|
|
|
|||||||
|
|||||||||
(Received for publication, August 5, 1994; and in revised form, October 5, 1994) From the
The B cell-specific expression of immunoglobulin (Ig) genes is
controlled by the concerted action of variable (V) region promoters and
intronic or 3` enhancers, all of which are active in a
lymphoid-specific manner. A crucial highly conserved element of the V
region promoters is the octamer site -ATTTGCAT-, which can be bound by
ubiquitous (Oct-1) as well as B cell-specific (Oct-2) factors. Another
less conserved element found in many Ig promoters is pyrimidine-rich
and has been shown to be functionally important, in particular for
those Ig promoters that have only an imperfect octamer site. In this
study we have analyzed the factors binding specifically to the
pyrimidine-rich motif of the V Immunoglobulin (Ig) ( The B cell
specificity of Ig promoters is largely caused by the octamer
element(9) , although this same element is also implicated in
the ubiquitous expression of small nuclear RNA genes(23) , the
cell cycle regulation of the histone H2B gene(24) , and the
VP16-dependent expression of herpesvirus intermediate early
genes(25, 26, 27) . The ability of the
octamer element to promote ubiquitous as well as B cell-specific gene
expression was initially suggested to reside in its interaction with
Oct-1 and Oct-2. The different cellular distribution of these two
proteins led to the proposal that Oct-2 rather than Oct-1 is
responsible for the B cell specificity of Ig promoters. The suggestion
that Oct-2 specifically promotes Ig gene transcription has come into
question, because from in vitro experiments with
octamer-containing promoter constructs, it has been shown that Oct-1
and Oct-2 are essentially interchangeable(28) . Analysis of
Oct-2 knockout mice has shown that Oct-2 is not required for the
generation of Ig-bearing B cells but is crucial for their maturation to
Ig-secreting cells, and this implies that Oct-2 plays an essential role
only late in B cell differentiation(29) . Thus, it appears that
both octamer factors can activate transcription from Ig promoters.
Moreover, a B cell-restricted coactivator, OCA-B, which can interact
with Oct-1 or Oct-2, has been suggested to be required for a high level
of Ig promoter activity(30, 31) . In addition, a third
less conserved pyrimidine-rich element is found upstream of the
heptamer or the octamer motif in many Ig promoters and has been shown
to be also important for full promoter activity. However, only little
is known about the factors mediating Ig gene transcription from these
pyrimidine-rich sequences(32, 33, 34) . In
the studies reported here, we have analyzed the factors binding to the
pyrimidine-rich motif of a The other factor recognizing
specifically the pyrimidine-rich motif has an apparent molecular mass
of
Lymphoid cells were grown to a density of 2
Figure 4:
PU.1 and Oct factors simultaneously bind
to the V
Figure 1:
A, nuclear factors bind to the
pyrimidine-rich motif of the V
Figure 2:
A, the C2 binding activity is competed
away by the SV40 PU box. Competition experiments were performed with
the
Figure 3:
Identification of the contact sites for
PU.1 and C1 by methylation interference and copper-phenanthroline
footprinting analysis. A and B, the partially
methylated, radiolabeled
Figure 5:
The pyrimidine-rich motif and the
divergent octamer site are both required for optimal V
Figure 6:
PU.1 can activate transcription in concert
with Oct-2. A, RNase protection analysis was performed with
RNA from HeLa cells transiently transfected with the plasmid OVEC-Ref
together with the promoterless OVEC parental plasmid (lanes 1 and 2),
Figure 7:
PU.1
binds to the pyrimidine-rich motifs of several other Ig promoters.
Pyrimidine-rich motifs derived from various Ig promoters were tested
for binding to 4 µg of BJA-B nuclear extract (odd numbered
lanes) or RL PU.1 protein (lane 2, 1 µl; even
numbered lanes 4-16, 2 µl), as indicated above each
lane in an EMSA.
The most conserved element of Ig promoters is the octamer
site(1, 5) , and numerous studies have shown its
importance for Ig expression (6, 7, 8, 9) . The nuclear factors
recognizing this motif, the ubiquitous Oct-1 and the lymphoid-specific
Oct-2, have been cloned and extensively
studied(12, 20) . In addition, other, less
conserved elements also contribute to the B cell-specific activity of
Ig promoters. One such element is the pyrimidine-rich
motif(33, 34) , a relatively loosely conserved element
found in many Ig promoters. In this case, very little is known about
the factors that mediate its activity. We have begun our studies by
looking at the factors interacting specifically with the
pyrimidine-rich motif of the V By performing binding studies with related
pyrimidine-rich sequences derived from other light or heavy chain Ig
promoters, we found that PU.1 not only shows binding affinity to the
V The other factor recognizing the
V Previously, Atchison et al.(32) demonstrated that
the In the case of the
V In conclusion, we
have demonstrated that the Ets-related protein PU.1 binds to the
pyrimidine-rich motif of V
Volume 270,
Number 2,
Issue of January 13, 1995 pp. 898-907
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
19 promoter, a light chain gene
promoter with an imperfect octamer site. Using nuclear extracts
prepared from B cells, we detected two sets of specific complexes in
electrophoretic mobility shift experiments. One complex appears to be
ubiquitous but enriched in lymphoid cells and represents the binding of
a potentially novel factor with an apparent molecular mass of 50
kDa. The other complex was found only with extracts from pre-B or B
cells as well as from a macrophage cell line and appears to be caused
by the binding of PU.1, a factor of the Ets family. We show that on
this Ig promoter Oct factors (Oct-1 or Oct-2) and PU.1 can bind
concomitantly but without synergism. By transfection experiments in
non-B cells we demonstrate that PU.1 is indeed able to activate this
promoter in concert with Oct-2. Furthermore, we show that PU.1 can bind
with varying affinities to the pyrimidine-rich elements of several
other Ig promoters. These data suggest a more general role for PU.1 or
other members of the Ets family in the activation of Ig promoters.
)genes are preferentially
expressed in cells of the B-lymphoid lineage. This tissue specificity
is a property of the promoter and enhancer elements (1, 2, 3, 4) , both of which are
lymphoid-specific. A highly conserved octamer element 5`-ATTTGCAT-3`
that is present in Ig light chain promoters and, in the inverted
orientation, in Ig heavy chain promoters (5) is essential for
efficient Ig promoter activity both in vivo and in
vitro(6, 7, 8, 9) . The octamer
motif, located 50-70 bp upstream of the transcriptional start
site, serves as a binding site for the lymphoid-specific transcription
factor Oct-2 (10, 11, 12, 13, 14) and
the ubiquitous factor
Oct-1(15, 16, 17, 18, 19, 20) ,
which are members of the POU family of homeodomain proteins. In
addition, some heavy chain promoters contain a so-called heptamer motif
5`-CTCATGA-3` that, in cooperation with the octamer motif, can also
bind octamer factors(21, 22) . light chain promoter (V19). By
electrophoretic mobility shift assays (EMSAs) with nuclear extracts
prepared from B cells and a V19 promoter pyrimidine-rich motif we
detected two sets of specific complexes. We show that one of these
factors binding specifically to that site appears to be PU.1, a member
of the Ets family that is expressed in B cells and
macrophages(35) . PU.1 is identical to the Spi-1
proto-oncogene(36, 37) , which was isolated as the
site of Friend erythroleukemia virus integration in 95% of virally
induced tumors. In addition to PU.1, the Ets family contains several
proteins, for instance Ets-1, Ets-2, Elf-1, Elk-1, Erg, E74, Fli-1, and
PEA3 (38) that share a relatively conserved 80-90-amino
acid long DNA-binding domain that recognizes a purine-rich sequence
with the core motif
5`-GGA(A/T)-3`(35, 39, 40) . As with other
Ets proteins, however, very little is known about the cellular genes
that are regulated by PU.1.50 kDa and is ubiquitous but is enriched in lymphoid extracts
and might be a novel factor, perhaps also belonging to the Ets family.
Furthermore, we demonstrate that PU.1 is able to strongly activate
transcription of the V
19 light chain promoter through the
pyrimidine-rich motif and that maximal promoter activity was obtained
in cooperation with Oct-2 in transfected cells. Finally, by performing
binding studies with related pyrimidine-rich sequences derived from
light or heavy chain promoters, we show that PU.1 can also bind with
varying affinities to several of these motifs present in other Ig
promoters. Our data, thus, suggest that PU.1 as well as perhaps other
factors of the Ets family might be involved in the regulation of a
number of Ig promoters.
Cell Lines and Nuclear Extracts
The non-lymphoid
cell line HeLa is derived from a human epitheloid cervical carcinoma;
Cos is an SV40-transformed monkey kidney; and 3T3 is an embryonal
BALB/c mouse cell line. The B cell line BJA-B is a lymphoblastoid cell
line; HAFTL, BAF3, 38B9, PD31, and 70Z/3 are mouse pre-B lymphocytes;
NFS5.3 is a mouse pre-B lymphoblast; S194 is a mouse plasmacytoma; Wehi
231 is a mouse lymphoma; Nalm 6 is a human pre-B cell; and Namalwa is a
Burkitt lymphoma cell line. The T-cell lines YAC1, PEER, and BW5147 are
mouse lymphoma; and CEM, Molt 4, and Jurkat are human acute
lymphoblastic leukemia cells. U937 is a human monocyte/macrophage cell
line.
10
cells/ml in RPMI 1640 medium supplemented with 10% fetal calf
serum, and non-lymphoid cells were grown to confluency in
Dulbecco's modified Eagle's medium with 3% fetal calf serum
and 3% newborn calf serum. Nuclear extracts from different cell lines
were prepared as described previously(41) .PU.1 cDNA Cloning
Cytoplasmic RNA from the pre-B
cell line 70Z/3 was used for first strand cDNA synthesis primed with
oligonucleotide dT. Using this cDNA, PU.1 cDNA was amplified by
polymerase chain reaction with the specific primers
5`-CGGGGCACCTGGTCCTG-3` and 5`-GTAATCTAGATATGGCCGGCGGGGTCCAG-3` and
subsequently subcloned into the XbaI and BamHI sites
of the pBluescript KS(II) vector. The clone was
verified by restriction mapping and DNA sequencing.
In Vitro Transcription and Translation
For in
vitro expression Oct-1, Oct-2, and PU.1 cDNAs were subcloned into
the pBGo vector, a Bluescript derivative in which part of the rabbit
-globin gene leader sequence has been inserted immediately
downstream of the T3 promoter. RNA was generated from BamHI-linearized Oct-1 and XbaI-linearized Oct-2 and
PU.1 plasmids in a T3 RNA polymerase reaction, using an mCAP
transcription kit (Stratagene). In vitro transcription
reactions were carried out for 60 min at 37 °C. In vitro translations were performed by using 10 µl of the synthesized
RNA, 35 µl of nuclease-treated rabbit reticulocyte lysate
(Promega), 1 µl of amino acid mix, and 40 units of RNase inhibitor
in a 50-µl reaction mixture. Translation reactions were carried out
for 60 min at 30 °C.EMSA
For EMSA 4-8 fmol of P-end-labeled oligonucleotides were incubated with 4
µg of nuclear extract or 1 µl of in vitro-translated
protein (PU.1, diluted 1:6; Oct-1, undiluted; Oct-2, diluted 1:5) and 2
or 0.4 µg of poly(dI/dC), respectively, in 15 µl of a buffer
containing 4% Ficoll, 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 0.25 mg/ml bovine serum albumin (Boehringer
Mannheim) and 2 mM spermine. After 15 min of incubation at
room temperature the binding reaction was separated on a native 4%
polyacrylamide gel (29:1 cross-link) in 0.25
Tris borate-EDTA
(TBE) buffer at 10 V/cm for 2-3 h at room temperature.
Competition experiments were done by mixing an 100-1000-fold molar
excess of unlabeled competitor DNA to the binding reaction before
adding the nuclear extract. For antibody supershift experiments 1
µl of a polyclonal rabbit antibody raised against the
carboxyl-terminal domain (amino acids 251-271) of PU.1 was added
to the nuclear extract or in vitro-translated protein. The
following oligonucleotides were synthesized for use in EMSA: the
pyrimidine-rich motif (Py) GTAATTTACTTCCTTATTTGATGA and the
mutated motif (Py*) GTAATTTACTCGAGTATTTGATGA, bp -97
to -74, of the V19 promoter; the pyrimidine-rich and the
octamer motif (Py/Octa)
GTAATTTACTTCCTTATTTGATGACTCCTTTGCATAGAT, bp -97 to
-59, of the V19 promoter; the SV40 PU box, bp -321 to
-298, CTCTGAAAGAGGAACTTGGTTAGG; the pyrimidine-rich motifs
of the V1 promoter, TAATAACTTCACTCTCTACAACTT; the V101 promoter,
GCTCATTGCTTCCTTTTATTCTGA; the V37A4 promoter,
CTCTAGTTTCTTCTTCTCCAGCTGGAATG; the V37A11 promoter,
CCAGTAGTTCTCCTGCTCAATTAG; the V105 promoter,
CTATATAACTCTTCCTTCTATACTGCAACAC; the V12G-1 promoter,
CCTTTTCACCTCTCCATACAGAGGC; and the VA19
CCCATTGACTCTTTCCACACCACTGC. The pyrimidine-rich sequences as
well as the purine-rich motif are in boldface type, and the mutated
sequence is indicated with an asterisk (*). All oligonucleotides were
purified by electrophoresis on 12% denaturing acrylamide gels.Methylation Interference Assays and Copper-phenanthroline
Footprinting Analysis
For methylation interference analysis a
24-bp fragment extending from bp -97 to -74 of the V19
promoter was subcloned into the EcoRV site of the pBluescript
KS vector. The resulting plasmid was then linearized with either EcoRI or SalI, treated with calf intestine alkaline
phosphatase (Boehringer Mannheim), 5`-end-labeled with
[-
P]ATP by polynucleotide kinase (BioLabs)
and recut with the second restriction enzyme. Labeled DNA fragments
were purified by polyacrylamide gel electrophoresis. These probes were
partially methylated for 8 min at room temperature with 1 µl of
dimethyl sulfate. As compared with the standard gel shift assay, each
preparative scale binding reaction was scaled up 10-fold in BJA-B
nuclear extract or in vitro-translated PU.1, 5-fold in
poly(dI-dC), and 100-fold in probe. After electrophoretic gel shift and
transfer to DE81 paper, the bound and the free DNA were isolated,
eluted with 1 M NaCl, Tris-EDTA, and precipitated with
ethanol. For the G > A cleavage reaction the DNA pellet was
dissolved in 10 mM sodium phosphate buffer (pH 7), heated for
15 min at 90 °C, cooled subsequently, and heated again for 20 min
at 90 °C in 0.1 M sodium hydroxide. The samples were
neutralized with 1 volume of 0.1 M acetic acid and
subsequently precipitated with ethanol. The G + A piperidine
cleavage reaction (Maxam and Gilbert method) of the probe and the G
> A reaction were analyzed on a 12% polyacrylamide, 8 M urea gel. After electrophoretic gel shift was performed as
described above, copper-phenanthroline footprinting reaction was
carried out in the polyacrylamide matrix by the method described by
Kuwabara et al.(42) .
Construction of Plasmids
Reporter plasmids were
constructed by cloning the following double-stranded oligonucleotides
containing various binding sites (in boldface type) into the SacI and SalI sites of the OVEC vector (43) immediately upstream of the -globin gene TATA box:
Py/Octa (bp -101 to -41),
CTGTGTAATTTACTTCCTTATTTGATGACTCCTTTGCATAGATCCCTAGAGGCCAGCACAG;
Py*/Octa, CTGTGTAATTTACTCGAGTATTTGATGACTCCTTTGCATA G
A T CCCTAGAGGCCAGCACAG; Py/Octa*,
CTGTGTAATTTACTTCCTTATTTGATGACTCCTGTTCAGAGATCCCTAGAGGCCAGCACAG;
Py*/Octa*,
CTGTGTAATTTACTCGAGTATTTGATGACTCCTGTTCAGAGATCCCTAGAGGCCAGCACAG;
Py (bp -93 to -73), CTTTACTTCCTTATTTGATGACTG of the
V19 promoter; SV40 PU box, CAACCTCTGAAAGAGGAACTTGGG; SV40
PU box inverse, CCCAAGTTCCTCTTTCAGAGGTTG. The mutated motifs are
indicated with an asterisk (*). The Oct-2 expression vector pOEV1 has
been described previously(12) . The PU.1 expression plasmid was
constructed by cloning the PU.1 cDNA into the SmaI and XbaI sites of the vector pEVRF-2 (44) 3` of the
cytomegalovirus enhancer/promoter and herpes simplex virus thymidine
kinase leader. All clones were verified by DNA sequencing.Transfections and RNase Protection
The mouse S194
and the human Namalwa B cell lines were grown to a density of 2
10
cells in 10 ml of RPMI 1640 medium and transfected by
the DEAE-dextran procedure (10) with 4 µg of reporter
plasmid and 0.8 µg of reference plasmid (Ovec-Ref). The human
epithelial carcinoma cell line HeLa was grown to a confluency of
60-70% in 10 ml of Dulbecco's modified Eagle's medium
and transfected by the calcium phosphate coprecipitation procedure with
20 µg of DNA (6 µg of reporter plasmid, 0.8 µg of reference
plasmid, 4 µg of either expression plasmid or sonicated salmon
sperm DNA and made up to 20 µg with sonicated salmon sperm DNA).
16-20 h after DNA addition, transfected HeLa cells were shocked
with 25% dimethyl sulfoxide. 48 h after transfection, cytoplasmic RNA
was extracted(10) . 20-40 µg of RNA was used for
hybridization to a radioactive complementary strand RNA probe (covering
positions -19 to 227 of the hybrid gene). Hybridization was
performed at 37 °C overnight. Hybridization products were digested
with 6.5 mg/ml RNase A and 10 units/ml RNase T1 at 37 °C for 1 h
and subsequently separated on a 6% polyacrylamide, 8 M urea
gel. The quantification of the radioactive bands was performed with a
PhosphorImager. The signals derived from the reference transcripts were
used to normalize the variability in transfection efficiency.
Nuclear Factors Bind to the Pyrimidine-rich Motif of
the V
To determine which factors can bind to the
pyrimidine-rich motif of Ig promoters, we prepared a probe derived from
the V19 Promoter19 light chain gene, an Ig gene expressed in plasmacytoma
MPC11 cells (45, 46) and containing a promoter with an
imperfect octamer site (7 out of 8; see Fig. 4, bottom). We chose this promoter because previous studies had
shown that a potentially novel factor was binding to that
site(32) , and we wanted to confirm and extend these original
studies. When this probe (Py) covering the pyrimidine-rich site of
the V19 promoter was incubated with B cell nuclear extract, two
prominent specific complexes were detected by EMSA, as shown in Fig. 1A. Binding was competed by the addition of
increased amounts of the cognate oligonucleotide (lanes
2-4) but not by oligonucleotide containing a mutated
pyrimidine-rich motif (Py*, lanes 5-7), indicating
that both complexes were binding specifically. The faster migrating
complex (C2) was especially prominent in the cell line used in Fig. 1A (BJA-B, a human mature B cell line) and was
easily detectable under our standard EMSA conditions, whereas the upper
complex (C1) was only easily detectable when spermine was included in
the binding buffer. For that reason all subsequent experiments included
spermine in the binding reactions. The third weak complex of
intermediate mobility could not be competed away by any DNA sequence
tested and thus represents nonspecific binding to the probe used. The
lowest faint Py-specific band may represent a complex resulting
from partially degraded protein.
19 promoter. A, EMSA was performed with a
fragment of the V19 promoter, comprising both the Py and the
octamer site, and 1 µl of RL PU.1 (lane 1), RL Oct-1 (lane 2), or RL Oct-2 (lane 3) alone or 1 µl of
RL PU.1 in combination with increasing amounts of RL Oct-1 (lane
4, 1 µl; lane 6, 2 µl), or Oct-2 (lane
5, 1 µl; lane 7, 5 µl). B, EMSA was
performed with 4 µg (lane 8) or 8 µg of BJA-B nuclear
extract (lane 9), and competition analysis was carried out
with 4 µg of BJA-B nuclear extract and a 1000-fold excess of an
unlabeled octamer motif (lane 10) or SV40 PU site (lane
11) as competitors. Lane 12, probe alone. The sequence of
the V19 probe used containing the pyrimidine-rich and octamer
motif is represented from bp -97 to -39 at the bottom of
the figure. The two binding sequences are indicated in white on
black.
19 promoter. EMSA was performed with
a Py probe covering the pyrimidine-rich site (bp -97 to
-74) of the V19 promoter and 4 µg of nuclear extract
prepared from BJA-B cells, a human mature B cell line. Increasing
amounts (100, 500, 2500 fmol) of unlabeled wild type Py (lanes
2-4) or mutated Py (indicated with an asterisk (*))
oligonucleotide competitor (lanes 5-7) as indicated
above were added. Lane 8, probe alone. B, cell line
distribution of the V19 promoter binding activities. 4 µg of
nuclear extract prepared from a number of non-lymphoid cell lines (lane 1, HeLa; lane 2, Cos7; lane 3, 3T3),
pre-B and B cells (lane 4, HAFTL; lane 5, BAF3; lane 6, 38B9; lane 7, PD31; lane 8, 70Z/3; lane 9, NFS5.3; lane 10, Nalm 6; lane 11,
Wehi 231; lane 12, Namalwa), T cells (lane 13, YAC1; lane 14, CEM; lane 15, Peer; lane 16,
BW5147; lane 17, Molt 4; lane 18, Jurkat), and
macrophages (lane 19, U937) was added to an EMSA using the
Py probe. For a description of the cell lines see ``Materials
and Methods.'' The two specific DNA-protein complexes are
designated C1 and C2 on the left.
Cell Line Distribution of the V
The cell line distribution of these V19 Promoter Binding
Activities19 promoter
binding activities was investigated by testing nuclear extracts derived
from a number of non-lymphoid as well as lymphoid cell lines from mouse
or human origin in an EMSA. As shown in Fig. 1B, the
slower migrating complex C1 was detected in essentially every extract
tested but was found to be enriched in lymphoid cell extracts. In some
extracts, this complex was heterogeneous in mobility and comprised two
species. The nature of this double band was not further analyzed. The
complex C1 may represent the factor originally identified by Atchison et al.(32) , since electrophoretic mobility and cell
line distribution appear to be similar. The faster migrating complex C2
had a much more restricted distribution and was clearly detected only
in extracts from pre-B cells (BAF3, lane 5; PD31, lane
7, and NFS5.3, lane 9) or B cells (Nalm 6, lane
10, and Namalwa, lane 12), as well as in one
monocyte/macrophage cell line tested (U937, lane 19).
Moreover, an additional band just above the complex C2 was detected in
the NFS5.3 nuclear extract (lane 9) but was not further
investigated.The Proto-oncogene PU.1 Binds to the Pyrimidine-rich
Motif of the V
To characterize the nature of the
factors giving rise to complex C1 or C2 we performed competition
experiments with a number of oligonucleotides containing binding sites
for known factors; some of these results are presented in Fig. 2A, where in particular different purine-rich
sequences were tested. As shown, the slowly migrating complex C1 was
only competed away by its cognate oligonucleotide (lane 2) and
not by oligonucleotides containing a purine-rich (PU) box derived from
the simian virus 40 (SV40) enhancer (lane 3), the distal or
proximal purine box of the interleukin-2 (IL-2) gene promoter (lanes 4 and 5), a NF-AT site of the IL-4 gene
promoter (lane 6), a CREB site (lane 7), or an Ets-1
or Ets-2 binding site (NF19 Promoter
4) of the T cell receptor gene
enhancer (lane
8)(47, 48, 49, 50) . Other
binding sites such as those for NF-B, Oct, or AP-1 were tested as
well and did not compete either (data not shown). The fast migrating
complex C2, on the other hand, was competed away efficiently by the
cognate oligonucleotide and also by the SV40 enhancer-derived
purine-rich box (lanes 2 and 3). This oligonucleotide
contains a binding site for PU.1(47) , a B cell- and
macrophage-specific member of the Ets family (35) , and this
raised the possibility that PU.1 or a related factor might be giving
rise to complex C2. This hypothesis was further substantiated by the
experiment presented in Fig. 2B, where, in addition to
the Py probe, the oligonucleotides containing the mutated V19
pyrimidine-rich site (Py*) or the SV40 PU box were labeled
radioactively and used as probes for EMSA reactions performed with
different nuclear extracts. As shown, the SV40-derived probe gave rise
only to the putative PU.1 complex C2, and this only with BJA-B or U937
extracts (lanes 4 and 8) but not with a HeLa nuclear
extract (lane 12), consistent with the fact that PU.1 is
expressed in B cells or macrophages but not in HeLa cells (35) . The Py* probe, on the other hand, only gave rise to
the previously identified nonspecific complex with every extract tested (lanes 3, 7, and 11). The lowest migrating
complex, detected with U937 extract (Fig. 2B, lanes
6 and 8; see also Fig. 1B, lane
19), may represent partially degraded protein. To provide further
evidence that the lower complex C2 was indeed caused by PU.1 binding,
we compared the electrophoretic mobility of complex C2 with that formed
by in vitro-translated PU.1 protein. Fig. 2C demonstrates that in vitro-translated PU.1 protein
incubated with the Py or the SV40 PU probe gave a retarded complex (lanes 3 and 6) comigrating exactly with the C2
complex identified with B cell extract (lanes 2 and 5). For final confirmation that PU.1 binds to the
pyrimidine-rich motif of the V19 promoter, we used an antibody
that reacts specifically against the carboxyl-terminal domain of PU.1.
As shown in Fig. 2D, when added to the EMSA reaction,
this antibody produced a supershift (marked with an S) of the in vitro-translated PU.1 protein (lane 6). When BJA-B
nuclear extract was used, addition of the antibody also resulted in a
supershift (lanes 2 and 4), although with a much
weaker intensity; this therefore identifies the complex C2 as caused by
PU.1 binding.
Py probe and 4 µg of BJA-B nuclear extract using a
1000-fold molar excess of different unlabeled competitor
oligonucleotides as indicated above each lane. B, the
C2 factor binds to the SV40 PU box. 4 µg of nuclear extracts
derived from BJA-B cells (lanes 2-4), U937 macrophages (lanes 6-8), and HeLa cells (lanes 10-12)
was tested for binding to the radiolabeled Py (lanes 2, 6, and 10), Py* (lanes 3, 7,
and 11), or SV PU probe (lanes 4, 8, and 12) in an EMSA. C, the complex C2 comigrates with in vitro-translated PU.1. For EMSA, the Py or SV40 PU
probe was incubated with either 4 µg of nuclear extract from BJA-B
cells (lanes 2 and 5) or 1 µl of in
vitro-translated PU.1 protein (lanes 3 and 6)
prepared from rabbit reticulocyte lysate (RL) as indicated above
each lane. Lanes 1 and 4, unprogrammed
reticulocyte lysate. D, identification of the C2 binding
activity as PU.1. 4 µg of nuclear extract from BJA-B cells (lanes 1-4) or 1 µl of in vitro-translated
PU.1 (lanes 5 and 6) was used in an EMSA. Lanes 1 and 2 contain the Py probe, and lanes 3-6 contain the SV40 PU box. Rabbit polyclonal antibody against a
peptide consisting of amino acids 251-271 of PU.1 (lanes
2, 4, and 6) was added to the EMSA reaction as
indicated above each lane. S refers to the
supershifted bands. The positions of the PU.1/C2 complex and its
supershift are indicated with an arrow.
Identification of the Contact Sites for C1 and PU.1 by
Methylation Interference and Copper-Phenanthroline Footprint
To
further define the way in which the C1 factor and PU.1 bind to the
V19 pyrimidine-rich sequence, we performed methylation
interference (Fig. 3, A and B) and
copper-phenanthroline footprinting experiments (Fig. 3C). The V19 sequence was cloned into the
polylinker of Bluescript and reclaimed by cleavage with SalI
or EcoRI after either the bottom strand at the EcoRI
or the top strand at the SalI site had been radioactively
labeled with [-
P]ATP. The probe was treated
with dimethyl sulfate and then used in a preparative mobility shift
assay. DNA bound in complexes as well as unbound DNA was subjected to
cleavage with sodium hydroxide and piperidine, respectively. On the
bottom (purine-rich) strand the interference pattern observed was
virtually identical for all of the complexes analyzed: C1, C2 (PU.1),
and recombinant PU.1 protein. The 2 central G residues interfered
strongly, and the 2 A residues of the core GGAA sequence interfered
weakly. In addition, a very weak interference of an A residue
downstream of this motif can also be observed (Fig. 3B). On the top (pyrimidine-rich) strand 2 A
residues interfered very weakly, but apparently only with the PU.1
factor, either from the B cell extract or as recombinant protein (Fig. 3A). Moreover, the copper-phenanthroline
footprint pattern (Fig. 3C) revealed that B cell
extract-derived PU.1 completely protected a 13-15-bp region
centered over the
Py motif (top strand, lane 2)
or the purine-rich sequence (bottom strand, lane 5).
By contrast, the C1 factor only partially protected these regions, and
hypersensitive sites were easily apparent (lanes 1 and 4). These results show that PU.1 and the C1 factor recognize
the pyrimidine-rich motif in a highly similar if not identical manner.
Py probe was incubated with nuclear
extract (BJA-B, lanes 2-5) or in
vitro-translated PU.1 protein (RL PU.1; lanes 6 and 7). Free and bound probes were separated on a 4%
nondenaturating polyacrylamide gel, isolated, and cleaved with sodium
hydroxide, as described under ``Materials and Methods.''
Cleavage products of both free (lanes 2 and 6) and
bound probe (lanes 3-5 and 7) were analyzed on
a 12% polyacrylamide, 8 M urea gel along with a G + A
piperidine cleavage reaction of the probe (lane 1). The
sequences of the top and bottom strands are aligned with the
gels. The pyrimidine-rich motif (top strand) and the
corresponding purine-rich sequence (bottom strand) are
indicated in white on black. The nucleotides whose methylation
strongly or partially interfered with protein binding are indicated by black or open triangles, respectively. C,
for copper-phenanthroline footprinting, the Py probe used for
methylation interference was incubated with BJA-B nuclear extract. Free
and bound probes were separated by electrophoresis and digested with
copper-phenanthroline while they were still embedded in the gel matrix.
Digested products of both free (top strand, lane 3; bottom strand, lane 6) and bound probes (top
strand, lanes 1 and 2; bottom strand, lanes 4 and 5) were analyzed as described in A and B.
PU.1 and Oct Factors Simultaneously Bind to the V
As mentioned previously the V19
Promoter19 promoter contains
a variant octamer site having only seven out of eight nucleotides
matching the consensus. Previous studies (32, 51) have
shown that, depending on the flanking sequences, such imperfect sites
can or cannot be efficiently bound by their cognate factors, the Oct
factors. Furthermore, it has been shown that Oct factors can exhibit
cooperative binding when two binding sites are juxtaposed, such as in
the case of many heavy chain promoters containing a heptamer motif
upstream of the octamer site(21, 52, 53) . We
therefore wondered whether Oct factors would bind efficiently to the
V19 octamer site and, possibly, be helped by the nearby binding of
PU.1 (or of the C1 factor). For that reason, we prepared a radiolabeled
probe, Py/octa, covering nucleotides -97 to -59 of the
V19 promoter and containing both the Py site and the octamer
site. This probe was used for EMSA experiments performed with
recombinant proteins prepared from reticulocyte lysate (Fig. 4A) or with B cell extract (Fig. 4B). When the Py/octa probe was incubated
with PU.1, Oct-1, or Oct-2, in each case a complex of the expected
mobility was observed (lanes 1-3). Although this octamer
site has a lower affinity than a consensus site, specific Oct complexes
were easily detected under our conditions. When PU.1 was mixed with
either Oct-1 or Oct-2 the same complexes were observed, and, in
addition, complexes corresponding to the simultaneous binding of two
factors (Oct-1 + PU.1, lanes 4 and 6; Oct-2
+ PU.1, lanes 5 and 7) on the DNA probe were
also visible. The identity of these complexes has been further
confirmed by competition and antibody supershift experiments (data not
shown). Under the various conditions tested, no cooperativity of
binding between PU.1 and Oct factors at steady state was observed (Fig. 4A, lanes 4-7, and data not
shown). When the same DNA probe was incubated with a B cell nuclear
extract a complex pattern of retarded species was observed (Fig. 4B). Careful examination of the autoradiogram
indicated that the observed pattern essentially represented the
combination of the complexes obtained with the reticulocyte lysate
proteins (Oct-1, Oct-2, and PU.1) plus the C1 factor (lanes 8 and 9; compare with lanes 4-7), whereby
the Oct-1 + PU.1 complex could not be easily detected with the B
cell nuclear extract. This might reflect the relatively low abundance
of Oct-1 protein (relative to Oct-2 and PU.1) in these extracts. When
EMSA reactions were set up with B cell nuclear extract in the presence
of a competitor oligonucleotide containing either an octamer site or an
SV40 PU box, the residual pattern of complexes corresponded to the
binding of the C1 and C2 factors (lane 10) or of the Oct-1,
C1, and Oct-2 factors (lane 11). Thus the data presented show
that the various factors that were identified can indeed bind
simultaneously to this V19 promoter fragment but provide no
evidence of synergistic binding.The Pyrimidine-rich Motif and the Divergent Octamer Site
Are Both Required for Optimal V
To
functionally test the role of the pyrimidine-rich site we constructed a
series of reporter plasmids in which we inserted sequences derived from
the V19 Promoter Activity19 promoter immediately upstream of the rabbit -globin
TATA box (Fig. 5A). These plasmids were transfected
transiently together with a reference reporter plasmid into various B
cell lines, and the resulting transcription was analyzed by an RNase
protection assay(12, 43) . In Fig. 5B,
the results of such an experiment in S194 plasmacytoma cells are
presented, and Fig. 5C shows the corresponding
quantification by PhosphorImaging as well as the quantification of the
results of similar experiments done in Namalwa lymphoma cells. For
quantification, the level of transcription from the reference gene was
used to normalize the variability in transfection efficiency. The
presence of the Py/octa sequence efficiently activated
transcription (lane 3) as compared with the parental plasmid
containing only a TATA box as promoter element (lane 1) or
with the plasmid containing both sites mutated (Py*/octa*, lane 6). Mutation of either the Py sequence
(Py*/octa, lane 4) or of the octamer site (Py/octa*, lane 5) had a strong deleterious effect and resulted in a
promoter with less than 30% activity in S194 B cells and less than 60%
in Namalwa B cells. Mutation of both sites (Py*/octa*, lane
6) led to a promoter with essentially basal activity. Thus, our
results agree well with those of Atchison et al.(32) ,
who carried out similar analysis of the V19 promoter in S194 B
cells and showed that the Py element and the divergent octamer
site were both required for optimal V19 promoter activity.
Furthermore, when the Py site was removed from its sequence
context and tested by itself, juxtaposed to the -globin TATA box
in its natural orientation, it was also able to activate transcription,
albeit only weakly (lane 9). As a control, the effect of an
isolated SV40 PU box, which contains a strong PU.1 binding site, was
also analyzed in either orientation. Transcriptional activation was
observed only when the SV40 PU box was in the sense orientation (lane 8), whereas the inverse orientation of this motif
(corresponding to the pyrimidine-rich sequence on the top) surprisingly
abolished promoter activity and resulted in a basal level of
transcription (lane 7).
19 promoter
activity. A, schematic representation of the reporter plasmids
used. All constructs are based on the OVEC reporter plasmid and contain
various factor binding sites in front of the -globin TATA box; in
addition, these reporters contain an SV40 enhancer 3` of the globin
gene (black box). The Sp1 construct containing the binding
site for the ubiquitous transcription factor Sp1 derived from the
metallothionein gene promoter was used as a positive control. The
Py/octa construct containing the pyrimidine-rich and octamer motif
(bp -101 to -41) was derived from the V19 promoter,
and the mutated motifs are indicated with an asterisk (*). The SV40 PU
inv construct contains the SV40 purine sequence in inverse orientation
(with the corresponding pyrimidine-rich sequence on the upper strand). B, RNase protection analysis was performed with RNA from S194
B cells transiently transfected with the plasmid OVEC-Ref alone in the
absence of a reporter plasmid (lane 1) or with the plasmid
OVEC-Ref together with the Sp1 (lane 2), Py/octa (lane 3), Py*/octa (lane 4), Py/octa* (lane 5), Py*/octa* (lane 6), SV40 PU inv (lane 7), SV40 PU (lane 8), or Py reporter
plasmid (lane 9). Lanes M and Y, marker and
control hybridization with yeast RNA, respectively. Ref indicates the position of the reference signal produced by the
plasmid OVEC-Ref, and Test indicates the position of the
correctly initiated RNA derived from the reporter plasmids. rt denotes the position of ``readthrough'' transcripts. C, relative activities of the various reporter constructs in
S194 and Namalwa B cells were determined by PhosphorImager
quantification of representative experiments. The signals derived from
the reference transcripts were used to normalize the variability in
transfection effficiency. Transfection with the plasmid OVEC-Ref alone
in the absence of a reporter plasmid (S194, lane 1) or with
the plasmid OVEC-Ref together with the promoterless OVEC parental
plasmid (Namalwa, lane 1), Sp1 (lane 2), Py/octa (lane 3), Py*/octa (lane 4), Py/octa* (lane 5), Py*/octa* (lane 6), SV40 PU inv (lane 7), SV40 PU (lane 8), or Py reporter
plasmid (lane 9). The quantified data correspond to the gel
represented in B for S194 B cells and the average of three
independent experiments for Namalwa B cells. The activities are shown
relative to the activity of Py*/octa* reporter plasmid, which was
arbitrarily set to 1.0.
On the V
To directly test whether PU.1 was indeed
able to activate transcription from the pyrimidine-rich site we
transfected the same reporter plasmids into HeLa cells, which lack both
PU.1 and Oct-2 but contain Oct-1 and low levels of the C1 factor. In
these transfections we also included, in various combinations,
expression vectors for PU.1 and/or Oct-2 (Fig. 6, A and B). The 19 Promoter PU.1 Can Activate Transcription
in Concert with Oct-2Py/octa reporter plasmid had only a low basal
level in HeLa cells, suggesting that endogenous Oct-1 and the C1 factor
are not sufficient to activate transcription efficiently (lane
3). When PU.1 or Oct-2 were cotransfected a strong transactivation
was obtained (lanes 4 and 5). Moreover,
transactivation by PU.1 was two times higher than that obtained by
Oct-2. This probably reflects, at least in part, the relatively weak
binding of Oct-2 to the imperfect octamer site and not necessarily a
stronger intrinsic transcription activation capacity of PU.1 than of
Oct-2. Maximal transactivation of the reporter plasmid was observed
when both expression vectors were cotransfected together (lane
6). As expected, only a partial transactivation was obtained when
the Py site (Py*/octa, lanes 7 and 8) or
the octamer site was mutated (Py/octa*, lanes 9 and 10), whereas no transactivation was observed when both sites
were mutated (Py*/octa*, lanes 11 and 12). The
absolute level of transactivation of the Py/octa motif by both
factors (100%) is higher than the sum of the levels obtained following
transactivation by PU.1 (60%) and Oct-2 (28%) independently and higher
than the sum of the levels of transactivation of the Py*/octa
motif (20%) and the Py/octa* motif (45%). These results suggest a
slight synergism between PU.1 and Oct-2 for transcription activation,
even though no cooperativity was detected in DNA binding. Furthermore,
cotransfected PU.1 could efficiently transactivate (more than 5-fold)
constructs containing the Py site alone (lanes 17 and 18). Consistent with the data obtained from B cells, a strong
transactivation by PU.1 was obtained when the SV40 PU box was in the
sense orientation (lanes 15 and 16), but only a weak
transactivation by PU.1 was observed when this motif was in the inverse
orientation (lanes 13 and 14). These data demonstrate
that the pyrimidine-rich motif is a target for transcriptional
activation by PU.1 and that PU.1 together with Oct-2 are required for
full V19 promoter activity.
Py/octa (lanes 3-6),
Py*/octa (lanes 7 and 8), Py/octa* (lanes 9 and 10), Py*/octa* (lanes 11 and 12), SV40 PU inv (lanes 13 and 14),
SV40 PU (lanes 15 and 16), or Py reporter
plasmid (lanes 17 and 18).The OVEC constructs (as
described in Fig. 5) were cotransfected with or without PU.1
and/or Oct-2 expression plasmids as indicated above each lane. B, relative transactivations of the various reporter
constructs by PU.1 and/or Oct-2 in HeLa cells were determined by
PhosphorImager quantification of representative experiments. The
signals derived from the reference transcripts were used to normalize
the variability in transfection efficiency. Lanes 1-18,
as described in A. The quantified data correspond to the gel
represented in A and were verified in several independent
experiments. The activities are shown relative to the activity of the
Py*/octa* reporter plasmid, which was arbitrarily set to
1.0.
PU.1 Binds to the Pyrimidine-rich Motifs of Several Other
Ig Promoters
To determine the generality of PU.1 binding to
pyrimidine-rich motifs, we tested by EMSA the ability of PU.1 to bind
to other pyrimidine-rich sequences found in heavy or light chain
promoters(34, 54, 55, 56, 57) .
For this a number of radiolabeled oligonucleotides containing different
pyrimidine-rich motifs were incubated with BJA-B nuclear extract or in vitro-translated PU.1 protein. As shown in Fig. 7,
recombinant PU.1 did bind to several additional Ig promoters, such as
V101 (lane 6), V37A4 (lane 8), or V37A11 (lane
10). In some cases a complex of similar mobility was also observed
in the reactions set up with B cell extract (lanes 5 and 7) in addition to other noncharacterized complexes.
Interestingly, the pyrimidine-rich elements of the V105 and
VA19 promoter, which also contain the conserved GGAA motif on the
opposite strand, did not bind or only very weakly bound PU.1 (lanes
12 and 16). The presence of this motif is therefore not
sufficient for PU.1 binding, and the sequences flanking this core
region have a critical effect on binding(58) . Finally, of the
sequences tested, the V101 sequence was the only one that also gave
rise to a complex with a mobility similar to that of the V19 C1
complex (compare lane 5 with lane 1). Table 1shows a summary of the different binding activities of
PU.1 and C1 to the various pyrimidine-rich motifs as derived from the
EMSA in Fig. 7. To verify these data, the relative PU.1 binding
activity to the SV40 PU, V19, V1, or V101 sequence was determined
in another experiment using a PhosphorImager to quantify the
radioactivity present in the bands containing PU.1 bound or in the free
probe. A comparison of the percentage of each oligonucleotide bound to
PU.1 indicated that PU.1 bound to the V19 pyrimidine-rich motif
with the same affinity as to the SV40 PU box, which contains a strong
binding site for PU.1, and that it had a 4 times weaker affinity to the
pyrimidine-rich motif of the V101 promoter. These results demonstrate
that the pyrimidine-rich motif of the V19 promoter is a strong
binding site for PU.1 and that there are several additional Ig
promoters to which PU.1 shows significant binding affinity.
19 promoter, a light chain gene
having a promoter with an imperfect octamer site. Our results show that
two nuclear factors are able to bind to the pyrimidine-rich site (the
Py site); one of these factors is a lymphoid-enriched but
ubiquitous protein with an apparent molecular mass of 50 kDa. This
protein appears to be a novel factor and might correspond to the
protein
Y, described by Atchison et al.(32) .
Multiple evidences support the conclusion that the second factor is
PU.1, a B cell- and macrophage-specific member of the Ets
family(35) . First, the complex C2 was competed away
efficiently by the SV40 PU box, which contains a strong PU.1 binding
site. Second, in vitro-translated PU.1 formed a complex
indistinguishable from complex C2 in electrophoretic mobility shift
assays. Finally, PU.1-specific antibodies recognized the complex C2 in
the same manner as in vitro-translated PU.1 protein (Fig. 2). Like other members of the Ets oncoprotein family, PU.1
is a transcription factor and binds to a purine-rich sequence that
contains a central core with the sequence 5`-GGAA-3`. However, only
little is known about which cellular genes are regulated by PU.1. Here,
we show that one of its roles is to regulate, probably in concert with
Oct-2 (or Oct-1), a critical event in B cell immune response, the
expression of the V19 light chain gene. The evidence is based on
the following observations. First, PU.1 recognizes the pyrimidine-rich
motif in the V19 light chain promoter and binds to this element
with high affinity (Fig. 2C). Second, a mutation of the
Py motif, which abolishes in vitro PU.1 binding, reduces
severalfold the activity of a reporter construct in transfected B cells (Fig. 5, A and B). Third, coexpression of PU.1
in HeLa cells, which lack PU.1, transactivates efficiently reporter
constructs containing the Py motif (Fig. 6, A and B).19 site but also to several such motifs present in other Ig
promoters (Fig. 7, Table 1). PU.1 expression is limited to
B cells and macrophages, and several other Ets family members, like
Ets-1, Elf-1, Elk-1, Fli-1, and Erg, are also predominantly expressed
in lymphoid
cells(48, 59, 60, 61, 62) .
It is interesting to note that two other mouse V genes, VSer
and VTNP, contain the same divergent octamer and pyrimidine-rich
elements, which are identically located as in the V19
promoter(32) . Thus, these observations suggest that PU.1 and
other Ets-related factors might indeed play a critical role in tissue-
and development-specific regulation of a number of Ig genes and provide
new insights into the function of these factors in lymphoid cells. In
support of this, a number of groups have recently shown that
Ets-related factors contribute to Ig expression. Evidence was provided
that the expression of PU.1 and Ets-1 together is sufficient to
activate the µA and µB elements of the Ig µ enhancer core
in nonlymphoid cells(63) . Similar results were reported by
Rivera et al.(64) , who have shown that Erg-3 and
Fli-1 can activate a reporter construct containing a multimer of
µE2- binding sites of the Ig µ enhancer, synergistically
with the helix-loop-helix protein E12. Furthermore, it has been shown
that PU.1 recruits the binding of a second B cell-restricted nuclear
factor to an adjacent DNA site in the Ig
3` enhancer (65, 66) and in the Ig 2-4 enhancer (67) and that this interaction is required for efficient
activity of these two enhancers. However, unlike in the Ig
3` and
the Ig 2-4 enhancer system, PU.1 binding does not appear to
assist the binding of Oct factors to the nearby octamer site in the
V
19 promoter since we were not able to detect a synergistic
binding between these factors in our assay (Fig. 4A and
data not shown). Thus, our data demonstrate that PU.1 not only has a
function in the activation of several Ig enhancers but is also likely
to be involved in the regulation of some Ig promoters. In addition, a
further important role for PU.1 in B cells was recently established in
the regulation of another B cell-specific gene, the Ig J-chain gene. In
this case, the element recognized by PU.1 is somewhat divergent from
the GGAA consensus that has generally been regarded to be the core of
the PU.1 recognition motif(68) . Finally, PU.1 has not only
been shown to be an important regulator of B cell target genes; it also
has a role in the regulation of macrophage gene expression including
the myeloid-specific CD11b and scavenger receptor
genes(69, 70) .19 pyrimidine-rich motif is ubiquitous but enriched in lymphoid
extracts (Fig. 1B). The identity of this factor is
still unclear. Southwestern experiments and UV cross-linking to a
BrdU-substituted Py probe (data not shown) have indicated that
this factor has an apparent molecular mass of 50 kDa. In addition,
competition experiments with known binding sites for Ets-1, Ets-2, or
Elf-1 (Fig. 2A) and lack of reaction of a broad
specificity anti-Ets antibody (data not shown) have shown that this
50 kDa protein appears not to be Ets-1, Ets-2, or Elf-1 but rather
to be a novel factor. However, comparison of the methylation
interference and copper-phenanthroline footprint pattern of the C1
factor with that of PU.1 revealed that both proteins were able to bind
the
Py motif in a highly similar if not identical way and that the
protein binding contacts were limited to the Py site (Fig. 3). Essential for the Py site is the GGAA motif,
which is the characteristic recognition sequence for the Ets family
members (38, 71, 72) on the opposite strand.
It has been shown that the lymphoid-specific Ets-1 factor also binds
purine-rich sequences in their inverse orientation in the stromelysin
promoter(73) , the T cell receptor enhancer(50) ,
and the GATA-1 promoter(74) . These observations suggest that
another factor of the large Ets family might correspond to the C1
complex. Potential candidates for this 50-kDa protein might be
Elk-1 (60 kDa), Fli-1 (51 kDa), and Erg (52 kDa), which correspond
roughly to the predicted size of the C1 factor and also display a more
or less lymphoid-specific expression pattern(38) .
Py motif of the V19 promoter serves as a strong binding
site for a novel lymphoid-specific nuclear factor, which they called
Y. This Py binding activity might be identical to our C1
factor, since electrophoretic mobility and cell line distribution
appear to be similar. Surprisingly, these authors did not observe PU.1
binding to the Py motif in their assay, and they also had
considerable difficulty detecting Oct-2 complexes. It is possible that
the minor V19-specific band, which they speculated to be a complex
with partially degraded Y factor, was in fact the PU.1-specific
complex. A possible reason for the difference in results might be the
different preparation of nuclear extracts.19 promoter, both sites, the divergent octamer motif,
5`-CTTTGCAT-3`, and the Py motif have a strong effect on promoter
activity. A mutation of the octamer motif that no longer binds the Oct
factors reduced the promoter activity to 20% in S194 B cells and to 45%
in HeLa cells cotransfected with PU.1 and Oct-2. A mutation of the
Py motif that abolishes its factor-binding capability reduced the
promoter activity to 27% in S194 B cells (Fig. 5, B and C) and to 20% in HeLa cells cotransfected with PU.1 and Oct-2 (Fig. 6, A and B). The mutation of the Py
motif has a more severe effect on promoter activity in HeLa cells than
the mutation of the octamer motif. Apparently, cotransfected Oct-2 and
endogenous Oct-1 do not suffice to efficiently activate transcription
from the octamer motif of the Py*/octa reporter construct in HeLa
cells, and this could reflect the absence in the transfected cells of
an additional B cell-specific factor that can interact with Oct-1 or
Oct-2 and is required for maximal octamer-dependent promoter activity.
Evidence for such a factor has been provided by previous
studies(30, 31) , which have shown that a B
cell-restricted coactivator, OCA-B, stimulates transcription from an
IgH promoter in conjunction with either Oct-1 or Oct-2. Moreover,
Atchison et al.(32) have shown that the divergent
octamer motif of the V19 promoter binds Oct factors only poorly
and that the flanking DNA sequences do not supply the additional
contacts required to produce a strong Oct factor binding. Thus, these
data demonstrate that the pyrimidine-rich element and the divergent
octamer motif are both required for optimal V19 promoter activity
and that interaction of these motifs with their cognate factors is
essential for tissue-specific expression of this gene. Moreover, no
synergism between PU.1 and Oct factors could be observed in binding
activity (Fig. 4A and data not shown), and only a weak
synergism could be detected in transactivation (Fig. 6). This
type of interaction contrasts with the proposed interplay between the
heptamer and octamer motifs in V heavy chain promoters, which appears
to involve cooperative binding of the Oct
factors(21, 52, 53) .19 promoter and is able to activate,
probably in concert with Oct-2 (or Oct-1) this promoter. Since PU.1 is
expressed in B lymphocytes, it is likely that it is at least in part
responsible for the maintenance of the cell type-specific function of
this Ig promoter. How PU.1 contributes to the stage-specific activation
of this Ig light chain gene is not clear. Northern analysis revealed
that the level of PU.1 mRNA remains constant during B cell development,
and analyses of nuclear levels of PU.1 protein showed similar
results(63, 68, 75) . The concerted action of
PU.1 and Oct-2 or Oct-1 as well as other factors acting through the
promoter and enhancer elements will be required to account for
developmental stage-specific regulation of Ig expression. In the
future, it will be interesting to determine whether PU.1 is also
involved in the regulation of other Ig promoters. Moreover, further
characterization and study of the C1 factor will be required to
determine its identity and its role in transcription of the V19
gene. Finally, it will be interesting to determine the influence of
other Ets family members on transcription of this gene.
)Py, the
pyrimidine-rich motif of the V19 promoter; Py/octa, the
pyrimidine-rich and octamer motif of the V19 promoter; SV40 PU
box, simian virus 40 purine-rich box; RL, reticulocyte lysate.
We thank E. Friedl, D. Schubart, and Dr. E. Serfling
for discussions and Drs. P. Caroni, J.-P. Jost, and Y. Nagamine for
critical reading of the manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  F. Wischnewski, O. Friese, K. Pantel, and H. Schwarzenbach Methyl-CpG Binding Domain Proteins and Their Involvement in the Regulation of the MAGE-A1, MAGE-A2, MAGE-A3, and MAGE-A12 Gene Promoters Mol. Cancer Res., July 1, 2007; 5(7): 749 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Schweitzer, K. J. Huang, M. B. Kamath, A. V. Emelyanov, B. K. Birshtein, and R. P. DeKoter Spi-C Has Opposing Effects to PU.1 on Gene Expression in Progenitor B Cells J. Immunol., August 15, 2006; 177(4): 2195 - 2207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Johnston, A. L. Wood, D. J. Bolland, and A. E. Corcoran Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region J. Immunol., April 1, 2006; 176(7): 4221 - 4234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Tantin, C. Schild-Poulter, V. Wang, R. J.G. Hache, and P. A. Sharp The Octamer Binding Transcription Factor Oct-1 Is a Stress Sensor Cancer Res., December 1, 2005; 65(23): 10750 - 10758. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. E. H. Wang, D. Tantin, J. Chen, and P. A. Sharp B cell development and immunoglobulin transcription in Oct-1-deficient mice PNAS, February 17, 2004; 101(7): 2005 - 2010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Schweitzer and R. P. DeKoter Analysis of Gene Expression and Ig Transcription in PU.1/Spi-B-Deficient Progenitor B Cell Lines J. Immunol., January 1, 2004; 172(1): 144 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Jundt, K. Kley, I. Anagnostopoulos, K. Schulze Probsting, A. Greiner, S. Mathas, C. Scheidereit, T. Wirth, H. Stein, and B. Dorken Loss of PU.1 expression is associated with defective immunoglobulin transcription in Hodgkin and Reed-Sternberg cells of classical Hodgkin disease Blood, April 15, 2002; 99(8): 3060 - 3062. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Peng and N. Jahroudi The NFY transcription factor functions as a repressor and activator of the von Willebrand factor promoter Blood, April 1, 2002; 99(7): 2408 - 2417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Tantin and P. A. Sharp Mouse Lymphoid Cell Line Selected To Have High Immunoglobulin Promoter Activity Mol. Cell. Biol., March 1, 2002; 22(5): 1460 - 1473. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bemark, A. Martensson, D. Liberg, and T. Leanderson Spi-C, a Novel Ets Protein That Is Temporally Regulated during B Lymphocyte Development J. Biol. Chem., April 9, 1999; 274(15): 10259 - 10267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Sauter and P. Matthias Coactivator OBF-1 Makes Selective Contacts with Both the POU-Specific Domain and the POU Homeodomain and Acts as a Molecular Clamp on DNA Mol. Cell. Biol., December 1, 1998; 18(12): 7397 - 7409. [Abstract] [Full Text]
|
|
|
|
|
|
M. Bemark, H. Olsson, D. Heinegard, and T. Leanderson Purification and Characterization of a Protein Binding to the SP6 kappa Promoter. A POTENTIAL ROLE FOR CArG-BOX BINDING FACTOR-A IN kappa TRANSCRIPTION J. Biol. Chem., July 24, 1998; 273(30): 18881 - 18890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Liberg, M. Sigvardsson, M. Bemark, and T. Leanderson Differentiation-Specific, Octamer-Dependent Costimulation of {kappa} Transcription J. Immunol., April 15, 1998; 160(8): 3899 - 3907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Junker, M Lamm, V Nielsen, and P Matthias Extinction of immunoglobulin gene expression in B cells upon fusion with HeLa cells is preceded by rapid nuclear depletion of essential transcription factors and is accompanied by widespread inactivation of genes expressed in a B cell-specific manner J. Cell Sci., January 10, 1997; 110(20): 2579 - 2587. [Abstract] [PDF]
|
|
|
|
|
|
S. Grigoryev, A. E. Stewart, Y. T. Kwon, S. M. Arfin, R. A. Bradshaw, N. A. Jenkins, N. G. Copeland, and A. Varshavsky A Mouse Amidase Specific for N-terminal Asparagine. THE GENE, THE ENZYME, AND THEIR FUNCTION IN THE N-END RULE PATHWAY J. Biol. Chem., November 8, 1996; 271(45): 28521 - 28532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Akbarali, P. Oettgen, J. Boltax, and T. A. Libermann ELF-1 Interacts with and Transactivates the IgH Enhancer pi Site J. Biol. Chem., October 18, 1996; 271(42): 26007 - 26012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Bastian, M. Yagi, C. Chan, and G. J. Roth Analysis of the Megakaryocyte Glycoprotein IX Promoter Identifies Positive and Negative Regulatory Domains and Functional GATA and Ets Sites J. Biol. Chem., August 2, 1996; 271(31): 18554 - 18560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-m. Chen, P. Zhang, H. S. Radomska, C. J. Hetherington, D.-E. Zhang, and D. G. Tenen Octamer Binding Factors and Their Coactivator Can Activate the Murine PU.1 (spi-1) Promoter J. Biol. Chem., June 28, 1996; 271(26): 15743 - 15752. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |