|
Volume 270,
Number 20,
Issue of May 19, pp. 11977-11984, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification
of a Second Region Upstream of the Mouse Heme Oxygenase-1 Gene That
Functions as a Basal Level and Inducer-dependent Transcription Enhancer
(*)
Jawed
Alam
(1) (2)(§),
Sharon
Camhi
(3),
Augustine M.
K.
Choi
(3) From the
(1)
Department of Molecular Genetics, Alton
Ochsner Medical Foundation and the
(2)
Department of Biochemistry and Molecular Biology,
Louisiana State University Medical Center, New Orleans, Louisiana 70121
and the
(3)
Department of Medicine, The Johns Hopkins
University School of Medicine, Baltimore, Maryland 21205
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
A 161-base pair fragment (AB1) 10 kilobase pairs upstream
of the transcription start site of the mouse heme oxygenase-1 gene
functions as a basal level and inducer-dependent enhancer.
AB1/chloramphenicol acetyltransferase fusion genes stably transfected
into mouse hepatoma (Hepa) cells or L929 fibroblasts were activated
7-8- or 17-22-fold, respectively, after treatment of the
cells with either CdCl or heme. The AB1 fragment is
composed largely of three tandem repeats containing two conserved core
elements, A and B. Part of core element A (TCCGGAGCTGTG) resembles the
consensus-binding site for transcription factor AP-4, whereas core
element B (GCTGAGTCANGG) includes the consensus-binding site (TGAGTCA)
for the AP-1 family of transcription factors. Nuclear proteins from
Hepa cells did not bind to any of the core A elements, but bound to all
three copies of the core B element. AB1 derivatives with one or two
mutant AP-1-binding elements exhibited reduced but measurable
inducer-dependent enhancer activity, but mutation of all three
AP-1-binding sites abolished activation by CdCl and heme
and also by mercury chloride, zinc chloride,
H O , sodium arsenate, and
12-O-tetradecanoylphorbol-13-acetate. Pretreatment of stably
transfected L929 cells with protein kinase C inhibitors, but not with
tyrosine kinase inhibitors or N-acetylcysteine, abrogated
12-O-tetradecanoylphorbol-13-acetate-dependent activation of
the AB1/chloramphenicol acetyltransferase fusion gene. Induction by
H O was unaffected by the kinase inhibitors, but
completely abolished by N-acetylcysteine. Heme-dependent
induction was not significantly affected by any of these chemicals.
INTRODUCTION
Heme oxygenase-1 (HO-1) ( )
catalyzes the
initial and rate-limiting reaction in heme (ferriprotoporphyrin IX)
catabolism. The expression of HO-1 is dramatically induced not only in
response to the substrate heme, but also by a variety of
stress-associated agents including tumor-promoting phorbol esters,
heavy metals, UV irradiation, and hyperthermia (reviewed in Ref. 1).
Stimulation of HO-1 expression by most agents is mediated primarily at
the level of gene transcription. A series of reports have described
distinct cis-acting DNA elements within the rat or human HO-1
gene that are important for basal expression
(2) or for
induction by hyperthermia
(3) , cytokines
(4) UV
irradiation
(5) , TPA
(6) , or heme (7). All of these
elements are located within or in the vicinity of the proximal promoter
of the rat or human HO-1 gene. In contrast, studies from our laboratory
have identified a 268-bp fragment, SX2, located 4 kbp upstream of
the transcription initiation site of the mouse HO-1 gene that functions
as a basal level enhancer and mediates induction of the heterologous
CAT gene by TPA
(8) , heme
(9) , and various heavy
metals
(9, 10) . This fragment contains two binding sites
each for the Fos/Jun (AP-1) and C/EBP families of transcription
factors, and mutational analysis indicates that, in the context of the
SX2 fragment, both types of elements are important for heavy
metal-dependent enhancer activity. Since multiple copies of the
AP-1-binding elements, but not the C/EBP elements, are necessary and
sufficient for activation of a heterologous gene by CdCl ,
the AP-1 proteins appear to play the primary role in the activation
process
(10) . Recently, Takeda et al.(11) isolated the human homolog of the SX2 region, and in
contrast to our results, their studies indicate that the AP-1 elements
do not mediate induction of a heterologous gene in response to cadmium.
In this report, we describe a second regulatory region, AB1, 10
kbp upstream of the mouse HO-1 gene with properties similar to SX2.
This fragment contains three copies of the AP-1-binding sequence, and
mutation of these elements abolishes induction not only by
CdCl , but also by heme and a variety of other HO-1
inducers. These results demonstrate for the first time that the
mechanism of HO-1 gene activation by diverse agents converges at the
same DNA motif and provide further evidence for the importance of
Fos/Jun proteins in this process. The signaling pathway leading to the
expression and/or activation of the transcription factors, however,
appears to be inducer-dependent.
EXPERIMENTAL PROCEDURES
DNase I was obtained from Worthington,
while restriction endonucleases and other DNA/RNA-modifying enzymes
were purchased from either Life Technologies, Inc. or New England
Biolabs Inc. DNA sequence analysis was carried out by the chain
termination method
(12) using the Sequenase version 2.0 kit from
United States Biochemical Corp. All radiolabeled nucleotides were
obtained from DuPont NEN. Heme (as hemin chloride) and cobalt
protoporphyrin IX were purchased from Porphyrin Products. Enzymes and
reagents for CAT and luciferase assays were purchased from Sigma.
Protein kinase C inhibitors, TPA, N-acetylcysteine, and
hydrogen peroxide were also purchased from Sigma. The protein-tyrosine
kinase inhibitors were obtained from Life Technologies, Inc. All other
chemicals were reagent-grade.
The construction of plasmids
pSKcat
(13, 14) , pMHO1cat, pMHO1cat -33,
pMHO3cat, pMHO4cat, and pRSVluc
(8) and pMHO9cat
(9) has
been described previously. The remainder of the constructs diagramed in
Fig. 1
were prepared by digestion of the BX2 fragment with the
appropriate restriction endonucleases, blunt-end repair using the
Klenow enzyme, and ligation into the BamHI (blunt-ended) site
of pMHO1cat. Subfragments (EA, AB1, BR, and RH (see Fig. 3)) of
EH2 were isolated after digestion with the appropriate restriction
endonucleases, blunt-ended, and cloned into the SpeI
(blunt-ended) site of plasmid pMHO1cat -33. The mouse HO-1
gene expression plasmids used to stably transfect C6 glioma cells were
constructed by cloning the appropriate blunt-ended restriction
fragments (see Fig. 1and Fig. 2) into the BamHI
site (blunt-ended) of plasmid pMHO4
(9) .
Figure 1:
Identification of a second enhancer
region upstream of the mouse HO-1 gene. A partial restriction
endonuclease map of the HO-1 gene locus is presented, with exons marked
by open boxes (untranslated regions) and solid boxes (protein-coding regions). All recognition sites for restriction
endonucleases BamHI (B), EcoRI (E),
HindIII (H), and XhoI (X) are
shown, and the sites marked by dashed lines are derived from
the cloning vector. Position +1 represents the transcription
initiation site. The portion of the 5`-flanking region (and part of
exon 1) cloned in the CAT expression vector and the fragments (BX1 and
BX2) used in the experiment depicted in Fig. 2 are appropriately
positioned below the restriction endonuclease map. The locations of the
previously defined enhancer, SX2, and the EH2 fragment identified in
this study are also presented. Transient transfection and CAT assays
were carried out as described under ``Experimental
Procedures.'' For each construct, the average value from four to
six independent transfections is presented as a percentage of the
activity from pMHO1cat-transfected cells. Part of the data have been
previously published (12).
Figure 3:
Localization of the transcription enhancer
activity to a 161-bp subfragment of EH2. The EH2 fragment was cloned
into plasmid pMHO1cat as diagramed in Fig. 1. Subfragments of EH2 were
cloned in the vector pMHO1cat -33. Transient (in L929 cells)
and stable transfections and analyses were carried out as described
under ``Experimental Procedures.'' For each construct, the
data represent the average value from three to five independent
experiments. E, EcoRI; A, AflII;
B, BsrBI; R, RsaI; H,
HindIII; REL CAT ACT, relative CAT
activity.
Figure 2:
Induction of mouse HO-1 gene constructs
stably integrated into rat C6 glioma cells. Monolayers of C6 cells
stably transfected with plasmid pMHO4SX2 (lanes a-d),
pMHO4BX1 (lanes e-h), or pMHO4BX2 (lanes
i-l) were treated with vehicle (lanes a,
e, and i), ZnCl (lanes b,
f, and j), heme (lanes c, g, and
k), or cobalt protoporphyrin IX (lanes d, h,
and l) for 3 h in serum-free medium. Total RNA was isolated,
and 10-µg portions were analyzed by RNase protection assays as
described under ``Experimental Procedures.'' The migration
positions of the mature mouse HO-1 mRNA (mHO-1), the mouse
HO-1 unspliced pre-mRNA (pre mHO-1), and the rat HO-1 mRNA
(rHO-1) are marked. The sizes (in bases) of the marker
fragments (laneM; HaeIII digestion products
of pBluescript II SK ) are
indicated.
Oligonucleotide-directed
mutagenesis was carried out according to the method of Deng and
Nickoloff
(15) , except that single-stranded DNA was used as a
template, and the mutagenic primer directed to an unique restriction
endonuclease site was omitted. Mutagenesis was carried out directly on
the single-strand form of plasmid pMHO1cat -33+AB1.
Multiple mutations were generated either simultaneously using
combinations of primers or successively by multiple rounds of
mutagenesis. All mutations were confirmed by DNA sequence analysis. The
sequences of the mutagenic oligonucleotides and the targets are as
follows: ccttttctgcTAGATCTaggtccggggctg, 5`-AP-1-binding site;
tgtgacgcTAGATCTggtcccgaggtctgt, central AP-1 element; and
gttttcgcTAAGCTTggttcccgttgctcc, 3`-AP-1 element. The upper-case
sequences represent the mutant versions of the AP-1-binding sequence
(TGAGTCA).
Mouse fibroblast L929, rat C6 glioma, and mouse hepatoma
(Hepa) cells were maintained in Dulbecco's modified Eagle's
medium containing 0.45% glucose and supplemented with 10% fetal bovine
serum. Transient and stable transfections were carried out by the
calcium phosphate precipitation technique
(16) as described
previously
(8) . For transient transfection, cultured cells
( 5 10 /60-mm plate) were plated 16 h prior to
transfection for 6 h with 16 µg (Fig. 1) or 7.5 µg
(Fig. 3) of a DNA mixture containing 1 pmol of the CAT expression
plasmid, 1 µg of pRSVluc, and an appropriate amount of pBluescript
II SK (pBSSK , Stratagene). After a
1-min treatment with 10% glycerol in phosphate-buffered saline, the
cells were cultured in complete medium for 40 h. Aliquots of cell
extracts containing equivalent amounts of luciferase activity were used
for CAT assays. To generate stable transfectants, cells (1-2
10 /10-cm plate) were transfected for 16 h with a
DNA mixture composed of 10 µg of the CAT or mouse HO-1 expression
plasmid and 1 µg of pSV2neo
(17) . The precipitate was
removed, and the cells were cultured in complete medium. Geneticin
(G418 sulfate) was added 24 h later to a final concentration of 500
µg/ml, and resistant colonies were selected over a 3-week period.
Pooled stable transfectants containing the CAT plasmids were seeded in
12-well plates at a density of 4 10 cells/well.
Fourty hours after plating, cells were washed twice with 1 ml of
phosphate-buffered saline and incubated at 37 °C in 2 ml of
serum-free medium containing vehicle or the indicated agent. After 3 h,
the cells were washed twice with phosphate-buffered saline and cultured
in complete medium for 4 h. H O treatment was
carried out in serum-containing medium for only 1 h with a recovery
period of 6 h. The inducers were used at the following concentrations:
CdCl , heme, and cobalt protoporphyrin IX, 10
µM; ZnCl , 50 µM;
HgCl , 5 µM; sodium arsenate, 100
µM; H O , 600 µM; and
TPA, 100 ng/ml. For the experiments depicted in Fig. 8,
N-acetylcysteine (20 mM) and the protein kinase
inhibitors were added 1 h prior to the addition of vehicle or the
inducing agent and were present during the induction and post-induction
periods. For these experiments, the post-induction period lasted 16 h
instead of 4 or 6 h as described above. The concentration of
staurosporin was 10 µM, and all the other inhibitors were
used at a final concentration of 1 µM. Cell extracts were
prepared as previously described
(8) , and aliquots equivalent to
3.0 µg of protein were used to measure CAT activity by the
procedure of Nordeen et al.(18) . Background CAT
activity from cells transfected with the promoterless vector pSKcat was
subtracted from each experimental measurement prior to calculation of
relative activity or -fold induction. Specific CAT activity was
calculated using purified CAT enzyme as a standard. One unit of CAT
converts 1 nmol of chloramphenicol and acetyl-CoA to chloramphenicol
3-acetate and CoA in 1 min at pH 7.8 and 25 °C. Luciferase assays
were carried out as described previously
(8) .
Figure 8:
Effect of N-acetylcysteine and
protein kinase inhibitors on inducer-mediated CAT gene activation. L929
cells stably transfected with plasmid pMHO1cat -33+AB1
were plated, treated with vehicle or the indicated inducers in the
presence or absence of N-acetylcysteine (NAC) or the
protein kinase inhibitors, and analyzed as described under
``Experimental Procedures.'' Each data point represents the
mean ± S.D. from three independent experiments. LAV,
lavendustin A; GEN, genistein; STAUR, staurosporin;
CALP C, calphostin C.
Total RNA from
stably transfected C6 cells was isolated by the acid guanidinium
thiocyanate/phenol/chloroform extraction procedure of Chomczynski and
Sacchi
(19) . The level of correctly initiated mouse HO-1 mRNA
was measured by RNase protection assays using standard techniques
(20).The in vitro generated RNA probe used
for these assays is 330 bases in length and contains sequences
complementary to residues -60 to +211 of the mouse HO-1 gene
and 59 bases of vector-derived sequence. The probe used for these
assays protects 151 bases of the correctly initiated mouse HO-1 mRNA
and 211 bases of the unspliced pre-mRNA. In addition, this probe
protects a series of fragments, 45-49 bases in length, of
the rat HO-1 transcript.
Nuclear protein extracts
from Hepa cells were prepared according to Dignam et
al.(21) . The extracts were fractionated with 50% ammonium
sulfate, and the precipitated proteins were resuspended and dialyzed
twice for 5 h against 20 mM Hepes/KOH (pH 7.9) containing 0.1
M KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol,
0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM
benzamidine, and 20% glycerol. The dialysate was clarified by
centrifugation and stored at -70 °C. Fragment AB1 probes were
generated as follows. Plasmid pMHO1cat -33 was linearized by
digestion with BamHI or NotI (which cleave at
vector-encoded sequences on either side of the AB1 fragment). A
1-µg sample of each linear plasmid was labeled by the ``end
fill'' reaction using the Klenow fragment of Escherichia coli DNA polymerase I and a dNTP mixture containing
[ - P]dCTP and
[ - P]dATP. The probe fragments, individually
labeled on the noncoding strand (BamHI-digested plasmid) or
the coding strand (NotI-digested plasmid), were liberated by
subsequent digestion with SacI or XbaI, respectively,
and purified by polyacrylamide gel electrophoresis. Protein binding
reactions and DNase I digestion were carried out as described by Lee
et al.(22) with slight modifications. Briefly, the
labeled fragment (20,000 cpm) was mixed with varying amounts of crude
protein extract in a total volume of 50 µl with a final buffer
concentration of 10 mM Tris-HCl, 8 mM Hepes/KOH (pH
7.9), 0.5 mM EDTA, 40 mM KCl, 0.7 mM
dithiothreitol, 1 µg of poly[d(I-C)], 10% glycerol, and
2% polyvinyl alcohol. The mixture was prepared on ice and incubated for
20 min at ambient temperature. The DNA/protein mixture was digested for
30 s with the addition of 100 µl of a freshly prepared solution
(70-550 ng/ml) of DNase I in 10 mM MgCl and
4 µM CaCl . The reaction was terminated by the
addition of 150 µl of a solution containing 8 M urea, 0.5%
SDS, 5 mM EDTA, and 10 µg/ml denatured salmon sperm DNA
and subsequently extracted with phenol/chloroform (1:1 mixture).
Digestion products (4000 cpm) were coelectrophoresed with the purine
sequence ladders
(23) of the DNA probes on an 8 M urea,
6% polyacrylamide gel.
The sequences (5` to 3`) of the sense strands
of the competitor oligodeoxynucleotides are as follows: AP-1/SX2,
CTTTTGCTGAGTCACCCTCTGTTG; CEBP/SX2, ATTTCCTCACTGCTCATTTCCTCA; CEBP/HIV,
GCTTGCTACAAGGGCTTGCTACAAGG; core A, AGGAATCCGGAGCTGTGCCTTT; CRE,
AAATTGACGTCATGGTAA; NF- B, GGGACTTTCCGCTGGGGACTTTCCA; and Sp1,
GGAGGCGTGGCCTGGGCGGGGACTGGGGAGTGGC. Both the sense and antisense
strands were synthesized with 5`-GATC overhangs.
We previously reported that in transient
transfection assays, the basal expression of pMHO4cat, a chimera
containing 7 kbp of the 5`-flanking region of the mouse HO-1 gene, was
significantly greater than that of pMHO1cat, which contains only 1287
bp of upstream sequence (Ref. 8; see Fig. 1). While the largest
difference in expression between these two constructs, 11-fold,
was observed in rat C6 glioma cells, a 2-5-fold difference was
consistently seen in all cell lines tested, including mouse Hepa and
fibroblast L929 cells. The transcriptionally active sequences in
pMHO4cat were localized to the SX2 fragment 4 kbp upstream of the
transcription initiation site. Functional analysis of 5`-flanking
sequences upstream of kbp -7 indicated that the HO-1 gene locus
contains a second basal level enhancer. The level of expression of
pMHO9cat, which contains 5`-flanking sequence to kbp -12.9, was
2-3 times greater than that of pMHO4cat in L929 and Hepa cells.
Under the conditions of the experiment depicted in Fig. 1, this
enhancer activity was less apparent in C6 cells. By examining
subfragments between kbp -7 and -12.9, the second basal level
enhancer was localized to within the 0.9-kbp EH2 fragment (kbp
-10.4 to -9.5).
Previous studies demonstrated that
the mouse HO-1 gene, when stably transfected into rat C6 cells, was
readily activated by heme and CdCl (9) . This
induction was strictly dependent on the presence of the 9.4-kbp
BamHI/BamHI 5`-flanking fragment (kbp -12.9 to
3.5). This fragment was digested at the unique XhoI site to
generate the 3.5-kbp BX1 fragment and the 5.9-kbp BX2 fragment
(Fig. 1), both of which were cloned upstream of the promoter and
coding region of the mouse HO-1 gene in plasmid pMHO4 and stably
transfected into C6 cells. The expression of the transfected mouse HO-1
gene and the endogenous rat HO-1 gene was analyzed by RNase protection
assays. As shown in Fig. 2, both the BX1 and BX2 constructs were
activated by heme, ZnCl , and the heme analog cobalt
protoporphyrin IX. The level of induction of the mouse HO-1 gene by
these agents roughly paralleled that of the endogenous rat HO-1 gene.
As expected, the SX2 fragment also mediated induction of the HO-1 gene
by these agents. The parent construct, pMHO4, was not activated by any
of these agents (data not shown)
(9) . Although not tested
directly (but see below), the inducer-responsive sequences within BX2
are presumably located in the EH2 fragment. These results demonstrate
that the mouse HO-1 gene 5`-flanking segment contains at least two
distal regulatory regions that function as basal level and
inducer-dependent enhancers.
To further localize the enhancer
activity, four subfragments of EH2 were cloned into the vector
pMHO1cat -33 and initially analyzed by transient expression
assays in L929 cells. Plasmid pMHO1cat -33, which contains
the minimal mouse HO-1 promoter (positions -33 to +73), was
used in this study instead of pMHO1cat because its low basal expression
permits sensitive detection of the transcriptional activity of test
fragments. Three of the four subfragments of EH2 increased the
expression of pMHO1cat -33 by varying amounts, with the
highest level ( 44-fold) observed with the AB1 subfragment
(Fig. 3). When stably transfected into either Hepa or L929 cells,
however, only the AB1 subclone was activated by heme or
CdCl . While in Hepa cells the level of induction of
pMHO1cat -33+AB1 was similar to that of
pMHO1cat+EH2, it was 5-6-fold greater in L929 cells. This
variation was due to the absence of the majority of the HO-1 proximal
promoter in the AB1 construct. A similar variation was observed with
analogous plasmids containing the SX2 fragment
(10) .
The sequence
of the 161-bp AB1 fragment, presented in Fig. 4A,
contains three copies of an element that is identical to the
consensus-binding site (TGA(G/C)TCA) for the AP-1 family of
transcription factors. In addition, the AB1 fragment contains motifs
similar to the consensus-binding elements for the transcription factors
Sp1
(24) and C/EBP
(25) . A closer examination of the
sequence revealed that the internal portion of the AB1 fragment is
composed of three tandem repeats containing two conserved core
elements, A and B (Fig. 4B). Core B contains the
AP-1-binding site, whereas the identity of the core A element is
presently unknown. The 3`-end of the core A element, however, does
resemble the binding site for the AP-4 transcription
factor
(26) .
Figure 4:
Nucleotide sequence of the AB1 enhancer
fragment. A, the complete sequence (5` to 3`) of the noncoding
strand of the AB1 fragment is presented. Elements similar or identical
to the consensus-binding site for the indicated transcription factors
are marked. Nuclear proteins from Hepa cells specifically bind to these
regions (see Fig. 5). B, AB1 internal sequences are manually
aligned to identify repeat motifs. Dashes were introduced to
maximize sequence similarity. The consensus sequences for the core A
and B elements were derived by using those nucleotides conserved in at
least two of the three repeat motifs. The consensus-binding sites for
the AP-4 and AP-1 transcription factors are also
presented.
DNase I footprint analysis was carried out to determine
if any of the motifs identified by similarity to consensus sequences
interact with site-specific nuclear factors. Nuclear proteins from Hepa
cells bound to all three putative AP-1 recognition sites, and this
interaction was completely abolished in the presence of excess
unlabeled oligonucleotides containing the AP-1-binding sequence from
the SX2 enhancer fragment (Fig. 5). The specificity of this
interaction was further established by the fact that oligonucleotides
containing one of the core A elements or the binding sites for
NF- B or Sp1 did not alter protein binding at these AP-1 sites. As
expected, the highly similar CRE (TGACGTCA), known to bind AP-1
proteins, was an effective competitor of the AP-1-binding element.
Surprisingly, an oligonucleotide containing both C/EBP-binding sites of
the SX2 fragment was as efficient a competitor as the AP-1 and CRE
oligonucleotides for the AP-1 elements. Furthermore, a C/EBP-binding
sequence from the human immunodeficiency virus long terminal repeat
also diminished protein binding at AP-1, but to a lesser extent than
that observed with the SX2 C/EBP oligonucleotide. Conversely, excess
AP-1 and CRE oligonucleotides specifically inhibited protein binding at
the putative C/EBP recognition sequence in the AB-1 fragment. These
cross-family inhibitions of protein-DNA interactions may be related to
the recently observed associations between members of the AP-1 and
C/EBP families of transcription factors
(27, 28) . The
identity of the putative Sp1-binding site was also confirmed by
competition experiments. No protein binding was observed at any of the
core A elements.
Figure 5:
Nuclear protein binding analysis of the
AB1 enhancer fragment. The 3`-end of the coding and noncoding strands
of fragment AB1 were individually end-labeled by the end fill reaction.
DNase I protection assays were carried out using 0, 15, 30, or 60
µg of nuclear protein extract from Hepa cells. In the competition
experiments, 30 µg (coding strand) or 60 µg (noncoding strand)
of nuclear proteins were used for each reaction, and the indicated
competitor oligonucleotides were present at a 200-fold molar excess.
The DNase I digestion products were coelectrophoresed with the G +
A chemical sequencing ladder of each strand on a denaturing 8%
polyacrylamide gel and autoradiographed for 48 h. The regions protected
from DNase I digestion are delimited by rectangles (open, putative C/EBP-binding site; hatched,
AP-1; solid, Sp1). The Sp1-binding site is not protected on
the noncoding strand, and the length of the rectangle is determined by
the hypersensitivity observed in the presence of the Sp1 competitor
oligonucleotide.
Based on the analysis of two
independent pools of stably transfected L929 cells, the expression of
pMHO1cat -33+AB1 was stimulated an average of 17.5- or
20.7-fold after treatment of cells with CdCl or heme,
respectively (Fig. 6). Site-directed mutagenesis of a single
AP-1-binding site, which abolished protein binding at that site (data
not shown), reduced the level of induction to 44-50%
(CdCl ) or to 59-96% (heme) of that observed with the
parent construct. Residual inducible enhancer activity was still
observed with two-site mutant constructs (1.4-1.8-fold, cadmium;
2.4-4.0-fold, heme), but completely abolished after mutation of
all three AP-1-binding sites (AB1M45). The AB1 fragment also mediated
activation of the CAT gene in response to other HO-1 inducers including
ZnCl , HgCl , H O , sodium
arsenate, and TPA (Fig. 7). Mutation of all three AP-1-binding
sites abolished gene activation in response to all inducers.
Figure 6:
Site-directed mutagenesis of the
AP-1-binding elements in the AB1 fragment abolishes inducer-dependent
enhancer activity. Site-directed mutants of plasmid
pMHO1cat -33+AB1 corresponding to the diagramed
fragments were transfected into L929 cells. Pooled stable transfectants
were cultured, treated, and analyzed as described under
``Experimental Procedures.'' Specific CAT activity (in 1
µg of protein extract) was calculated; each data point represents
the mean ± S.D. from three to seven independent measurements,
and -fold induction is given in parentheses. Mutations are
indicated by an X across the appropriate
element.
Figure 7:
Effect of various agents on CAT expression
in stably transfected L929 cells. Cells transfected with
pMHO1cat -33+AB1 or pMHO1cat -33+AB1M45
were plated, treated with the indicated agents, and analyzed as
described under ``Experimental Procedures.'' Each data point
represents the mean ± S.D. from three to five independent
experiments. Ars, sodium arsenate.
AP-1 activity is regulated by several
different mechanisms including oxidation/reduction reactions
(29) and phosphorylation
(30) resulting from the
activation of various protein kinase-dependent signal transduction
pathways. To determine if one or more of these mechanisms is involved
in HO-1 gene regulation, we tested the effect of
N-acetylcysteine (a reducing agent and glutathione precursor)
and various protein kinase C and protein-tyrosine kinase inhibitors on
inducer-dependent activation of the AB1/CAT fusion gene in L929 cells.
As expected, pretreatment of cells with the protein kinase C inhibitors
(calphostin C and staurosporin), but not with the protein-tyrosine
kinase inhibitors (genistein and lavendustin A), blunted induction by
TPA, a potent protein kinase C activator (Fig. 8A). TPA
also functions as a pro-oxidant, but N-acetylcysteine had no
visible effect on TPA-mediated activation of the CAT reporter gene. In
contrast, N-acetylcysteine completely abolished induction by
H O (Fig. 8B). The kinase
inhibitors had no effect on H O -mediated CAT
gene activation. Induction by heme was not significantly affected by
any of these chemicals. These results indicate that although many
agents activate the HO-1 gene through the same cis-acting
elements (i.e. AP-1-binding sites), they utilize different
transcription factor activation pathways for this process.
Functional analysis of 16 kbp of the 5`-flanking
sequence of the mouse HO-1 gene indicates that this locus contains two
regions (a 268-bp fragment, SX2, 4 kbp from the transcription
initiation site (12-14) and a 161-bp fragment, AB1, 6 kbp further
upstream of SX2 (this report)) that possess inducer-dependent
transcription enhancer activity. Previous analysis of the SX2 enhancer
suggested that members of the AP-1 family of proteins play a primary
role in transcriptional activation of the HO-1 gene by heavy metals as
mutation of both AP-1-binding sites reduced cadmium-mediated induction
by >80% (10). The present study further substantiates this
conclusion as the AB1 fragment also contains multiple AP-1 elements,
and mutation of these motifs completely abolishes cadmium-dependent AB1
enhancer activity. We also demonstrate here that the actions of a
chemically diverse group of HO-1 inducers, including heme, heavy
metals, TPA, H O , and sodium arsenate, all
converge at the AP-1-binding site. This result is consistent with our
previous prediction that most agents utilize one or a limited number of
transcription factors for activation of the HO-1 gene
(9) .
Although all inducers thus far tested require intact AP-1-binding
sites for activation of the AB1/CAT fusion gene, some of these agents
clearly utilize either different AP-1 member proteins and/or different
AP-1 transcription factor activation pathways for this process. As
expected, induction by TPA requires activation of protein kinase C. The
protein kinase C pathway is known not only to stimulate the expression
of c-fos and c-jun(31) , but also to enhance
AP-1 DNA-binding activity by dephosphorylation of c-Jun at one or more
sites that negatively regulate DNA-binding function
(32) .
Consistent with these mechanisms, treatment of Hepa or L929 cells with
TPA increases the level of nuclear AP-1-specific, DNA-binding activity
by 2-3-fold
(10) . ( )
In contrast
to that observed with TPA, induction of the AB1/CAT gene by
H O apparently does not involve protein kinase
C, but is dependent on the redox state of the cell. Reduction/oxidation
reactions are known to modulate the activity of various transcription
factors
(33, 34) including the DNA-binding activity of
the c-Fos-c-Jun heterodimer
(29) . Although the effect of
hydrogen peroxide on AP-1 DNA-binding activity in Hepa or L929 cells
was not examined, H O does induce this activity
in HeLa cells (31).
Since treatment of Hepa or L929 cells with heme
does not alter the nuclear concentration of AP-1 DNA-binding
activity
(10) , induction of the HO-1 gene by this agent probably
occurs by a mechanism that involves modulation of the transactivation
properties of one or more of the AP-1 member proteins. One potential
target for such regulation is c-Jun, the transactivation potential of
which is elevated by phosphorylation within the N-terminal activation
domain in response to mitogenic stimulation or expression of
transforming oncoproteins (reviewed in Ref. 30) and by UV
irradiation
(35) , a potent inducer of HO-1 gene transcription.
Phosphorylation of c-Jun in response to UV irradiation is mediated by a
Ras-dependent kinase cascade and is sensitive to protein-tyrosine
kinase inhibitors. Clearly, if the mechanism of AB1/CAT fusion gene
induction by heme (or, for that matter, by TPA and
H O ) involves phosphorylation of c-Jun within
the activation domain, this process occurs by a pathway independent of
protein-tyrosine kinases. Heme-mediated gene activation is also
insensitive to protein kinase C inhibitors and
N-acetylcysteine. The latter observation is consistent with
results from previous studies demonstrating that the antioxidants
-tocopherol and allopurinol do not inhibit heme-dependent
stimulation of heme oxygenase activity in rat liver
(36) .
The
AB1 fragment contains three AP-1-binding sites, each of which is
identical to the AP-1 consensus sequence (TGAGTCA). The distances
between the end of one AP-1 heptad and the beginning of the next heptad
are 21 and 22 bp, or two full turns of the B-DNA helix. AP-1 proteins
would therefore bind to the same face of the DNA helix with the
potential for cooperative interaction. That such interaction occurs at
the AB1 locus is strongly suggested by the results obtained with the
site-directed mutants. For example, AB1 mutant constructs with only one
intact AP-1-binding site (AB1M29, AB1M30, and AB1M31) are induced an
average of 1.6-fold by CdCl , whereas mutants with two
intact AP-1-binding elements (AB1M14, AB1M15, and AB1M16) are induced
an average of 8.4-fold. This synergism is also observed with
heme-mediated activation of the AB1/CAT fusion genes. Furthermore,
previous studies
(10) demonstrated that a single copy of either
of the AP-1 elements of the SX2 fragment cannot activate the CAT gene
in response to CdCl ; multimerized elements are necessary
for induction. Taken together, these results support a mechanism of
inducer-dependent HO-1 gene activation that involves cooperative
interaction between AP-1 proteins bound at adjacent sites.
Of
course, positive cooperativity between duplicated or multimerized
elements or between different elements, whether in artificial or
natural settings, has been extensively documented. A classical example
is the requirement of multiple, active metal regulatory elements for
induction of metallothionein genes in response to heavy
metals
(37) . This type of cooperativity may be of particular
significance for AP-1-dependent gene regulation. Unlike metal
regulatory elements, AP-1-binding sites have been identified within the
regulatory sequences of a large number of genes. For instance, in a
recent survey of the Eukaryotic Promoter Data Base (EMBL release 37,
March 1994), 94 out of the 1230 entries contained AP-1-binding
elements. This ratio is almost certainly an underestimate of the total
percentage of genes with AP-1-binding sites since the data base
contains only sequences from positions -499 to +100 and only
canonical AP-1 sequences were scored in this search. The abundance of
AP-1 target genes reflects the fact that the AP-1 transcription factors
regulate, at least in part, many complex biological processes including
cellular growth and differentiation. Presumably, only a subset of these
AP-1 target gene products would be involved in protection against or in
response to oxidant injury. Selective activation of these genes may be
achieved by a mechanism requiring cooperative interaction between AP-1
proteins bound at adjacent sites. This restriction would prevent the
activation of the majority of AP-1 target genes with only a single
binding site.
Takeda et al.(11) recently isolated
and characterized the human homolog of the SX2 region. Surprisingly,
these investigators identified a cadmium-responsive element completely
different from the AP-1 motif and, in fact, were unable to demonstrate
a direct role for the conserved AP-1 element in cadmium-mediated
activation of the human HO-1 gene. The reason for the discrepancy is
not clear, but may reflect the fact that different cell lines were
utilized for characterization of the mouse and human enhancers. More
important, the human SX2 region was analyzed using transient expression
assay, a procedure in which the mouse SX2 and AB1 fragments do not
exhibit inducer-dependent enhancer activity, at least in the cell lines
thus far examined.
Finally, the significance of two upstream
regulatory regions within the mouse HO-1 gene locus is presently
unclear. Optimal activation of the HO-1 gene may require cooperative
interaction between the SX2 and AB1 enhancers. Alternatively, these
regions may function in a mutually exclusive manner depending on, for
example, the nature of the inducer and/or the developmental or
differentiation state of the target tissue. Studies to address this
issue are currently in progress.
FOOTNOTES
- *
- This work was
supported by United States Public Health Service Grant DK-43135. The
costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank /EMBL Data Bank with accession number(s) L37439.
- §
- To whom correspondence should be addressed:
Dept. of Molecular Genetics, Alton Ochsner Medical Foundation, 1516
Jefferson Highway, New Orleans, LA 70121. Tel.: 504-842-3314; Fax:
504-842-3381.
- The abbreviations used are: HO-1,
heme oxygenase-1; TPA, 12-O-tetradecanoylphorbol-13-acetate;
AP-1, activator protein-1; bp, base pair(s); kbp, kilobase pair(s);
CAT, chloramphenicol acetyltransferase; C/EBP, CCAAT/enhancer-binding
protein; CRE, cAMP response element; NF-
B, nuclear factor- B.
- J. Alam, unpublished data.
ACKNOWLEDGEMENTS
We thank Bridgette Hagler for preparation of the
manuscript.
REFERENCES
- Maines, M. D.(1992) Heme Oxygenase: Clinical Applications and Functions, CRC Press, Inc., Boca Raton, FL
- Sato, M., Fukushi, Y., Ishizawa, S., Okinaga, S., Muller, R. M., and Shibahara, S.(1989) J. Biol. Chem. 264, 10251-10260
[Abstract/Free Full Text]
- Shibahara, S., Muller, R. M., and Taguchi, H.(1987) J. Biol. Chem. 262, 12889-12892
[Abstract/Free Full Text]
- Mitani, K., Fujita, H., Kappas, A., and Sassa, S.(1992) Blood 79, 1255-1259
[Abstract/Free Full Text]
- Nascimento, A. L. T. O., Luscher, P., and Tyrrell, R. M.(1993) Nucleic Acids Res. 21, 1103-1109
[Abstract/Free Full Text]
- Muraosa, Y., and Shibahara, S.(1993) Mol. Cell. Biol. 13, 7881-7891
[Abstract/Free Full Text]
- Lavrovsky, Y., Schwartzman, M. L., Levere, R. D., Kappas, A., and Abraham, N. G.(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5987-5991
[Abstract/Free Full Text]
- Alam, J., and Zhining, D.(1992) J. Biol. Chem. 267, 21894-21900
[Abstract/Free Full Text]
- Alam, J., Cai, J., and Smith, A.(1994) J. Biol. Chem. 269, 1001-1009
[Abstract/Free Full Text]
- Alam, J.(1994) J. Biol. Chem. 269, 25049-25056
[Abstract/Free Full Text]
- Takeda, K., Ishizawa, S., Sato, M., Yoshida, T., and Shibahara, S. (1994) J. Biol. Chem. 269, 22858-22867
[Abstract/Free Full Text]
- Sanger, F., Nicklen, S., and Coulson, A. R.(1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467
[Abstract/Free Full Text]
- Alam, J., and Cook, J. L.(1990) Anal. Biochem. 188, 245-254
[CrossRef][Medline]
[Order article via Infotrieve]
- Alam, J., Yu, N., Irias, S., Cook, J. L., and Vig, E.(1991) BioTechniques 10, 423-425
- Deng, W. P., and Nickoloff, J. A.(1992) Anal. Biochem. 200, 81-88
[CrossRef][Medline]
[Order article via Infotrieve]
- Graham, F. L., and van der Eb, A. J.(1973) Virology 52, 456-467
[CrossRef][Medline]
[Order article via Infotrieve]
- Southern, P. J., and Berg, P.(1982) J. Mol. Appl. Genet. 1, 327-341
[Medline]
[Order article via Infotrieve]
- Nordeen, S. K., Green, P. P., III, and Fowlkes, D. M.(1987) DNA (N. Y.) 6, 173-178
[Medline]
[Order article via Infotrieve]
- Chomczynski, P., and Sacchi, N.(1987) Anal. Biochem. 162, 156-159
[Medline]
[Order article via Infotrieve]
- Sambrook, J., Fritsch, E. F., and Maniatis, T.(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Dignam, J. D., Lebovitz, R. M., and Roeder, R. G.(1983) Nucleic Acids Res. 11, 1475-1489
[Abstract/Free Full Text]
- Lee, W., Mitchell, P., and Tjian, R.(1987) Cell 49, 741-752
[CrossRef][Medline]
[Order article via Infotrieve]
- Maxam, A. M., and Gilbert, W.(1980) Methods Enzymol. 65, 499-560
[Medline]
[Order article via Infotrieve]
- Courey, A. J., and Tjian, R.(1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) Vol. 2, pp. 743-770, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- McKnight, S. L.(1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) Vol. 2, pp. 771-796, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Mermod, N., Williams, T. J., and Tjian, R.(1988) Nature 332, 557-561
[CrossRef][Medline]
[Order article via Infotrieve]
- Hsu, W., Kerppola, T. K., Chen, P.-L., Curran, T., and Chen-Kiang, S. (1994) Mol. Cell. Biol. 14, 268-276
[Abstract/Free Full Text]
- Klampfer, L., Lee, T. H., Hsu, W., Vilcek, J., and Chen-Kiang, S. (1994) Mol. Cell. Biol. 14, 6561-6569
[Abstract/Free Full Text]
- Abate, C., Patel, L., Rauscher, F. J., III, and Curran, T.(1990) Science 249, 1157-1161
[Abstract/Free Full Text]
- Hunter, T., and Karin, M.(1992) Cell 70, 375-387
[CrossRef][Medline]
[Order article via Infotrieve]
- Devary, Y., Gottlieb, R. A., Lau, L. F., and Karin, M.(1991) Mol. Cell. Biol. 11, 2804-2811
[Abstract/Free Full Text]
- Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T.(1991) Cell 64, 573-584
[CrossRef][Medline]
[Order article via Infotrieve]
- Macbride, A. A., Klausner, R. D., and Howley, P. M.(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7531-7535
[Abstract/Free Full Text]
- Meyer, M., Pahl, H. L., and Baeuerle, P. A.(1994) Chem. Biol. Interact. 91, 91-100
[CrossRef][Medline]
[Order article via Infotrieve]
- Devary, Y., Gottlieb, R. A., Smeal, T., and Karin, M.(1992) Cell 71, 1081-1091
[CrossRef][Medline]
[Order article via Infotrieve]
- Tomaro, M. L., Frydman, J., and Frydman, R. B.(1991) Arch. Biochem. Biophys. 286, 610-617
[CrossRef][Medline]
[Order article via Infotrieve]
- Stuart, G. W., Searle, P. F., Chen, H. Y., Brinster, R. L., and Palmiter, R. D.(1984) Proc. Natl. Acad. Sci. U. S. A. 81, 7318-7322
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Iwasaki, K. Hailemariam, and Y. Tsuji
PIAS3 Interacts with ATF1 and Regulates the Human Ferritin H Gene through an Antioxidant-responsive Element
J. Biol. Chem.,
August 3, 2007;
282(31):
22335 - 22343.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Gong and A. I. Cederbaum
Transcription Factor Nrf2 Protects HepG2 Cells against CYP2E1 plus Arachidonic Acid-dependent Toxicity
J. Biol. Chem.,
May 26, 2006;
281(21):
14573 - 14579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Ryter, J. Alam, and A. M. K. Choi
Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications
Physiol Rev,
April 1, 2006;
86(2):
583 - 650.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Wu and A. I. Cederbaum
Opposite action of S-adenosyl methionine and its metabolites on CYP2E1-mediated toxicity in pyrazole-induced rat hepatocytes and HepG2 E47 cells
Am J Physiol Gastrointest Liver Physiol,
April 1, 2006;
290(4):
G674 - G684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-J. Min, M.-s. Yang, S.-U. Kim, I. Jou, and E.-h. Joe
Astrocytes Induce Hemeoxygenase-1 Expression in Microglia: A Feasible Mechanism for Preventing Excessive Brain Inflammation
J. Neurosci.,
February 8, 2006;
26(6):
1880 - 1887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Morse and A. M. K. Choi
Heme Oxygenase-1: From Bench to Bedside
Am. J. Respir. Crit. Care Med.,
September 15, 2005;
172(6):
660 - 670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Chung, Y.-H. Chen, and M. A. Perrella
Role of Ets-2 in the Regulation of Heme Oxygenase-1 by Endotoxin
J. Biol. Chem.,
February 11, 2005;
280(6):
4578 - 4584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Sikorski, T. Hock, N. Hill-Kapturczak, and A. Agarwal
The story so far: molecular regulation of the heme oxygenase-1 gene in renal injury
Am J Physiol Renal Physiol,
March 1, 2004;
286(3):
F425 - F441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. A. D. T. G. Wagener, H.-D. Volk, D. Willis, N. G. Abraham, M. P. Soares, G. J. Adema, and C. G. Figdor
Different Faces of the Heme-Heme Oxygenase System in Inflammation
Pharmacol. Rev.,
September 1, 2003;
55(3):
551 - 571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hill-Kapturczak, E. Sikorski, C. Voakes, J. Garcia, H. S. Nick, and A. Agarwal
An internal enhancer regulates heme- and cadmium-mediated induction of human heme oxygenase-1
Am J Physiol Renal Physiol,
September 1, 2003;
285(3):
F515 - F523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hill-Kapturczak, C. Voakes, J. Garcia, G. Visner, H. S. Nick, and A. Agarwal
A cis-Acting Region Regulates Oxidized Lipid-Mediated Induction of the Human Heme Oxygenase-1 Gene in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol.,
August 1, 2003;
23(8):
1416 - 1422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wright, J. J. Higgin, R. T. Raines, C. Steenbergen, and E. Murphy
Activation of the Prolyl Hydroxylase Oxygen-sensor Results in Induction of GLUT1, Heme Oxygenase-1, and Nitric-oxide Synthase Proteins and Confers Protection from Metabolic Inhibition to Cardiomyocytes
J. Biol. Chem.,
May 23, 2003;
278(22):
20235 - 20239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kietzmann, A. Samoylenko, and S. Immenschuh
Transcriptional Regulation of Heme Oxygenase-1 Gene Expression by MAP Kinases of th | |