|
Volume 270,
Number 20,
Issue of May 19, pp. 11912-11920, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The
-Glucuronidase Propeptide Contains a Serpin-related Octamer
Necessary for Complex Formation with Egasyn Esterase and for Retention
within the Endoplasmic Reticulum (*)
Lida
Zhen
,
Michael
E.
Rusiniak
,
Richard T.
Swank (§)
From the
(1)
Department of Molecular and Cellular Biology, Roswell
Park Cancer Institute, Buffalo, New York 14263
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
-Glucuronidase is retained within the endoplasmic reticulum
(ER) via complex formation with esterase-22 (egasyn), which in turn has
a COOH-terminal HTEL ER retention sequence. To identify the regions of
glucuronidase that interact with egasyn, complex formation was assayed
in COS cells cotransfected with egasyn cDNA and with either deletion
constructs of glucuronidase or with constructs containing specific
glucuronidase propeptide sequences appended to the carboxyl terminus of
a rat secretory protein 1-acid glycoprotein. The region of
glucuronidase essential for complex formation is a linear octamer
sequence at the COOH terminus of the propeptide. A portion of this
octamer is similar to a sequence near the reactive site of serpins.
This and associated data indicate that an interaction related to that
between serine proteinases and their serpin inhibitors retains
-glucuronidase within the ER. Further, attachment of this octamer
sequence provides an alternative method of targeting proteins to the ER
lumen of any cell that contains egasyn. These and related results
demonstrate that complex formation with esterases/proteinases within
the ER is important in the subcellular targeting and/or processing of
certain proteins.
INTRODUCTION
Selective subcellular targeting of proteins implies that
individual proteins bear signals that control either their forward
progress to, or their retention within, discrete organelles. The
endoplasmic reticulum (ER) ( )
is the site where
membrane proteins, secretory proteins, and resident ER, Golgi, and
lysosomal proteins are synthesized. In a nonselective fashion, the bulk
of synthesized proteins enter the secretory pathway and are targeted to
their final destinations. Mechanisms by which proteins are retained
within the ER lumen and prevented from entering the secretory pathway
involve carboxyl-terminal KDEL-related tetrapeptide sequences (1).
Receptors that recognize these targeting sequences are located in a
salvage compartment or the cis-Golgi and serve to retrieve ER resident
proteins to the ER
(2, 3, 4, 5) .
Murine hepatic -glucuronidase is derived from a single gene but
is located in two subcellular fractions; 20-50% of glucuronidase,
depending upon the inbred mouse strain, is localized in the ER and the
remainder in lysosomes
(6, 7) . Such a large percentage
of ER enzyme is unique to glucuronidase among lysosomal enzymes. ER
glucuronidase does not have an intrinsic ER retention sequence. Rather,
its ER location is a secondary result of association with egasyn, which
is retained within the lumen of the ER
(8) via an HTEL ER
retention sequence
(9) . The complex is present in hepatocytes,
proximal tubule cells of kidney, lung, tongue, and submandibular gland.
No ER glucuronidase complex has been detected in spleen, brain, heart,
erythrocytes, testis, and skin (7).
While the necessity of lysosomal
glucuronidase in the catabolism of a wide variety of glycosaminoglycans
is dramatized by the occurrence of mucopolysaccharidosis VII in
patients with glucuronidase deficiency (10), the function of ER
glucuronidase has remained uncertain. However, recently Whiting and
co-workers
(11) have demonstrated that ER glucuronidase
functions in vivo in deconjugation reactions such as the
hydrolysis of bilirubin glucuronides. In vitro biochemical
evidence corroborates that ER glucuronidase functions in the hydrolysis
of a wide variety of endogenous and xenobiotic
glucuronides
(12, 13, 14, 15) . ER
glucuronidase is ideally situated topologically to regulate the level
of endogenous and xenobiotic substrates since it is lumenal and the
active site of UDP glucuronyl transferase is on the lumenal face of the
ER
(16) .
The site on egasyn that complexes with the
glucuronidase propeptide is unusual in that it is in fact an esterase
catalytic site
(17) . Egasyn is mouse
esterase-22
(18, 19) . Mouse esterase-22 belongs to a
group of nonspecific carboxyl esterases that likely metabolize a
variety of both exogenous and endogenous compounds, including
herbicides, insecticides, anesthetics, analgesics, monoglycerides, and
CoA esters
(20, 21) . Inhibitors and substrates of the
esterase-22 catalytic site cause dissociation of the
glucuronidase-egasyn complex both in vitro and in
vivo, thus demonstrating that the catalytic site of egasyn is
essential for complex formation.
Biochemical and immunological
evidence indicate that the carboxyl-terminal propeptide of
glucuronidase is involved in complex formation with egasyn
(22) .
Maturation of glucuronidase involves propeptide cleavage from the
75-kDa precursor to produce a 73-kDa mature form
(23) . This
propeptide is present on ER but not lysosomal glucuronidase, is
carboxyl-terminal
(24) , and probably is 18-19 amino acid
residues in length
(25) .
Several considerations suggest that
the egasyn-glucuronidase complex is related to complexes formed between
serine proteinases and their serpin inhibitors. First, serine
proteinases have overlapping substrate and inhibitor specificities with
carboxyl esterases, such as egasyn
(26) . Second, the catalytic
sites of both have an invariant serine with a three in eight match in
the sequence of a consensus octapeptide
(26) . Third, the
glucuronidase carboxyl-terminal propeptide, which complexes with
egasyn, contains sequence similarity to the reactive site of
serpins
(27) . Together, these studies suggest that the
interaction may involve the esterase active site of egasyn and the
serpin-related carboxyl-terminal propeptide of glucuronidase.
In
this paper, we report direct evidence that a region including the
serpin-like sequence in the glucuronidase propeptide is essential for
complex formation with egasyn and ER retention of glucuronidase. These
amino acids are found in a linear octamer sequence at the COOH-terminal
end of the propeptide. Furthermore, the octamer sequence is sufficient
for ER retention of other proteins in cells cotransfected with egasyn.
It thus provides an alternative mechanism for retention of any protein
within the lumen of the ER. Finally, recent reports suggest that
complexes of esterases/proteinases and other proteins are commonly
found within the ER
(28, 29, 30) .
EXPERIMENTAL PROCEDURES
Synthetic oligonucleotides
were prepared by the Bio-polymer facility at Roswell Park Cancer
Institute (Buffalo, NY). Polyclonal rabbit anti-rat AGP antibody was
kindly provided by Dr. H. Baumann (Roswell Park Cancer Institute).
Polyclonal goat anti-mouse glucuronidase antibody was prepared as
previously described
(31, 32) . Fluorescein-conjugated
donkey anti-goat IgG was obtained from Jackson Immuno-Research (West
Grove, PA). Minimal essential medium, Met(-) and Cys(-)
Dulbecco's minimal essential medium, and fetal calf serum were
obtained from Life Technologies Inc. Endoglycosidase H was purchased
from Boehringer Mannheim. Fast Garnet GBC salt, -naphthyl acetate,
and naphthol AS-BI -D-glucuronide were from Sigma.
Mouse Gus cDNA cloned into the
XhoI site of the PJC199 vector
(33) was obtained as a
gift from Dr. Gordon Watson (Childrens Hospital Oakland, Oakland, CA).
The Gus cDNA was recloned into the XbaI site of pUC19 in which
both EcoRI and BamHI restriction sites were deleted.
Therefore, a unique BamHI site at 1643 of Gus and a unique
EcoRI site in the 3`-extension sequence (which was a fragment
from the Bluescript vector) of Gus was used as a transplantation site.
To construct plasmids containing alterations in the COOH-terminal
propeptide of glucuronidase, each polymerase chain reaction
(PCR)-generated fragment, which carries a particular mutation and has a
BamHI site at one end and an EcoRI site at the other
end, was transplanted into the BamHI and EcoRI sites
of Gus to produce a mutant form of glucuronidase cDNA. A synthetic
oligonucleotide (see below) functioned as an upper primer
(oligonucleotide 1), which matches Gus at residues 1617-1637. The
upper primer was designed so that the PCR products included the
BamHI site at position 1643 of Gus. All downstream primers
(oligos 2-10) were designed to produce COOH-terminal mutants of
glucuronidase. Each primer was composed of a region that matched the
nucleotides before each deletion position, a stop codon, and an
EcoRI site. For example, the Gus 30 primer
(oligonucleotide 2) matched nucleotides from 1843 to 1866 followed by a
stop codon and an EcoRI site. The PCR products of Gus 30
encoded a peptide with a COOH-terminal 30-mer deletion. Similarly, PCR
products of Gus 15 and Gus 6 were produced by primers (oligos 3
and 4) encoding a peptide with COOH-terminal 15-mer and 6-mer
deletions, respectively. In addition, and in like manner, PCR products
of Gus (Phe Tyr, Phe Tyr,
Pro Gly, Arg Ile, Phe Met, and mouse 8-mer human 7-mer) were produced by
oligonucleotide primers 5-10, respectively. These PCR products
were recloned into the BamHI and EcoRI sites of
Gus/pUC19. These mutant glucuronidase cDNA constructs were then
transferred into the XbaI site of the pCDpoly
vector
(34) . Oligonucleotides were as follows:
5`-CGAGTATGGAGCAGACGCAAT-3`
(1) ,
5`-CGAATTCTTACAAAATAAAGGCCGAAGTTTTGGG-3`
(2) ,
5`-CGAATTCTTAACCGTGACCTCCGGTTTCGTTGGCAAT-3`
(3) ,
5`-CGAATTCTTATCCGAAACACTGGGTCCTCGGCCCTGA-3`
(4) ,
5`-CGAATTCTTAGTACGTGAACGGTCTGCTTCCGAAACACTG-3`
(5) ,
5`-CGAATTCTTAGAACGTGTACGGTCTGCTTCCGAAACACTG-3`
(6) ,
5`-CGAATTCTTAGAACGTGAACCCTCTGCTTCCGAAACACTG-3`
(7) ,
5`-CGAATTCTTAGAACGTGAACGGTATGCTTCCGAAACACTG-3`
(8) ,
5`-CGAATTCTTAGAACGTGAACGGTCTGCTTCCCATACACTGGGTCC-3`
(9) , and
5`-CGAATTCTCAAGTAAACGGGCTGTTTTCCAAACACTGGGTCCTCGGCCCTGA-3`
(10) .
To establish an
easy and efficient system for construction of AGP mutations, a
derivative of AGP called AGP-B was constructed, which contained a
unique BglII site at nucleotide position 647 in the COOH
terminus of the coding sequence between Glu and Asp. This resulted in a
change in the COOH-terminal KKDP of AGP, which was changed to KKED, a
modification that did not affect the rate of protein secretion. AGP-B
was then cloned into an XbaI site on the expression vector,
pCDpoly. To add regions of the glucuronidase propeptide to the COOH
terminus of AGP, glucuronidase PCR products generated by mutant primers
were cloned into the BglII and SstI sites of the
AGP-B cDNA. Since the pCDpoly expression vector lacks both
BglII and SstI sites, double-stranded DNA with these
two sites at the ends can be directly linked with AGP cDNA on the
expression vector by a single ligation step. A downstream primer
(oligonucleotide 9, below) shared by these reactions is composed of a
stretch of nucleotides, which matches 2124-2144 of the
3`-untranslated region of glucuronidase, and an SstI site.
Upper primers (oligos 1-8, below), which contained a
BglII site and the nucleotides encoding different
COOH-terminal peptide regions (30, 15, 14, 10, 9, 8, 7, and 6
COOH-terminal amino acids, respectively) of the glucuronidase
propeptide, were used in the PCR reactions to create mutant cDNAs.
These mutant PCR products were then cloned into the AGP-B/pCDpoly
vector to produce AGP+30, AGP+15, AGP+14, AGP+10,
AGP+9, AGP+8, AGP+7, and AGP+6 constructs. The
sequence of each construct was confirmed by DNA sequencing.
Oligonucleotides used were as follows:
5`-CGAGATCTCCGAGAGAGATACTGGAGGATT-3`
(1) ,
5`-CGAGATCTCTCAGGGCCGAGGACCCAGTGT-3`
(2) ,
5`-CGAGATCTCGGGCCGAGGACCCAGTGTTTC-3`
(3) ,
5`-CGAGATCTCCAGTGTTTCGGAAGCAGACCG-3`
(4) ,
5`-CGAGATCTCTGTTTCGGAAGCAGACCGTTC-3`
(5) ,
5`-CGAGATCTCTTCGGAAGCAGACCGTTCACG-3`
(6) ,
5`-CGAGATCTCGGAAGCAGACCGTTCACGTTC-3`
(7) ,
5`-CGAGATCTCAGCAGACCGTTCACGTTCTAA-3`
(8) , and
5`-CGAGCTCTGGACACCTCTCAGCAGGACA-3`
(9) . Modifications to the
critical glucuronidase octamer sequence were tested with constructs
prepared by a synthetic complementary oligonucleotide hybridization
approach. Sense and antisense oligonucleotides were synthesized to
encode mutations in the octamer region. The annealed DNA strands
included BglII and SstI sites, which facilitated
ligation into the BglII and SstI sites of pCDAGP-B.
Oligonucleotides listed under 1, 2, and 3 (below) were used to prepare
constructs with deletion of serine from within the octamer
(AGP+8 S), addition of leucine to the COOH terminus
(AGP+8+L), and deletion of threonine and phenylalanine from
the COOH terminus (AGP+8 TF), respectively, as follows: 1)
sense, GATCTGTTCGGAAGACCGTTCACGTTCTAAAGCT; antisense,
TTAGAACGTGAACGGTCTTCCGAACA; 2) sense,
GATCTGTTCGGAAGCAGACCGTTCACGTTCTTGTAAAGCT; antisense,
TTACAAGAACGTGAACGGTCTGCTTCCGAACA; 3) sense,
GATCTGTTCGGAAGCAGACCGTTCTAAAGCT; antisense, TTAGAACGGTCTGCTTCCGAACA.
COS-1 cells were
cultured with minimal essential medium supplemented with 5% fetal calf
serum (Life Technologies, Inc.). The constructs were transfected into
COS-1 cells by standard DEAE-dextran methods
(1) . Egasyn
esterase and -glucuronidase constructs were co-expressed by
cotransfection of egasyn and -glucuronidase cDNA subcloned into
the pCDpoly vector; transfections were carried out as previously
described
(35) .
48 h after transfection,
cells were washed with phosphate-buffered saline and changed to
serum-free minimal essential medium. Subsequently, cells and media were
routinely collected at 24 h, unless otherwise indicated. Media were
concentrated to the same volumes as cell extracts, and equal aliquots
were analyzed in 6% non-denaturing acrylamide gels. For visualization
of esterase activity, gels were incubated with -naphthyl acetate
and fast blue, and for visualization of glucuronidase activity, gels
were incubated with fast garnet GBC salt and naphthol AS-BI
-D-glucuronide as previously described
(18) .
Metabolic labeling
experiments were conducted as previously described by Skudlarek and
Swank
(36) , with minor modifications
(9) .
24 h after
transfection, COS cells on coverslips were fixed, permeabilized, and
treated with primary antibodies
(1) . Specific antibody to mouse
glucuronidase
(32) was used as the first antibody. Antigens in
COS cells were then visualized with fluorescein-conjugated secondary
antibodies. Stained cells were photographed with an epifluorescent
illumination microscope, using Kodak Ektachrome films.
Because
previous studies
(18, 22) suggested that the
glucuronidase propeptide is involved in complex formation with egasyn,
we analyzed specific regions of the propeptide for mediation of the
interaction. Complex formation of glucuronidase with egasyn was tested
by cotransfecting COS cells with egasyn cDNA together with Gus cDNA
constructs encoding Gus deletion mutants (a depiction of the deletion
constructs is in Fig. 1A). Complex formation was
visualized by specific histochemical staining of non-denaturing gels
for egasyn esterase or glucuronidase activity. Complex formation is
evident in the appearance of four high molecular weight bands (M
bands), which are formed by interaction between the glucuronidase
tetramer and 1-4 molecules of egasyn.
Figure 1:
Gus and AGP constructs. A,
glucuronidase COOH-terminal deletion constructs. Gus (WT), Gus 30,
Gus 15, and Gus 6 represent wild-type glucuronidase and
glucuronidase with COOH-terminal 30, 15, and 6 amino acid deletions
from the propeptide, respectively. Complex formation with egasyn
esterase is indicated at the right for each construct.
Glucuronidase-egasyn complexes are visible as 1-4 high molecular
weight M bands on non-denaturing gels stained for egasyn esterase or
glucuronidase activity (Fig. 2). Regions of sequence similarity to the
reactive site region of serpins are highlighted (S at residue 359 and
RPFTF at residues 368-372 of 1-AT (36)). B,
constructs in which native and modified COOH-terminal regions of the
glucuronidase propeptide have been appended to the secretory protein
AGP. The wild-type glucuronidase propeptide is represented by Gus
(WT). Constructs designated AGP+6, AGP+7, AGP+8,
AGP+9, AGP+10, AGP+14, AGP+15, and AGP+30
contain 6,7, 8, 9, 10, 14, 15, or 30 amino acids from the COOH terminus
of the glucuronidase propeptide added to AGP. In other constructs,
open and closedarrowheads indicate AGP
fusion proteins with amino acid deletions or additions, respectively,
to the glucuronidase propeptide. Complex formation with egasyn esterase
is indicated at the right. Regions of sequence similarity to
the reactive site region of serpins are highlighted (S at residue 359
and RPFTF at residues 368-372 of 1-AT(36)). C,
constructs with modifications to the COOH-terminal octamer of the
propeptide of intact glucuronidase. Depicted are WT glucuronidase,
glucuronidase constructs with amino acid substitutions (closedarrowheads) to the propeptide, and a construct where the
entire COOH-terminal octamer of mouse glucuronidase was replaced by the
homologous 7 COOH-terminal amino acids of human glucuronidase (mouse
8-mer human 7-mer). Glucuronidase-egasyn complex formation is
indicated at the right. The relative amount of complex formed
was assayed by the number of visible M complex bands indicated by the
number of plus signs. The plus sign within parentheses indicates that although no high molecular weight M complexes were
observed, a significant amount of ER-associated X form glucuronidase
(see Fig. 6) was observed. This in turn suggests that relatively labile
M complexes were formed in vivo and were dissociated during
subsequent in vitro manipulations. A region of sequence
similarity to the reactive site region of serpins is highlighted (RPFTF
at residues 368-372 of 1-AT
(36)).
Whereas complex
formation was readily visible when egasyn and wild-type glucuronidase
cDNAs were cotransfected, no complex was apparent when egasyn cDNA was
cotransfected with a propeptide negative construct (Gus 30) in
either enzyme assay (Fig. 2, A and B). As in
the case of Gus 30, no complexes were formed when constructs
(Gus 15 and Gus 6) encoding smaller deletions of the
COOH-terminal propeptide were cotransfected with egasyn cDNAs. In the
case of Gus 30, catalytically active glucuronidase molecules were
not produced (Fig. 2B), so that lack of complex
formation is likely a secondary result of nonfunctional or absent
glucuronidase enzyme. The lack of functional enzyme in the case of
Gus 30 may reflect the instability of a protein product that lacks
an N-linked carbohydrate chain normally found at position 22
from the COOH terminus
(27) . However, functional enzyme, which
did not form complexes with egasyn, was clearly formed in the case of
the Gus 15 and Gus 6 constructs. These results indicate that
the glucuronidase propeptide is necessary for complex formation and
that amino acids at the extreme carboxyl terminus of the propeptide are
critical in this interaction.
Figure 2:
The
carboxyl region of the glucuronidase propeptide is necessary for
complex formation with egasyn esterase. COS cells were cotransfected
with egasyn cDNA and Gus WT, Gus 30, Gus 15, or Gus 6
constructs (see Fig. 1). After 72 h, equivalent amounts of media
(M) and cell extracts (C) of these transfected cells
were electrophoresed on 6% non-denaturing polyacrylamide gels, which
were then stained with -naphthyl acetate and fast blue to reveal
esterase activity (A) or with fast garnet GBC salt and
naphthol AS-BI -D-glucuronide to reveal glucuronidase
activity (B). Egasyn indicates the free form of
egasyn, Gus the free form of glucuronidase, and Complex glucuronidase complexed with egasyn. Note the large amount of Gus
in the medium in B. It is commonly observed (for example, see
Ref. 37) that expression of lysosomal enzymes in cultured cells after
transient transfection results in excess secretion, probably due to
overloading of the receptor system.
Note that neither egasyn, a lumenal ER
protein, nor egasyn-glucuronidase complexes were secreted from COS
cells regardless of the glucuronidase cotransfected (Fig. 2,
A and B). However, glucuronidase was partially
secreted (Fig. 2B) since it is not entirely retained by
egasyn (see below).
To verify that
the complexes of egasyn with wild-type glucuronidase are retained
within the ER of COS cells as in intact liver and kidney tissues, COS
cells were cotransfected with various Gus and egasyn cDNA constructs,
and the subcellular localization of the resulting glucuronidase product
was monitored by immunofluorescent microscopy with specific antibodies
(Fig. 3). Upon transfection with Gus WT cDNA alone, a
predominantly lysosomal pattern was observed together with some ER and
nuclear envelope staining (Fig. 3A). Cotransfection of
Gus WT and egasyn cDNA yielded a markedly enhanced ER localization of
glucuronidase (Fig. 3B). Principally, the lysosomal
pattern appeared in cells transfected with Gus 6, whether
transfected alone (Fig. 3C) or together with egasyn cDNA
(Fig. 3D). These results indicate that ER localization
of glucuronidase in COS cells requires complex formation with egasyn.
In addition, deletion of the carboxyl-terminal six amino acids of the
glucuronidase propeptide did not affect targeting to the lysosome,
suggesting that this region of the propeptide does not contain an
essential lysosomal targeting sequence.
Figure 3:
Cotransfection with egasyn directs
glucuronidase to the ER in COS cells. COS cells transfected with Gus WT
(A) or cotransfected with Gus WT and egasyn cDNA (B)
or transfected with Gus 6 (C) or cotransfected with
Gus 6 and egasyn cDNA (D) were grown on coverslips, fixed,
permeabilized, treated with anti-Gus antibody, and then visualized with
fluorescent-conjugated antibody (Epifluorescence microsopy,
2,300).
The serum glycoprotein rat
1-acid glycoprotein (AGP) is normally synthesized within the ER
and then secreted. To test whether the glucuronidase propeptide can
direct AGP to be retained within the ER by complex formation with
egasyn, various constructs (Fig. 1B) of AGP, in which
the carboxyl terminus of AGP was fused with various propeptide
sequences of glucuronidase, were cotransfected with egasyn cDNA into
COS cells. Our initial experiments focused on three constructs:
AGP+30, AGP+15, and AGP+6. Complex formation was assayed
by electrophoresis of cell extracts on non-denaturing gels followed by
specific staining for egasyn esterase activity. Wild-type AGP protein
products did not form complexes with egasyn (Fig. 4A,
lane1). However, when the carboxyl-terminal 30
(Fig. 4A, lane2) or 15
(Fig. 4A, lane 3) amino acids of the glucuronidase propeptide
were appended to the carboxyl terminus of AGP, the formation of
esterase components with diminished electrophoretic mobility was
readily apparent. That the slowly migrating esterase components
represented bona fide complexes of AGP with egasyn was proven by their
recognition by specific AGP antisera (Fig. 4E) and by
their ready dissociation at 56 °C (data not shown), a known
characteristic of the egasyn-glucuronidase complex
(38) . In
contrast, the carboxyl-terminal 6 amino acids of the glucuronidase
propeptide were not sufficient to form complexes with egasyn
(Fig. 4A, lane4). Thus, these initial
experiments indicated that a peptide sequence at the COOH terminus of
the glucuronidase propeptide within the 15 COOH-terminal amino acids
and larger than the 6 COOH-terminal amino acids is sufficient for
complex formation of other proteins with egasyn.
Figure 4:
A
sequence within the glucuronidase propeptide is sufficient to direct an
unrelated protein, AGP, to complex with egasyn esterase. COS cells were
cotransfected with egasyn and the indicated AGP constructs. Equivalent
amounts of cell extracts from each transfectant were electrophoresed on
6% non-denaturing gels, and esterase activity was detected by specific
histochemical staining. Egasyn indicates the free form of
egasyn and Complex stands for egasyn complexed with AGP.
M, medium; C, cells. The designation AGP indicates
cotransfection with the control AGP construct. The remaining
designations indicate cotransfection with AGP constructs modified to
contain at the COOH terminus of AGP the various regions of the
glucuronidase propeptide as explained in Fig. 1B. Panel
A, more than 6 amino acids from the COOH terminus of the
glucuronidase propeptide region are required for complex formation with
egasyn. Panel B, the serine at position 15 from the COOH
terminus of the glucuronidase propeptide is not required for complex
formation. Panel C, an octamer sequence at the COOH terminus
of the glucuronidase propeptide is required for complex formation.
Panel D, the removal of serine from within the octamer, the
addition of leucine to the extreme COOH terminus, or the deletion of
threonine and phenylalanine from the COOH terminus results in loss of
complex formation. Panel E, treatment of transfectant cell
extracts with excess rabbit anti-rat AGP antibody demonstrates that the
complex contains AGP. Note the absence of complex bands (anti-AGP) and
the appearance of high molecular weight antigen-antibody aggregates at
the very top of the gel (anti-AGP+30, +15) compared to the
control case (untreated).
A relevant issue is
the quantity of AGP that forms stable complexes with egasyn in cells
that are cotransfected with egasyn and the AGP constructs above. To
address this issue, cells were pulsed for 1 h with radiolabeled amino
acids and chased for 24 h in unlabeled media. Under these conditions
40% of labeled immunoprecipitable AGP+30 and AGP+15 protein
products remained intracellular (Fig. 5) as determined by
densitometry of autoradiograms while wild-type AGP was secreted (not
shown). This intracellular material was bound to egasyn since very
little intracellular AGP was detected in cells that were transfected by
the same AGP constructs in the absence of egasyn. Also, the
intracellular AGP components in cells cotransfected with egasyn were
located within the ER since they were sensitive to digestion with
endo- -N-acetylglucosaminidase H (data not shown). As
expected from the above results, no significant intracellular AGP was
detected in cells transfected with AGP+6, whether or not the cells
were cotransfected with egasyn. Therefore, an unrelated secretory
protein, modified to contain the glucuronidase propeptide, is
relatively stable within the ER as a result of complex formation with
egasyn.
Figure 5:
AGP is stably retained within the ER by
complexing with egasyn. Cells expressing AGP, AGP+15, or
AGP+30 constructs either alone (-) or together with the
egasyn (Egasyn) construct were pulsed with radiolabeled amino
acids for 1 h and chased in unlabeled media for 24 h. AGP proteins were
immunoprecipitated with anti-AGP antibody and electrophoresed on 12%
acrylamide gels. M and C represent medium and cell
extracts, respectively; molecular weight markers are to the
right. 1 and 2 (left) show complex
(45 kDa) and high mannose (37 kDa) forms of AGP, respectively.
Endoglycosidase H sensitivity was observed for 2 but not 1 (data not
shown).
We further probed the glucuronidase propeptide to
identify the minimum amino acid sequence sufficient for complex
formation with egasyn. A series of constructs including the
glucuronidase carboxyl-terminal 14, 10, 9, 8, or 7 amino acids appended
to the COOH terminus of AGP were co-expressed with egasyn esterase in
COS cells (see Fig. 1B). Complex formation was indicated
by the appearance of esterase bands of reduced mobility on
non-denaturing gels (Fig. 4). Fig. 4B reveals that
the serine residue at position 15 from the COOH terminus, which may be
aligned with the active site serine at the active center of the
serpins
(27) , is not required for complex formation. Further,
the carboxyl-terminal 8 amino acid residues 641 to 648 of the
propeptide clearly represent the minimal sequence sufficient for
complex formation (Fig. 4C). This octamer region
includes the serpin-like RPFTF sequence.
Sequence specificity,
within the critical octamer region, for complex formation between the
AGP-propeptide fusion proteins and egasyn was examined.
AGP+15 F and AGP+8 TF represent two constructs with
either phenylalanine or threonine and phenylalanine, respectively,
deleted from the COOH-terminal end of the propeptide
(Fig. 1B). AGP+8 S designates a construct
wherein the serine at C-6 is deleted (Fig. 1B).
AGP+8+L was designed to test the importance of the extreme
COOH-terminal location of the peptide sequence
(Fig. 1B). When assayed for egasyn complex formation,
none of these gene products complexed with egasyn
(Fig. 4D, data not shown for AGP+15 F). That
addition of leucine at the extreme COOH terminus abolished complex
formation demonstrates the critical nature of the COOH-terminal context
of the octamer.
Additional
constructs were designed to address the question of how specific amino
acids within the COOH-terminal octamer sequence of glucuronidase affect
complex formation with egasyn. Because the complexes of glucuronidase
with egasyn form discrete components that can readily be separated and
analyzed qualitatively and quantitatively on non-denaturing gels, amino
acid alterations were introduced directly into the propeptide of the
intact glucuronidase molecule, rather than fusing an altered octamer to
another protein. A series of six glucuronidase mutants were
co-expressed with egasyn cDNA in COS cells (Fig. 1C).
Complex formation was assayed on non-denaturing gels stained for
glucuronidase activity (Fig. 6). In a companion gel, egasyn
esterase activity was measured (data not shown). Both stains yielded
similar results in terms of the mobility of complex bands. Extracts
from mock transfected cells showed negligible staining compared with
transfected cells (not shown).
Figure 6:
Effects of modifications of the
glucuronidase propeptide octamer signal sequence on
egasyn-glucuronidase complex formation. COS cells were cotransfected
with an egasyn cDNA construct and one of a series of Gus cDNA
constructs with substitutions in the COOH-terminal octamer propeptide
region (lanes1-8) or were transfected with a
glucuronidase wild-type cDNA construct alone (lane9). Resulting extracts were electrophoresed on
non-denaturing acrylamide gels, which were stained for glucuronidase
activity. Constructs (see Fig. 1C) are indicated above each lane. Complex formation is apparent as more slowly migrating
bands M , M , M , and M ,
which contain 1, 2, 3, and 4 molecules of egasyn, respectively, bound
to the glucuronidase tetramer. BandX is precursor ER
glucuronidase tetramer, and bandL is mature
lysosomal glucuronidase tetramer.
Changing carboxyl-terminal (C-1)
phenylalanine to tyrosine resulted in a decrease in efficiency of
complex formation (Fig. 6, lane1 compared with
lane7 (Gus WT control)). This confirms the
importance of the terminal phenylalanine observed with AGP-propeptide
constructs (Fig. 4D). Compared with the Gus WT control,
no high molecular weight complexes of glucuronidase and egasyn were
observed. Rather, the predominant glucuronidase form corresponded to an
ER-associated or ``X'' form. The X form of the enzyme
represents precursor glucuronidase containing the propeptide, whereas
the faster migrating L, or lysosomal form, denotes mature lysosomal
enzyme from which the propeptide has been cleaved. Note, however, that
the ratio of X to L form glucuronidase is considerably greater than
that of cells in which glucuronidase was transfected in the absence of
egasyn (lane9). Therefore, despite the absence of
high molecular weight complexes visible as M bands between
glucuronidase and egasyn, retention of glucuronidase within the ER
through association with egasyn had apparently occurred. A probable
explanation for the absence of M bands is that these complexes are
relatively labile and dissociated during processing of cell extracts
for electrophoresis.
Replacing the other phenylalanine at position 3
(C-3) from the COOH terminus of the octamer with tyrosine gave a
significant amount of complex formation. However, these complexes
contained just one or two egasyn molecules rather than the full range
of one to four egasyn molecules observed in the control case
(Fig. 6, lane2 compared with Gus WT control,
lane7). When proline at C-4 was replaced by glycine,
stable complex formation was lost entirely (Fig. 6, lane3). This result may relate to the significant effects of
proline on the folding of a polypeptide chain. Again, however, there
had apparently been ER association with egasyn since the ratio of X to
L form was far greater than that of cells transfected only with
glucuronidase. Substitution of the basic arginine at C-5 by a neutral
isoleucine residue caused a slightly decreased efficiency of complex
formation (Fig. 6, lane4) in that
glucuronidase molecules containing 1, 2, and 3 but not 4 attached
egasyn molecules were apparent.
A distinction between the rat and
mouse glucuronidase propeptide carboxyl termini is the presence of
methionine rather than phenylalanine at C-8
(27) . Replacement of
phenylalanine with methionine yielded an intermediate efficiency of
complex formation with complexes containing 1 and 2 egasyn molecules
visible (Fig. 6, lane5). Therefore, the in
vitro experiment predicts that in vivo, rat glucuronidase
will interact with mouse egasyn.
The octamer sequence in the human
glucuronidase propeptide differs from that of the mouse in that the
COOH-terminal phenylalanine is deleted (27). Also, amino acid
substitutions are present at residues 4-7 from the carboxyl
terminus (see Fig. 1C). A mouse glucuronidase cDNA
construct was prepared with the 8 COOH-terminal amino acid residues
replaced by the 7 residues of the human Gus COOH terminus. No complex
formation was apparent when this fusion protein was expressed with
mouse egasyn cDNA, demonstrating species specificity for the
glucuronidase propeptide-mouse egasyn interaction (Fig. 6,
lane6).
In this
report, we demonstrate that an octamer sequence at the COOH terminus of
the glucuronidase propeptide with sequence similarity to a region near
the reactive site of serpins contains information that is both
necessary and sufficient for complex formation with egasyn. This
complex formation in turn leads to retention of a significant
proportion of glucuronidase within a specific subcellular organelle,
the ER. The glucuronidase-egasyn system therefore utilizes an unusual
mechanism for ER retention of a protein. A serpin-like sequence on one
protein serves to bind it to the esterase catalytic site of a second
protein, which in turn contains an intrinsic ER retention signal.
Furthermore, attachment of the octamer sequence to COOH termini
provides a general method of targeting proteins to the ER lumen of
cells that contain egasyn.
Deletional analysis demonstrated that the
six carboxyl-terminal amino acids of the propeptide are necessary for
the association of proglucuronidase with egasyn. When appended to rat
AGP, eight contiguous amino acids from the carboxyl terminus of the
propeptide allowed AGP, which is naturally secreted, to form a complex
with mouse egasyn within the ER. Modification of the octamer sequence
at several positions diminishes complex formation. Supporting evidence
for the importance of the octamer sequence occurs in the case of the
naturally occurring W26 mouse, which contains a Gly Arg
substitution at amino acid position 7 from the COOH terminus of
proglucuronidase, reducing its ability to form complexes with
egasyn
(27) . Also, a synthetic 30-mer peptide, which includes
the octamer sequence, is a specific and potent inhibitor of the same
egasyn esterase active site that forms complexes with
glucuronidase
(22) . Taken together, these results establish that
the critical information for complex formation is in a serpin-related
octamer sequence at the extreme COOH terminus of the glucuronidase
propeptide. The remaining structure (i.e. other than the
propeptide) of glucuronidase is not necessary for complex formation
with egasyn.
Complex formation between egasyn and the glucuronidase
propeptide is less efficient than that between KDEL-tailed (or
HTEL-tailed) proteins and their receptors. For example, approximately
half of the glucuronidase of hepatocytes continues to the lysosome
rather than remaining within the ER, despite a 10-fold molar excess of
egasyn over glucuronidase within the ER
(6) . Likewise, only 40%
of AGP, to which the glucuronidase propeptide had been appended, was
retained within the ER by binding to egasyn over a 24-h period
(Fig. 5). In contrast, greater than 98% of AGP-HTEL and AGP-KDEL
fusion proteins were retained in the ER of transfected COS
cells
(9) . It is, in fact, a significant advantage that the ER
retention system for glucuronidase is leaky since efficient retention
of glucuronidase within the ER would likely result in lysosomal storage
disease.
There are several possible explanations for the leaky
nature of the ER retention system for glucuronidase. One possibility is
that competition between the binding of glucuronidase to egasyn and to
mannose-6-phosphate (Man-6-P) receptors regulates the subcellular
distribution of glucuronidase. Hepatic ER glucuronidase bound to egasyn
contains covered Man-6-P residues, which become uncovered in the Golgi
to expose the Man-6-P recognition marker
(39) . In most cell
types, Man-6-P receptors are concentrated in the trans-Golgi network,
but they may also be localized earlier in the cis-Golgi
(40) . In
the latter case, they might compete with egasyn for binding to
glucuronidase and thereby direct a portion of glucuronidase to
lysosomes. Another possibility is that in the salvage compartment,
where HTEL (KDEL)-tailed proteins efficiently complex with receptors,
ion concentrations or pH may not be optimal for complexation between
egasyn and glucuronidase, resulting in some dissociation of the
complex
(41) . This possibility is reinforced by the finding that
the glucuronidase-egasyn complex is not stable when it is allowed to
traverse the secretory pathway (by removing the HTEL ER retention
signal from egasyn)
(9) . The most likely possibility is that the
glucuronidase-egasyn complex intrinsically has a relatively high
dissociation constant. This is supported by the fact that there are
relatively few M complexes, in which all four subunits of
the glucuronidase tetramer are occupied by egasyn, even in the presence
of a 10-fold molar excess of egasyn
(18) . Also, the complex is
relatively labile in vitro. Mild treatments such as heating at
relatively low temperatures or, in the case of the rat complex,
treating with mild nonionic detergents
(18) cause significant
complex dissociation.
The terminal phenylalanine residue
and the proline at C-4 of the glucuronidase propeptide are critical to
complex formation; no association of glucuronidase with egasyn was
apparent when these residues were replaced by tyrosine and glycine,
respectively. Nevertheless, in each of these cases, significant
egasyn-dependent retention of glucuronidase within the ER occurred. The
most likely explanation for these observations is that substitution of
these residues resulted in a complex that is sufficiently stable to
retain glucuronidase within the ER but is not stable to the in
vitro conditions of tissue homogenization and electrophoresis of
cellular extracts. Reduced efficiency of complex formation was evident
when phenylalanine at C-3 was replaced with tyrosine, the basic
arginine at C-5 was replaced by neutral isoleucine, or when
phenylalanine at C-8 was replaced by methionine. These data demonstrate
that critical residues within the octamer sequence confer specific
information in terms of its association with egasyn and ER
localization.
Although mouse egasyn interacts efficiently with the
propeptide of rat glucuronidase, it does not associate with the
corresponding human propeptide. The interpretation of the lack of
complex formation between mouse egasyn and the glucuronidase construct
containing the human glucuronidase propeptide (Fig. 6) is not
clear. One explanation is that the interaction is species restricted.
Our work
(35) demonstrated in fact that the signal for
association of egasyn with glucuronidase is species restricted.
Nevertheless, a critical test for interaction of the human
glucuronidase propeptide and egasyn is not possible at this time since
the human equivalent of egasyn has not yet been identified. Recently,
Islam and co-workers
(25) have determined that the propeptide of
human glucuronidase influences catalytic activity, secretion, and
phosphorylation of human glucuronidase. It remains uncertain whether a
complex between egasyn and the glucuronidase propeptide occurs in human
tissues
(7) .
Two regions of the glucuronidase propeptide are
similar in sequence to portions of the conserved sequences within or
near the reactive site region of members of the serpin superfamily
(27). These experiments (Fig. 4B) clearly indicate that
the serine residue at the P1`-position of the reactive
site
(42) , which plays a critical role in serpin inhibition, is
not essential for complex formation between glucuronidase and egasyn.
The second region of sequence similarity of the glucuronidase
propeptide to members of the serpin superfamily is the RPFTF sequence
found at the COOH terminus of the propeptide. This sequence is similar
to the RPFXF sequence found to the P`-side of the reactive
site of most serpins (residues 368-372 of the prototypical serpin
-1-antitrypsin ( 1-AT)
(42) ). These experiments clearly
indicate that this sequence is critical for interaction of
glucuronidase with the esterase active site of egasyn. While this or a
closely related sequence is found in most serpins, its functional and
structural roles, unfortunately, are
uncertain
(43, 44, 45) .
A portion of the same
RPFXF sequence of serpins participates in the recognition of
serpin-serine proteinase complexes by a cell surface receptor found on
HepG2 cells. A hepatocyte cell surface receptor, the serpin enzyme
complex receptor, recognizes the pentapeptide FVFLM at residues
370-374 of 1-AT in the 1-AT-elastase complex. Binding
of receptor to the pentapeptide mediates degradation of the complex
(46) and increased synthesis of 1-AT. This pentapeptide
FVFLM sequence overlaps the RPFTF sequence (residues
644-648
(33) ) of the glucuronidase propeptide and has an
additional LM dipeptide. Unlike the COOH-terminal octamer sequence of
-glucuronidase, the FVFLM sequence is internal in 1-AT.
C-reactive protein is retained
within the lumen of the ER of unstimulated hepatocytes, similarly to
glucuronidase, by formation of complexes with two ER
carboxyl-esterases
(47, 48) . C-reactive protein is
synthesized in hepatocytes and is secreted into plasma during the acute
phase response due to a markedly reduced binding capacity of the ER
esterases. Amino-terminal sequence analysis has identified the
esterases as rabbit ER esterases 1 and 2, which, like egasyn esterase,
contain the COOH-terminal ER retention signal
HXEL
(49, 50) . In contrast to the interaction
between -glucuronidase and egasyn, which is blocked by esterase
active site inhibitors, the binding of C-reactive protein is
independent of the active sites of the esterases.
Additional
examples of complexes between proteinases/esterases and other ER
proteins have been described. Protective protein, a serine
carboxypeptidase, and -galactosidase associate early in the
biosynthetic pathway in the rough ER
(29) . In this case, the
active site of the carboxypeptidase is not required for complex
formation, and the complex is not retained within the ER. Rather, the
complex of lysosomal protective protein and -galactosidase is
transported to the lysosome where protective protein stabilizes the
mature -galactosidase and N-acetyl- -neuraminidase
enzymes.
A third example of an interaction between a proteinase and
an accessory protein within the ER lumen is that of procathepsin D and
prosaposin
(30) . A mannose-6-phosphate independent association
between procathepsin D and prosaposin begins as a soluble complex in
the ER and continues during transport through the Golgi. The complex
becomes membrane associated in the Golgi apparatus and is transported
to the lysosome. In the lysosome, procathepsin D is processed to a
mature form, and membrane association and binding between the two
proteins are lost.
Finally it is of interest that another ER lumenal
protein, chick s-cyclophilin, has sequence similarity at its
COOH terminus to the reactive site region of serpins and to the
glucuronidase COOH terminus. Its COOH-terminal 10 amino acids,
VEKPFAIAKE, localize this cyclophilin within the ER lumen and, when
appended at the COOH terminus, are sufficient to cause retention of an
unrelated secretory protein within the ER
(51) . The internal KPF
sequence is similar to the KPF (residues 368-370
(52) and
RPF (residues 644-646
(33) ) sequences near and at the
carboxyl termini of 1-AT and -glucuronidase, respectively. It
will be of interest to determine whether s-cyclophilin, like
glucuronidase, is retained within the ER by binding to an
esterase/proteinase that recognizes the KPF sequence.
In summary,
our findings establish that a linear octamer sequence at the COOH
terminus of the glucuronidase propeptide is essential for complex
formation between glucuronidase and egasyn. A general method for
targeting proteins to the lumen of the ER of cells containing egasyn is
to append this glucuronidase propeptide octamer sequence to their COOH
terminus. The mechanism by which the octamer retains proteins within
the ER is related to the mechanism by which serine proteinases complex
with serpins. Whatever the precise mechanism regulating the leaky
nature of the ER retention system for glucuronidase, it allows
translocation of sufficient enzyme to the lysosome, thereby averting
another lysosomal storage disease. The propeptide-esterase retention
system may represent a generalized mechanism, whereby an accessory
esterase/proteinase serves a role in the subcellular
localization/processing of another protein.
FOOTNOTES
- *
- This work was supported by Public Health
Service Grant GM33559. The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
the Dept. of Molecular and Cellular Biology, Roswell Park Cancer
Institute, Elm and Carlton Sts., Buffalo, NY 14263.
- The abbreviations used are: ER, endoplasmic
reticulum; Gus, glucuronidase; Man-6-P, mannose-6-phosphate; AGP,
1-acid glycoprotein; 1-AT, 1-antitrypsin; WT, wild type;
PCR, polymerase chain reaction; M bands, high molecular weight bands.
ACKNOWLEDGEMENTS
We thank Dr. Edward K. Novak for advice and Shelley Y.
Jiang and Lijie Zhen for expert technical assistance. We also thank Dr.
Heinz Baumann for generously supplying antiserum to rat AGP, Dr. Steven
Pruitt for providing the pCDpoly expression vector, and Dr. Gordon
Watson for the gift of mouse Gus cDNA clone. We are indebted to Mary
Ketcham and Cheryl Mrowczynski for excellent secretarial assistance.
REFERENCES
- Munro, S., and Pelham, H. R. B.(1987) Cell 48, 899-907
[CrossRef][Medline]
[Order article via Infotrieve]
- Lewis, M. J., and Pelham, H. R. B.(1990) Nature 348, 162-163
[CrossRef][Medline]
[Order article via Infotrieve]
- Lewis, M. J., and Pelham, H. R. B.(1992) J. Mol. Biol. 226, 913-916
[CrossRef][Medline]
[Order article via Infotrieve]
- Hsu, V. W., Shah, N., and Klausner, R. D.(1992) Cell 69, 625-635
[CrossRef][Medline]
[Order article via Infotrieve]
- Tang, B. L., Wong, S. H., Qi, X. L., Low, S. H., and Hong, W.(1993) J. Cell Biol. 120, 325-338
[Abstract/Free Full Text]
- Lusis, A. J., and Paigen, K.(1977) in Current Topics in Biological and Medical Research. (Rattazzi, M. C., Scandalios, J. G., and Whitt, G. S., eds) pp. 63-106, Alan R. Liss, New York
- Swank, R. T., Novak, E. K., and Zhen, L.(1994) in Handbook of Experimental Pharmacology (Kauffman, F. C., ed) pp. 131-160, Springer-Verlag, Berlin
- Brown, J. A., Novak, E. K., Takeuchi, K., Moore, K., Medda, S., and Swank R. T.(1987) J. Cell Biol. 105, 1571-1578
[Abstract/Free Full Text]
- Zhen, L., Baumann, H., Novak, E. K., and Swank, R. T.(1993) Arch. Biochem. Biophys. 304, 402-404
[CrossRef][Medline]
[Order article via Infotrieve]
- Neufeld, E. F., and Moenzer, J.(1989) in The Metabolic Basis of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) pp. 1565-1587, McGraw-Hill Inc., New York
- Whiting, J. F., Narciso, J. P., Chapman, V., Ransil, B. J., Swank, R. T., and Gollan, J. L.(1993) J. Biol. Chem. 268, 23197-23201
[Abstract/Free Full Text]
- Brunelle, F. M., and Verbeeck, R. K.(1993) Biochem. Pharmacol. 46, 1953-1958
[CrossRef][Medline]
[Order article via Infotrieve]
- Belinsky, S. A., Kauffman, F. C., Sokolove, P. M., Tsukuda, T., and Thurman, R. G.(1984) J. Biol. Chem. 259, 7705-7711
[Abstract/Free Full Text]
- Sokolove, P. M., Wilcox, M. A., Thurman, R. G., and Kauffman, F. C. (1984) Biochem. Biophys. Res. Commun. 121, 987-993
[CrossRef][Medline]
[Order article via Infotrieve]
- Whittaker, M., Sokolove, P. M., Thurman, R. G., and Kauffman, F. C. (1985) Cancer Lett. 26, 145-152
[CrossRef][Medline]
[Order article via Infotrieve]
- Vanstapel, F., and Blanckaert, N.(1988) Arch. Biochem. Biophys. 263, 216-225
[CrossRef][Medline]
[Order article via Infotrieve]
- Medda, S., Stevens, A. M., and Swank, R. T.(1987) Cell 50, 301-310
[CrossRef][Medline]
[Order article via Infotrieve]
- Medda, S., and Swank, R. T.(1985) J. Biol. Chem. 260, 15802-15808
[Abstract/Free Full Text]
- Medda, S., von Deimling, O. V., and Swank, R. T.(1986) Biochem. Genet. 24, 229-243
[CrossRef][Medline]
[Order article via Infotrieve]
- Heymann, E.(1980) in Enzymatic Basis of Detoxification (Jakoby, W. B., ed) pp. 291-323, Academis Press, New York
- Mentlein, R., Suttorp, M., and Heymann, E.(1984) Arch. Biochem. Biophys. 228, 230-246
[CrossRef][Medline]
[Order article via Infotrieve]
- Medda, S., Chemelli, R. M., Martin, J. L., Pohl, L. R., and Swank, R. T.(1989) J. Biol. Chem. 264, 15824-15828
[Abstract/Free Full Text]
- Brown, J. A., and Swank, R. T.(1983) J. Biol. Chem. 258, 15323-15328
[Abstract/Free Full Text]
- Erickson, A. H., and Blobel, G.(1983) Biochemistry 22, 5201-5205
[CrossRef][Medline]
[Order article via Infotrieve]
- Islam, M. R., Grubb, J. H., and Sly, W. S.(1993) J. Biol. Chem. 268, 22627-22633
[Abstract/Free Full Text]
- Myers, M., Richmond, R. C., and Oakeshott, J. G.(1988) Mol. Biol. Evol. 5, 113-119
[Abstract]
- Li, H., Takeuchi, K. H., Manly, K., Chapman, V., and Swank, R. T. (1990) J. Biol. Chem. 265, 14732-14735
[Abstract/Free Full Text]
- Macintyre, S. S., and Kalonek, P. A.(1992) Mol. Biol. Cell 3, (suppl.) 120
- Morreau, H., Galjart, N. J., Willemsen, R., Gillemans, N., Zhou, X. Y., and d' Azzo, A.(1992) J. Biol. Chem. 267, 17949-17956
[Abstract/Free Full Text]
- Zhu, Y., and Conner, G.(1994) J. Biol. Chem. 269, 3846-3851
[Abstract/Free Full Text]
- Tomino, S., and Paigen, K.(1975) J. Biol. Chem. 250, 1146-1148
[Abstract/Free Full Text]
- Skudlarek, M. D., and Swank, R. T.(1979) J. Biol. Chem. 254, 9939-9942
[Abstract/Free Full Text]
- Gallagher, P. M., D'Amore, M. A., Lund, S. D., and Ganschow, R. E. (1988) Genomics 2, 215-219
[CrossRef][Medline]
[Order article via Infotrieve]
- Pruitt, S. C.(1988) Gene (Amst.) 66, 121-134
[CrossRef][Medline]
[Order article via Infotrieve]
- Novak, E. K., Baumann, H., Ovnic, M., and Swank, R. T.(1991) J. Biol. Chem. 266, 6377-6380
[Abstract/Free Full Text]
- Skudlarek, M. D., and Swank, R. T.(1981) J. Biol. Chem. 256, 10137-10144
[Free Full Text]
- Weitz, G., and Proia, R. L.(1992) J. Biol. Chem. 267, 10039-10044
[Abstract/Free Full Text]
- Lusis, A. J., Tomino, S., and Paigen, K.(1976) J. Biol. Chem. 251, 7753-7760
[Abstract/Free Full Text]
- Gabel, C. A., Goldberg, D. E., and Kornfeld, S.(1982) J. Cell Biol. 95, 536-542
[Abstract/Free Full Text]
- Kornfeld, S.(1992) Annu. Rev. Biochem. 61, 307-330
[CrossRef][Medline]
[Order article via Infotrieve]
- Pelham, H. R. B.(1991) Curr. Opin. Cell Biol. 3, 589-591
- Shieh, B-H., and Travis, J.(1987) J. Biol. Chem. 262, 6055-6059
[Abstract/Free Full Text]
- Patston, P. A., and Gettins, P. G. W.(1994) Thromb. Haemostasis 72, 166-179
[Medline]
[Order article via Infotrieve]
- Wei, A., Rubin, H., Cooperman, B. S., and Christianson, D. W.(1994) Nat. Struct. Biol. 1, 251-258
[CrossRef][Medline]
[Order article via Infotrieve]
- Schreuder, H. A., de Boer, B., Dijkema, R., Mulders, J., Theunissen, H. J. M., Grootenhuis, P. D. J., and Hol, W. G. J.(1994) Nat. Struct. Biol. 1, 48-54
[CrossRef][Medline]
[Order article via Infotrieve]
- Joslin, G., Fallon, R. J., Bullock, J., Adams, S. P., and Perlmutter, D. H.(1991) J. Biol. Chem. 266, 11282-11288
[Abstract/Free Full Text]
- Macintyre, S. S.(1992) J. Cell Biol. 118, 253-266
[Abstract/Free Full Text]
- Macintyre, S., Samols, D., and Dailey, P.(1994) J. Biol. Chem. 269, 24496-24503
[Abstract/Free Full Text]
- Korza, G., and Ozols, J.(1988) J. Biol. Chem. 263, 3486-3495
[Abstract/Free Full Text]
- Ozols, J.(1989) J. Biol. Chem. 264, 12533-12545
[Abstract/Free Full Text]
- Arber, S., Krause, K. H., and Caroni, P.(1992) J. Cell Biol. 116, 113-125
[Abstract/Free Full Text]
- Colau, B., Chucana, P., and Bollen, A.(1984) DNA 3, 327-330
[Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. S. Heinemann, G. Korza, and J. Ozols
A Plasminogen-like Protein Selectively Degrades Stearoyl-CoA Desaturase in Liver Microsomes
J. Biol. Chem.,
October 31, 2003;
278(44):
42966 - 42975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Xie, D. Yang, M. Wu, B. Xue, and B. Yan
Mouse Liver and Kidney Carboxylesterase (M-LK) Rapidly Hydrolyzes Antitumor Prodrug Irinotecan and the N-Terminal Three Quarter Sequence Determines Substrate Selectivity
Drug Metab. Dispos.,
January 1, 2003;
31(1):
21 - 27.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Monnat, E. M. Neuhaus, M. S. Pop, D. M. Ferrari, B. Kramer, and T. Soldati
Identification of a Novel Saturable Endoplasmic Reticulum Localization Mechanism Mediated by the C-Terminus of a Dictyostelium Protein Disulfide Isomerase
Mol. Biol. Cell,
October 1, 2000;
11(10):
3469 - 3484.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Ellgaard, M. Molinari, and A. Helenius
Setting the Standards: Quality Control in the Secretory Pathway
Science,
December 3, 1999;
286(5446):
1882 - 1888.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Greenfield and S High
The Sec61 complex is located in both the ER and the ER-Golgi intermediate compartment
J. Cell Sci.,
January 5, 1999;
112(10):
1477 - 1486.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Schiller, R. E. Mains, and B. A. Eipper
A Neuroendocrine-specific Protein Localized to the Endoplasmic Reticulum by Distal Degradation
J. Biol. Chem.,
November 3, 1995;
270(44):
26129 - 26138.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|