Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhen, L.
Right arrow Articles by Swank, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhen, L.
Right arrow Articles by Swank, R. T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 20, Issue of May 19, pp. 11912-11920, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The -Glucuronidase Propeptide Contains a Serpin-related Octamer Necessary for Complex Formation with Egasyn Esterase and for Retention within the Endoplasmic Reticulum (*)

Lida Zhen , Michael E. Rusiniak , Richard T. Swank (§)

From the (1) Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York 14263

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

-Glucuronidase is retained within the endoplasmic reticulum (ER) via complex formation with esterase-22 (egasyn), which in turn has a COOH-terminal HTEL ER retention sequence. To identify the regions of glucuronidase that interact with egasyn, complex formation was assayed in COS cells cotransfected with egasyn cDNA and with either deletion constructs of glucuronidase or with constructs containing specific glucuronidase propeptide sequences appended to the carboxyl terminus of a rat secretory protein 1-acid glycoprotein. The region of glucuronidase essential for complex formation is a linear octamer sequence at the COOH terminus of the propeptide. A portion of this octamer is similar to a sequence near the reactive site of serpins. This and associated data indicate that an interaction related to that between serine proteinases and their serpin inhibitors retains -glucuronidase within the ER. Further, attachment of this octamer sequence provides an alternative method of targeting proteins to the ER lumen of any cell that contains egasyn. These and related results demonstrate that complex formation with esterases/proteinases within the ER is important in the subcellular targeting and/or processing of certain proteins.


INTRODUCTION

Selective subcellular targeting of proteins implies that individual proteins bear signals that control either their forward progress to, or their retention within, discrete organelles. The endoplasmic reticulum (ER)() is the site where membrane proteins, secretory proteins, and resident ER, Golgi, and lysosomal proteins are synthesized. In a nonselective fashion, the bulk of synthesized proteins enter the secretory pathway and are targeted to their final destinations. Mechanisms by which proteins are retained within the ER lumen and prevented from entering the secretory pathway involve carboxyl-terminal KDEL-related tetrapeptide sequences (1). Receptors that recognize these targeting sequences are located in a salvage compartment or the cis-Golgi and serve to retrieve ER resident proteins to the ER (2, 3, 4, 5) .

Murine hepatic -glucuronidase is derived from a single gene but is located in two subcellular fractions; 20-50% of glucuronidase, depending upon the inbred mouse strain, is localized in the ER and the remainder in lysosomes (6, 7) . Such a large percentage of ER enzyme is unique to glucuronidase among lysosomal enzymes. ER glucuronidase does not have an intrinsic ER retention sequence. Rather, its ER location is a secondary result of association with egasyn, which is retained within the lumen of the ER (8) via an HTEL ER retention sequence (9) . The complex is present in hepatocytes, proximal tubule cells of kidney, lung, tongue, and submandibular gland. No ER glucuronidase complex has been detected in spleen, brain, heart, erythrocytes, testis, and skin (7).

While the necessity of lysosomal glucuronidase in the catabolism of a wide variety of glycosaminoglycans is dramatized by the occurrence of mucopolysaccharidosis VII in patients with glucuronidase deficiency (10), the function of ER glucuronidase has remained uncertain. However, recently Whiting and co-workers (11) have demonstrated that ER glucuronidase functions in vivo in deconjugation reactions such as the hydrolysis of bilirubin glucuronides. In vitro biochemical evidence corroborates that ER glucuronidase functions in the hydrolysis of a wide variety of endogenous and xenobiotic glucuronides (12, 13, 14, 15) . ER glucuronidase is ideally situated topologically to regulate the level of endogenous and xenobiotic substrates since it is lumenal and the active site of UDP glucuronyl transferase is on the lumenal face of the ER (16) .

The site on egasyn that complexes with the glucuronidase propeptide is unusual in that it is in fact an esterase catalytic site (17) . Egasyn is mouse esterase-22 (18, 19) . Mouse esterase-22 belongs to a group of nonspecific carboxyl esterases that likely metabolize a variety of both exogenous and endogenous compounds, including herbicides, insecticides, anesthetics, analgesics, monoglycerides, and CoA esters (20, 21) . Inhibitors and substrates of the esterase-22 catalytic site cause dissociation of the glucuronidase-egasyn complex both in vitro and in vivo, thus demonstrating that the catalytic site of egasyn is essential for complex formation.

Biochemical and immunological evidence indicate that the carboxyl-terminal propeptide of glucuronidase is involved in complex formation with egasyn (22) . Maturation of glucuronidase involves propeptide cleavage from the 75-kDa precursor to produce a 73-kDa mature form (23) . This propeptide is present on ER but not lysosomal glucuronidase, is carboxyl-terminal (24) , and probably is 18-19 amino acid residues in length (25) .

Several considerations suggest that the egasyn-glucuronidase complex is related to complexes formed between serine proteinases and their serpin inhibitors. First, serine proteinases have overlapping substrate and inhibitor specificities with carboxyl esterases, such as egasyn (26) . Second, the catalytic sites of both have an invariant serine with a three in eight match in the sequence of a consensus octapeptide (26) . Third, the glucuronidase carboxyl-terminal propeptide, which complexes with egasyn, contains sequence similarity to the reactive site of serpins (27) . Together, these studies suggest that the interaction may involve the esterase active site of egasyn and the serpin-related carboxyl-terminal propeptide of glucuronidase.

In this paper, we report direct evidence that a region including the serpin-like sequence in the glucuronidase propeptide is essential for complex formation with egasyn and ER retention of glucuronidase. These amino acids are found in a linear octamer sequence at the COOH-terminal end of the propeptide. Furthermore, the octamer sequence is sufficient for ER retention of other proteins in cells cotransfected with egasyn. It thus provides an alternative mechanism for retention of any protein within the lumen of the ER. Finally, recent reports suggest that complexes of esterases/proteinases and other proteins are commonly found within the ER (28, 29, 30) .


EXPERIMENTAL PROCEDURES

Materials

Synthetic oligonucleotides were prepared by the Bio-polymer facility at Roswell Park Cancer Institute (Buffalo, NY). Polyclonal rabbit anti-rat AGP antibody was kindly provided by Dr. H. Baumann (Roswell Park Cancer Institute). Polyclonal goat anti-mouse glucuronidase antibody was prepared as previously described (31, 32) . Fluorescein-conjugated donkey anti-goat IgG was obtained from Jackson Immuno-Research (West Grove, PA). Minimal essential medium, Met(-) and Cys(-) Dulbecco's minimal essential medium, and fetal calf serum were obtained from Life Technologies Inc. Endoglycosidase H was purchased from Boehringer Mannheim. Fast Garnet GBC salt, -naphthyl acetate, and naphthol AS-BI -D-glucuronide were from Sigma.

Construction of COOH-terminal Mutants of Mouse -Glucuronidase

Mouse Gus cDNA cloned into the XhoI site of the PJC199 vector (33) was obtained as a gift from Dr. Gordon Watson (Childrens Hospital Oakland, Oakland, CA). The Gus cDNA was recloned into the XbaI site of pUC19 in which both EcoRI and BamHI restriction sites were deleted. Therefore, a unique BamHI site at 1643 of Gus and a unique EcoRI site in the 3`-extension sequence (which was a fragment from the Bluescript vector) of Gus was used as a transplantation site.

To construct plasmids containing alterations in the COOH-terminal propeptide of glucuronidase, each polymerase chain reaction (PCR)-generated fragment, which carries a particular mutation and has a BamHI site at one end and an EcoRI site at the other end, was transplanted into the BamHI and EcoRI sites of Gus to produce a mutant form of glucuronidase cDNA. A synthetic oligonucleotide (see below) functioned as an upper primer (oligonucleotide 1), which matches Gus at residues 1617-1637. The upper primer was designed so that the PCR products included the BamHI site at position 1643 of Gus. All downstream primers (oligos 2-10) were designed to produce COOH-terminal mutants of glucuronidase. Each primer was composed of a region that matched the nucleotides before each deletion position, a stop codon, and an EcoRI site. For example, the Gus30 primer (oligonucleotide 2) matched nucleotides from 1843 to 1866 followed by a stop codon and an EcoRI site. The PCR products of Gus30 encoded a peptide with a COOH-terminal 30-mer deletion. Similarly, PCR products of Gus15 and Gus6 were produced by primers (oligos 3 and 4) encoding a peptide with COOH-terminal 15-mer and 6-mer deletions, respectively. In addition, and in like manner, PCR products of Gus (Phe Tyr, Phe Tyr, Pro Gly, Arg Ile, Phe Met, and mouse 8-mer human 7-mer) were produced by oligonucleotide primers 5-10, respectively. These PCR products were recloned into the BamHI and EcoRI sites of Gus/pUC19. These mutant glucuronidase cDNA constructs were then transferred into the XbaI site of the pCDpoly vector (34) . Oligonucleotides were as follows: 5`-CGAGTATGGAGCAGACGCAAT-3` (1) , 5`-CGAATTCTTACAAAATAAAGGCCGAAGTTTTGGG-3` (2) , 5`-CGAATTCTTAACCGTGACCTCCGGTTTCGTTGGCAAT-3` (3) , 5`-CGAATTCTTATCCGAAACACTGGGTCCTCGGCCCTGA-3` (4) , 5`-CGAATTCTTAGTACGTGAACGGTCTGCTTCCGAAACACTG-3` (5) , 5`-CGAATTCTTAGAACGTGTACGGTCTGCTTCCGAAACACTG-3` (6) , 5`-CGAATTCTTAGAACGTGAACCCTCTGCTTCCGAAACACTG-3` (7) , 5`-CGAATTCTTAGAACGTGAACGGTATGCTTCCGAAACACTG-3` (8) , 5`-CGAATTCTTAGAACGTGAACGGTCTGCTTCCCATACACTGGGTCC-3` (9) , and 5`-CGAATTCTCAAGTAAACGGGCTGTTTTCCAAACACTGGGTCCTCGGCCCTGA-3` (10) .

Addition of Glucuronidase COOH-terminal Propeptide Regions to the COOH Terminus of Rat AGP

To establish an easy and efficient system for construction of AGP mutations, a derivative of AGP called AGP-B was constructed, which contained a unique BglII site at nucleotide position 647 in the COOH terminus of the coding sequence between Glu and Asp. This resulted in a change in the COOH-terminal KKDP of AGP, which was changed to KKED, a modification that did not affect the rate of protein secretion. AGP-B was then cloned into an XbaI site on the expression vector, pCDpoly. To add regions of the glucuronidase propeptide to the COOH terminus of AGP, glucuronidase PCR products generated by mutant primers were cloned into the BglII and SstI sites of the AGP-B cDNA. Since the pCDpoly expression vector lacks both BglII and SstI sites, double-stranded DNA with these two sites at the ends can be directly linked with AGP cDNA on the expression vector by a single ligation step. A downstream primer (oligonucleotide 9, below) shared by these reactions is composed of a stretch of nucleotides, which matches 2124-2144 of the 3`-untranslated region of glucuronidase, and an SstI site. Upper primers (oligos 1-8, below), which contained a BglII site and the nucleotides encoding different COOH-terminal peptide regions (30, 15, 14, 10, 9, 8, 7, and 6 COOH-terminal amino acids, respectively) of the glucuronidase propeptide, were used in the PCR reactions to create mutant cDNAs. These mutant PCR products were then cloned into the AGP-B/pCDpoly vector to produce AGP+30, AGP+15, AGP+14, AGP+10, AGP+9, AGP+8, AGP+7, and AGP+6 constructs. The sequence of each construct was confirmed by DNA sequencing. Oligonucleotides used were as follows: 5`-CGAGATCTCCGAGAGAGATACTGGAGGATT-3` (1) , 5`-CGAGATCTCTCAGGGCCGAGGACCCAGTGT-3` (2) , 5`-CGAGATCTCGGGCCGAGGACCCAGTGTTTC-3` (3) , 5`-CGAGATCTCCAGTGTTTCGGAAGCAGACCG-3` (4) , 5`-CGAGATCTCTGTTTCGGAAGCAGACCGTTC-3` (5) , 5`-CGAGATCTCTTCGGAAGCAGACCGTTCACG-3` (6) , 5`-CGAGATCTCGGAAGCAGACCGTTCACGTTC-3` (7) , 5`-CGAGATCTCAGCAGACCGTTCACGTTCTAA-3` (8) , and 5`-CGAGCTCTGGACACCTCTCAGCAGGACA-3` (9) . Modifications to the critical glucuronidase octamer sequence were tested with constructs prepared by a synthetic complementary oligonucleotide hybridization approach. Sense and antisense oligonucleotides were synthesized to encode mutations in the octamer region. The annealed DNA strands included BglII and SstI sites, which facilitated ligation into the BglII and SstI sites of pCDAGP-B. Oligonucleotides listed under 1, 2, and 3 (below) were used to prepare constructs with deletion of serine from within the octamer (AGP+8S), addition of leucine to the COOH terminus (AGP+8+L), and deletion of threonine and phenylalanine from the COOH terminus (AGP+8TF), respectively, as follows: 1) sense, GATCTGTTCGGAAGACCGTTCACGTTCTAAAGCT; antisense, TTAGAACGTGAACGGTCTTCCGAACA; 2) sense, GATCTGTTCGGAAGCAGACCGTTCACGTTCTTGTAAAGCT; antisense, TTACAAGAACGTGAACGGTCTGCTTCCGAACA; 3) sense, GATCTGTTCGGAAGCAGACCGTTCTAAAGCT; antisense, TTAGAACGGTCTGCTTCCGAACA.

Cell Transfections

COS-1 cells were cultured with minimal essential medium supplemented with 5% fetal calf serum (Life Technologies, Inc.). The constructs were transfected into COS-1 cells by standard DEAE-dextran methods (1) . Egasyn esterase and -glucuronidase constructs were co-expressed by cotransfection of egasyn and -glucuronidase cDNA subcloned into the pCDpoly vector; transfections were carried out as previously described (35) .

Esterase and Glucuronidase Activity Assay of Transiently Expressed Constructs

48 h after transfection, cells were washed with phosphate-buffered saline and changed to serum-free minimal essential medium. Subsequently, cells and media were routinely collected at 24 h, unless otherwise indicated. Media were concentrated to the same volumes as cell extracts, and equal aliquots were analyzed in 6% non-denaturing acrylamide gels. For visualization of esterase activity, gels were incubated with -naphthyl acetate and fast blue, and for visualization of glucuronidase activity, gels were incubated with fast garnet GBC salt and naphthol AS-BI -D-glucuronide as previously described (18) .

Metabolic Labeling of Proteins with S Amino Acids and Endoglycosidase H Digestion

Metabolic labeling experiments were conducted as previously described by Skudlarek and Swank (36) , with minor modifications (9) .

Immunofluorescence Microsocopy

24 h after transfection, COS cells on coverslips were fixed, permeabilized, and treated with primary antibodies (1) . Specific antibody to mouse glucuronidase (32) was used as the first antibody. Antigens in COS cells were then visualized with fluorescein-conjugated secondary antibodies. Stained cells were photographed with an epifluorescent illumination microscope, using Kodak Ektachrome films.

RESULTS

The COOH Terminus of the Glucuronidase Propeptide Mediates Complex Formation with Egasyn Esterase

Because previous studies (18, 22) suggested that the glucuronidase propeptide is involved in complex formation with egasyn, we analyzed specific regions of the propeptide for mediation of the interaction. Complex formation of glucuronidase with egasyn was tested by cotransfecting COS cells with egasyn cDNA together with Gus cDNA constructs encoding Gus deletion mutants (a depiction of the deletion constructs is in Fig. 1A). Complex formation was visualized by specific histochemical staining of non-denaturing gels for egasyn esterase or glucuronidase activity. Complex formation is evident in the appearance of four high molecular weight bands (M bands), which are formed by interaction between the glucuronidase tetramer and 1-4 molecules of egasyn.


Figure 1: Gus and AGP constructs. A, glucuronidase COOH-terminal deletion constructs. Gus (WT), Gus 30, Gus15, and Gus6 represent wild-type glucuronidase and glucuronidase with COOH-terminal 30, 15, and 6 amino acid deletions from the propeptide, respectively. Complex formation with egasyn esterase is indicated at the right for each construct. Glucuronidase-egasyn complexes are visible as 1-4 high molecular weight M bands on non-denaturing gels stained for egasyn esterase or glucuronidase activity (Fig. 2). Regions of sequence similarity to the reactive site region of serpins are highlighted (S at residue 359 and RPFTF at residues 368-372 of 1-AT (36)). B, constructs in which native and modified COOH-terminal regions of the glucuronidase propeptide have been appended to the secretory protein AGP. The wild-type glucuronidase propeptide is represented by Gus (WT). Constructs designated AGP+6, AGP+7, AGP+8, AGP+9, AGP+10, AGP+14, AGP+15, and AGP+30 contain 6,7, 8, 9, 10, 14, 15, or 30 amino acids from the COOH terminus of the glucuronidase propeptide added to AGP. In other constructs, open and closedarrowheads indicate AGP fusion proteins with amino acid deletions or additions, respectively, to the glucuronidase propeptide. Complex formation with egasyn esterase is indicated at the right. Regions of sequence similarity to the reactive site region of serpins are highlighted (S at residue 359 and RPFTF at residues 368-372 of 1-AT(36)). C, constructs with modifications to the COOH-terminal octamer of the propeptide of intact glucuronidase. Depicted are WT glucuronidase, glucuronidase constructs with amino acid substitutions (closedarrowheads) to the propeptide, and a construct where the entire COOH-terminal octamer of mouse glucuronidase was replaced by the homologous 7 COOH-terminal amino acids of human glucuronidase (mouse 8-mer human 7-mer). Glucuronidase-egasyn complex formation is indicated at the right. The relative amount of complex formed was assayed by the number of visible M complex bands indicated by the number of plus signs. The plus sign within parentheses indicates that although no high molecular weight M complexes were observed, a significant amount of ER-associated X form glucuronidase (see Fig. 6) was observed. This in turn suggests that relatively labile M complexes were formed in vivo and were dissociated during subsequent in vitro manipulations. A region of sequence similarity to the reactive site region of serpins is highlighted (RPFTF at residues 368-372 of 1-AT (36)).



Whereas complex formation was readily visible when egasyn and wild-type glucuronidase cDNAs were cotransfected, no complex was apparent when egasyn cDNA was cotransfected with a propeptide negative construct (Gus30) in either enzyme assay (Fig. 2, A and B). As in the case of Gus30, no complexes were formed when constructs (Gus15 and Gus6) encoding smaller deletions of the COOH-terminal propeptide were cotransfected with egasyn cDNAs. In the case of Gus30, catalytically active glucuronidase molecules were not produced (Fig. 2B), so that lack of complex formation is likely a secondary result of nonfunctional or absent glucuronidase enzyme. The lack of functional enzyme in the case of Gus30 may reflect the instability of a protein product that lacks an N-linked carbohydrate chain normally found at position 22 from the COOH terminus (27) . However, functional enzyme, which did not form complexes with egasyn, was clearly formed in the case of the Gus15 and Gus6 constructs. These results indicate that the glucuronidase propeptide is necessary for complex formation and that amino acids at the extreme carboxyl terminus of the propeptide are critical in this interaction.


Figure 2: The carboxyl region of the glucuronidase propeptide is necessary for complex formation with egasyn esterase. COS cells were cotransfected with egasyn cDNA and Gus WT, Gus30, Gus15, or Gus6 constructs (see Fig. 1). After 72 h, equivalent amounts of media (M) and cell extracts (C) of these transfected cells were electrophoresed on 6% non-denaturing polyacrylamide gels, which were then stained with -naphthyl acetate and fast blue to reveal esterase activity (A) or with fast garnet GBC salt and naphthol AS-BI -D-glucuronide to reveal glucuronidase activity (B). Egasyn indicates the free form of egasyn, Gus the free form of glucuronidase, and Complex glucuronidase complexed with egasyn. Note the large amount of Gus in the medium in B. It is commonly observed (for example, see Ref. 37) that expression of lysosomal enzymes in cultured cells after transient transfection results in excess secretion, probably due to overloading of the receptor system.



Note that neither egasyn, a lumenal ER protein, nor egasyn-glucuronidase complexes were secreted from COS cells regardless of the glucuronidase cotransfected (Fig. 2, A and B). However, glucuronidase was partially secreted (Fig. 2B) since it is not entirely retained by egasyn (see below).

Glucuronidase-Egasyn Complex Formation Determines the Subcellular Localization of Glucuronidase

To verify that the complexes of egasyn with wild-type glucuronidase are retained within the ER of COS cells as in intact liver and kidney tissues, COS cells were cotransfected with various Gus and egasyn cDNA constructs, and the subcellular localization of the resulting glucuronidase product was monitored by immunofluorescent microscopy with specific antibodies (Fig. 3). Upon transfection with Gus WT cDNA alone, a predominantly lysosomal pattern was observed together with some ER and nuclear envelope staining (Fig. 3A). Cotransfection of Gus WT and egasyn cDNA yielded a markedly enhanced ER localization of glucuronidase (Fig. 3B). Principally, the lysosomal pattern appeared in cells transfected with Gus6, whether transfected alone (Fig. 3C) or together with egasyn cDNA (Fig. 3D). These results indicate that ER localization of glucuronidase in COS cells requires complex formation with egasyn. In addition, deletion of the carboxyl-terminal six amino acids of the glucuronidase propeptide did not affect targeting to the lysosome, suggesting that this region of the propeptide does not contain an essential lysosomal targeting sequence.


Figure 3: Cotransfection with egasyn directs glucuronidase to the ER in COS cells. COS cells transfected with Gus WT (A) or cotransfected with Gus WT and egasyn cDNA (B) or transfected with Gus6 (C) or cotransfected with Gus6 and egasyn cDNA (D) were grown on coverslips, fixed, permeabilized, treated with anti-Gus antibody, and then visualized with fluorescent-conjugated antibody (Epifluorescence microsopy, 2,300).



The Glucuronidase Propeptide Causes an Unrelated Secretory Protein, AGP, to Complex with Egasyn and to be Partially Retained within the ER

The serum glycoprotein rat 1-acid glycoprotein (AGP) is normally synthesized within the ER and then secreted. To test whether the glucuronidase propeptide can direct AGP to be retained within the ER by complex formation with egasyn, various constructs (Fig. 1B) of AGP, in which the carboxyl terminus of AGP was fused with various propeptide sequences of glucuronidase, were cotransfected with egasyn cDNA into COS cells. Our initial experiments focused on three constructs: AGP+30, AGP+15, and AGP+6. Complex formation was assayed by electrophoresis of cell extracts on non-denaturing gels followed by specific staining for egasyn esterase activity. Wild-type AGP protein products did not form complexes with egasyn (Fig. 4A, lane1). However, when the carboxyl-terminal 30 (Fig. 4A, lane2) or 15 (Fig. 4A, lane 3) amino acids of the glucuronidase propeptide were appended to the carboxyl terminus of AGP, the formation of esterase components with diminished electrophoretic mobility was readily apparent. That the slowly migrating esterase components represented bona fide complexes of AGP with egasyn was proven by their recognition by specific AGP antisera (Fig. 4E) and by their ready dissociation at 56 °C (data not shown), a known characteristic of the egasyn-glucuronidase complex (38) . In contrast, the carboxyl-terminal 6 amino acids of the glucuronidase propeptide were not sufficient to form complexes with egasyn (Fig. 4A, lane4). Thus, these initial experiments indicated that a peptide sequence at the COOH terminus of the glucuronidase propeptide within the 15 COOH-terminal amino acids and larger than the 6 COOH-terminal amino acids is sufficient for complex formation of other proteins with egasyn.


Figure 4: A sequence within the glucuronidase propeptide is sufficient to direct an unrelated protein, AGP, to complex with egasyn esterase. COS cells were cotransfected with egasyn and the indicated AGP constructs. Equivalent amounts of cell extracts from each transfectant were electrophoresed on 6% non-denaturing gels, and esterase activity was detected by specific histochemical staining. Egasyn indicates the free form of egasyn and Complex stands for egasyn complexed with AGP. M, medium; C, cells. The designation AGP indicates cotransfection with the control AGP construct. The remaining designations indicate cotransfection with AGP constructs modified to contain at the COOH terminus of AGP the various regions of the glucuronidase propeptide as explained in Fig. 1B. Panel A, more than 6 amino acids from the COOH terminus of the glucuronidase propeptide region are required for complex formation with egasyn. Panel B, the serine at position 15 from the COOH terminus of the glucuronidase propeptide is not required for complex formation. Panel C, an octamer sequence at the COOH terminus of the glucuronidase propeptide is required for complex formation. Panel D, the removal of serine from within the octamer, the addition of leucine to the extreme COOH terminus, or the deletion of threonine and phenylalanine from the COOH terminus results in loss of complex formation. Panel E, treatment of transfectant cell extracts with excess rabbit anti-rat AGP antibody demonstrates that the complex contains AGP. Note the absence of complex bands (anti-AGP) and the appearance of high molecular weight antigen-antibody aggregates at the very top of the gel (anti-AGP+30, +15) compared to the control case (untreated).



A relevant issue is the quantity of AGP that forms stable complexes with egasyn in cells that are cotransfected with egasyn and the AGP constructs above. To address this issue, cells were pulsed for 1 h with radiolabeled amino acids and chased for 24 h in unlabeled media. Under these conditions 40% of labeled immunoprecipitable AGP+30 and AGP+15 protein products remained intracellular (Fig. 5) as determined by densitometry of autoradiograms while wild-type AGP was secreted (not shown). This intracellular material was bound to egasyn since very little intracellular AGP was detected in cells that were transfected by the same AGP constructs in the absence of egasyn. Also, the intracellular AGP components in cells cotransfected with egasyn were located within the ER since they were sensitive to digestion with endo--N-acetylglucosaminidase H (data not shown). As expected from the above results, no significant intracellular AGP was detected in cells transfected with AGP+6, whether or not the cells were cotransfected with egasyn. Therefore, an unrelated secretory protein, modified to contain the glucuronidase propeptide, is relatively stable within the ER as a result of complex formation with egasyn.


Figure 5: AGP is stably retained within the ER by complexing with egasyn. Cells expressing AGP, AGP+15, or AGP+30 constructs either alone (-) or together with the egasyn (Egasyn) construct were pulsed with radiolabeled amino acids for 1 h and chased in unlabeled media for 24 h. AGP proteins were immunoprecipitated with anti-AGP antibody and electrophoresed on 12% acrylamide gels. M and C represent medium and cell extracts, respectively; molecular weight markers are to the right. 1 and 2 (left) show complex (45 kDa) and high mannose (37 kDa) forms of AGP, respectively. Endoglycosidase H sensitivity was observed for 2 but not 1 (data not shown).



Amino Acid Residues of the Glucuronidase Propeptide Critical for Complex Formation between Egasyn Esterase and AGP

We further probed the glucuronidase propeptide to identify the minimum amino acid sequence sufficient for complex formation with egasyn. A series of constructs including the glucuronidase carboxyl-terminal 14, 10, 9, 8, or 7 amino acids appended to the COOH terminus of AGP were co-expressed with egasyn esterase in COS cells (see Fig. 1B). Complex formation was indicated by the appearance of esterase bands of reduced mobility on non-denaturing gels (Fig. 4). Fig. 4B reveals that the serine residue at position 15 from the COOH terminus, which may be aligned with the active site serine at the active center of the serpins (27) , is not required for complex formation. Further, the carboxyl-terminal 8 amino acid residues 641 to 648 of the propeptide clearly represent the minimal sequence sufficient for complex formation (Fig. 4C). This octamer region includes the serpin-like RPFTF sequence.

Sequence specificity, within the critical octamer region, for complex formation between the AGP-propeptide fusion proteins and egasyn was examined. AGP+15F and AGP+8TF represent two constructs with either phenylalanine or threonine and phenylalanine, respectively, deleted from the COOH-terminal end of the propeptide (Fig. 1B). AGP+8S designates a construct wherein the serine at C-6 is deleted (Fig. 1B). AGP+8+L was designed to test the importance of the extreme COOH-terminal location of the peptide sequence (Fig. 1B). When assayed for egasyn complex formation, none of these gene products complexed with egasyn (Fig. 4D, data not shown for AGP+15F). That addition of leucine at the extreme COOH terminus abolished complex formation demonstrates the critical nature of the COOH-terminal context of the octamer.

Complex Formation between Glucuronidase and Egasyn Requires a Highly Specific Octamer Sequence

Additional constructs were designed to address the question of how specific amino acids within the COOH-terminal octamer sequence of glucuronidase affect complex formation with egasyn. Because the complexes of glucuronidase with egasyn form discrete components that can readily be separated and analyzed qualitatively and quantitatively on non-denaturing gels, amino acid alterations were introduced directly into the propeptide of the intact glucuronidase molecule, rather than fusing an altered octamer to another protein. A series of six glucuronidase mutants were co-expressed with egasyn cDNA in COS cells (Fig. 1C). Complex formation was assayed on non-denaturing gels stained for glucuronidase activity (Fig. 6). In a companion gel, egasyn esterase activity was measured (data not shown). Both stains yielded similar results in terms of the mobility of complex bands. Extracts from mock transfected cells showed negligible staining compared with transfected cells (not shown).


Figure 6: Effects of modifications of the glucuronidase propeptide octamer signal sequence on egasyn-glucuronidase complex formation. COS cells were cotransfected with an egasyn cDNA construct and one of a series of Gus cDNA constructs with substitutions in the COOH-terminal octamer propeptide region (lanes1-8) or were transfected with a glucuronidase wild-type cDNA construct alone (lane9). Resulting extracts were electrophoresed on non-denaturing acrylamide gels, which were stained for glucuronidase activity. Constructs (see Fig. 1C) are indicated above each lane. Complex formation is apparent as more slowly migrating bands M, M, M, and M, which contain 1, 2, 3, and 4 molecules of egasyn, respectively, bound to the glucuronidase tetramer. BandX is precursor ER glucuronidase tetramer, and bandL is mature lysosomal glucuronidase tetramer.



Changing carboxyl-terminal (C-1) phenylalanine to tyrosine resulted in a decrease in efficiency of complex formation (Fig. 6, lane1 compared with lane7 (Gus WT control)). This confirms the importance of the terminal phenylalanine observed with AGP-propeptide constructs (Fig. 4D). Compared with the Gus WT control, no high molecular weight complexes of glucuronidase and egasyn were observed. Rather, the predominant glucuronidase form corresponded to an ER-associated or ``X'' form. The X form of the enzyme represents precursor glucuronidase containing the propeptide, whereas the faster migrating L, or lysosomal form, denotes mature lysosomal enzyme from which the propeptide has been cleaved. Note, however, that the ratio of X to L form glucuronidase is considerably greater than that of cells in which glucuronidase was transfected in the absence of egasyn (lane9). Therefore, despite the absence of high molecular weight complexes visible as M bands between glucuronidase and egasyn, retention of glucuronidase within the ER through association with egasyn had apparently occurred. A probable explanation for the absence of M bands is that these complexes are relatively labile and dissociated during processing of cell extracts for electrophoresis.

Replacing the other phenylalanine at position 3 (C-3) from the COOH terminus of the octamer with tyrosine gave a significant amount of complex formation. However, these complexes contained just one or two egasyn molecules rather than the full range of one to four egasyn molecules observed in the control case (Fig. 6, lane2 compared with Gus WT control, lane7). When proline at C-4 was replaced by glycine, stable complex formation was lost entirely (Fig. 6, lane3). This result may relate to the significant effects of proline on the folding of a polypeptide chain. Again, however, there had apparently been ER association with egasyn since the ratio of X to L form was far greater than that of cells transfected only with glucuronidase. Substitution of the basic arginine at C-5 by a neutral isoleucine residue caused a slightly decreased efficiency of complex formation (Fig. 6, lane4) in that glucuronidase molecules containing 1, 2, and 3 but not 4 attached egasyn molecules were apparent.

A distinction between the rat and mouse glucuronidase propeptide carboxyl termini is the presence of methionine rather than phenylalanine at C-8 (27) . Replacement of phenylalanine with methionine yielded an intermediate efficiency of complex formation with complexes containing 1 and 2 egasyn molecules visible (Fig. 6, lane5). Therefore, the in vitro experiment predicts that in vivo, rat glucuronidase will interact with mouse egasyn.

The octamer sequence in the human glucuronidase propeptide differs from that of the mouse in that the COOH-terminal phenylalanine is deleted (27). Also, amino acid substitutions are present at residues 4-7 from the carboxyl terminus (see Fig. 1C). A mouse glucuronidase cDNA construct was prepared with the 8 COOH-terminal amino acid residues replaced by the 7 residues of the human Gus COOH terminus. No complex formation was apparent when this fusion protein was expressed with mouse egasyn cDNA, demonstrating species specificity for the glucuronidase propeptide-mouse egasyn interaction (Fig. 6, lane6).

DISCUSSION

The Glucuronidase Propeptide Contains Sequence Information Necessary and Sufficient for Complex Formation with Egasyn and ER Retention of Unrelated Secretory Proteins

In this report, we demonstrate that an octamer sequence at the COOH terminus of the glucuronidase propeptide with sequence similarity to a region near the reactive site of serpins contains information that is both necessary and sufficient for complex formation with egasyn. This complex formation in turn leads to retention of a significant proportion of glucuronidase within a specific subcellular organelle, the ER. The glucuronidase-egasyn system therefore utilizes an unusual mechanism for ER retention of a protein. A serpin-like sequence on one protein serves to bind it to the esterase catalytic site of a second protein, which in turn contains an intrinsic ER retention signal. Furthermore, attachment of the octamer sequence to COOH termini provides a general method of targeting proteins to the ER lumen of cells that contain egasyn.

Deletional analysis demonstrated that the six carboxyl-terminal amino acids of the propeptide are necessary for the association of proglucuronidase with egasyn. When appended to rat AGP, eight contiguous amino acids from the carboxyl terminus of the propeptide allowed AGP, which is naturally secreted, to form a complex with mouse egasyn within the ER. Modification of the octamer sequence at several positions diminishes complex formation. Supporting evidence for the importance of the octamer sequence occurs in the case of the naturally occurring W26 mouse, which contains a Gly Arg substitution at amino acid position 7 from the COOH terminus of proglucuronidase, reducing its ability to form complexes with egasyn (27) . Also, a synthetic 30-mer peptide, which includes the octamer sequence, is a specific and potent inhibitor of the same egasyn esterase active site that forms complexes with glucuronidase (22) . Taken together, these results establish that the critical information for complex formation is in a serpin-related octamer sequence at the extreme COOH terminus of the glucuronidase propeptide. The remaining structure (i.e. other than the propeptide) of glucuronidase is not necessary for complex formation with egasyn.

Complex formation between egasyn and the glucuronidase propeptide is less efficient than that between KDEL-tailed (or HTEL-tailed) proteins and their receptors. For example, approximately half of the glucuronidase of hepatocytes continues to the lysosome rather than remaining within the ER, despite a 10-fold molar excess of egasyn over glucuronidase within the ER (6) . Likewise, only 40% of AGP, to which the glucuronidase propeptide had been appended, was retained within the ER by binding to egasyn over a 24-h period (Fig. 5). In contrast, greater than 98% of AGP-HTEL and AGP-KDEL fusion proteins were retained in the ER of transfected COS cells (9) . It is, in fact, a significant advantage that the ER retention system for glucuronidase is leaky since efficient retention of glucuronidase within the ER would likely result in lysosomal storage disease.

There are several possible explanations for the leaky nature of the ER retention system for glucuronidase. One possibility is that competition between the binding of glucuronidase to egasyn and to mannose-6-phosphate (Man-6-P) receptors regulates the subcellular distribution of glucuronidase. Hepatic ER glucuronidase bound to egasyn contains covered Man-6-P residues, which become uncovered in the Golgi to expose the Man-6-P recognition marker (39) . In most cell types, Man-6-P receptors are concentrated in the trans-Golgi network, but they may also be localized earlier in the cis-Golgi (40) . In the latter case, they might compete with egasyn for binding to glucuronidase and thereby direct a portion of glucuronidase to lysosomes. Another possibility is that in the salvage compartment, where HTEL (KDEL)-tailed proteins efficiently complex with receptors, ion concentrations or pH may not be optimal for complexation between egasyn and glucuronidase, resulting in some dissociation of the complex (41) . This possibility is reinforced by the finding that the glucuronidase-egasyn complex is not stable when it is allowed to traverse the secretory pathway (by removing the HTEL ER retention signal from egasyn) (9) . The most likely possibility is that the glucuronidase-egasyn complex intrinsically has a relatively high dissociation constant. This is supported by the fact that there are relatively few M complexes, in which all four subunits of the glucuronidase tetramer are occupied by egasyn, even in the presence of a 10-fold molar excess of egasyn (18) . Also, the complex is relatively labile in vitro. Mild treatments such as heating at relatively low temperatures or, in the case of the rat complex, treating with mild nonionic detergents (18) cause significant complex dissociation.

Sequence Specificity for Complex Formation within the COOH-terminal Octamer

The terminal phenylalanine residue and the proline at C-4 of the glucuronidase propeptide are critical to complex formation; no association of glucuronidase with egasyn was apparent when these residues were replaced by tyrosine and glycine, respectively. Nevertheless, in each of these cases, significant egasyn-dependent retention of glucuronidase within the ER occurred. The most likely explanation for these observations is that substitution of these residues resulted in a complex that is sufficiently stable to retain glucuronidase within the ER but is not stable to the in vitro conditions of tissue homogenization and electrophoresis of cellular extracts. Reduced efficiency of complex formation was evident when phenylalanine at C-3 was replaced with tyrosine, the basic arginine at C-5 was replaced by neutral isoleucine, or when phenylalanine at C-8 was replaced by methionine. These data demonstrate that critical residues within the octamer sequence confer specific information in terms of its association with egasyn and ER localization.

Although mouse egasyn interacts efficiently with the propeptide of rat glucuronidase, it does not associate with the corresponding human propeptide. The interpretation of the lack of complex formation between mouse egasyn and the glucuronidase construct containing the human glucuronidase propeptide (Fig. 6) is not clear. One explanation is that the interaction is species restricted. Our work (35) demonstrated in fact that the signal for association of egasyn with glucuronidase is species restricted. Nevertheless, a critical test for interaction of the human glucuronidase propeptide and egasyn is not possible at this time since the human equivalent of egasyn has not yet been identified. Recently, Islam and co-workers (25) have determined that the propeptide of human glucuronidase influences catalytic activity, secretion, and phosphorylation of human glucuronidase. It remains uncertain whether a complex between egasyn and the glucuronidase propeptide occurs in human tissues (7) .

Comparison with Serpin-Serine Proteinase Complexes

Two regions of the glucuronidase propeptide are similar in sequence to portions of the conserved sequences within or near the reactive site region of members of the serpin superfamily (27). These experiments (Fig. 4B) clearly indicate that the serine residue at the P1`-position of the reactive site (42) , which plays a critical role in serpin inhibition, is not essential for complex formation between glucuronidase and egasyn.

The second region of sequence similarity of the glucuronidase propeptide to members of the serpin superfamily is the RPFTF sequence found at the COOH terminus of the propeptide. This sequence is similar to the RPFXF sequence found to the P`-side of the reactive site of most serpins (residues 368-372 of the prototypical serpin -1-antitrypsin (1-AT) (42) ). These experiments clearly indicate that this sequence is critical for interaction of glucuronidase with the esterase active site of egasyn. While this or a closely related sequence is found in most serpins, its functional and structural roles, unfortunately, are uncertain (43, 44, 45) .

A portion of the same RPFXF sequence of serpins participates in the recognition of serpin-serine proteinase complexes by a cell surface receptor found on HepG2 cells. A hepatocyte cell surface receptor, the serpin enzyme complex receptor, recognizes the pentapeptide FVFLM at residues 370-374 of 1-AT in the 1-AT-elastase complex. Binding of receptor to the pentapeptide mediates degradation of the complex (46) and increased synthesis of 1-AT. This pentapeptide FVFLM sequence overlaps the RPFTF sequence (residues 644-648 (33) ) of the glucuronidase propeptide and has an additional LM dipeptide. Unlike the COOH-terminal octamer sequence of -glucuronidase, the FVFLM sequence is internal in 1-AT.

Complexes of Proteinases/Esterases with Other Proteins within the ER Lumen

C-reactive protein is retained within the lumen of the ER of unstimulated hepatocytes, similarly to glucuronidase, by formation of complexes with two ER carboxyl-esterases (47, 48) . C-reactive protein is synthesized in hepatocytes and is secreted into plasma during the acute phase response due to a markedly reduced binding capacity of the ER esterases. Amino-terminal sequence analysis has identified the esterases as rabbit ER esterases 1 and 2, which, like egasyn esterase, contain the COOH-terminal ER retention signal HXEL (49, 50) . In contrast to the interaction between -glucuronidase and egasyn, which is blocked by esterase active site inhibitors, the binding of C-reactive protein is independent of the active sites of the esterases.

Additional examples of complexes between proteinases/esterases and other ER proteins have been described. Protective protein, a serine carboxypeptidase, and -galactosidase associate early in the biosynthetic pathway in the rough ER (29) . In this case, the active site of the carboxypeptidase is not required for complex formation, and the complex is not retained within the ER. Rather, the complex of lysosomal protective protein and -galactosidase is transported to the lysosome where protective protein stabilizes the mature -galactosidase and N-acetyl--neuraminidase enzymes.

A third example of an interaction between a proteinase and an accessory protein within the ER lumen is that of procathepsin D and prosaposin (30) . A mannose-6-phosphate independent association between procathepsin D and prosaposin begins as a soluble complex in the ER and continues during transport through the Golgi. The complex becomes membrane associated in the Golgi apparatus and is transported to the lysosome. In the lysosome, procathepsin D is processed to a mature form, and membrane association and binding between the two proteins are lost.

Finally it is of interest that another ER lumenal protein, chick s-cyclophilin, has sequence similarity at its COOH terminus to the reactive site region of serpins and to the glucuronidase COOH terminus. Its COOH-terminal 10 amino acids, VEKPFAIAKE, localize this cyclophilin within the ER lumen and, when appended at the COOH terminus, are sufficient to cause retention of an unrelated secretory protein within the ER (51) . The internal KPF sequence is similar to the KPF (residues 368-370 (52) and RPF (residues 644-646 (33) ) sequences near and at the carboxyl termini of 1-AT and -glucuronidase, respectively. It will be of interest to determine whether s-cyclophilin, like glucuronidase, is retained within the ER by binding to an esterase/proteinase that recognizes the KPF sequence.

In summary, our findings establish that a linear octamer sequence at the COOH terminus of the glucuronidase propeptide is essential for complex formation between glucuronidase and egasyn. A general method for targeting proteins to the lumen of the ER of cells containing egasyn is to append this glucuronidase propeptide octamer sequence to their COOH terminus. The mechanism by which the octamer retains proteins within the ER is related to the mechanism by which serine proteinases complex with serpins. Whatever the precise mechanism regulating the leaky nature of the ER retention system for glucuronidase, it allows translocation of sufficient enzyme to the lysosome, thereby averting another lysosomal storage disease. The propeptide-esterase retention system may represent a generalized mechanism, whereby an accessory esterase/proteinase serves a role in the subcellular localization/processing of another protein.


FOOTNOTES

*
This work was supported by Public Health Service Grant GM33559. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: the Dept. of Molecular and Cellular Biology, Roswell Park Cancer Institute, Elm and Carlton Sts., Buffalo, NY 14263.

The abbreviations used are: ER, endoplasmic reticulum; Gus, glucuronidase; Man-6-P, mannose-6-phosphate; AGP, 1-acid glycoprotein; 1-AT, 1-antitrypsin; WT, wild type; PCR, polymerase chain reaction; M bands, high molecular weight bands.


ACKNOWLEDGEMENTS

We thank Dr. Edward K. Novak for advice and Shelley Y. Jiang and Lijie Zhen for expert technical assistance. We also thank Dr. Heinz Baumann for generously supplying antiserum to rat AGP, Dr. Steven Pruitt for providing the pCDpoly expression vector, and Dr. Gordon Watson for the gift of mouse Gus cDNA clone. We are indebted to Mary Ketcham and Cheryl Mrowczynski for excellent secretarial assistance.


REFERENCES
  1. Munro, S., and Pelham, H. R. B.(1987) Cell 48, 899-907 [CrossRef][Medline] [Order article via Infotrieve]
  2. Lewis, M. J., and Pelham, H. R. B.(1990) Nature 348, 162-163 [CrossRef][Medline] [Order article via Infotrieve]
  3. Lewis, M. J., and Pelham, H. R. B.(1992) J. Mol. Biol. 226, 913-916 [CrossRef][Medline] [Order article via Infotrieve]
  4. Hsu, V. W., Shah, N., and Klausner, R. D.(1992) Cell 69, 625-635 [CrossRef][Medline] [Order article via Infotrieve]
  5. Tang, B. L., Wong, S. H., Qi, X. L., Low, S. H., and Hong, W.(1993) J. Cell Biol. 120, 325-338 [Abstract/Free Full Text]
  6. Lusis, A. J., and Paigen, K.(1977) in Current Topics in Biological and Medical Research. (Rattazzi, M. C., Scandalios, J. G., and Whitt, G. S., eds) pp. 63-106, Alan R. Liss, New York
  7. Swank, R. T., Novak, E. K., and Zhen, L.(1994) in Handbook of Experimental Pharmacology (Kauffman, F. C., ed) pp. 131-160, Springer-Verlag, Berlin
  8. Brown, J. A., Novak, E. K., Takeuchi, K., Moore, K., Medda, S., and Swank R. T.(1987) J. Cell Biol. 105, 1571-1578 [Abstract/Free Full Text]
  9. Zhen, L., Baumann, H., Novak, E. K., and Swank, R. T.(1993) Arch. Biochem. Biophys. 304, 402-404 [CrossRef][Medline] [Order article via Infotrieve]
  10. Neufeld, E. F., and Moenzer, J.(1989) in The Metabolic Basis of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) pp. 1565-1587, McGraw-Hill Inc., New York
  11. Whiting, J. F., Narciso, J. P., Chapman, V., Ransil, B. J., Swank, R. T., and Gollan, J. L.(1993) J. Biol. Chem. 268, 23197-23201 [Abstract/Free Full Text]
  12. Brunelle, F. M., and Verbeeck, R. K.(1993) Biochem. Pharmacol. 46, 1953-1958 [CrossRef][Medline] [Order article via Infotrieve]
  13. Belinsky, S. A., Kauffman, F. C., Sokolove, P. M., Tsukuda, T., and Thurman, R. G.(1984) J. Biol. Chem. 259, 7705-7711 [Abstract/Free Full Text]
  14. Sokolove, P. M., Wilcox, M. A., Thurman, R. G., and Kauffman, F. C. (1984) Biochem. Biophys. Res. Commun. 121, 987-993 [CrossRef][Medline] [Order article via Infotrieve]
  15. Whittaker, M., Sokolove, P. M., Thurman, R. G., and Kauffman, F. C. (1985) Cancer Lett. 26, 145-152 [CrossRef][Medline] [Order article via Infotrieve]
  16. Vanstapel, F., and Blanckaert, N.(1988) Arch. Biochem. Biophys. 263, 216-225 [CrossRef][Medline] [Order article via Infotrieve]
  17. Medda, S., Stevens, A. M., and Swank, R. T.(1987) Cell 50, 301-310 [CrossRef][Medline] [Order article via Infotrieve]
  18. Medda, S., and Swank, R. T.(1985) J. Biol. Chem. 260, 15802-15808 [Abstract/Free Full Text]
  19. Medda, S., von Deimling, O. V., and Swank, R. T.(1986) Biochem. Genet. 24, 229-243 [CrossRef][Medline] [Order article via Infotrieve]
  20. Heymann, E.(1980) in Enzymatic Basis of Detoxification (Jakoby, W. B., ed) pp. 291-323, Academis Press, New York
  21. Mentlein, R., Suttorp, M., and Heymann, E.(1984) Arch. Biochem. Biophys. 228, 230-246 [CrossRef][Medline] [Order article via Infotrieve]
  22. Medda, S., Chemelli, R. M., Martin, J. L., Pohl, L. R., and Swank, R. T.(1989) J. Biol. Chem. 264, 15824-15828 [Abstract/Free Full Text]
  23. Brown, J. A., and Swank, R. T.(1983) J. Biol. Chem. 258, 15323-15328 [Abstract/Free Full Text]
  24. Erickson, A. H., and Blobel, G.(1983) Biochemistry 22, 5201-5205 [CrossRef][Medline] [Order article via Infotrieve]
  25. Islam, M. R., Grubb, J. H., and Sly, W. S.(1993) J. Biol. Chem. 268, 22627-22633 [Abstract/Free Full Text]
  26. Myers, M., Richmond, R. C., and Oakeshott, J. G.(1988) Mol. Biol. Evol. 5, 113-119 [Abstract]
  27. Li, H., Takeuchi, K. H., Manly, K., Chapman, V., and Swank, R. T. (1990) J. Biol. Chem. 265, 14732-14735 [Abstract/Free Full Text]
  28. Macintyre, S. S., and Kalonek, P. A.(1992) Mol. Biol. Cell 3, (suppl.) 120
  29. Morreau, H., Galjart, N. J., Willemsen, R., Gillemans, N., Zhou, X. Y., and d' Azzo, A.(1992) J. Biol. Chem. 267, 17949-17956 [Abstract/Free Full Text]
  30. Zhu, Y., and Conner, G.(1994) J. Biol. Chem. 269, 3846-3851 [Abstract/Free Full Text]
  31. Tomino, S., and Paigen, K.(1975) J. Biol. Chem. 250, 1146-1148 [Abstract/Free Full Text]
  32. Skudlarek, M. D., and Swank, R. T.(1979) J. Biol. Chem. 254, 9939-9942 [Abstract/Free Full Text]
  33. Gallagher, P. M., D'Amore, M. A., Lund, S. D., and Ganschow, R. E. (1988) Genomics 2, 215-219 [CrossRef][Medline] [Order article via Infotrieve]
  34. Pruitt, S. C.(1988) Gene (Amst.) 66, 121-134 [CrossRef][Medline] [Order article via Infotrieve]
  35. Novak, E. K., Baumann, H., Ovnic, M., and Swank, R. T.(1991) J. Biol. Chem. 266, 6377-6380 [Abstract/Free Full Text]
  36. Skudlarek, M. D., and Swank, R. T.(1981) J. Biol. Chem. 256, 10137-10144 [Free Full Text]
  37. Weitz, G., and Proia, R. L.(1992) J. Biol. Chem. 267, 10039-10044 [Abstract/Free Full Text]
  38. Lusis, A. J., Tomino, S., and Paigen, K.(1976) J. Biol. Chem. 251, 7753-7760 [Abstract/Free Full Text]
  39. Gabel, C. A., Goldberg, D. E., and Kornfeld, S.(1982) J. Cell Biol. 95, 536-542 [Abstract/Free Full Text]
  40. Kornfeld, S.(1992) Annu. Rev. Biochem. 61, 307-330 [CrossRef][Medline] [Order article via Infotrieve]
  41. Pelham, H. R. B.(1991) Curr. Opin. Cell Biol. 3, 589-591
  42. Shieh, B-H., and Travis, J.(1987) J. Biol. Chem. 262, 6055-6059 [Abstract/Free Full Text]
  43. Patston, P. A., and Gettins, P. G. W.(1994) Thromb. Haemostasis 72, 166-179 [Medline] [Order article via Infotrieve]
  44. Wei, A., Rubin, H., Cooperman, B. S., and Christianson, D. W.(1994) Nat. Struct. Biol. 1, 251-258 [CrossRef][Medline] [Order article via Infotrieve]
  45. Schreuder, H. A., de Boer, B., Dijkema, R., Mulders, J., Theunissen, H. J. M., Grootenhuis, P. D. J., and Hol, W. G. J.(1994) Nat. Struct. Biol. 1, 48-54 [CrossRef][Medline] [Order article via Infotrieve]
  46. Joslin, G., Fallon, R. J., Bullock, J., Adams, S. P., and Perlmutter, D. H.(1991) J. Biol. Chem. 266, 11282-11288 [Abstract/Free Full Text]
  47. Macintyre, S. S.(1992) J. Cell Biol. 118, 253-266 [Abstract/Free Full Text]
  48. Macintyre, S., Samols, D., and Dailey, P.(1994) J. Biol. Chem. 269, 24496-24503 [Abstract/Free Full Text]
  49. Korza, G., and Ozols, J.(1988) J. Biol. Chem. 263, 3486-3495 [Abstract/Free Full Text]
  50. Ozols, J.(1989) J. Biol. Chem. 264, 12533-12545 [Abstract/Free Full Text]
  51. Arber, S., Krause, K. H., and Caroni, P.(1992) J. Cell Biol. 116, 113-125 [Abstract/Free Full Text]
  52. Colau, B., Chucana, P., and Bollen, A.(1984) DNA 3, 327-330 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
F. S. Heinemann, G. Korza, and J. Ozols
A Plasminogen-like Protein Selectively Degrades Stearoyl-CoA Desaturase in Liver Microsomes
J. Biol. Chem., October 31, 2003; 278(44): 42966 - 42975.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
M. Xie, D. Yang, M. Wu, B. Xue, and B. Yan
Mouse Liver and Kidney Carboxylesterase (M-LK) Rapidly Hydrolyzes Antitumor Prodrug Irinotecan and the N-Terminal Three Quarter Sequence Determines Substrate Selectivity
Drug Metab. Dispos., January 1, 2003; 31(1): 21 - 27.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Monnat, E. M. Neuhaus, M. S. Pop, D. M. Ferrari, B. Kramer, and T. Soldati
Identification of a Novel Saturable Endoplasmic Reticulum Localization Mechanism Mediated by the C-Terminus of a Dictyostelium Protein Disulfide Isomerase
Mol. Biol. Cell, October 1, 2000; 11(10): 3469 - 3484.
[Abstract] [Full Text]


Home page
ScienceHome page
L. Ellgaard, M. Molinari, and A. Helenius
Setting the Standards: Quality Control in the Secretory Pathway
Science, December 3, 1999; 286(5446): 1882 - 1888.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
J. Greenfield and S High
The Sec61 complex is located in both the ER and the ER-Golgi intermediate compartment
J. Cell Sci., January 5, 1999; 112(10): 1477 - 1486.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Schiller, R. E. Mains, and B. A. Eipper
A Neuroendocrine-specific Protein Localized to the Endoplasmic Reticulum by Distal Degradation
J. Biol. Chem., November 3, 1995; 270(44): 26129 - 26138.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhen, L.
Right arrow Articles by Swank, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhen, L.
Right arrow Articles by Swank, R. T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement