhesion molecules, components of the extracellular matrix, or secretory factors produced by mesenchymal cells and acting on epithelia in a paracrine manner (reviewed in (3) ). Among the latter, there exist several ligands for epithelial receptor tyrosine kinases, e.g. scatter factor/hepatocyte growth factor (SF/HGF), (^1)neuregulin (also called neu differentiation factor, or heregulin) or keratinocyte growth factor. All these factors are produced by mesenchymal cells, bind to membrane receptors expressed in mainly epithelial cells (c-met, the c-erbBs, and the keratinocyte growth factor receptor, 4-8), and are potent effectors of epithelial growth, movement, and differentiation in vitro(5, 8, 9, 10) .

Scatter factor/hepatocyte growth factor, the specific ligand for the c-met receptor, is a 90-kDa secreted glycoprotein, which consists of disulfide-linked heavy (H) and light (L) chains generated by proteolytic cleavage from a single precursor molecule: the H-chain contains an N-terminal hairpin structure and four kringle domains, the L-chain is an inactive serine protease due to replacement mutations in 2 out of 3 resides of the catalytic site(11, 12, 13, 14, 15, 16, 17) . The structure of SF/HGF is thus similar to blood proteases such as plasminogen but not to other known ligands for receptor type tyrosine kinases. Two distinct activities, the ability to induce proliferation and movement of epithelial cells, have been used to independently isolate and molecularily characterize the factor(5, 10, 11, 12, 13, 14, 15, 16, 17) . SF/HGF can also increase invasiveness of epithelial cells and acts as a cytostatic factor on certain other cells(10, 18, 19) . In addition, SF/HGF is an inducer of epithelial tubulogenesis in vitro(20) : When Madin-Darby canine kidney epithelial cells are cultured in collagen gels together with SF/HGF, they rapidly proliferate and form complex networks of branching tubules. In situ hybridization analysis demonstrated that during mouse development, the c-met receptor is expressed in many epithelia whereas transcripts for the ligand SF/HGF are preferentially found in nearby mesenchymal cells(6) . SF/HGF also plays an important role in liver regeneration since in animals, plasma levels of the factor and cellular mRNA are elevated after partial hepatectomy or liver damage induced by hepatotoxins(21, 22, 23, 24) . Thus, SF/HGF and c-met constitute a paracrine signaling system, a concept originally proposed by Stoker and colleagues(5, 6, 25) , that is acting during organ development and regeneration. SF/HGF is also expressed in distinct embryonal muscle and brain cells(6) .

Little is known about the regulation of SF/HGF expression in mesenchymal cells. It has been shown that in MRC5 fibroblasts, SF/HGF expression is down-regulated by TGFbeta1 or by coculture with epithelial cells(26, 27, 28) . In contrast, interleukin 1alpha, tumor necrosis factor-alpha, and the newly identified factor injurin increased SF/HGF expression(29, 30) . In primary human fibroblasts and HL60 leukemia cells, SF/HGF expression was also stimulated by phorbol esters(31, 32) . The sequences of the human and rat SF/HGF gene promoters have been determined and the major transcription start sites were mapped(33, 34) , but no activity studies have been reported. In the present investigation, we show that sequences around the major transcription start site of the mouse SF/HGF promoter are sufficient to direct expression in fibroblasts but not in epithelial cells and that a negative regulatory element is located between positions -239 and -258 of the promoter.


MATERIAL AND METHODS

DNA Clones and Promoter CAT Assays

A mouse genomic library (E 14 TG2A, from mouse strain 129) in 2001 was screened for the SF/HGF promoter region with P-labeled fragments spanning 5` sequences of the mouse SF/HGF cDNA. A 10-kilobase XhoI fragment containing 5`-flanking sequences, the first exon, and part of the first intron was subcloned from a particular lambda clone into Blue Script KS- (Stratagene, La Jolla) and used to generate the chimeric promoter CAT constructs m-3000 and m-755 by ligating appropriate restriction fragments into the promoter-less plasmid pCAT-basic (Promega). The -365, -291, -239, -150, and -70 mouse promoter CAT constructs were prepared by BAL-31 nuclease (Boehringer Mannheim) digestion of the m-755 fragment. The -7 and +14 mouse promoter CAT constructs were generated by cloning respective oligonucleotides into pCAT-basic. All deletion fragments had a common 3`-end at position +34 which represents a natural PstI site in the mouse SF/HGF promoter. Deletion construct Delta-66/+34 was generated by digesting clone m-755 with restriction enzymes BglII and PstI. Blunt ends were created with Klenow DNA polymerase (Boehringer Mannheim), and the fragment was religated using T4 DNA ligase (Biolabs, Beverly, Ma). Internal deletion construct Delta-239/-258 was generated via PCR (35) using the respective plasmid clones as the starting templates and Vent polymerase (Biolabs, Beverly, MA). Primer pairs had the following sequence: a, CACAGGAAACAGCTATGACC; b, TTACAAAGCAAAGGTCACCTTTTGGAAGCTGGAGCTCCAGATCC; a`, TTTAGCTTCCTTAGCTCCTG; b`, AGGTGACCTTTGCTTTGTAAG.

Fragments spanning the human promoter were cloned after PCR amplification using 5`-nested primers (35) and human placenta DNA (donated by Dr. Ilse Wieland, University of Essen); 5` primer (h-991/-10179): CTCCTGCAGGATTTCCGGTGAAAGTCAGTCCTAACC; 5` primer (h-345/-372): CTCCTGCAGCTGCCTGTGCCTTGATTTAGCCATTGG; 3` primer (h+32/+58): CCAGGCATCTCCTCCAGAGGGATCCGCTCTAGACTC. After digestion with the restriction enzymes XbaI and PstI, the fragments were cloned into Bluescript SK+ and pCAT-basic (Promega). The correct sequence was confirmed by sequencing with T7 DNA polymerase (Pharmacia Biotech Inc.). The human promoter CAT constructs had a common 3`-end at position +58. Relative promoter activities of the various constructs were estimated by comparison with the promoter activity of a CAT plasmid containing the simian virus 40 promoter/enhancer CAT gene (Promega). CAT assays were performed after transient transfection using the calcium-phosphate method, and activities were quantified as described(37) . A control plasmid containing the Rous sarcoma virus promoter and the Escherichia coli lacZ gene was cotransfected in each experiment. The amount of cell extracts used in CAT assays was adjusted according to the beta-galactosidase activities. Each transfection experiment was carried out twice with double values and with two different preparations of the same plasmid. To assess the effect of TGFbeta1 on promoter activity, transfected cells were treated 14 h post-transfection with 5 ng/ml of the factor (Boehringer Mannheim), and cell extracts were prepared 24 h later. To analyze the effect of coculture with epithelial cells, equal numbers of either mitomycin-treated Madin-Darby canine kidney cells or, as a contol, mitomycin-treated fibroblasts were immediately seeded on top of the transfectants. Cocultures were continued for 40 h after which cell extracts were prepared. Mitomycin treatment was as described (27) .

RNA Preparation and RNase Protection Analysis

Total RNA from cells transiently transfected with promoter CAT constructs was prepared by guanidinium isothiocyanate extraction 16 h after the removal of the precipitates and treated with DNaseI (Boehringer) in the presence of RNasin ribonuclease inhibitor (Boehringer). RNase protection experiments were performed as described(6) . A subclone of deletion construct m-150 covering SF/HGF promoter sequences and the N-terminal part of the CAT gene was generated after digestion with HindIII and PvuII and insertion into Bluescribe M13+ between HindIII and SmaII sites. The antisense probe was synthesized as T7 run-off transcript after linearization with BglII. For RNase protection, 50,000 counts/min of labeled transcript were hybridized for 12 h to 50 µg of RNA, digested with 6 units of RNase T2 (Sigma) for 1 h, and analyzed on denaturing polyacrylamide gels.

Gel Retardation Assay and DNase Footprinting

Nuclear extracts were prepared and gel retardation assays performed as described(37) ; each sample contained 1 µg of poly(dI-dC) (Boehringer Mannheim) as nonspecific competitor. Double-stranded oligonucleotides span the positions -7 to +34 of the mouse SF/HGF promoter; competitor oligonucleotides span nucleotides -7 to + 34 or +14 to +34. For DNaseI footprinting of the promoter region covering the transcription start sites, clone m-150 was radioactively labeled at the 3`-end of the noncoding strand (with Klenow after linearization with HindIII). An end-labeled fragment of 200 nt in length was recovered after digestion with XbaI. To analyze factor binding in the region between position -70 to -450, the m-755 clone was labeled at the 3`-end of the coding strand after linearization wirh either BSTE II or BglII. Digestion with NsiI or HindIII resulted in end-labeled fragments of 330 and 520 nucleotides in length. Footprinting assays were performed as described (37) with 100-150 µg of protein from crude nuclear extracts, 1 µg of poly(dI-dC), and 1-2 ng of labeled probe at a specific activity of 2 times 10^7 counts/min/µg.

Cell Lines

Two sources of NIH3T3 mouse fibroblasts were used: the clone D4 and ras transfectants of the same clone(5) . The other cell lines were as described in Refs. 10, 13, and 37.


RESULTS

Cloning of Mouse and Human SF/HGF Promoter Sequences

In order to carry out functional analyses of the SF/HGF promoter, sequences upstream of the major transcription start site of the human gene (33) were amplified by PCR using 5` nested primers (see ``Materials and Methods''). The isolated fragments span 1017 and 372 base pairs upstream of the major transcription start site (33) and contained identical 3`-ends at position +58. The mouse SF/HGF promoter was isolated from a genomic library of embryonal stem cells (strain 129); the fragments employed in this study span 3,000 and 755 base pairs of upstream sequences and again had identical 3` -ends at position +34. Alignment of the SF/HGF promoter sequences of the two species (Fig. 1) revealed 89.5% identity up to position -453 and no homology further upstream (shown up to position -514, but see also Genbank data base). Alignment of the mouse sequence and the previously reported rat SF/HGF promoter sequence (34) showed 96.4% identity up to position -450 and 88% from positions -450 to -758. Characteristically, the human promoter contains two stretches of 13 and 16 nt that are absent in the mouse sequence. The major transcription start site of the human gene (large downward pointing arrow, 33) is shown in Fig. 1, and so are the mapped start sites of the mouse promoter (upward pointing arrows; see also below). Identical sites were previously determined for the rat promoter sequence(34) .


Figure 1: Sequences of the mouse (m) and human (h) SF/HGF promoter. Genomic sequences are aligned in the region between nt -514 and +113 relative to the most proximal transcription start site of the mouse gene. The ATG codon marked by dots represents the translation start site; nucleotides marked by stars represent the identity between the two sequences. Arrows mark the major transcription start site of the human gene (33) and the identified transcription start site of the mouse gene, which corresponds to the major and minor start sites of the rat gene(34) .



The SF/HGF Promoters Are Functional in Mesenchymal But Not Epithelial Cells

Fragments of both the mouse and human promoters were cloned into a CAT expression vector (pCAT basic, see (37) ) and examined by transfection into fibroblasts and epithelial cells (Fig. 2). In ras3T3 fibroblasts, shorter fragments of both promoters resulted in slightly stronger activity than larger fragments (compare human-1017 with h-372 and mouse-3,000 with m-755 or m-70). A promoter fragment in the reverse orientation (m-755 r) was inactive. None of the constructs tested showed significant activity in the epithelial cell line MCF7. Similar differences in promoter activities were observed in other fibroblast (3T3 and MRC5) and epithelial (CSG 120/7 and MDA MB 435) cell lines (data not shown).


Figure 2: Relative activities of human (h) and mouse (m) SF/HGF promoter CAT constructs. Specific transcript initiation in fibroblasts. CAT assays are shown for ras3T3 fibroblasts (A) and MCF7 breast epithelial (carcinoma) cells (B). The activities of various deletion constructs were compared with those of the SV40 promoter/enhancer construct and of pCAT basic. Numbers indicate the position of the 5`-end of the promoter fragment used, relative to the major transcription start site. The m-755 construct of the mouse promoter was also tested in the reverse orientation (m-755r). C, scheme of the experimental design for the RNase protection assay. The HindIII-PvuII fragment from the chimeric -150/+34 SF/HGF-CAT fusion gene was cloned into the HindIII-Sma sites of Bluescribe M13+ and linearized with BglII as indicated to generate the specific run-off transcript. Relative positions of transcriptional start sites are marked with upward-pointing arrows. Hybridization of the specific antisense probe to RNA of transient transfectants yielded protected fragments of 270, 220, and 200 nt. Fragments of 113 nt correspond to properly initiated transcripts of the cotransfected SV40 promoter/enhancer plasmid. D, RNase protection assay of various transfected constructs in ras3T3 or MCF7 cells as indicated above the slots. The size marker M is pBR digested with MSPII. The input lane (I) shows the T7 antisense probe. The protected fragments corresponding to transcripts initiated at either the SF/HGF or the SV40 promoter are indicated by arrows.



In order to confirm that the observed differences in CAT activity result from a transcriptional effect, we mapped by RNase protection chimeric CAT-mRNA transcripts in fibroblasts (ras3T3) and epithelial cells (MCF7) transiently transfected with the mouse SF/HGF promoter. The antisense riboprobe that we used recognizes the N-terminal part of the CAT gene and mouse SF/HGF promoter sequences up to position -70 (Fig. 2C). Cells were transfected with the SV40 promoter/enhancer-driven CAT gene alone or in combination with the SF/HGF promoter construct m-365. We detected three protected fragments in ras3T3 fibroblasts but none in epithelial cells (Fig. 2D). This indicates tissue-specific transcription from the SF/HGF promoter in agreement with the results obtained in the CAT assays. The major protected fragments of 200, 220, and 270 nucleotides in length correspond to transcript initiation sites that have been mapped for the rat SF/HGF gene(34, 42) .

Deletion Analysis of the Mouse SF/HGF Promoter

Progressive 5` deletions of the mouse SF/HGF promoter, either generated by BAL-31 digestion of clone m-755 or by inserting synthetic oligonucleotides, were also tested in the CAT assays (Fig. 3): In ras3T3 fibroblasts, promoter activity increased with progressive deletion to position -365 and decreased sharply after further deletion to -291. Removal of additional 52 nt to -239 increased the promoter activity again, which remained essentially constant when further sequences down to the major transcription start site were deleted (position -7). Removal of the sequence containing the major transcription start site (nt -7 to +14) resulted in complete loss of activity. The most active promoter fragment (nt -365 to +34) had approximately 20% of the activity of the SV40 promoter/enhancer. Similar results were obtained with 3T3 fibroblasts (not shown). In MCF7 epithelial cells, all constructs showed only background activity. These combined results indicate that the SF/HGF promoter is composed of positive and negative regulatory elements which restrict the activity of the promoter to mesenchymal cells. Positive elements are located upstream of position -291 and around the major transcription start site, and a negative element is located between positions -291 and -239.


Figure 3: Activity of progressive 5` deletions of the mouse SF/HGF promoter. On the left, the transfected chimeric deletion CAT constructs are displayed; the numbers indicate the length of the constructs with respect to the major transcription start site. On the right, relative CAT-activities of the constructs in fibroblasts (ras3T3) and epithelial cells (MCF7) in comparison to the SV40 promoter/enhancer are shown. Major and minor transcription start sites are indicated by the two arrows.



It has previously been shown that SF/HGF mRNA levels in fibroblasts are modulated after treatment with TGFbeta1, TPA, and coculture with epithelial cells(26, 27, 32, 38, 39, 40) . We subjected ras3T3 fibroblasts, which were transiently transfected with the various promoter deletion constructs, to treatment with TGFbeta1, TPA, and coculture with Madin-Darby canine kidney epithelial cells. These treatments did not lead to significant changes in the amounts of promoter CAT activities and in the profile seen when different deletion constructs were compared (data not shown).

Localization of Nuclear Factor Binding Sites by Footprinting and Gel Retardation Analysis

Footprint analyses of the SF/HGF promoter with nuclear extracts of fibroblasts and epithelial cells were performed in the region which is highly conserved between species, i.e. between the transcription start sites and position -450 (Fig. 4). With nuclear extracts of ras3T3 cells, specific DNaseI protection was observed between positions +14 and -7 as well as between positions -21 and -70. A site protected in both fibroblasts and epithelial cells (MCF7) was detected between positions -229 and -258.


Figure 4: Nuclear factor binding to the SF/HGF promoter by footprint analysis. Fragments of the mouse SF/HGF promoter were labeled at position -239 (left picture, non-coding strand) and -70 (right picture, coding strand) and subjected to DNaseI footprint analysis using nuclear extracts of ras3T3 fibroblasts and MCF7 epithelial cells (see ``Materials and Methods''). The lanes marked(-) indicate digestion in the absence of nuclear extract. The lanes G and G + A are Maxam-Gilbert sequence reaction products. The region specifically protected in fibroblasts (+14 to -7 and -21 to -70) and the region protected in both cell lines (-229 to -258) are schematically displayed on the left and right side, respectively.



The region around the major transcription start site was also examined by gel retardation analysis with nuclear extracts from various cell lines (Fig. 5). Using an oligonucleotide spanning positions -7 to +34 and nuclear extracts of fibroblasts (ras3T3 and NIH3T3), three major retarded complexes were detected (arrowheads). The formation of these complexes was competed by the unlabeled oligonucleotide but not by an oligonucleotide from positions +14 to +34 or by an unrelated oligonucleotide (E-Pal). Interestingly, extracts of MCF7 epithelial and neuro 2A cells did not form the complex of intermediate size (large arrowhead).


Figure 5: Nuclear factor binding to the region covering the transcription start site of the mouse SF/HGF promoter by gel retardation analysis: Difference between SF/HGF-producing and non-producing cell lines. A, schematic representation of the radiolabeled oligonucleotide probe (-7 to -34) used for gel retardation assays. B, gel retardation assay using nuclear extracts from ras3T3 fibroblasts and MCF7 epithelial cells. The specific competitor was the unlabeled -7 to +34 oligonucleotide, a second oligonucleotide was from position +14 to +34, and a nonspecific competitor was from the E-cadherin promoter (E-Pal, cf. (37) ). Unlabeled oligonucleotides were used at 50-fold molar excess. C, gel retardation assay using nuclear extracts from 3T3 fibroblasts and neuro 2A (neuroblastoma) cells. Conditions were as in B.



Analysis of the Negative and Positive Regulatory Elements of the SF/HGF Promoter by Specific Deletion

Two regions of the promoter which appear to be important for negative and positive regulation were deleted and analyzed in transient transfection experiments (Fig. 6). Removal of the nucleotides between -239 and -258 which were protected in footprint analysis resulted in a release of the inhibition of promoter activity seen with the mouse -291 construct. We inserted multiple copies of an oligonucleotide containing nt -229 to -258 into heterologous promoters (SV40, TK minimal promoter, and E-cadherin(37) ). No inhibitory effect was detected; the E-cadherin promoter was stimulated 2-3-fold (data not shown). Deletion of the -66 to +34 region from the m-755 construct, which harbors the transcription start sites and was found to be involved in nuclear factor binding, resulted in complete loss of promoter activity.


Figure 6: Deletion of the promoter regions presumed to be important for positive and negative regulation. A, the region -258 to -239 specifically protected in footprint analysis (cf.Fig. 4) was deleted from the m-291 construct, and B, the region -66 to +34 was deleted from the mouse -755 construct. C and D, CAT assays showing the effects of these two deletions. CAT activities of the constructs m-755, m-150, and pCAT basic are shown for comparison.




DISCUSSION

In the present investigation we examined, by promoter analysis, the regulation of the scatter factor/hepatocyte growth factor gene which is, in vivo, expressed in mesenchymal (and some neuronal) but not in epithelial cells(6) . The target of SF/HGF is the Met receptor tyrosine kinase which is predominantly produced by epithelial and endothelial but not mesenchymal cells. We show here that the activity of our SF/HGF promoter constructs is restricted to mesenchymal cells, as shown by CAT and RNase protection assays, and we have identified positive and negative regulatory elements in this promoter fragment (Fig. 7). The positive regulatory elements are located around the major transcription start site and upstream of position -291, a negative regulatory element is located at positions -239 to -258. Our work has failed to provide evidence for a role of the IL6 and TGFbeta response elements previously identified in the human and rat promoter (cf. Refs. 33, 34).


Figure 7: Functionally important sequences in the SF/HGF promoter. Large (shadowed) boxes, positive and negative regulatory regions identified by deletion and footprint analysis. Arrows indicate major and minor transcription start sites. HLH, NF1, hAPF1, and AP-1 are consensus binding sites for helix-loop-helix transcription factors, nuclear factor-1, human interleukin 6-dependent transcription factor, and AP-1 transcription factor. TGFbeta/TIE, TGFbeta inhibitory element (black box); IL6RE, interleukin 6-responsive elements (bullet); NFIL6, interleukin 6-dependent nuclear factor (). P1, P2, and P3 are palindromic sequences.



The negative regulatory element in the SF/HGF promoter was uncovered due to a 3-4-fold drop of promoter activity in a 5` deletion experiment and was also detected in our footprint analysis as a region of factor binding (positions -258 to -229). Indeed, internal deletion of the protected sequences fully released the inhibitory effect of the element. This sequence, therefore, is a negative regulatory element for which some preliminary evidence may have been presented by others(41) . Interestingly, the sequence contains putative binding sites for helix-loop-helix transcription factors and nuclear factor-1 (42) as well as a previously identified palindrome, P2(33) . However, this element appears to be largely promoter context dependent since it had no negative influence on the heterologous SV40 and TK promoters; to our surprise, it stimulated the activity of the E-cadherin promoter when inserted at position -78 (data not shown, cf.(37) ). A promoter context-dependent element with similar characteristics has also been described in the human erbB-2 promoter(43) . Footprint analysis also uncovered nuclear factor binding sites to regions close to the transcriptional start sites, which are specific for extracts of mesenchymal cells. The 5` deletion analysis revealed that the region between positions -7 and +14 is of particular importance, and gel retardation experiments with an oligonucleotide from this region showed the formation of a specific proteinbulletDNA complex which is characteristic for SF/HGF-expressing cells. The sequence -7 to +14 of the SF/HGF promoter does not fit the initiator sequence 5`-CTCANTCT-3` described for well studied TATA-less promoters(44) . A noncanonical TATA element (AATAAA) at position -24 might be responsible for transcription initiation at multiple sites.

Much effort has here been undertaken to identify elements in the SF/HGF promoter which reflect the effects of various modulators of SF/HGF expression in vivo and in cell culture, such as TGFbeta(26, 38) , TPA(32) , or factors produced by cocultured epithelial cells(27) . None of these factors significantly influenced promoter activity in our transient transfection assays. This suggests that additional cis-elements outside the promoter region we have studied here are involved in the response to these agents or that the effect of TGFbeta, TPA, and coculture with epithelial cells is translational rather than transcriptional. Nuclear run-off transcription reactions and measurements of the half-life of the SF/HGF transcript in fibroblast cultures exposed to TGFbeta, TPA, or IL6 should clarify this point. After completion of this work, a paper appeared (45) which describes aspects of the SF/HGF promoter. Surprisingly, these authors found activity also in the carcinoma (epithelial) cell line RL 95-2. No factor binding by footprinting or bandshift analysis is shown. However, IL6 treatment stimulated promoter activity 2.5-fold in a stably transfected cell clone. No stimulation of SF/HGF expression by IL6 was reported by others(29) .

Future experiments in transgenic animals will show whether the SF/HGF promoter elements identified in the present study are sufficient to generate the expression pattern as seen with the endogenous gene. In particular, it will be interesting to examine whether the SF/HGF cDNA driven by this promoter fragment can rescue the lethal phenotype of mice with homozygous deletion of the SF/HGF gene. (^2)Furthermore, we will compare promoter fragments with and without the negatively acting element in order to see in which tissues this element may suppress SF/HGF expression in vivo.


FOOTNOTES

*
This work was supported by the Deutsche Forschungsgemein-schaft. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) X81630[GenBank].

(^1)
The abbreviations used are: SF/HGF, scatter factor/hepatocyte growth factor; TGFbeta1, transforming growth factor beta1; TPA, 12-O-tetradecanoylphorbol-13-acetate; CAT, chloramphenicol acetyltransferase; PCR, polymerase chain reaction; nt, nucleotide(s); IL6, interleukin-6.

(^2)
C. Schmidt, S. Goedecke, F. Bladt, V. Brinkmann, W. Zschiesche, M. Sharpe, E. Gherardi, and C. Birchmeier, manuscript submitted for publication.


ACKNOWLEDGEMENTS

We thank Jörg Hülsken for the help with the computer graphics, Dr. Carmen Birchmeier (Cologne) for critically reading the manuscript, and I. Wiznerowicz for excellent secretarial work.


REFERENCES

  1. Saxen, L. (1987) Organogenesis of the Kidney, Cambridge University Press, Cambridge
  2. Sakakura, T. (1991) Int. Rev. Cytol. 125, 165-202 [Medline] [Order article via Infotrieve]
  3. Birchmeier, C., and Birchmeier, W. (1993) Ann. Rev. Cell Biol. 9, 511-540 [CrossRef]
  4. Bottaro, D. P., Rubin, J. S., Faletto, D. L., Chan, A. M.-L., Kmiecik, T. E., Vande Woude, G. F., and Aaronson, S. A. (1991) Science 251, 802-804 [Abstract/Free Full Text]
  5. Stoker, M., Gherardi, E., Perryman, M., and Gray, J. (1987) Nature 327, 239-242 [CrossRef][Medline] [Order article via Infotrieve]
  6. Sonnenberg, E., Meyer, D., Weidner, K. M., and Birchmeier, C. (1993) J. Cell Biol. 123, 223-235 [Abstract/Free Full Text]
  7. Meyer, D., and Birchmeier, C. (1994) Proc. Natl. Acad. Sci. U. S. A. 97, 1064-1068
  8. Miki, T., Fleming, T. P., Bottaro, D. P., Rubin, J. S., Ron, D., D., and Aaronson, S. A., (1991) Science 251, 72-75 [Abstract/Free Full Text]
  9. Peles, E., Ben-Levy, R., Tzahar, E., Liu, N., Wen, D., and Yarden, Y. (1993) EMBO J. 12, 961-971 [Medline] [Order article via Infotrieve]
  10. Weidner, K. M., Behrens, J., Vandekerckhove, J., and Birchmeier, W. (1990) J. Cell Biol. 111, 2097-2108 [Abstract/Free Full Text]
  11. Miyazawa, K., Tsubouchi, H., Naka, D., Takahashi, K., Okigaki, M., Arakaki, N., Nakayama, H., Hirono, S., Sakiyama, O., Takahashi, K., Gogha, E., Daikuhara, Y., and Kitamura, N. (1989) Biochem. Biophys. Res. Commun. 163, 967-973 [CrossRef][Medline] [Order article via Infotrieve]
  12. Nakamura, T., Nishizawa, T., Hagiya, M., Seki, T., Shimonishi, M., Sugimura, A., Tashiro, K., and Shimizu, S. (1989) Nature 342, 440-443 [CrossRef][Medline] [Order article via Infotrieve]
  13. Weidner, K. M., Arakaki, N., Hartmann, G., Vandekerckhove, J., Weingart, S., Rieder, H., Fonatsch, C., Tsubouchi, H., Hishida, T., Daikuhara, Y., and Birchmeier, W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7001-7005 [Abstract/Free Full Text]
  14. Lokker, N. A., Mark, M. R., Luis, E. A., Bennett, G. L., Robbins, K. A., Baker, J. B., and Godowski, P. J. (1992) EMBO J. 11, 2503-2510 [Medline] [Order article via Infotrieve]
  15. Zarnegar, R., and Michalopoulos, S. (1989) Cancer Res. 49, 3314-3320 [Abstract/Free Full Text]
  16. Rubin, J. S., Chan, A. M. L., Bottaro, D. P., Burgess, W. H., Taylor, W. G., Cech, A. C., Hirschfield, D. W., Wong, J., Miki, T., Finch, P. W., and Aaronson, S. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 415-419 [Abstract/Free Full Text]
  17. Rosen, E. M., Meromsky, L., Romero, R., Setter, E., and Goldberg, I. (1990) Biochem. Biophys. Res. Commun. 168, 1082-1088 [CrossRef][Medline] [Order article via Infotrieve]
  18. Higashio, K., Shima, N., Goto, M., Itagaki, Y., Nagao, M., Yasuda, H., and Morinaga, T. (1990) Biochem. Biophys. Res. Commun. 170, 397-404 [CrossRef][Medline] [Order article via Infotrieve]
  19. Shiota, G., Rhoads, B. D., Wang, C. T., Nakamara, T., and Schmidt, U. R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 373-377 [Abstract/Free Full Text]
  20. Montesano, R., Matsumoto, K., Nakamura, T., and Orci, L. (1991) Cell 67, 9011-908
  21. Zarnegar, R., DeFrances, M. C., Kost, D., Lindroos, P., and Michalopoulos, G. K. (1991) Biochem. Biophys. Res. Commun. 177, 559-565 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kinoshita, T., Tashiro, K., and Nakamura, T. (1989) Biochem. Biophys. Res. Commun. 165, 1229-1234 [CrossRef][Medline] [Order article via Infotrieve]
  23. Tsubouchi, H., Niitani, Y., Hirono, S., Nakayama, H., Gohda, E., Arakaki, N., Sakiyama, N., Takahashi, K., Kimoto, M., Kawakami, S., Setoguch, M., Tachkawa, T., Shin, S., Arima, T., and Daikuhara, Y. (1991) Hepatology 13, 1-5 [CrossRef][Medline] [Order article via Infotrieve]
  24. Hu, Z., Evarts, P. R., Fujio, K., Marsden, E. R., and Thorgeirsson, S. (1991) Am. J. Pathol. 142, 1823-1830 [Abstract]
  25. Stern, C. D., Ireland, G. W., Herricle, S. E., Gherardi, E., Gray, J., Perryman, M., and Stoker, M. (1990) Development 110, 1271-1284 [Abstract/Free Full Text]
  26. Gohda, E., Matsunaga, T., Kataoka, H., and Yamamoto, I. (1992) Cell Biol. Intern. Reports 16, 917-926
  27. Kamalati, T., Thirunavukarasu, B., Wallace, A., Holder, N., Brooks, R., Nakamura, T., Stoker, M., Gherardi, E., and Buluwela, L. (1992) J. Cell Sci. 101, 323-332 [Abstract/Free Full Text]
  28. Seslar, S. P., Nakamura, T., and Byers, S. W. (1993) Cancer Res. 53, 1233-1238 [Abstract/Free Full Text]
  29. Tamura, M., Arakaki, N., Tsubouchi, H., Takada, H., and Daikuhara, Y. (1993) J. Biol. Chem. 268, 8140-8145 [Abstract/Free Full Text]
  30. Matsumoto, K., Tajima, H., Hamanoue, M., Kohno, S., Kinoshita, T., and Nakamura, T. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 3800-3804 [Abstract/Free Full Text]
  31. Nishino, T., Kaise, N., Nishio, Y., Nishida, T., Yasuda, S., and Masui, Y. (1991) Biochem. Biophys. Res. Commun. 181, 323-330 [CrossRef][Medline] [Order article via Infotrieve]
  32. Gohda, E., Kataoka, H., Tsubouchi, H., Daikilara, Y., and Yamamoto, I. (1992) FEBS Lett. 301, 107-110 [CrossRef][Medline] [Order article via Infotrieve]
  33. Miyazawa, K., Kitamura, A., and Kitamura, N. (1991) Biochemistry 30, 9170-9176 [CrossRef][Medline] [Order article via Infotrieve]
  34. Okajima, A., Miyazawa, K., and Kitamura, N. (1993) Eur. J. Biochem. 213, 113-119 [Medline] [Order article via Infotrieve]
  35. Erlich, A. H. (1989) PCR Technology, Principles and Applications for DNA Amplifications , pp. 61-70, Stockton Press,
  36. Sambrook, J., Fritch, E. F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY
  37. Behrens, J., Löwrick, O., Klein-Hitpass, L., and Birchmeier, W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11495-11499 [Abstract/Free Full Text]
  38. Ramadori, G., Neubauer, K., Odenthal, M., Nakamura, T., Knittel, T., Schwögler, S., and Meyer zum Büschenfelde, K. H. (1992) Biochem. Biophys. Res. Commun. 183, 739-742 [CrossRef][Medline] [Order article via Infotrieve]
  39. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krause, M., Benezra, R., Blackwell, T. K., Turner, D., Rupp, R., Hollenberg, S., Zhuang, Y., and Lassar, A. (1991) Science 251, 761-766 [Abstract/Free Full Text]
  40. Goyal, N., Knox, J., and Gronostajski, R. M. (1990) Mol. Cell. Biol. 10, 1041-1048 [Abstract/Free Full Text]
  41. Aravamudan, B., Watabe, M., and Watabe, K. (1993) Biochem. Biophys. Res. Commun. 195, 346-353 [CrossRef][Medline] [Order article via Infotrieve]
  42. Faisst, S., and Meyer, S. (1992) Nucleic Acids Res. 20, 3-26 [Free Full Text]
  43. Chen, Y., and Gill, G. N. (1994) Oncogene 9, 2269-2276 [Medline] [Order article via Infotrieve]
  44. Smale, S. T., and Baltimore, D. (1989) Cell 57, 103-133 [CrossRef][Medline] [Order article via Infotrieve]
  45. Liu, Y., Michalopoulos, G. K., and Zarnegar, R. (1994) J. Biol. Chem. 269, 4152-4160 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
K. Nasu, T. Sugano, N. Matsui, H. Narahara, Y. Kawano, and I. Miyakawa
Expression of Hepatocyte Growth Factor in Cultured Human Endometrial Stromal Cells Is Induced through a Protein Kinase C-Dependent Pathway
Biol Reprod, May 1, 1999; 60(5): 1183 - 1187.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. W. Bell, J.-G. Jiang, Q. Chen, Y. Liu, and R. Zarnegar
The Upstream Regulatory Regions of the Hepatocyte Growth Factor Gene Promoter Are Essential for Its Expression in Transgenic Mice
J. Biol. Chem., March 20, 1998; 273(12): 6900 - 6908.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-G. Jiang, A. Bell, Y. Liu, and R. Zarnegar
Transcriptional Regulation of the Hepatocyte Growth Factor Gene by the Nuclear Receptors Chicken Ovalbumin Upstream Promoter Transcription Factor and Estrogen Receptor
J. Biol. Chem., February 14, 1997; 272(7): 3928 - 3934.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-G. Jiang, C. Johnson, and R. Zarnegar
Peroxisome Proliferator-activated Receptor gamma -mediated Transcriptional Up-regulation of the Hepatocyte Growth Factor Gene Promoter via a Novel Composite cis-Acting Element
J. Biol. Chem., June 29, 2001; 276(27): 25049 - 25056.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plaschke-Schlütter, A.
Right arrow Articles by Birchmeier, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plaschke-Schlütter, A.
Right arrow Articles by Birchmeier, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement