Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwarzenbach, H.
Right arrow Articles by Matthias, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwarzenbach, H.
Right arrow Articles by Matthias, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 2, Issue of January 13, 1995 pp. 898-907
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Involvement of the Ets Family Factor PU.1 in the Activation of Immunoglobulin Promoters (*)

(Received for publication, August 5, 1994; and in revised form, October 5, 1994)

Heidi Schwarzenbach John W. Newell Patrick Matthias(§)

From the Friedrich Miescher Institute, P.O. Box 2543, CH-4002 Basel, Switzerland

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The B cell-specific expression of immunoglobulin (Ig) genes is controlled by the concerted action of variable (V) region promoters and intronic or 3` enhancers, all of which are active in a lymphoid-specific manner. A crucial highly conserved element of the V region promoters is the octamer site -ATTTGCAT-, which can be bound by ubiquitous (Oct-1) as well as B cell-specific (Oct-2) factors. Another less conserved element found in many Ig promoters is pyrimidine-rich and has been shown to be functionally important, in particular for those Ig promoters that have only an imperfect octamer site. In this study we have analyzed the factors binding specifically to the pyrimidine-rich motif of the Vkappa19 promoter, a light chain gene promoter with an imperfect octamer site. Using nuclear extracts prepared from B cells, we detected two sets of specific complexes in electrophoretic mobility shift experiments. One complex appears to be ubiquitous but enriched in lymphoid cells and represents the binding of a potentially novel factor with an apparent molecular mass of 50 kDa. The other complex was found only with extracts from pre-B or B cells as well as from a macrophage cell line and appears to be caused by the binding of PU.1, a factor of the Ets family. We show that on this Ig promoter Oct factors (Oct-1 or Oct-2) and PU.1 can bind concomitantly but without synergism. By transfection experiments in non-B cells we demonstrate that PU.1 is indeed able to activate this promoter in concert with Oct-2. Furthermore, we show that PU.1 can bind with varying affinities to the pyrimidine-rich elements of several other Ig promoters. These data suggest a more general role for PU.1 or other members of the Ets family in the activation of Ig promoters.


INTRODUCTION

Immunoglobulin (Ig) (^1)genes are preferentially expressed in cells of the B-lymphoid lineage. This tissue specificity is a property of the promoter and enhancer elements (1, 2, 3, 4) , both of which are lymphoid-specific. A highly conserved octamer element 5`-ATTTGCAT-3` that is present in Ig light chain promoters and, in the inverted orientation, in Ig heavy chain promoters (5) is essential for efficient Ig promoter activity both in vivo and in vitro(6, 7, 8, 9) . The octamer motif, located 50-70 bp upstream of the transcriptional start site, serves as a binding site for the lymphoid-specific transcription factor Oct-2 (10, 11, 12, 13, 14) and the ubiquitous factor Oct-1(15, 16, 17, 18, 19, 20) , which are members of the POU family of homeodomain proteins. In addition, some heavy chain promoters contain a so-called heptamer motif 5`-CTCATGA-3` that, in cooperation with the octamer motif, can also bind octamer factors(21, 22) .

The B cell specificity of Ig promoters is largely caused by the octamer element(9) , although this same element is also implicated in the ubiquitous expression of small nuclear RNA genes(23) , the cell cycle regulation of the histone H2B gene(24) , and the VP16-dependent expression of herpesvirus intermediate early genes(25, 26, 27) . The ability of the octamer element to promote ubiquitous as well as B cell-specific gene expression was initially suggested to reside in its interaction with Oct-1 and Oct-2. The different cellular distribution of these two proteins led to the proposal that Oct-2 rather than Oct-1 is responsible for the B cell specificity of Ig promoters. The suggestion that Oct-2 specifically promotes Ig gene transcription has come into question, because from in vitro experiments with octamer-containing promoter constructs, it has been shown that Oct-1 and Oct-2 are essentially interchangeable(28) . Analysis of Oct-2 knockout mice has shown that Oct-2 is not required for the generation of Ig-bearing B cells but is crucial for their maturation to Ig-secreting cells, and this implies that Oct-2 plays an essential role only late in B cell differentiation(29) . Thus, it appears that both octamer factors can activate transcription from Ig promoters. Moreover, a B cell-restricted coactivator, OCA-B, which can interact with Oct-1 or Oct-2, has been suggested to be required for a high level of Ig promoter activity(30, 31) . In addition, a third less conserved pyrimidine-rich element is found upstream of the heptamer or the octamer motif in many Ig promoters and has been shown to be also important for full promoter activity. However, only little is known about the factors mediating Ig gene transcription from these pyrimidine-rich sequences(32, 33, 34) .

In the studies reported here, we have analyzed the factors binding to the pyrimidine-rich motif of a kappa light chain promoter (Vkappa19). By electrophoretic mobility shift assays (EMSAs) with nuclear extracts prepared from B cells and a Vkappa19 promoter pyrimidine-rich motif we detected two sets of specific complexes. We show that one of these factors binding specifically to that site appears to be PU.1, a member of the Ets family that is expressed in B cells and macrophages(35) . PU.1 is identical to the Spi-1 proto-oncogene(36, 37) , which was isolated as the site of Friend erythroleukemia virus integration in 95% of virally induced tumors. In addition to PU.1, the Ets family contains several proteins, for instance Ets-1, Ets-2, Elf-1, Elk-1, Erg, E74, Fli-1, and PEA3 (38) that share a relatively conserved 80-90-amino acid long DNA-binding domain that recognizes a purine-rich sequence with the core motif 5`-GGA(A/T)-3`(35, 39, 40) . As with other Ets proteins, however, very little is known about the cellular genes that are regulated by PU.1.

The other factor recognizing specifically the pyrimidine-rich motif has an apparent molecular mass of 50 kDa and is ubiquitous but is enriched in lymphoid extracts and might be a novel factor, perhaps also belonging to the Ets family. Furthermore, we demonstrate that PU.1 is able to strongly activate transcription of the Vkappa19 light chain promoter through the pyrimidine-rich motif and that maximal promoter activity was obtained in cooperation with Oct-2 in transfected cells. Finally, by performing binding studies with related pyrimidine-rich sequences derived from light or heavy chain promoters, we show that PU.1 can also bind with varying affinities to several of these motifs present in other Ig promoters. Our data, thus, suggest that PU.1 as well as perhaps other factors of the Ets family might be involved in the regulation of a number of Ig promoters.


MATERIALS AND METHODS

Cell Lines and Nuclear Extracts

The non-lymphoid cell line HeLa is derived from a human epitheloid cervical carcinoma; Cos is an SV40-transformed monkey kidney; and 3T3 is an embryonal BALB/c mouse cell line. The B cell line BJA-B is a lymphoblastoid cell line; HAFTL, BAF3, 38B9, PD31, and 70Z/3 are mouse pre-B lymphocytes; NFS5.3 is a mouse pre-B lymphoblast; S194 is a mouse plasmacytoma; Wehi 231 is a mouse lymphoma; Nalm 6 is a human pre-B cell; and Namalwa is a Burkitt lymphoma cell line. The T-cell lines YAC1, PEER, and BW5147 are mouse lymphoma; and CEM, Molt 4, and Jurkat are human acute lymphoblastic leukemia cells. U937 is a human monocyte/macrophage cell line.

Lymphoid cells were grown to a density of 2 times 10^6 cells/ml in RPMI 1640 medium supplemented with 10% fetal calf serum, and non-lymphoid cells were grown to confluency in Dulbecco's modified Eagle's medium with 3% fetal calf serum and 3% newborn calf serum. Nuclear extracts from different cell lines were prepared as described previously(41) .

PU.1 cDNA Cloning

Cytoplasmic RNA from the pre-B cell line 70Z/3 was used for first strand cDNA synthesis primed with oligonucleotide dT. Using this cDNA, PU.1 cDNA was amplified by polymerase chain reaction with the specific primers 5`-CGGGGCACCTGGTCCTG-3` and 5`-GTAATCTAGATATGGCCGGCGGGGTCCAG-3` and subsequently subcloned into the XbaI and BamHI sites of the pBluescript KS(II) vector. The clone was verified by restriction mapping and DNA sequencing.

In Vitro Transcription and Translation

For in vitro expression Oct-1, Oct-2, and PU.1 cDNAs were subcloned into the pBGo vector, a Bluescript derivative in which part of the rabbit beta-globin gene leader sequence has been inserted immediately downstream of the T3 promoter. RNA was generated from BamHI-linearized Oct-1 and XbaI-linearized Oct-2 and PU.1 plasmids in a T3 RNA polymerase reaction, using an mCAP transcription kit (Stratagene). In vitro transcription reactions were carried out for 60 min at 37 °C. In vitro translations were performed by using 10 µl of the synthesized RNA, 35 µl of nuclease-treated rabbit reticulocyte lysate (Promega), 1 µl of amino acid mix, and 40 units of RNase inhibitor in a 50-µl reaction mixture. Translation reactions were carried out for 60 min at 30 °C.

EMSA

For EMSA 4-8 fmol of P-end-labeled oligonucleotides were incubated with 4 µg of nuclear extract or 1 µl of in vitro-translated protein (PU.1, diluted 1:6; Oct-1, undiluted; Oct-2, diluted 1:5) and 2 or 0.4 µg of poly(dI/dC), respectively, in 15 µl of a buffer containing 4% Ficoll, 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 0.25 mg/ml bovine serum albumin (Boehringer Mannheim) and 2 mM spermine. After 15 min of incubation at room temperature the binding reaction was separated on a native 4% polyacrylamide gel (29:1 cross-link) in 0.25 times Tris borate-EDTA (TBE) buffer at 10 V/cm for 2-3 h at room temperature. Competition experiments were done by mixing an 100-1000-fold molar excess of unlabeled competitor DNA to the binding reaction before adding the nuclear extract. For antibody supershift experiments 1 µl of a polyclonal rabbit antibody raised against the carboxyl-terminal domain (amino acids 251-271) of PU.1 was added to the nuclear extract or in vitro-translated protein. The following oligonucleotides were synthesized for use in EMSA: the pyrimidine-rich motif (kappaPy) GTAATTTACTTCCTTATTTGATGA and the mutated motif (kappaPy*) GTAATTTACTCGAGTATTTGATGA, bp -97 to -74, of the Vkappa19 promoter; the pyrimidine-rich and the octamer motif (kappaPy/Octa) GTAATTTACTTCCTTATTTGATGACTCCTTTGCATAGAT, bp -97 to -59, of the Vkappa19 promoter; the SV40 PU box, bp -321 to -298, CTCTGAAAGAGGAACTTGGTTAGG; the pyrimidine-rich motifs of the V1 promoter, TAATAACTTCACTCTCTACAACTT; the V101 promoter, GCTCATTGCTTCCTTTTATTCTGA; the V37A4 promoter, CTCTAGTTTCTTCTTCTCCAGCTGGAATG; the V37A11 promoter, CCAGTAGTTCTCCTGCTCAATTAG; the Vkappa105 promoter, CTATATAACTCTTCCTTCTATACTGCAACAC; the V12G-1 promoter, CCTTTTCACCTCTCCATACAGAGGC; and the VkappaA19 CCCATTGACTCTTTCCACACCACTGC. The pyrimidine-rich sequences as well as the purine-rich motif are in boldface type, and the mutated sequence is indicated with an asterisk (*). All oligonucleotides were purified by electrophoresis on 12% denaturing acrylamide gels.

Methylation Interference Assays and Copper-phenanthroline Footprinting Analysis

For methylation interference analysis a 24-bp fragment extending from bp -97 to -74 of the Vkappa19 promoter was subcloned into the EcoRV site of the pBluescript KS vector. The resulting plasmid was then linearized with either EcoRI or SalI, treated with calf intestine alkaline phosphatase (Boehringer Mannheim), 5`-end-labeled with [-P]ATP by polynucleotide kinase (BioLabs) and recut with the second restriction enzyme. Labeled DNA fragments were purified by polyacrylamide gel electrophoresis. These probes were partially methylated for 8 min at room temperature with 1 µl of dimethyl sulfate. As compared with the standard gel shift assay, each preparative scale binding reaction was scaled up 10-fold in BJA-B nuclear extract or in vitro-translated PU.1, 5-fold in poly(dI-dC), and 100-fold in probe. After electrophoretic gel shift and transfer to DE81 paper, the bound and the free DNA were isolated, eluted with 1 M NaCl, Tris-EDTA, and precipitated with ethanol. For the G > A cleavage reaction the DNA pellet was dissolved in 10 mM sodium phosphate buffer (pH 7), heated for 15 min at 90 °C, cooled subsequently, and heated again for 20 min at 90 °C in 0.1 M sodium hydroxide. The samples were neutralized with 1 volume of 0.1 M acetic acid and subsequently precipitated with ethanol. The G + A piperidine cleavage reaction (Maxam and Gilbert method) of the probe and the G > A reaction were analyzed on a 12% polyacrylamide, 8 M urea gel. After electrophoretic gel shift was performed as described above, copper-phenanthroline footprinting reaction was carried out in the polyacrylamide matrix by the method described by Kuwabara et al.(42) .

Construction of Plasmids

Reporter plasmids were constructed by cloning the following double-stranded oligonucleotides containing various binding sites (in boldface type) into the SacI and SalI sites of the OVEC vector (43) immediately upstream of the beta-globin gene TATA box: kappaPy/Octa (bp -101 to -41), CTGTGTAATTTACTTCCTTATTTGATGACTCCTTTGCATAGATCCCTAGAGGCCAGCACAG; kappaPy*/Octa, CTGTGTAATTTACTCGAGTATTTGATGACTCCTTTGCATA G A T CCCTAGAGGCCAGCACAG; kappaPy/Octa*, CTGTGTAATTTACTTCCTTATTTGATGACTCCTGTTCAGAGATCCCTAGAGGCCAGCACAG; kappaPy*/Octa*, CTGTGTAATTTACTCGAGTATTTGATGACTCCTGTTCAGAGATCCCTAGAGGCCAGCACAG; kappaPy (bp -93 to -73), CTTTACTTCCTTATTTGATGACTG of the Vkappa19 promoter; SV40 PU box, CAACCTCTGAAAGAGGAACTTGGG; SV40 PU box inverse, CCCAAGTTCCTCTTTCAGAGGTTG. The mutated motifs are indicated with an asterisk (*). The Oct-2 expression vector pOEV1 has been described previously(12) . The PU.1 expression plasmid was constructed by cloning the PU.1 cDNA into the SmaI and XbaI sites of the vector pEVRF-2 (44) 3` of the cytomegalovirus enhancer/promoter and herpes simplex virus thymidine kinase leader. All clones were verified by DNA sequencing.

Transfections and RNase Protection

The mouse S194 and the human Namalwa B cell lines were grown to a density of 2 times 10^7 cells in 10 ml of RPMI 1640 medium and transfected by the DEAE-dextran procedure (10) with 4 µg of reporter plasmid and 0.8 µg of reference plasmid (Ovec-Ref). The human epithelial carcinoma cell line HeLa was grown to a confluency of 60-70% in 10 ml of Dulbecco's modified Eagle's medium and transfected by the calcium phosphate coprecipitation procedure with 20 µg of DNA (6 µg of reporter plasmid, 0.8 µg of reference plasmid, 4 µg of either expression plasmid or sonicated salmon sperm DNA and made up to 20 µg with sonicated salmon sperm DNA). 16-20 h after DNA addition, transfected HeLa cells were shocked with 25% dimethyl sulfoxide. 48 h after transfection, cytoplasmic RNA was extracted(10) . 20-40 µg of RNA was used for hybridization to a radioactive complementary strand RNA probe (covering positions -19 to 227 of the hybrid gene). Hybridization was performed at 37 °C overnight. Hybridization products were digested with 6.5 mg/ml RNase A and 10 units/ml RNase T1 at 37 °C for 1 h and subsequently separated on a 6% polyacrylamide, 8 M urea gel. The quantification of the radioactive bands was performed with a PhosphorImager. The signals derived from the reference transcripts were used to normalize the variability in transfection efficiency.


RESULTS

Nuclear Factors Bind to the Pyrimidine-rich Motif of the Vkappa19 Promoter

To determine which factors can bind to the pyrimidine-rich motif of Ig promoters, we prepared a probe derived from the Vkappa19 light chain gene, an Ig gene expressed in plasmacytoma MPC11 cells (45, 46) and containing a promoter with an imperfect octamer site (7 out of 8; see Fig. 4, bottom). We chose this promoter because previous studies had shown that a potentially novel factor was binding to that site(32) , and we wanted to confirm and extend these original studies. When this probe (kappaPy) covering the pyrimidine-rich site of the Vkappa19 promoter was incubated with B cell nuclear extract, two prominent specific complexes were detected by EMSA, as shown in Fig. 1A. Binding was competed by the addition of increased amounts of the cognate oligonucleotide (lanes 2-4) but not by oligonucleotide containing a mutated pyrimidine-rich motif (kappaPy*, lanes 5-7), indicating that both complexes were binding specifically. The faster migrating complex (C2) was especially prominent in the cell line used in Fig. 1A (BJA-B, a human mature B cell line) and was easily detectable under our standard EMSA conditions, whereas the upper complex (C1) was only easily detectable when spermine was included in the binding buffer. For that reason all subsequent experiments included spermine in the binding reactions. The third weak complex of intermediate mobility could not be competed away by any DNA sequence tested and thus represents nonspecific binding to the probe used. The lowest faint kappaPy-specific band may represent a complex resulting from partially degraded protein.


Figure 4: PU.1 and Oct factors simultaneously bind to the Vkappa19 promoter. A, EMSA was performed with a fragment of the Vkappa19 promoter, comprising both the kappaPy and the octamer site, and 1 µl of RL PU.1 (lane 1), RL Oct-1 (lane 2), or RL Oct-2 (lane 3) alone or 1 µl of RL PU.1 in combination with increasing amounts of RL Oct-1 (lane 4, 1 µl; lane 6, 2 µl), or Oct-2 (lane 5, 1 µl; lane 7, 5 µl). B, EMSA was performed with 4 µg (lane 8) or 8 µg of BJA-B nuclear extract (lane 9), and competition analysis was carried out with 4 µg of BJA-B nuclear extract and a 1000-fold excess of an unlabeled octamer motif (lane 10) or SV40 PU site (lane 11) as competitors. Lane 12, probe alone. The sequence of the Vkappa19 probe used containing the pyrimidine-rich and octamer motif is represented from bp -97 to -39 at the bottom of the figure. The two binding sequences are indicated in white on black.




Figure 1: A, nuclear factors bind to the pyrimidine-rich motif of the Vkappa19 promoter. EMSA was performed with a kappaPy probe covering the pyrimidine-rich site (bp -97 to -74) of the Vkappa19 promoter and 4 µg of nuclear extract prepared from BJA-B cells, a human mature B cell line. Increasing amounts (100, 500, 2500 fmol) of unlabeled wild type kappaPy (lanes 2-4) or mutated kappaPy (indicated with an asterisk (*)) oligonucleotide competitor (lanes 5-7) as indicated above were added. Lane 8, probe alone. B, cell line distribution of the Vkappa19 promoter binding activities. 4 µg of nuclear extract prepared from a number of non-lymphoid cell lines (lane 1, HeLa; lane 2, Cos7; lane 3, 3T3), pre-B and B cells (lane 4, HAFTL; lane 5, BAF3; lane 6, 38B9; lane 7, PD31; lane 8, 70Z/3; lane 9, NFS5.3; lane 10, Nalm 6; lane 11, Wehi 231; lane 12, Namalwa), T cells (lane 13, YAC1; lane 14, CEM; lane 15, Peer; lane 16, BW5147; lane 17, Molt 4; lane 18, Jurkat), and macrophages (lane 19, U937) was added to an EMSA using the kappaPy probe. For a description of the cell lines see ``Materials and Methods.'' The two specific DNA-protein complexes are designated C1 and C2 on the left.



Cell Line Distribution of the Vkappa19 Promoter Binding Activities

The cell line distribution of these Vkappa19 promoter binding activities was investigated by testing nuclear extracts derived from a number of non-lymphoid as well as lymphoid cell lines from mouse or human origin in an EMSA. As shown in Fig. 1B, the slower migrating complex C1 was detected in essentially every extract tested but was found to be enriched in lymphoid cell extracts. In some extracts, this complex was heterogeneous in mobility and comprised two species. The nature of this double band was not further analyzed. The complex C1 may represent the factor originally identified by Atchison et al.(32) , since electrophoretic mobility and cell line distribution appear to be similar. The faster migrating complex C2 had a much more restricted distribution and was clearly detected only in extracts from pre-B cells (BAF3, lane 5; PD31, lane 7, and NFS5.3, lane 9) or B cells (Nalm 6, lane 10, and Namalwa, lane 12), as well as in one monocyte/macrophage cell line tested (U937, lane 19). Moreover, an additional band just above the complex C2 was detected in the NFS5.3 nuclear extract (lane 9) but was not further investigated.

The Proto-oncogene PU.1 Binds to the Pyrimidine-rich Motif of the Vkappa19 Promoter

To characterize the nature of the factors giving rise to complex C1 or C2 we performed competition experiments with a number of oligonucleotides containing binding sites for known factors; some of these results are presented in Fig. 2A, where in particular different purine-rich sequences were tested. As shown, the slowly migrating complex C1 was only competed away by its cognate oligonucleotide (lane 2) and not by oligonucleotides containing a purine-rich (PU) box derived from the simian virus 40 (SV40) enhancer (lane 3), the distal or proximal purine box of the interleukin-2 (IL-2) gene promoter (lanes 4 and 5), a NF-AT site of the IL-4 gene promoter (lane 6), a CREB site (lane 7), or an Ets-1 or Ets-2 binding site (NFalpha4) of the T cell receptor alpha gene enhancer (lane 8)(47, 48, 49, 50) . Other binding sites such as those for NF-kappaB, Oct, or AP-1 were tested as well and did not compete either (data not shown). The fast migrating complex C2, on the other hand, was competed away efficiently by the cognate oligonucleotide and also by the SV40 enhancer-derived purine-rich box (lanes 2 and 3). This oligonucleotide contains a binding site for PU.1(47) , a B cell- and macrophage-specific member of the Ets family (35) , and this raised the possibility that PU.1 or a related factor might be giving rise to complex C2. This hypothesis was further substantiated by the experiment presented in Fig. 2B, where, in addition to the kappaPy probe, the oligonucleotides containing the mutated Vkappa19 pyrimidine-rich site (kappaPy*) or the SV40 PU box were labeled radioactively and used as probes for EMSA reactions performed with different nuclear extracts. As shown, the SV40-derived probe gave rise only to the putative PU.1 complex C2, and this only with BJA-B or U937 extracts (lanes 4 and 8) but not with a HeLa nuclear extract (lane 12), consistent with the fact that PU.1 is expressed in B cells or macrophages but not in HeLa cells (35) . The kappaPy* probe, on the other hand, only gave rise to the previously identified nonspecific complex with every extract tested (lanes 3, 7, and 11). The lowest migrating complex, detected with U937 extract (Fig. 2B, lanes 6 and 8; see also Fig. 1B, lane 19), may represent partially degraded protein. To provide further evidence that the lower complex C2 was indeed caused by PU.1 binding, we compared the electrophoretic mobility of complex C2 with that formed by in vitro-translated PU.1 protein. Fig. 2C demonstrates that in vitro-translated PU.1 protein incubated with the kappaPy or the SV40 PU probe gave a retarded complex (lanes 3 and 6) comigrating exactly with the C2 complex identified with B cell extract (lanes 2 and 5). For final confirmation that PU.1 binds to the pyrimidine-rich motif of the Vkappa19 promoter, we used an antibody that reacts specifically against the carboxyl-terminal domain of PU.1. As shown in Fig. 2D, when added to the EMSA reaction, this antibody produced a supershift (marked with an S) of the in vitro-translated PU.1 protein (lane 6). When BJA-B nuclear extract was used, addition of the antibody also resulted in a supershift (lanes 2 and 4), although with a much weaker intensity; this therefore identifies the complex C2 as caused by PU.1 binding.


Figure 2: A, the C2 binding activity is competed away by the SV40 PU box. Competition experiments were performed with the kappaPy probe and 4 µg of BJA-B nuclear extract using a 1000-fold molar excess of different unlabeled competitor oligonucleotides as indicated above each lane. B, the C2 factor binds to the SV40 PU box. 4 µg of nuclear extracts derived from BJA-B cells (lanes 2-4), U937 macrophages (lanes 6-8), and HeLa cells (lanes 10-12) was tested for binding to the radiolabeled kappaPy (lanes 2, 6, and 10), kappaPy* (lanes 3, 7, and 11), or SV PU probe (lanes 4, 8, and 12) in an EMSA. C, the complex C2 comigrates with in vitro-translated PU.1. For EMSA, the kappaPy or SV40 PU probe was incubated with either 4 µg of nuclear extract from BJA-B cells (lanes 2 and 5) or 1 µl of in vitro-translated PU.1 protein (lanes 3 and 6) prepared from rabbit reticulocyte lysate (RL) as indicated above each lane. Lanes 1 and 4, unprogrammed reticulocyte lysate. D, identification of the C2 binding activity as PU.1. 4 µg of nuclear extract from BJA-B cells (lanes 1-4) or 1 µl of in vitro-translated PU.1 (lanes 5 and 6) was used in an EMSA. Lanes 1 and 2 contain the kappaPy probe, and lanes 3-6 contain the SV40 PU box. Rabbit polyclonal antibody against a peptide consisting of amino acids 251-271 of PU.1 (lanes 2, 4, and 6) was added to the EMSA reaction as indicated above each lane. S refers to the supershifted bands. The positions of the PU.1/C2 complex and its supershift are indicated with an arrow.



Identification of the Contact Sites for C1 and PU.1 by Methylation Interference and Copper-Phenanthroline Footprint

To further define the way in which the C1 factor and PU.1 bind to the Vkappa19 pyrimidine-rich sequence, we performed methylation interference (Fig. 3, A and B) and copper-phenanthroline footprinting experiments (Fig. 3C). The Vkappa19 sequence was cloned into the polylinker of Bluescript and reclaimed by cleavage with SalI or EcoRI after either the bottom strand at the EcoRI or the top strand at the SalI site had been radioactively labeled with [-P]ATP. The probe was treated with dimethyl sulfate and then used in a preparative mobility shift assay. DNA bound in complexes as well as unbound DNA was subjected to cleavage with sodium hydroxide and piperidine, respectively. On the bottom (purine-rich) strand the interference pattern observed was virtually identical for all of the complexes analyzed: C1, C2 (PU.1), and recombinant PU.1 protein. The 2 central G residues interfered strongly, and the 2 A residues of the core GGAA sequence interfered weakly. In addition, a very weak interference of an A residue downstream of this motif can also be observed (Fig. 3B). On the top (pyrimidine-rich) strand 2 A residues interfered very weakly, but apparently only with the PU.1 factor, either from the B cell extract or as recombinant protein (Fig. 3A). Moreover, the copper-phenanthroline footprint pattern (Fig. 3C) revealed that B cell extract-derived PU.1 completely protected a 13-15-bp region centered over the kappaPy motif (top strand, lane 2) or the purine-rich sequence (bottom strand, lane 5). By contrast, the C1 factor only partially protected these regions, and hypersensitive sites were easily apparent (lanes 1 and 4). These results show that PU.1 and the C1 factor recognize the pyrimidine-rich motif in a highly similar if not identical manner.


Figure 3: Identification of the contact sites for PU.1 and C1 by methylation interference and copper-phenanthroline footprinting analysis. A and B, the partially methylated, radiolabeled kappaPy probe was incubated with nuclear extract (BJA-B, lanes 2-5) or in vitro-translated PU.1 protein (RL PU.1; lanes 6 and 7). Free and bound probes were separated on a 4% nondenaturating polyacrylamide gel, isolated, and cleaved with sodium hydroxide, as described under ``Materials and Methods.'' Cleavage products of both free (lanes 2 and 6) and bound probe (lanes 3-5 and 7) were analyzed on a 12% polyacrylamide, 8 M urea gel along with a G + A piperidine cleavage reaction of the probe (lane 1). The sequences of the top and bottom strands are aligned with the gels. The pyrimidine-rich motif (top strand) and the corresponding purine-rich sequence (bottom strand) are indicated in white on black. The nucleotides whose methylation strongly or partially interfered with protein binding are indicated by black or open triangles, respectively. C, for copper-phenanthroline footprinting, the kappaPy probe used for methylation interference was incubated with BJA-B nuclear extract. Free and bound probes were separated by electrophoresis and digested with copper-phenanthroline while they were still embedded in the gel matrix. Digested products of both free (top strand, lane 3; bottom strand, lane 6) and bound probes (top strand, lanes 1 and 2; bottom strand, lanes 4 and 5) were analyzed as described in A and B.



PU.1 and Oct Factors Simultaneously Bind to the Vkappa19 Promoter

As mentioned previously the Vkappa19 promoter contains a variant octamer site having only seven out of eight nucleotides matching the consensus. Previous studies (32, 51) have shown that, depending on the flanking sequences, such imperfect sites can or cannot be efficiently bound by their cognate factors, the Oct factors. Furthermore, it has been shown that Oct factors can exhibit cooperative binding when two binding sites are juxtaposed, such as in the case of many heavy chain promoters containing a heptamer motif upstream of the octamer site(21, 52, 53) . We therefore wondered whether Oct factors would bind efficiently to the Vkappa19 octamer site and, possibly, be helped by the nearby binding of PU.1 (or of the C1 factor). For that reason, we prepared a radiolabeled probe, kappaPy/octa, covering nucleotides -97 to -59 of the Vkappa19 promoter and containing both the kappaPy site and the octamer site. This probe was used for EMSA experiments performed with recombinant proteins prepared from reticulocyte lysate (Fig. 4A) or with B cell extract (Fig. 4B). When the kappaPy/octa probe was incubated with PU.1, Oct-1, or Oct-2, in each case a complex of the expected mobility was observed (lanes 1-3). Although this octamer site has a lower affinity than a consensus site, specific Oct complexes were easily detected under our conditions. When PU.1 was mixed with either Oct-1 or Oct-2 the same complexes were observed, and, in addition, complexes corresponding to the simultaneous binding of two factors (Oct-1 + PU.1, lanes 4 and 6; Oct-2 + PU.1, lanes 5 and 7) on the DNA probe were also visible. The identity of these complexes has been further confirmed by competition and antibody supershift experiments (data not shown). Under the various conditions tested, no cooperativity of binding between PU.1 and Oct factors at steady state was observed (Fig. 4A, lanes 4-7, and data not shown). When the same DNA probe was incubated with a B cell nuclear extract a complex pattern of retarded species was observed (Fig. 4B). Careful examination of the autoradiogram indicated that the observed pattern essentially represented the combination of the complexes obtained with the reticulocyte lysate proteins (Oct-1, Oct-2, and PU.1) plus the C1 factor (lanes 8 and 9; compare with lanes 4-7), whereby the Oct-1 + PU.1 complex could not be easily detected with the B cell nuclear extract. This might reflect the relatively low abundance of Oct-1 protein (relative to Oct-2 and PU.1) in these extracts. When EMSA reactions were set up with B cell nuclear extract in the presence of a competitor oligonucleotide containing either an octamer site or an SV40 PU box, the residual pattern of complexes corresponded to the binding of the C1 and C2 factors (lane 10) or of the Oct-1, C1, and Oct-2 factors (lane 11). Thus the data presented show that the various factors that were identified can indeed bind simultaneously to this Vkappa19 promoter fragment but provide no evidence of synergistic binding.

The Pyrimidine-rich Motif and the Divergent Octamer Site Are Both Required for Optimal Vkappa19 Promoter Activity

To functionally test the role of the pyrimidine-rich site we constructed a series of reporter plasmids in which we inserted sequences derived from the Vkappa19 promoter immediately upstream of the rabbit beta-globin TATA box (Fig. 5A). These plasmids were transfected transiently together with a reference reporter plasmid into various B cell lines, and the resulting transcription was analyzed by an RNase protection assay(12, 43) . In Fig. 5B, the results of such an experiment in S194 plasmacytoma cells are presented, and Fig. 5C shows the corresponding quantification by PhosphorImaging as well as the quantification of the results of similar experiments done in Namalwa lymphoma cells. For quantification, the level of transcription from the reference gene was used to normalize the variability in transfection efficiency. The presence of the kappaPy/octa sequence efficiently activated transcription (lane 3) as compared with the parental plasmid containing only a TATA box as promoter element (lane 1) or with the plasmid containing both sites mutated (kappaPy*/octa*, lane 6). Mutation of either the kappaPy sequence (kappaPy*/octa, lane 4) or of the octamer site (kappaPy/octa*, lane 5) had a strong deleterious effect and resulted in a promoter with less than 30% activity in S194 B cells and less than 60% in Namalwa B cells. Mutation of both sites (kappaPy*/octa*, lane 6) led to a promoter with essentially basal activity. Thus, our results agree well with those of Atchison et al.(32) , who carried out similar analysis of the Vkappa19 promoter in S194 B cells and showed that the kappaPy element and the divergent octamer site were both required for optimal Vkappa19 promoter activity. Furthermore, when the kappaPy site was removed from its sequence context and tested by itself, juxtaposed to the beta-globin TATA box in its natural orientation, it was also able to activate transcription, albeit only weakly (lane 9). As a control, the effect of an isolated SV40 PU box, which contains a strong PU.1 binding site, was also analyzed in either orientation. Transcriptional activation was observed only when the SV40 PU box was in the sense orientation (lane 8), whereas the inverse orientation of this motif (corresponding to the pyrimidine-rich sequence on the top) surprisingly abolished promoter activity and resulted in a basal level of transcription (lane 7).


Figure 5: The pyrimidine-rich motif and the divergent octamer site are both required for optimal Vkappa19 promoter activity. A, schematic representation of the reporter plasmids used. All constructs are based on the OVEC reporter plasmid and contain various factor binding sites in front of the beta-globin TATA box; in addition, these reporters contain an SV40 enhancer 3` of the globin gene (black box). The Sp1 construct containing the binding site for the ubiquitous transcription factor Sp1 derived from the metallothionein gene promoter was used as a positive control. The kappaPy/octa construct containing the pyrimidine-rich and octamer motif (bp -101 to -41) was derived from the Vkappa19 promoter, and the mutated motifs are indicated with an asterisk (*). The SV40 PU inv construct contains the SV40 purine sequence in inverse orientation (with the corresponding pyrimidine-rich sequence on the upper strand). B, RNase protection analysis was performed with RNA from S194 B cells transiently transfected with the plasmid OVEC-Ref alone in the absence of a reporter plasmid (lane 1) or with the plasmid OVEC-Ref together with the Sp1 (lane 2), kappaPy/octa (lane 3), kappaPy*/octa (lane 4), kappaPy/octa* (lane 5), kappaPy*/octa* (lane 6), SV40 PU inv (lane 7), SV40 PU (lane 8), or kappaPy reporter plasmid (lane 9). Lanes M and Y, marker and control hybridization with yeast RNA, respectively. Ref indicates the position of the reference signal produced by the plasmid OVEC-Ref, and Test indicates the position of the correctly initiated RNA derived from the reporter plasmids. rt denotes the position of ``readthrough'' transcripts. C, relative activities of the various reporter constructs in S194 and Namalwa B cells were determined by PhosphorImager quantification of representative experiments. The signals derived from the reference transcripts were used to normalize the variability in transfection effficiency. Transfection with the plasmid OVEC-Ref alone in the absence of a reporter plasmid (S194, lane 1) or with the plasmid OVEC-Ref together with the promoterless OVEC parental plasmid (Namalwa, lane 1), Sp1 (lane 2), kappaPy/octa (lane 3), kappaPy*/octa (lane 4), kappaPy/octa* (lane 5), kappaPy*/octa* (lane 6), SV40 PU inv (lane 7), SV40 PU (lane 8), or kappaPy reporter plasmid (lane 9). The quantified data correspond to the gel represented in B for S194 B cells and the average of three independent experiments for Namalwa B cells. The activities are shown relative to the activity of kappaPy*/octa* reporter plasmid, which was arbitrarily set to 1.0.



On the Vkappa19 Promoter PU.1 Can Activate Transcription in Concert with Oct-2

To directly test whether PU.1 was indeed able to activate transcription from the pyrimidine-rich site we transfected the same reporter plasmids into HeLa cells, which lack both PU.1 and Oct-2 but contain Oct-1 and low levels of the C1 factor. In these transfections we also included, in various combinations, expression vectors for PU.1 and/or Oct-2 (Fig. 6, A and B). The kappaPy/octa reporter plasmid had only a low basal level in HeLa cells, suggesting that endogenous Oct-1 and the C1 factor are not sufficient to activate transcription efficiently (lane 3). When PU.1 or Oct-2 were cotransfected a strong transactivation was obtained (lanes 4 and 5). Moreover, transactivation by PU.1 was two times higher than that obtained by Oct-2. This probably reflects, at least in part, the relatively weak binding of Oct-2 to the imperfect octamer site and not necessarily a stronger intrinsic transcription activation capacity of PU.1 than of Oct-2. Maximal transactivation of the reporter plasmid was observed when both expression vectors were cotransfected together (lane 6). As expected, only a partial transactivation was obtained when the kappaPy site (kappaPy*/octa, lanes 7 and 8) or the octamer site was mutated (kappaPy/octa*, lanes 9 and 10), whereas no transactivation was observed when both sites were mutated (kappaPy*/octa*, lanes 11 and 12). The absolute level of transactivation of the kappaPy/octa motif by both factors (100%) is higher than the sum of the levels obtained following transactivation by PU.1 (60%) and Oct-2 (28%) independently and higher than the sum of the levels of transactivation of the kappaPy*/octa motif (20%) and the kappaPy/octa* motif (45%). These results suggest a slight synergism between PU.1 and Oct-2 for transcription activation, even though no cooperativity was detected in DNA binding. Furthermore, cotransfected PU.1 could efficiently transactivate (more than 5-fold) constructs containing the kappaPy site alone (lanes 17 and 18). Consistent with the data obtained from B cells, a strong transactivation by PU.1 was obtained when the SV40 PU box was in the sense orientation (lanes 15 and 16), but only a weak transactivation by PU.1 was observed when this motif was in the inverse orientation (lanes 13 and 14). These data demonstrate that the pyrimidine-rich motif is a target for transcriptional activation by PU.1 and that PU.1 together with Oct-2 are required for full Vkappa19 promoter activity.


Figure 6: PU.1 can activate transcription in concert with Oct-2. A, RNase protection analysis was performed with RNA from HeLa cells transiently transfected with the plasmid OVEC-Ref together with the promoterless OVEC parental plasmid (lanes 1 and 2), kappaPy/octa (lanes 3-6), kappaPy*/octa (lanes 7 and 8), kappaPy/octa* (lanes 9 and 10), kappaPy*/octa* (lanes 11 and 12), SV40 PU inv (lanes 13 and 14), SV40 PU (lanes 15 and 16), or kappaPy reporter plasmid (lanes 17 and 18).The OVEC constructs (as described in Fig. 5) were cotransfected with or without PU.1 and/or Oct-2 expression plasmids as indicated above each lane. B, relative transactivations of the various reporter constructs by PU.1 and/or Oct-2 in HeLa cells were determined by PhosphorImager quantification of representative experiments. The signals derived from the reference transcripts were used to normalize the variability in transfection efficiency. Lanes 1-18, as described in A. The quantified data correspond to the gel represented in A and were verified in several independent experiments. The activities are shown relative to the activity of the kappaPy*/octa* reporter plasmid, which was arbitrarily set to 1.0.



PU.1 Binds to the Pyrimidine-rich Motifs of Several Other Ig Promoters

To determine the generality of PU.1 binding to pyrimidine-rich motifs, we tested by EMSA the ability of PU.1 to bind to other pyrimidine-rich sequences found in heavy or light chain promoters(34, 54, 55, 56, 57) . For this a number of radiolabeled oligonucleotides containing different pyrimidine-rich motifs were incubated with BJA-B nuclear extract or in vitro-translated PU.1 protein. As shown in Fig. 7, recombinant PU.1 did bind to several additional Ig promoters, such as V101 (lane 6), V37A4 (lane 8), or V37A11 (lane 10). In some cases a complex of similar mobility was also observed in the reactions set up with B cell extract (lanes 5 and 7) in addition to other noncharacterized complexes. Interestingly, the pyrimidine-rich elements of the Vkappa105 and VkappaA19 promoter, which also contain the conserved GGAA motif on the opposite strand, did not bind or only very weakly bound PU.1 (lanes 12 and 16). The presence of this motif is therefore not sufficient for PU.1 binding, and the sequences flanking this core region have a critical effect on binding(58) . Finally, of the sequences tested, the V101 sequence was the only one that also gave rise to a complex with a mobility similar to that of the Vkappa19 C1 complex (compare lane 5 with lane 1). Table 1shows a summary of the different binding activities of PU.1 and C1 to the various pyrimidine-rich motifs as derived from the EMSA in Fig. 7. To verify these data, the relative PU.1 binding activity to the SV40 PU, Vkappa19, V1, or V101 sequence was determined in another experiment using a PhosphorImager to quantify the radioactivity present in the bands containing PU.1 bound or in the free probe. A comparison of the percentage of each oligonucleotide bound to PU.1 indicated that PU.1 bound to the Vkappa19 pyrimidine-rich motif with the same affinity as to the SV40 PU box, which contains a strong binding site for PU.1, and that it had a 4 times weaker affinity to the pyrimidine-rich motif of the V101 promoter. These results demonstrate that the pyrimidine-rich motif of the Vkappa19 promoter is a strong binding site for PU.1 and that there are several additional Ig promoters to which PU.1 shows significant binding affinity.


Figure 7: PU.1 binds to the pyrimidine-rich motifs of several other Ig promoters. Pyrimidine-rich motifs derived from various Ig promoters were tested for binding to 4 µg of BJA-B nuclear extract (odd numbered lanes) or RL PU.1 protein (lane 2, 1 µl; even numbered lanes 4-16, 2 µl), as indicated above each lane in an EMSA.






DISCUSSION

The most conserved element of Ig promoters is the octamer site(1, 5) , and numerous studies have shown its importance for Ig expression (6, 7, 8, 9) . The nuclear factors recognizing this motif, the ubiquitous Oct-1 and the lymphoid-specific Oct-2, have been cloned and extensively studied(12, 20) .

In addition, other, less conserved elements also contribute to the B cell-specific activity of Ig promoters. One such element is the pyrimidine-rich motif(33, 34) , a relatively loosely conserved element found in many Ig promoters. In this case, very little is known about the factors that mediate its activity. We have begun our studies by looking at the factors interacting specifically with the pyrimidine-rich motif of the Vkappa19 promoter, a light chain gene having a promoter with an imperfect octamer site. Our results show that two nuclear factors are able to bind to the pyrimidine-rich site (the kappaPy site); one of these factors is a lymphoid-enriched but ubiquitous protein with an apparent molecular mass of 50 kDa. This protein appears to be a novel factor and might correspond to the protein kappaY, described by Atchison et al.(32) . Multiple evidences support the conclusion that the second factor is PU.1, a B cell- and macrophage-specific member of the Ets family(35) . First, the complex C2 was competed away efficiently by the SV40 PU box, which contains a strong PU.1 binding site. Second, in vitro-translated PU.1 formed a complex indistinguishable from complex C2 in electrophoretic mobility shift assays. Finally, PU.1-specific antibodies recognized the complex C2 in the same manner as in vitro-translated PU.1 protein (Fig. 2). Like other members of the Ets oncoprotein family, PU.1 is a transcription factor and binds to a purine-rich sequence that contains a central core with the sequence 5`-GGAA-3`. However, only little is known about which cellular genes are regulated by PU.1. Here, we show that one of its roles is to regulate, probably in concert with Oct-2 (or Oct-1), a critical event in B cell immune response, the expression of the Vkappa19 light chain gene. The evidence is based on the following observations. First, PU.1 recognizes the pyrimidine-rich motif in the Vkappa19 light chain promoter and binds to this element with high affinity (Fig. 2C). Second, a mutation of the kappaPy motif, which abolishes in vitro PU.1 binding, reduces severalfold the activity of a reporter construct in transfected B cells (Fig. 5, A and B). Third, coexpression of PU.1 in HeLa cells, which lack PU.1, transactivates efficiently reporter constructs containing the kappaPy motif (Fig. 6, A and B).

By performing binding studies with related pyrimidine-rich sequences derived from other light or heavy chain Ig promoters, we found that PU.1 not only shows binding affinity to the Vkappa19 site but also to several such motifs present in other Ig promoters (Fig. 7, Table 1). PU.1 expression is limited to B cells and macrophages, and several other Ets family members, like Ets-1, Elf-1, Elk-1, Fli-1, and Erg, are also predominantly expressed in lymphoid cells(48, 59, 60, 61, 62) . It is interesting to note that two other mouse Vkappa genes, VkappaSer and VkappaTNP, contain the same divergent octamer and pyrimidine-rich elements, which are identically located as in the Vkappa19 promoter(32) . Thus, these observations suggest that PU.1 and other Ets-related factors might indeed play a critical role in tissue- and development-specific regulation of a number of Ig genes and provide new insights into the function of these factors in lymphoid cells. In support of this, a number of groups have recently shown that Ets-related factors contribute to Ig expression. Evidence was provided that the expression of PU.1 and Ets-1 together is sufficient to activate the µA and µB elements of the Ig µ enhancer core in nonlymphoid cells(63) . Similar results were reported by Rivera et al.(64) , who have shown that Erg-3 and Fli-1 can activate a reporter construct containing a multimer of µE2- binding sites of the Ig µ enhancer, synergistically with the helix-loop-helix protein E12. Furthermore, it has been shown that PU.1 recruits the binding of a second B cell-restricted nuclear factor to an adjacent DNA site in the Ig kappa3` enhancer (65, 66) and in the Ig 2-4 enhancer (67) and that this interaction is required for efficient activity of these two enhancers. However, unlike in the Ig kappa3` and the Ig 2-4 enhancer system, PU.1 binding does not appear to assist the binding of Oct factors to the nearby octamer site in the Vkappa19 promoter since we were not able to detect a synergistic binding between these factors in our assay (Fig. 4A and data not shown). Thus, our data demonstrate that PU.1 not only has a function in the activation of several Ig enhancers but is also likely to be involved in the regulation of some Ig promoters. In addition, a further important role for PU.1 in B cells was recently established in the regulation of another B cell-specific gene, the Ig J-chain gene. In this case, the element recognized by PU.1 is somewhat divergent from the GGAA consensus that has generally been regarded to be the core of the PU.1 recognition motif(68) . Finally, PU.1 has not only been shown to be an important regulator of B cell target genes; it also has a role in the regulation of macrophage gene expression including the myeloid-specific CD11b and scavenger receptor genes(69, 70) .

The other factor recognizing the Vkappa19 pyrimidine-rich motif is ubiquitous but enriched in lymphoid extracts (Fig. 1B). The identity of this factor is still unclear. Southwestern experiments and UV cross-linking to a BrdU-substituted kappaPy probe (data not shown) have indicated that this factor has an apparent molecular mass of 50 kDa. In addition, competition experiments with known binding sites for Ets-1, Ets-2, or Elf-1 (Fig. 2A) and lack of reaction of a broad specificity anti-Ets antibody (data not shown) have shown that this 50 kDa protein appears not to be Ets-1, Ets-2, or Elf-1 but rather to be a novel factor. However, comparison of the methylation interference and copper-phenanthroline footprint pattern of the C1 factor with that of PU.1 revealed that both proteins were able to bind the kappaPy motif in a highly similar if not identical way and that the protein binding contacts were limited to the kappaPy site (Fig. 3). Essential for the kappaPy site is the GGAA motif, which is the characteristic recognition sequence for the Ets family members (38, 71, 72) on the opposite strand. It has been shown that the lymphoid-specific Ets-1 factor also binds purine-rich sequences in their inverse orientation in the stromelysin promoter(73) , the T cell receptor alpha enhancer(50) , and the GATA-1 promoter(74) . These observations suggest that another factor of the large Ets family might correspond to the C1 complex. Potential candidates for this 50-kDa protein might be Elk-1 (60 kDa), Fli-1 (51 kDa), and Erg (52 kDa), which correspond roughly to the predicted size of the C1 factor and also display a more or less lymphoid-specific expression pattern(38) .

Previously, Atchison et al.(32) demonstrated that the kappaPy motif of the Vkappa19 promoter serves as a strong binding site for a novel lymphoid-specific nuclear factor, which they called kappaY. This kappaPy binding activity might be identical to our C1 factor, since electrophoretic mobility and cell line distribution appear to be similar. Surprisingly, these authors did not observe PU.1 binding to the kappaPy motif in their assay, and they also had considerable difficulty detecting Oct-2 complexes. It is possible that the minor Vkappa19-specific band, which they speculated to be a complex with partially degraded kappaY factor, was in fact the PU.1-specific complex. A possible reason for the difference in results might be the different preparation of nuclear extracts.

In the case of the Vkappa19 promoter, both sites, the divergent octamer motif, 5`-CTTTGCAT-3`, and the kappaPy motif have a strong effect on promoter activity. A mutation of the octamer motif that no longer binds the Oct factors reduced the promoter activity to 20% in S194 B cells and to 45% in HeLa cells cotransfected with PU.1 and Oct-2. A mutation of the kappaPy motif that abolishes its factor-binding capability reduced the promoter activity to 27% in S194 B cells (Fig. 5, B and C) and to 20% in HeLa cells cotransfected with PU.1 and Oct-2 (Fig. 6, A and B). The mutation of the kappaPy motif has a more severe effect on promoter activity in HeLa cells than the mutation of the octamer motif. Apparently, cotransfected Oct-2 and endogenous Oct-1 do not suffice to efficiently activate transcription from the octamer motif of the kappaPy*/octa reporter construct in HeLa cells, and this could reflect the absence in the transfected cells of an additional B cell-specific factor that can interact with Oct-1 or Oct-2 and is required for maximal octamer-dependent promoter activity. Evidence for such a factor has been provided by previous studies(30, 31) , which have shown that a B cell-restricted coactivator, OCA-B, stimulates transcription from an IgH promoter in conjunction with either Oct-1 or Oct-2. Moreover, Atchison et al.(32) have shown that the divergent octamer motif of the Vkappa19 promoter binds Oct factors only poorly and that the flanking DNA sequences do not supply the additional contacts required to produce a strong Oct factor binding. Thus, these data demonstrate that the pyrimidine-rich element and the divergent octamer motif are both required for optimal Vkappa19 promoter activity and that interaction of these motifs with their cognate factors is essential for tissue-specific expression of this gene. Moreover, no synergism between PU.1 and Oct factors could be observed in binding activity (Fig. 4A and data not shown), and only a weak synergism could be detected in transactivation (Fig. 6). This type of interaction contrasts with the proposed interplay between the heptamer and octamer motifs in V heavy chain promoters, which appears to involve cooperative binding of the Oct factors(21, 52, 53) .

In conclusion, we have demonstrated that the Ets-related protein PU.1 binds to the pyrimidine-rich motif of Vkappa19 promoter and is able to activate, probably in concert with Oct-2 (or Oct-1) this promoter. Since PU.1 is expressed in B lymphocytes, it is likely that it is at least in part responsible for the maintenance of the cell type-specific function of this Ig promoter. How PU.1 contributes to the stage-specific activation of this Ig light chain gene is not clear. Northern analysis revealed that the level of PU.1 mRNA remains constant during B cell development, and analyses of nuclear levels of PU.1 protein showed similar results(63, 68, 75) . The concerted action of PU.1 and Oct-2 or Oct-1 as well as other factors acting through the promoter and enhancer elements will be required to account for developmental stage-specific regulation of Ig expression. In the future, it will be interesting to determine whether PU.1 is also involved in the regulation of other Ig promoters. Moreover, further characterization and study of the C1 factor will be required to determine its identity and its role in transcription of the Vkappa19 gene. Finally, it will be interesting to determine the influence of other Ets family members on transcription of this gene.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 41-61-6976661-5046; Fax: 41-61-6973976-9386.

(^1)
The abbreviations used are: Ig, immunoglobulin; V, variable; EMSA, electrophoretic mobility shift assay; kappaPy, the pyrimidine-rich motif of the Vkappa19 promoter; kappaPy/octa, the pyrimidine-rich and octamer motif of the Vkappa19 promoter; SV40 PU box, simian virus 40 purine-rich box; RL, reticulocyte lysate.


ACKNOWLEDGEMENTS

We thank E. Friedl, D. Schubart, and Dr. E. Serfling for discussions and Drs. P. Caroni, J.-P. Jost, and Y. Nagamine for critical reading of the manuscript.


REFERENCES

  1. Falkner, F. G., and Zachau, H. G. (1984) Nature 310, 71-74 [CrossRef][Medline] [Order article via Infotrieve]
  2. Grosschedl, R., and Baltimore, D. (1985) Cell 41, 885-897 [CrossRef][Medline] [Order article via Infotrieve]
  3. Mason, J. O., Williams, G. T., and Neuberger, M. S. (1985) Cell 41, 479-487 [CrossRef][Medline] [Order article via Infotrieve]
  4. Picard, D., and Schaffner, W. (1985) EMBO J. 4, 2831-2838 [Medline] [Order article via Infotrieve]
  5. Parslow, T. G., Blair, D. L., Murphy, W. J., and Granner, D. K. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 2650-2654 [Abstract/Free Full Text]
  6. Bergmann, Y., Rice, D., Grosschedl, R., and Baltimore, D. (1984) ProcNatl. Acad. Sci. U. S. A. 81, 7041-7045 [Abstract/Free Full Text]
  7. Dreyfus, M., Doyen, N., and Rougeon, F. (1987) EMBO J. 6, 1685-1690 [Medline] [Order article via Infotrieve]
  8. Jenuwein, T., and Grosschedl, R. (1991) Genes & Dev. 5, 932-943
  9. Wirth, T., Staudt, L., and Baltimore, D. (1987) Nature 329, 174-177 [CrossRef][Medline] [Order article via Infotrieve]
  10. Gerster, T., Matthias, P., Thali, M., Jiricny, J., and Schaffner, W. (1987) EMBO J. 6, 1323-1330 [Medline] [Order article via Infotrieve]
  11. Landolfi, N. F., Capra, D. J., and Tucker, P. W. (1986) Nature 323, 548-551 [CrossRef][Medline] [Order article via Infotrieve]
  12. Müller, M. M., Ruppert, S., Schaffner, W., and Matthias, P. (1988) Nature 336, 544-551 [CrossRef][Medline] [Order article via Infotrieve]
  13. Scheidereit, C., Heguy, A., and Roeder, R. G. (1987) Cell 51, 783-793 [CrossRef][Medline] [Order article via Infotrieve]
  14. Staudt, L. M., Singh, H., Sen, R., Sharp, P. A., and Baltimore, D. (1986) Nature 323, 640-643 [CrossRef][Medline] [Order article via Infotrieve]
  15. Bohmann, D., Keller, W., Dale, T., Schöler, H. R., Tebb, G., and Mattaj, I. W. (1987) Nature 325, 268-272 [CrossRef][Medline] [Order article via Infotrieve]
  16. Davidson, I., Fromental, C., Augereau, P., Wildeman, A., Zenke, M., and Chambon, P. (1986) Nature 323, 544-548 [CrossRef][Medline] [Order article via Infotrieve]
  17. Fletcher, C., Heintz, N., and Roeder, R. G. (1987) Cell 51, 773-781 [CrossRef][Medline] [Order article via Infotrieve]
  18. Singh, H., Sen, R., Baltimore, D., and Sharp, P. A. (1986) Nature 319, 154-158 [CrossRef][Medline] [Order article via Infotrieve]
  19. Sive, H. L., and Roeder, R. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6382-6386 [Abstract/Free Full Text]
  20. Sturm, R., Baumruker, T., Franza, B. R., Jr., and Herr, W. (1987) Genes& Dev. 1, 1147-1160
  21. Kemler, I., Schreiber, E., Müller, M. M., Matthias, P., and Schaffner, W. (1989) EMBO J. 8, 2001-2008 [Medline] [Order article via Infotrieve]
  22. Poellinger, L., and Roeder, R. G. (1989) Mol. Cell. Biol. 9, 747-756 [Abstract/Free Full Text]
  23. Parry, H. D., Scherly, D., and Mattaj, I. W. (1989) Trends BiochemSci. 14, 15-19
  24. LaBella, F., Sive, H. L., Roeder, R. G., and Heintz, N. (1988) Genes & Dev. 2, 32-39
  25. Gerster, T., and Roeder, R. G. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 6347-6351 [Abstract/Free Full Text]
  26. O'Hare, P., Goding, C. R., and Haigh, A. (1988) EMBO J. 7, 4231-4238 [Medline] [Order article via Infotrieve]
  27. Stern, S., Tanaka, M., and Herr, W. (1989) Nature 341, 624-630 [CrossRef][Medline] [Order article via Infotrieve]
  28. Kemler, I., Bucher, E., Seipel, K., Müller-Immerglück, M. M., and Schaffner, W. (1991) Nucleic Acids Res. 19, 237-242 [Abstract/Free Full Text]
  29. Corcoran, L., Karvelas, M. M., Nossal, G. J., Ve, Z. S., Jacks, T., and Baltimore, D. (1993) Genes & Dev. 7, 570-582
  30. Luo, Y., Fujii, H., Gerster, T., and Roeder, R. G., (1992) Cell 71, 231-241 [CrossRef][Medline] [Order article via Infotrieve]
  31. Pierani, A., Heguy, A., Fujii, H., and Roeder, R. G. (1990) Mol. Cell. Biol. 10, 6204-6215 [Abstract/Free Full Text]
  32. Atchison, M. L., Delmas, V., and Perry, R. P. (1990) EMBO J. 9, 3109-3117 [Medline] [Order article via Infotrieve]
  33. Ballard, D. W., and Bothwell, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 9626-9630 [Abstract/Free Full Text]
  34. Eaton, S., and Calame, K. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7634-7638 [Abstract/Free Full Text]
  35. Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., and Maki, R. A. (1990) Cell 61, 113-124 [CrossRef][Medline] [Order article via Infotrieve]
  36. Moreau-Gachelin, F., Ray, D., Mattei, M.-G., Tambourin, P., and Tavitian, A. (1989) Oncogene 4, 1449-1456 [Medline] [Order article via Infotrieve]
  37. Paul, R., Schuetze, S., Kozak, S. L., Kozak, C. A., and Kabat, D. (1991) J. Virol. 65, 464-467 [Abstract/Free Full Text]
  38. Macleod, K., Leprince, D., and Stehelin, D. (1992) Trends Biochem. Sci. 17, 251-256 [CrossRef][Medline] [Order article via Infotrieve]
  39. Bosselut, R., Levin, J., Adjadj, E., and Ghysdael, J. (1993) Nucleic AcidsRes. 21, 5184-5191
  40. Wasylyk, B., Wasylyk, C., Flores, P., Begue, A., Leprince, D., and Stehelin, D. (1990) Nature 346, 191-193 [CrossRef][Medline] [Order article via Infotrieve]
  41. Schreiber, E., M ü ller, M. M., Schaffner, W., and Matthias, P. (1989) in Tissue-specific Gene Expression (Renkawitz, R., ed) pp. 33-54, VCH Verlagsgesellschaft, Weinheim, Germany
  42. Kuwabara, M. D., and Sigman, D. S. (1987) Biochemistry 26, 7234-7238 [CrossRef][Medline] [Order article via Infotrieve]
  43. Westin, G., Gerster, T., Müller, M. M., Schaffner, G., and Schaffner, W. (1987) Nucleic Acids Res. 15, 6787-6798 [Abstract/Free Full Text]
  44. Matthias, P., Müller, M. M., Schreiber, E., Rusconi, S., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6418 [Free Full Text]
  45. Mather, E. L., and Perry, R. P. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 4689-4693 [Abstract/Free Full Text]
  46. Schibler, U., Marcu, K. B., and Perry, R. P. (1978) Cell 15, 1495-1509 [CrossRef][Medline] [Order article via Infotrieve]
  47. Pettersson, M., and Schaffner, W. (1987) Genes & Dev. 1, 962-972
  48. Thompson, C. B., Wang, C. Y., Ho, I. C., Bohjanen, P. R., Petryniak, B., June, C. H., Miesfeldt, S., Zhang, L., Nabel, G. J., Karpinski, B., and Leiden, J. M. (1992) Mol. Cell. Biol. 12, 1043-1053 [Abstract/Free Full Text]
  49. Chuvpilo, S., Schomberg, C., Gerwig, R., Heinfling, A., Reeves, R., Grummt, F., and Serfling, E. (1993) Nucleic Acids Res. 21, 5694-5704 [Abstract/Free Full Text]
  50. Ho, I.-C., Bhat, N. K., Gottschalk, L. R., Lindsten, T., Thompson, C. B., Papas, T. S., and Leiden, J. M. (1990) Science 250, 814-818 [Abstract/Free Full Text]
  51. Baumruker, T., Sturm, R., and Herr, W. (1988) Genes & Dev. 2, 1400-1413
  52. LeBowitz, J. H., Clerc, R. G., Brenowitz, M., and Sharp, P. A. (1989) Genes & Dev. 3, 1625-1638
  53. Poellinger, L., Yoza, B. K., and Roeder, R. G. (1989) Nature 337, 573-576 [CrossRef][Medline] [Order article via Infotrieve]
  54. Moynet, D., MacLean, S. J., Ng, K. H., Anctil, D., and Gibson, D. M. (1985) J. Immunol. 135, 727-732
  55. Kataoka, T., Nikaido, T., Miyata, T., Moriwaki, K., and Honjo, T. (1982) J. Biol. Chem. 257, 277-285 [Free Full Text]
  56. Nahmias, C., Strosberg, A. D., and Emorine, L. J. (1988) J. Immunol. 140, 1304-1311 [Abstract]
  57. Lee, K. H., Matsuda, F., Kinashi, T., Kodaira, M., and Honjo, T. (1987) J. Mol. Biol. 195, 761-768 [CrossRef][Medline] [Order article via Infotrieve]
  58. Wasylyk, C., Kerckaert, J.-P., and Wasylyk, B. (1992) Genes & Dev. 6, 965-974
  59. Bhat, N. K., Fischer, R. J., Fujiwara, S., Ascione, R., and Papas, T. S. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 3161-3165 [Abstract/Free Full Text]
  60. Klemsz, M. J., Maki, R. A., Papayannopoulou, T., Moore, J., and Hromas, R. (1993) J. Biol. Chem. 268, 5769-5773 [Abstract/Free Full Text]
  61. Pognonec, P., Boulukos, K. E., and Ghysdael, J. (1989) Oncogene 4, 691-697 [Medline] [Order article via Infotrieve]
  62. Rao, V. N., Huebner, K., Isobe, M., Ar-Rushdi, A., Croce, C. M., and Reddy, E. S. P. (1989) Science 244, 66-70 [Abstract/Free Full Text]
  63. Nelsen, B., Tian, G., Erman, B., Gregoire, J., Maki, R., Graves, B., and Sen, R. (1993) Science 261, 82-86 [Abstract/Free Full Text]
  64. Rivera, R. R., Stuiver, M. H., Steenberger, R., and Murre, C. (1993) Mol. Cell. Biol. 13, 7163-7169 [Abstract/Free Full Text]
  65. Pongubala, J. M., Nagulapalli, S., Klemsz, M. J., McKercher, S. R., Maki, R. A., and Atchison, M. L. (1992) Mol. Cell. Biol. 12, 368-378 [Abstract/Free Full Text]
  66. Pongubala, J. M., Van Beveren, C., Nagulapalli, S., Klemsz, M. J., McKercher, S. R., Maki, R. A., and Atchison, M. L. (1993) Science 259, 1622-1625 [Abstract/Free Full Text]
  67. Eisenbeis, C. F., Singh, H., and Storb, U. (1993) Mol. Cell. Biol. 13, 6452-6461 [Abstract/Free Full Text]
  68. Shin, M. K., and Koshland, M. E. (1993) Genes & Dev. 7, 2006-2015
  69. Pahl, H. L., Scheibe, R. L., Zhang, D., Chen, H., Galson, D. L., Maki, R. A., and Tenen, D. G. (1993) J. Biol. Chem. 268, 5014-5020 [Abstract/Free Full Text]
  70. Moulton, K. S., Semple, K., Wu, H., and Glass, C. K. (1994) Mol. Cell. Biol. 14, 4408-4418 [Abstract/Free Full Text]
  71. Karim, F. D., Urness, L. D., Thummel, C. S., Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., Maki, R. A., Gunther, C. V., Nye, J. A., and Graves, B. C. (1990) Genes & Dev. 4, 1451-1453
  72. Nye, J. A., Petersen, J. M., Gunther, C. V., Jonsen, M. D., and Graves, B. J. (1992) Genes & Dev. 6, 975-990
  73. Wasylyk, C., Gutman, A., Nicholson, R., and Wasylyk, B. (1991) EMBO J. 10, 1127-1134 [Medline] [Order article via Infotrieve]
  74. Seth, A., Robinson, L., Thompson, D. M., Watson, D. K., and Papas, T. S. (1993) Oncogene 8, 1783-1790 [Medline] [Order article via Infotrieve]
  75. Galson, D. L., Hensold, J. O., Bishop, T. R., Schalling, M., D'Andrea, A. D., Jones C., Auron, P. E., and Housman, D. E. (1993) Mol. Cell. Biol. 13, 2929-2941 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
F. Wischnewski, O. Friese, K. Pantel, and H. Schwarzenbach
Methyl-CpG Binding Domain Proteins and Their Involvement in the Regulation of the MAGE-A1, MAGE-A2, MAGE-A3, and MAGE-A12 Gene Promoters
Mol. Cancer Res., July 1, 2007; 5(7): 749 - 759.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. L. Schweitzer, K. J. Huang, M. B. Kamath, A. V. Emelyanov, B. K. Birshtein, and R. P. DeKoter
Spi-C Has Opposing Effects to PU.1 on Gene Expression in Progenitor B Cells
J. Immunol., August 15, 2006; 177(4): 2195 - 2207.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Johnston, A. L. Wood, D. J. Bolland, and A. E. Corcoran
Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region
J. Immunol., April 1, 2006; 176(7): 4221 - 4234.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Tantin, C. Schild-Poulter, V. Wang, R. J.G. Hache, and P. A. Sharp
The Octamer Binding Transcription Factor Oct-1 Is a Stress Sensor
Cancer Res., December 1, 2005; 65(23): 10750 - 10758.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. E. H. Wang, D. Tantin, J. Chen, and P. A. Sharp
B cell development and immunoglobulin transcription in Oct-1-deficient mice
PNAS, February 17, 2004; 101(7): 2005 - 2010.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. L. Schweitzer and R. P. DeKoter
Analysis of Gene Expression and Ig Transcription in PU.1/Spi-B-Deficient Progenitor B Cell Lines
J. Immunol., January 1, 2004; 172(1): 144 - 154.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Jundt, K. Kley, I. Anagnostopoulos, K. Schulze Probsting, A. Greiner, S. Mathas, C. Scheidereit, T. Wirth, H. Stein, and B. Dorken
Loss of PU.1 expression is associated with defective immunoglobulin transcription in Hodgkin and Reed-Sternberg cells of classical Hodgkin disease
Blood, April 15, 2002; 99(8): 3060 - 3062.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Peng and N. Jahroudi
The NFY transcription factor functions as a repressor and activator of the von Willebrand factor promoter
Blood, April 1, 2002; 99(7): 2408 - 2417.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Tantin and P. A. Sharp
Mouse Lymphoid Cell Line Selected To Have High Immunoglobulin Promoter Activity
Mol. Cell. Biol., March 1, 2002; 22(5): 1460 - 1473.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bemark, A. Martensson, D. Liberg, and T. Leanderson
Spi-C, a Novel Ets Protein That Is Temporally Regulated during B Lymphocyte Development
J. Biol. Chem., April 9, 1999; 274(15): 10259 - 10267.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Sauter and P. Matthias
Coactivator OBF-1 Makes Selective Contacts with Both the POU-Specific Domain and the POU Homeodomain and Acts as a Molecular Clamp on DNA
Mol. Cell. Biol., December 1, 1998; 18(12): 7397 - 7409.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Bemark, H. Olsson, D. Heinegard, and T. Leanderson
Purification and Characterization of a Protein Binding to the SP6 kappa  Promoter. A POTENTIAL ROLE FOR CArG-BOX BINDING FACTOR-A IN kappa  TRANSCRIPTION
J. Biol. Chem., July 24, 1998; 273(30): 18881 - 18890.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Liberg, M. Sigvardsson, M. Bemark, and T. Leanderson
Differentiation-Specific, Octamer-Dependent Costimulation of {kappa} Transcription
J. Immunol., April 15, 1998; 160(8): 3899 - 3907.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S Junker, M Lamm, V Nielsen, and P Matthias
Extinction of immunoglobulin gene expression in B cells upon fusion with HeLa cells is preceded by rapid nuclear depletion of essential transcription factors and is accompanied by widespread inactivation of genes expressed in a B cell-specific manner
J. Cell Sci., January 10, 1997; 110(20): 2579 - 2587.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
S. Grigoryev, A. E. Stewart, Y. T. Kwon, S. M. Arfin, R. A. Bradshaw, N. A. Jenkins, N. G. Copeland, and A. Varshavsky
A Mouse Amidase Specific for N-terminal Asparagine. THE GENE, THE ENZYME, AND THEIR FUNCTION IN THE N-END RULE PATHWAY
J. Biol. Chem., November 8, 1996; 271(45): 28521 - 28532.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Akbarali, P. Oettgen, J. Boltax, and T. A. Libermann
ELF-1 Interacts with and Transactivates the IgH Enhancer pi Site
J. Biol. Chem., October 18, 1996; 271(42): 26007 - 26012.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. S. Bastian, M. Yagi, C. Chan, and G. J. Roth
Analysis of the Megakaryocyte Glycoprotein IX Promoter Identifies Positive and Negative Regulatory Domains and Functional GATA and Ets Sites
J. Biol. Chem., August 2, 1996; 271(31): 18554 - 18560.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-m. Chen, P. Zhang, H. S. Radomska, C. J. Hetherington, D.-E. Zhang, and D. G. Tenen
Octamer Binding Factors and Their Coactivator Can Activate the Murine PU.1 (spi-1) Promoter
J. Biol. Chem., June 28, 1996; 271(26): 15743 - 15752.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwarzenbach, H.
Right arrow Articles by Matthias, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwarzenbach, H.
Right arrow Articles by Matthias, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement