Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alam, J.
Right arrow Articles by Choi, A. M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alam, J.
Right arrow Articles by Choi, A. M. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 20, Issue of May 19, pp. 11977-11984, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of a Second Region Upstream of the Mouse Heme Oxygenase-1 Gene That Functions as a Basal Level and Inducer-dependent Transcription Enhancer (*)

Jawed Alam (1) (2)(§), Sharon Camhi (3), Augustine M. K. Choi (3)

From the (1) Department of Molecular Genetics, Alton Ochsner Medical Foundation and the (2) Department of Biochemistry and Molecular Biology, Louisiana State University Medical Center, New Orleans, Louisiana 70121 and the (3) Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A 161-base pair fragment (AB1) 10 kilobase pairs upstream of the transcription start site of the mouse heme oxygenase-1 gene functions as a basal level and inducer-dependent enhancer. AB1/chloramphenicol acetyltransferase fusion genes stably transfected into mouse hepatoma (Hepa) cells or L929 fibroblasts were activated 7-8- or 17-22-fold, respectively, after treatment of the cells with either CdCl or heme. The AB1 fragment is composed largely of three tandem repeats containing two conserved core elements, A and B. Part of core element A (TCCGGAGCTGTG) resembles the consensus-binding site for transcription factor AP-4, whereas core element B (GCTGAGTCANGG) includes the consensus-binding site (TGAGTCA) for the AP-1 family of transcription factors. Nuclear proteins from Hepa cells did not bind to any of the core A elements, but bound to all three copies of the core B element. AB1 derivatives with one or two mutant AP-1-binding elements exhibited reduced but measurable inducer-dependent enhancer activity, but mutation of all three AP-1-binding sites abolished activation by CdCl and heme and also by mercury chloride, zinc chloride, HO, sodium arsenate, and 12-O-tetradecanoylphorbol-13-acetate. Pretreatment of stably transfected L929 cells with protein kinase C inhibitors, but not with tyrosine kinase inhibitors or N-acetylcysteine, abrogated 12-O-tetradecanoylphorbol-13-acetate-dependent activation of the AB1/chloramphenicol acetyltransferase fusion gene. Induction by HO was unaffected by the kinase inhibitors, but completely abolished by N-acetylcysteine. Heme-dependent induction was not significantly affected by any of these chemicals.


INTRODUCTION

Heme oxygenase-1 (HO-1)() catalyzes the initial and rate-limiting reaction in heme (ferriprotoporphyrin IX) catabolism. The expression of HO-1 is dramatically induced not only in response to the substrate heme, but also by a variety of stress-associated agents including tumor-promoting phorbol esters, heavy metals, UV irradiation, and hyperthermia (reviewed in Ref. 1). Stimulation of HO-1 expression by most agents is mediated primarily at the level of gene transcription. A series of reports have described distinct cis-acting DNA elements within the rat or human HO-1 gene that are important for basal expression (2) or for induction by hyperthermia (3) , cytokines (4) UV irradiation (5) , TPA (6) , or heme (7). All of these elements are located within or in the vicinity of the proximal promoter of the rat or human HO-1 gene. In contrast, studies from our laboratory have identified a 268-bp fragment, SX2, located 4 kbp upstream of the transcription initiation site of the mouse HO-1 gene that functions as a basal level enhancer and mediates induction of the heterologous CAT gene by TPA (8) , heme (9) , and various heavy metals (9, 10) . This fragment contains two binding sites each for the Fos/Jun (AP-1) and C/EBP families of transcription factors, and mutational analysis indicates that, in the context of the SX2 fragment, both types of elements are important for heavy metal-dependent enhancer activity. Since multiple copies of the AP-1-binding elements, but not the C/EBP elements, are necessary and sufficient for activation of a heterologous gene by CdCl, the AP-1 proteins appear to play the primary role in the activation process (10) . Recently, Takeda et al.(11) isolated the human homolog of the SX2 region, and in contrast to our results, their studies indicate that the AP-1 elements do not mediate induction of a heterologous gene in response to cadmium.

In this report, we describe a second regulatory region, AB1, 10 kbp upstream of the mouse HO-1 gene with properties similar to SX2. This fragment contains three copies of the AP-1-binding sequence, and mutation of these elements abolishes induction not only by CdCl, but also by heme and a variety of other HO-1 inducers. These results demonstrate for the first time that the mechanism of HO-1 gene activation by diverse agents converges at the same DNA motif and provide further evidence for the importance of Fos/Jun proteins in this process. The signaling pathway leading to the expression and/or activation of the transcription factors, however, appears to be inducer-dependent.


EXPERIMENTAL PROCEDURES

Materials

DNase I was obtained from Worthington, while restriction endonucleases and other DNA/RNA-modifying enzymes were purchased from either Life Technologies, Inc. or New England Biolabs Inc. DNA sequence analysis was carried out by the chain termination method (12) using the Sequenase version 2.0 kit from United States Biochemical Corp. All radiolabeled nucleotides were obtained from DuPont NEN. Heme (as hemin chloride) and cobalt protoporphyrin IX were purchased from Porphyrin Products. Enzymes and reagents for CAT and luciferase assays were purchased from Sigma. Protein kinase C inhibitors, TPA, N-acetylcysteine, and hydrogen peroxide were also purchased from Sigma. The protein-tyrosine kinase inhibitors were obtained from Life Technologies, Inc. All other chemicals were reagent-grade.

Plasmid Constructs

The construction of plasmids pSKcat (13, 14) , pMHO1cat, pMHO1cat-33, pMHO3cat, pMHO4cat, and pRSVluc (8) and pMHO9cat (9) has been described previously. The remainder of the constructs diagramed in Fig. 1 were prepared by digestion of the BX2 fragment with the appropriate restriction endonucleases, blunt-end repair using the Klenow enzyme, and ligation into the BamHI (blunt-ended) site of pMHO1cat. Subfragments (EA, AB1, BR, and RH (see Fig. 3)) of EH2 were isolated after digestion with the appropriate restriction endonucleases, blunt-ended, and cloned into the SpeI (blunt-ended) site of plasmid pMHO1cat-33. The mouse HO-1 gene expression plasmids used to stably transfect C6 glioma cells were constructed by cloning the appropriate blunt-ended restriction fragments (see Fig. 1and Fig. 2) into the BamHI site (blunt-ended) of plasmid pMHO4 (9) .


Figure 1: Identification of a second enhancer region upstream of the mouse HO-1 gene. A partial restriction endonuclease map of the HO-1 gene locus is presented, with exons marked by open boxes (untranslated regions) and solid boxes (protein-coding regions). All recognition sites for restriction endonucleases BamHI (B), EcoRI (E), HindIII (H), and XhoI (X) are shown, and the sites marked by dashed lines are derived from the cloning vector. Position +1 represents the transcription initiation site. The portion of the 5`-flanking region (and part of exon 1) cloned in the CAT expression vector and the fragments (BX1 and BX2) used in the experiment depicted in Fig. 2 are appropriately positioned below the restriction endonuclease map. The locations of the previously defined enhancer, SX2, and the EH2 fragment identified in this study are also presented. Transient transfection and CAT assays were carried out as described under ``Experimental Procedures.'' For each construct, the average value from four to six independent transfections is presented as a percentage of the activity from pMHO1cat-transfected cells. Part of the data have been previously published (12).




Figure 3: Localization of the transcription enhancer activity to a 161-bp subfragment of EH2. The EH2 fragment was cloned into plasmid pMHO1cat as diagramed in Fig. 1. Subfragments of EH2 were cloned in the vector pMHO1cat-33. Transient (in L929 cells) and stable transfections and analyses were carried out as described under ``Experimental Procedures.'' For each construct, the data represent the average value from three to five independent experiments. E, EcoRI; A, AflII; B, BsrBI; R, RsaI; H, HindIII; REL CAT ACT, relative CAT activity.




Figure 2: Induction of mouse HO-1 gene constructs stably integrated into rat C6 glioma cells. Monolayers of C6 cells stably transfected with plasmid pMHO4SX2 (lanes a-d), pMHO4BX1 (lanes e-h), or pMHO4BX2 (lanes i-l) were treated with vehicle (lanes a, e, and i), ZnCl (lanes b, f, and j), heme (lanes c, g, and k), or cobalt protoporphyrin IX (lanes d, h, and l) for 3 h in serum-free medium. Total RNA was isolated, and 10-µg portions were analyzed by RNase protection assays as described under ``Experimental Procedures.'' The migration positions of the mature mouse HO-1 mRNA (mHO-1), the mouse HO-1 unspliced pre-mRNA (pre mHO-1), and the rat HO-1 mRNA (rHO-1) are marked. The sizes (in bases) of the marker fragments (laneM; HaeIII digestion products of pBluescript II SK) are indicated.



Site-directed Mutagenesis

Oligonucleotide-directed mutagenesis was carried out according to the method of Deng and Nickoloff (15) , except that single-stranded DNA was used as a template, and the mutagenic primer directed to an unique restriction endonuclease site was omitted. Mutagenesis was carried out directly on the single-strand form of plasmid pMHO1cat-33+AB1. Multiple mutations were generated either simultaneously using combinations of primers or successively by multiple rounds of mutagenesis. All mutations were confirmed by DNA sequence analysis. The sequences of the mutagenic oligonucleotides and the targets are as follows: ccttttctgcTAGATCTaggtccggggctg, 5`-AP-1-binding site; tgtgacgcTAGATCTggtcccgaggtctgt, central AP-1 element; and gttttcgcTAAGCTTggttcccgttgctcc, 3`-AP-1 element. The upper-case sequences represent the mutant versions of the AP-1-binding sequence (TGAGTCA).

Cell Culture, Transfection, and Enzyme Assays

Mouse fibroblast L929, rat C6 glioma, and mouse hepatoma (Hepa) cells were maintained in Dulbecco's modified Eagle's medium containing 0.45% glucose and supplemented with 10% fetal bovine serum. Transient and stable transfections were carried out by the calcium phosphate precipitation technique (16) as described previously (8) . For transient transfection, cultured cells (5 10/60-mm plate) were plated 16 h prior to transfection for 6 h with 16 µg (Fig. 1) or 7.5 µg (Fig. 3) of a DNA mixture containing 1 pmol of the CAT expression plasmid, 1 µg of pRSVluc, and an appropriate amount of pBluescript II SK (pBSSK, Stratagene). After a 1-min treatment with 10% glycerol in phosphate-buffered saline, the cells were cultured in complete medium for 40 h. Aliquots of cell extracts containing equivalent amounts of luciferase activity were used for CAT assays. To generate stable transfectants, cells (1-2 10/10-cm plate) were transfected for 16 h with a DNA mixture composed of 10 µg of the CAT or mouse HO-1 expression plasmid and 1 µg of pSV2neo (17) . The precipitate was removed, and the cells were cultured in complete medium. Geneticin (G418 sulfate) was added 24 h later to a final concentration of 500 µg/ml, and resistant colonies were selected over a 3-week period. Pooled stable transfectants containing the CAT plasmids were seeded in 12-well plates at a density of 4 10 cells/well. Fourty hours after plating, cells were washed twice with 1 ml of phosphate-buffered saline and incubated at 37 °C in 2 ml of serum-free medium containing vehicle or the indicated agent. After 3 h, the cells were washed twice with phosphate-buffered saline and cultured in complete medium for 4 h. HO treatment was carried out in serum-containing medium for only 1 h with a recovery period of 6 h. The inducers were used at the following concentrations: CdCl, heme, and cobalt protoporphyrin IX, 10 µM; ZnCl, 50 µM; HgCl, 5 µM; sodium arsenate, 100 µM; HO, 600 µM; and TPA, 100 ng/ml. For the experiments depicted in Fig. 8, N-acetylcysteine (20 mM) and the protein kinase inhibitors were added 1 h prior to the addition of vehicle or the inducing agent and were present during the induction and post-induction periods. For these experiments, the post-induction period lasted 16 h instead of 4 or 6 h as described above. The concentration of staurosporin was 10 µM, and all the other inhibitors were used at a final concentration of 1 µM. Cell extracts were prepared as previously described (8) , and aliquots equivalent to 3.0 µg of protein were used to measure CAT activity by the procedure of Nordeen et al.(18) . Background CAT activity from cells transfected with the promoterless vector pSKcat was subtracted from each experimental measurement prior to calculation of relative activity or -fold induction. Specific CAT activity was calculated using purified CAT enzyme as a standard. One unit of CAT converts 1 nmol of chloramphenicol and acetyl-CoA to chloramphenicol 3-acetate and CoA in 1 min at pH 7.8 and 25 °C. Luciferase assays were carried out as described previously (8) .


Figure 8: Effect of N-acetylcysteine and protein kinase inhibitors on inducer-mediated CAT gene activation. L929 cells stably transfected with plasmid pMHO1cat-33+AB1 were plated, treated with vehicle or the indicated inducers in the presence or absence of N-acetylcysteine (NAC) or the protein kinase inhibitors, and analyzed as described under ``Experimental Procedures.'' Each data point represents the mean ± S.D. from three independent experiments. LAV, lavendustin A; GEN, genistein; STAUR, staurosporin; CALP C, calphostin C.



Preparation and Analysis of RNA

Total RNA from stably transfected C6 cells was isolated by the acid guanidinium thiocyanate/phenol/chloroform extraction procedure of Chomczynski and Sacchi (19) . The level of correctly initiated mouse HO-1 mRNA was measured by RNase protection assays using standard techniques (20).The in vitro generated RNA probe used for these assays is 330 bases in length and contains sequences complementary to residues -60 to +211 of the mouse HO-1 gene and 59 bases of vector-derived sequence. The probe used for these assays protects 151 bases of the correctly initiated mouse HO-1 mRNA and 211 bases of the unspliced pre-mRNA. In addition, this probe protects a series of fragments, 45-49 bases in length, of the rat HO-1 transcript.

DNase I Protection Assays

Nuclear protein extracts from Hepa cells were prepared according to Dignam et al.(21) . The extracts were fractionated with 50% ammonium sulfate, and the precipitated proteins were resuspended and dialyzed twice for 5 h against 20 mM Hepes/KOH (pH 7.9) containing 0.1 M KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM benzamidine, and 20% glycerol. The dialysate was clarified by centrifugation and stored at -70 °C. Fragment AB1 probes were generated as follows. Plasmid pMHO1cat-33 was linearized by digestion with BamHI or NotI (which cleave at vector-encoded sequences on either side of the AB1 fragment). A 1-µg sample of each linear plasmid was labeled by the ``end fill'' reaction using the Klenow fragment of Escherichia coli DNA polymerase I and a dNTP mixture containing [-P]dCTP and [-P]dATP. The probe fragments, individually labeled on the noncoding strand (BamHI-digested plasmid) or the coding strand (NotI-digested plasmid), were liberated by subsequent digestion with SacI or XbaI, respectively, and purified by polyacrylamide gel electrophoresis. Protein binding reactions and DNase I digestion were carried out as described by Lee et al.(22) with slight modifications. Briefly, the labeled fragment (20,000 cpm) was mixed with varying amounts of crude protein extract in a total volume of 50 µl with a final buffer concentration of 10 mM Tris-HCl, 8 mM Hepes/KOH (pH 7.9), 0.5 mM EDTA, 40 mM KCl, 0.7 mM dithiothreitol, 1 µg of poly[d(I-C)], 10% glycerol, and 2% polyvinyl alcohol. The mixture was prepared on ice and incubated for 20 min at ambient temperature. The DNA/protein mixture was digested for 30 s with the addition of 100 µl of a freshly prepared solution (70-550 ng/ml) of DNase I in 10 mM MgCl and 4 µM CaCl. The reaction was terminated by the addition of 150 µl of a solution containing 8 M urea, 0.5% SDS, 5 mM EDTA, and 10 µg/ml denatured salmon sperm DNA and subsequently extracted with phenol/chloroform (1:1 mixture). Digestion products (4000 cpm) were coelectrophoresed with the purine sequence ladders (23) of the DNA probes on an 8 M urea, 6% polyacrylamide gel.

The sequences (5` to 3`) of the sense strands of the competitor oligodeoxynucleotides are as follows: AP-1/SX2, CTTTTGCTGAGTCACCCTCTGTTG; CEBP/SX2, ATTTCCTCACTGCTCATTTCCTCA; CEBP/HIV, GCTTGCTACAAGGGCTTGCTACAAGG; core A, AGGAATCCGGAGCTGTGCCTTT; CRE, AAATTGACGTCATGGTAA; NF-B, GGGACTTTCCGCTGGGGACTTTCCA; and Sp1, GGAGGCGTGGCCTGGGCGGGGACTGGGGAGTGGC. Both the sense and antisense strands were synthesized with 5`-GATC overhangs.

RESULTS

Identification of a Second 5`-Distal Enhancer of the Mouse HO-1 Gene

We previously reported that in transient transfection assays, the basal expression of pMHO4cat, a chimera containing 7 kbp of the 5`-flanking region of the mouse HO-1 gene, was significantly greater than that of pMHO1cat, which contains only 1287 bp of upstream sequence (Ref. 8; see Fig. 1). While the largest difference in expression between these two constructs, 11-fold, was observed in rat C6 glioma cells, a 2-5-fold difference was consistently seen in all cell lines tested, including mouse Hepa and fibroblast L929 cells. The transcriptionally active sequences in pMHO4cat were localized to the SX2 fragment 4 kbp upstream of the transcription initiation site. Functional analysis of 5`-flanking sequences upstream of kbp -7 indicated that the HO-1 gene locus contains a second basal level enhancer. The level of expression of pMHO9cat, which contains 5`-flanking sequence to kbp -12.9, was 2-3 times greater than that of pMHO4cat in L929 and Hepa cells. Under the conditions of the experiment depicted in Fig. 1, this enhancer activity was less apparent in C6 cells. By examining subfragments between kbp -7 and -12.9, the second basal level enhancer was localized to within the 0.9-kbp EH2 fragment (kbp -10.4 to -9.5).

The Second Distal Enhancer Also Mediates Transcriptional Activation by HO-1 Inducers

Previous studies demonstrated that the mouse HO-1 gene, when stably transfected into rat C6 cells, was readily activated by heme and CdCl(9) . This induction was strictly dependent on the presence of the 9.4-kbp BamHI/BamHI 5`-flanking fragment (kbp -12.9 to 3.5). This fragment was digested at the unique XhoI site to generate the 3.5-kbp BX1 fragment and the 5.9-kbp BX2 fragment (Fig. 1), both of which were cloned upstream of the promoter and coding region of the mouse HO-1 gene in plasmid pMHO4 and stably transfected into C6 cells. The expression of the transfected mouse HO-1 gene and the endogenous rat HO-1 gene was analyzed by RNase protection assays. As shown in Fig. 2, both the BX1 and BX2 constructs were activated by heme, ZnCl, and the heme analog cobalt protoporphyrin IX. The level of induction of the mouse HO-1 gene by these agents roughly paralleled that of the endogenous rat HO-1 gene. As expected, the SX2 fragment also mediated induction of the HO-1 gene by these agents. The parent construct, pMHO4, was not activated by any of these agents (data not shown) (9) . Although not tested directly (but see below), the inducer-responsive sequences within BX2 are presumably located in the EH2 fragment. These results demonstrate that the mouse HO-1 gene 5`-flanking segment contains at least two distal regulatory regions that function as basal level and inducer-dependent enhancers.

Localization of the Inducer-dependent Enhancer Activity to the AB1 Subfragment

To further localize the enhancer activity, four subfragments of EH2 were cloned into the vector pMHO1cat-33 and initially analyzed by transient expression assays in L929 cells. Plasmid pMHO1cat-33, which contains the minimal mouse HO-1 promoter (positions -33 to +73), was used in this study instead of pMHO1cat because its low basal expression permits sensitive detection of the transcriptional activity of test fragments. Three of the four subfragments of EH2 increased the expression of pMHO1cat-33 by varying amounts, with the highest level (44-fold) observed with the AB1 subfragment (Fig. 3). When stably transfected into either Hepa or L929 cells, however, only the AB1 subclone was activated by heme or CdCl. While in Hepa cells the level of induction of pMHO1cat-33+AB1 was similar to that of pMHO1cat+EH2, it was 5-6-fold greater in L929 cells. This variation was due to the absence of the majority of the HO-1 proximal promoter in the AB1 construct. A similar variation was observed with analogous plasmids containing the SX2 fragment (10) .

Sequence Analysis of the AB1 Fragment

The sequence of the 161-bp AB1 fragment, presented in Fig. 4A, contains three copies of an element that is identical to the consensus-binding site (TGA(G/C)TCA) for the AP-1 family of transcription factors. In addition, the AB1 fragment contains motifs similar to the consensus-binding elements for the transcription factors Sp1 (24) and C/EBP (25) . A closer examination of the sequence revealed that the internal portion of the AB1 fragment is composed of three tandem repeats containing two conserved core elements, A and B (Fig. 4B). Core B contains the AP-1-binding site, whereas the identity of the core A element is presently unknown. The 3`-end of the core A element, however, does resemble the binding site for the AP-4 transcription factor (26) .


Figure 4: Nucleotide sequence of the AB1 enhancer fragment. A, the complete sequence (5` to 3`) of the noncoding strand of the AB1 fragment is presented. Elements similar or identical to the consensus-binding site for the indicated transcription factors are marked. Nuclear proteins from Hepa cells specifically bind to these regions (see Fig. 5). B, AB1 internal sequences are manually aligned to identify repeat motifs. Dashes were introduced to maximize sequence similarity. The consensus sequences for the core A and B elements were derived by using those nucleotides conserved in at least two of the three repeat motifs. The consensus-binding sites for the AP-4 and AP-1 transcription factors are also presented.



DNase I Footprint Analysis of the AB1 Fragment

DNase I footprint analysis was carried out to determine if any of the motifs identified by similarity to consensus sequences interact with site-specific nuclear factors. Nuclear proteins from Hepa cells bound to all three putative AP-1 recognition sites, and this interaction was completely abolished in the presence of excess unlabeled oligonucleotides containing the AP-1-binding sequence from the SX2 enhancer fragment (Fig. 5). The specificity of this interaction was further established by the fact that oligonucleotides containing one of the core A elements or the binding sites for NF-B or Sp1 did not alter protein binding at these AP-1 sites. As expected, the highly similar CRE (TGACGTCA), known to bind AP-1 proteins, was an effective competitor of the AP-1-binding element. Surprisingly, an oligonucleotide containing both C/EBP-binding sites of the SX2 fragment was as efficient a competitor as the AP-1 and CRE oligonucleotides for the AP-1 elements. Furthermore, a C/EBP-binding sequence from the human immunodeficiency virus long terminal repeat also diminished protein binding at AP-1, but to a lesser extent than that observed with the SX2 C/EBP oligonucleotide. Conversely, excess AP-1 and CRE oligonucleotides specifically inhibited protein binding at the putative C/EBP recognition sequence in the AB-1 fragment. These cross-family inhibitions of protein-DNA interactions may be related to the recently observed associations between members of the AP-1 and C/EBP families of transcription factors (27, 28) . The identity of the putative Sp1-binding site was also confirmed by competition experiments. No protein binding was observed at any of the core A elements.


Figure 5: Nuclear protein binding analysis of the AB1 enhancer fragment. The 3`-end of the coding and noncoding strands of fragment AB1 were individually end-labeled by the end fill reaction. DNase I protection assays were carried out using 0, 15, 30, or 60 µg of nuclear protein extract from Hepa cells. In the competition experiments, 30 µg (coding strand) or 60 µg (noncoding strand) of nuclear proteins were used for each reaction, and the indicated competitor oligonucleotides were present at a 200-fold molar excess. The DNase I digestion products were coelectrophoresed with the G + A chemical sequencing ladder of each strand on a denaturing 8% polyacrylamide gel and autoradiographed for 48 h. The regions protected from DNase I digestion are delimited by rectangles (open, putative C/EBP-binding site; hatched, AP-1; solid, Sp1). The Sp1-binding site is not protected on the noncoding strand, and the length of the rectangle is determined by the hypersensitivity observed in the presence of the Sp1 competitor oligonucleotide.



The AP-1-binding Elements Are Essential for Inducer-dependent Enhancer Activity

Based on the analysis of two independent pools of stably transfected L929 cells, the expression of pMHO1cat-33+AB1 was stimulated an average of 17.5- or 20.7-fold after treatment of cells with CdCl or heme, respectively (Fig. 6). Site-directed mutagenesis of a single AP-1-binding site, which abolished protein binding at that site (data not shown), reduced the level of induction to 44-50% (CdCl) or to 59-96% (heme) of that observed with the parent construct. Residual inducible enhancer activity was still observed with two-site mutant constructs (1.4-1.8-fold, cadmium; 2.4-4.0-fold, heme), but completely abolished after mutation of all three AP-1-binding sites (AB1M45). The AB1 fragment also mediated activation of the CAT gene in response to other HO-1 inducers including ZnCl, HgCl, HO, sodium arsenate, and TPA (Fig. 7). Mutation of all three AP-1-binding sites abolished gene activation in response to all inducers.


Figure 6: Site-directed mutagenesis of the AP-1-binding elements in the AB1 fragment abolishes inducer-dependent enhancer activity. Site-directed mutants of plasmid pMHO1cat-33+AB1 corresponding to the diagramed fragments were transfected into L929 cells. Pooled stable transfectants were cultured, treated, and analyzed as described under ``Experimental Procedures.'' Specific CAT activity (in 1 µg of protein extract) was calculated; each data point represents the mean ± S.D. from three to seven independent measurements, and -fold induction is given in parentheses. Mutations are indicated by an X across the appropriate element.




Figure 7: Effect of various agents on CAT expression in stably transfected L929 cells. Cells transfected with pMHO1cat-33+AB1 or pMHO1cat-33+AB1M45 were plated, treated with the indicated agents, and analyzed as described under ``Experimental Procedures.'' Each data point represents the mean ± S.D. from three to five independent experiments. Ars, sodium arsenate.



Inducers Utilize Different AP-1 Activation Pathways for Induction of the HO-1 Gene

AP-1 activity is regulated by several different mechanisms including oxidation/reduction reactions (29) and phosphorylation (30) resulting from the activation of various protein kinase-dependent signal transduction pathways. To determine if one or more of these mechanisms is involved in HO-1 gene regulation, we tested the effect of N-acetylcysteine (a reducing agent and glutathione precursor) and various protein kinase C and protein-tyrosine kinase inhibitors on inducer-dependent activation of the AB1/CAT fusion gene in L929 cells. As expected, pretreatment of cells with the protein kinase C inhibitors (calphostin C and staurosporin), but not with the protein-tyrosine kinase inhibitors (genistein and lavendustin A), blunted induction by TPA, a potent protein kinase C activator (Fig. 8A). TPA also functions as a pro-oxidant, but N-acetylcysteine had no visible effect on TPA-mediated activation of the CAT reporter gene. In contrast, N-acetylcysteine completely abolished induction by HO (Fig. 8B). The kinase inhibitors had no effect on HO-mediated CAT gene activation. Induction by heme was not significantly affected by any of these chemicals. These results indicate that although many agents activate the HO-1 gene through the same cis-acting elements (i.e. AP-1-binding sites), they utilize different transcription factor activation pathways for this process.

DISCUSSION

Functional analysis of 16 kbp of the 5`-flanking sequence of the mouse HO-1 gene indicates that this locus contains two regions (a 268-bp fragment, SX2, 4 kbp from the transcription initiation site (12-14) and a 161-bp fragment, AB1, 6 kbp further upstream of SX2 (this report)) that possess inducer-dependent transcription enhancer activity. Previous analysis of the SX2 enhancer suggested that members of the AP-1 family of proteins play a primary role in transcriptional activation of the HO-1 gene by heavy metals as mutation of both AP-1-binding sites reduced cadmium-mediated induction by >80% (10). The present study further substantiates this conclusion as the AB1 fragment also contains multiple AP-1 elements, and mutation of these motifs completely abolishes cadmium-dependent AB1 enhancer activity. We also demonstrate here that the actions of a chemically diverse group of HO-1 inducers, including heme, heavy metals, TPA, HO, and sodium arsenate, all converge at the AP-1-binding site. This result is consistent with our previous prediction that most agents utilize one or a limited number of transcription factors for activation of the HO-1 gene (9) .

Although all inducers thus far tested require intact AP-1-binding sites for activation of the AB1/CAT fusion gene, some of these agents clearly utilize either different AP-1 member proteins and/or different AP-1 transcription factor activation pathways for this process. As expected, induction by TPA requires activation of protein kinase C. The protein kinase C pathway is known not only to stimulate the expression of c-fos and c-jun(31) , but also to enhance AP-1 DNA-binding activity by dephosphorylation of c-Jun at one or more sites that negatively regulate DNA-binding function (32) . Consistent with these mechanisms, treatment of Hepa or L929 cells with TPA increases the level of nuclear AP-1-specific, DNA-binding activity by 2-3-fold (10) .() In contrast to that observed with TPA, induction of the AB1/CAT gene by HO apparently does not involve protein kinase C, but is dependent on the redox state of the cell. Reduction/oxidation reactions are known to modulate the activity of various transcription factors (33, 34) including the DNA-binding activity of the c-Fos-c-Jun heterodimer (29) . Although the effect of hydrogen peroxide on AP-1 DNA-binding activity in Hepa or L929 cells was not examined, HO does induce this activity in HeLa cells (31).

Since treatment of Hepa or L929 cells with heme does not alter the nuclear concentration of AP-1 DNA-binding activity (10) , induction of the HO-1 gene by this agent probably occurs by a mechanism that involves modulation of the transactivation properties of one or more of the AP-1 member proteins. One potential target for such regulation is c-Jun, the transactivation potential of which is elevated by phosphorylation within the N-terminal activation domain in response to mitogenic stimulation or expression of transforming oncoproteins (reviewed in Ref. 30) and by UV irradiation (35) , a potent inducer of HO-1 gene transcription. Phosphorylation of c-Jun in response to UV irradiation is mediated by a Ras-dependent kinase cascade and is sensitive to protein-tyrosine kinase inhibitors. Clearly, if the mechanism of AB1/CAT fusion gene induction by heme (or, for that matter, by TPA and HO) involves phosphorylation of c-Jun within the activation domain, this process occurs by a pathway independent of protein-tyrosine kinases. Heme-mediated gene activation is also insensitive to protein kinase C inhibitors and N-acetylcysteine. The latter observation is consistent with results from previous studies demonstrating that the antioxidants -tocopherol and allopurinol do not inhibit heme-dependent stimulation of heme oxygenase activity in rat liver (36) .

The AB1 fragment contains three AP-1-binding sites, each of which is identical to the AP-1 consensus sequence (TGAGTCA). The distances between the end of one AP-1 heptad and the beginning of the next heptad are 21 and 22 bp, or two full turns of the B-DNA helix. AP-1 proteins would therefore bind to the same face of the DNA helix with the potential for cooperative interaction. That such interaction occurs at the AB1 locus is strongly suggested by the results obtained with the site-directed mutants. For example, AB1 mutant constructs with only one intact AP-1-binding site (AB1M29, AB1M30, and AB1M31) are induced an average of 1.6-fold by CdCl, whereas mutants with two intact AP-1-binding elements (AB1M14, AB1M15, and AB1M16) are induced an average of 8.4-fold. This synergism is also observed with heme-mediated activation of the AB1/CAT fusion genes. Furthermore, previous studies (10) demonstrated that a single copy of either of the AP-1 elements of the SX2 fragment cannot activate the CAT gene in response to CdCl; multimerized elements are necessary for induction. Taken together, these results support a mechanism of inducer-dependent HO-1 gene activation that involves cooperative interaction between AP-1 proteins bound at adjacent sites.

Of course, positive cooperativity between duplicated or multimerized elements or between different elements, whether in artificial or natural settings, has been extensively documented. A classical example is the requirement of multiple, active metal regulatory elements for induction of metallothionein genes in response to heavy metals (37) . This type of cooperativity may be of particular significance for AP-1-dependent gene regulation. Unlike metal regulatory elements, AP-1-binding sites have been identified within the regulatory sequences of a large number of genes. For instance, in a recent survey of the Eukaryotic Promoter Data Base (EMBL release 37, March 1994), 94 out of the 1230 entries contained AP-1-binding elements. This ratio is almost certainly an underestimate of the total percentage of genes with AP-1-binding sites since the data base contains only sequences from positions -499 to +100 and only canonical AP-1 sequences were scored in this search. The abundance of AP-1 target genes reflects the fact that the AP-1 transcription factors regulate, at least in part, many complex biological processes including cellular growth and differentiation. Presumably, only a subset of these AP-1 target gene products would be involved in protection against or in response to oxidant injury. Selective activation of these genes may be achieved by a mechanism requiring cooperative interaction between AP-1 proteins bound at adjacent sites. This restriction would prevent the activation of the majority of AP-1 target genes with only a single binding site.

Takeda et al.(11) recently isolated and characterized the human homolog of the SX2 region. Surprisingly, these investigators identified a cadmium-responsive element completely different from the AP-1 motif and, in fact, were unable to demonstrate a direct role for the conserved AP-1 element in cadmium-mediated activation of the human HO-1 gene. The reason for the discrepancy is not clear, but may reflect the fact that different cell lines were utilized for characterization of the mouse and human enhancers. More important, the human SX2 region was analyzed using transient expression assay, a procedure in which the mouse SX2 and AB1 fragments do not exhibit inducer-dependent enhancer activity, at least in the cell lines thus far examined.

Finally, the significance of two upstream regulatory regions within the mouse HO-1 gene locus is presently unclear. Optimal activation of the HO-1 gene may require cooperative interaction between the SX2 and AB1 enhancers. Alternatively, these regions may function in a mutually exclusive manner depending on, for example, the nature of the inducer and/or the developmental or differentiation state of the target tissue. Studies to address this issue are currently in progress.


FOOTNOTES

*
This work was supported by United States Public Health Service Grant DK-43135. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) L37439.

§
To whom correspondence should be addressed: Dept. of Molecular Genetics, Alton Ochsner Medical Foundation, 1516 Jefferson Highway, New Orleans, LA 70121. Tel.: 504-842-3314; Fax: 504-842-3381.

The abbreviations used are: HO-1, heme oxygenase-1; TPA, 12-O-tetradecanoylphorbol-13-acetate; AP-1, activator protein-1; bp, base pair(s); kbp, kilobase pair(s); CAT, chloramphenicol acetyltransferase; C/EBP, CCAAT/enhancer-binding protein; CRE, cAMP response element; NF-B, nuclear factor-B.

J. Alam, unpublished data.


ACKNOWLEDGEMENTS

We thank Bridgette Hagler for preparation of the manuscript.


REFERENCES
  1. Maines, M. D.(1992) Heme Oxygenase: Clinical Applications and Functions, CRC Press, Inc., Boca Raton, FL
  2. Sato, M., Fukushi, Y., Ishizawa, S., Okinaga, S., Muller, R. M., and Shibahara, S.(1989) J. Biol. Chem. 264, 10251-10260 [Abstract/Free Full Text]
  3. Shibahara, S., Muller, R. M., and Taguchi, H.(1987) J. Biol. Chem. 262, 12889-12892 [Abstract/Free Full Text]
  4. Mitani, K., Fujita, H., Kappas, A., and Sassa, S.(1992) Blood 79, 1255-1259 [Abstract/Free Full Text]
  5. Nascimento, A. L. T. O., Luscher, P., and Tyrrell, R. M.(1993) Nucleic Acids Res. 21, 1103-1109 [Abstract/Free Full Text]
  6. Muraosa, Y., and Shibahara, S.(1993) Mol. Cell. Biol. 13, 7881-7891 [Abstract/Free Full Text]
  7. Lavrovsky, Y., Schwartzman, M. L., Levere, R. D., Kappas, A., and Abraham, N. G.(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5987-5991 [Abstract/Free Full Text]
  8. Alam, J., and Zhining, D.(1992) J. Biol. Chem. 267, 21894-21900 [Abstract/Free Full Text]
  9. Alam, J., Cai, J., and Smith, A.(1994) J. Biol. Chem. 269, 1001-1009 [Abstract/Free Full Text]
  10. Alam, J.(1994) J. Biol. Chem. 269, 25049-25056 [Abstract/Free Full Text]
  11. Takeda, K., Ishizawa, S., Sato, M., Yoshida, T., and Shibahara, S. (1994) J. Biol. Chem. 269, 22858-22867 [Abstract/Free Full Text]
  12. Sanger, F., Nicklen, S., and Coulson, A. R.(1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  13. Alam, J., and Cook, J. L.(1990) Anal. Biochem. 188, 245-254 [CrossRef][Medline] [Order article via Infotrieve]
  14. Alam, J., Yu, N., Irias, S., Cook, J. L., and Vig, E.(1991) BioTechniques 10, 423-425
  15. Deng, W. P., and Nickoloff, J. A.(1992) Anal. Biochem. 200, 81-88 [CrossRef][Medline] [Order article via Infotrieve]
  16. Graham, F. L., and van der Eb, A. J.(1973) Virology 52, 456-467 [CrossRef][Medline] [Order article via Infotrieve]
  17. Southern, P. J., and Berg, P.(1982) J. Mol. Appl. Genet. 1, 327-341 [Medline] [Order article via Infotrieve]
  18. Nordeen, S. K., Green, P. P., III, and Fowlkes, D. M.(1987) DNA (N. Y.) 6, 173-178 [Medline] [Order article via Infotrieve]
  19. Chomczynski, P., and Sacchi, N.(1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  20. Sambrook, J., Fritsch, E. F., and Maniatis, T.(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  21. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G.(1983) Nucleic Acids Res. 11, 1475-1489 [Abstract/Free Full Text]
  22. Lee, W., Mitchell, P., and Tjian, R.(1987) Cell 49, 741-752 [CrossRef][Medline] [Order article via Infotrieve]
  23. Maxam, A. M., and Gilbert, W.(1980) Methods Enzymol. 65, 499-560 [Medline] [Order article via Infotrieve]
  24. Courey, A. J., and Tjian, R.(1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) Vol. 2, pp. 743-770, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  25. McKnight, S. L.(1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) Vol. 2, pp. 771-796, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  26. Mermod, N., Williams, T. J., and Tjian, R.(1988) Nature 332, 557-561 [CrossRef][Medline] [Order article via Infotrieve]
  27. Hsu, W., Kerppola, T. K., Chen, P.-L., Curran, T., and Chen-Kiang, S. (1994) Mol. Cell. Biol. 14, 268-276 [Abstract/Free Full Text]
  28. Klampfer, L., Lee, T. H., Hsu, W., Vilcek, J., and Chen-Kiang, S. (1994) Mol. Cell. Biol. 14, 6561-6569 [Abstract/Free Full Text]
  29. Abate, C., Patel, L., Rauscher, F. J., III, and Curran, T.(1990) Science 249, 1157-1161 [Abstract/Free Full Text]
  30. Hunter, T., and Karin, M.(1992) Cell 70, 375-387 [CrossRef][Medline] [Order article via Infotrieve]
  31. Devary, Y., Gottlieb, R. A., Lau, L. F., and Karin, M.(1991) Mol. Cell. Biol. 11, 2804-2811 [Abstract/Free Full Text]
  32. Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T.(1991) Cell 64, 573-584 [CrossRef][Medline] [Order article via Infotrieve]
  33. Macbride, A. A., Klausner, R. D., and Howley, P. M.(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7531-7535 [Abstract/Free Full Text]
  34. Meyer, M., Pahl, H. L., and Baeuerle, P. A.(1994) Chem. Biol. Interact. 91, 91-100 [CrossRef][Medline] [Order article via Infotrieve]
  35. Devary, Y., Gottlieb, R. A., Smeal, T., and Karin, M.(1992) Cell 71, 1081-1091 [CrossRef][Medline] [Order article via Infotrieve]
  36. Tomaro, M. L., Frydman, J., and Frydman, R. B.(1991) Arch. Biochem. Biophys. 286, 610-617 [CrossRef][Medline] [Order article via Infotrieve]
  37. Stuart, G. W., Searle, P. F., Chen, H. Y., Brinster, R. L., and Palmiter, R. D.(1984) Proc. Natl. Acad. Sci. U. S. A. 81, 7318-7322 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Iwasaki, K. Hailemariam, and Y. Tsuji
PIAS3 Interacts with ATF1 and Regulates the Human Ferritin H Gene through an Antioxidant-responsive Element
J. Biol. Chem., August 3, 2007; 282(31): 22335 - 22343.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Gong and A. I. Cederbaum
Transcription Factor Nrf2 Protects HepG2 Cells against CYP2E1 plus Arachidonic Acid-dependent Toxicity
J. Biol. Chem., May 26, 2006; 281(21): 14573 - 14579.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. W. Ryter, J. Alam, and A. M. K. Choi
Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications
Physiol Rev, April 1, 2006; 86(2): 583 - 650.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. Wu and A. I. Cederbaum
Opposite action of S-adenosyl methionine and its metabolites on CYP2E1-mediated toxicity in pyrazole-induced rat hepatocytes and HepG2 E47 cells
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G674 - G684.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K.-J. Min, M.-s. Yang, S.-U. Kim, I. Jou, and E.-h. Joe
Astrocytes Induce Hemeoxygenase-1 Expression in Microglia: A Feasible Mechanism for Preventing Excessive Brain Inflammation
J. Neurosci., February 8, 2006; 26(6): 1880 - 1887.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
D. Morse and A. M. K. Choi
Heme Oxygenase-1: From Bench to Bedside
Am. J. Respir. Crit. Care Med., September 15, 2005; 172(6): 660 - 670.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. W. Chung, Y.-H. Chen, and M. A. Perrella
Role of Ets-2 in the Regulation of Heme Oxygenase-1 by Endotoxin
J. Biol. Chem., February 11, 2005; 280(6): 4578 - 4584.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. M. Sikorski, T. Hock, N. Hill-Kapturczak, and A. Agarwal
The story so far: molecular regulation of the heme oxygenase-1 gene in renal injury
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F425 - F441.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
F. A. D. T. G. Wagener, H.-D. Volk, D. Willis, N. G. Abraham, M. P. Soares, G. J. Adema, and C. G. Figdor
Different Faces of the Heme-Heme Oxygenase System in Inflammation
Pharmacol. Rev., September 1, 2003; 55(3): 551 - 571.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. Hill-Kapturczak, E. Sikorski, C. Voakes, J. Garcia, H. S. Nick, and A. Agarwal
An internal enhancer regulates heme- and cadmium-mediated induction of human heme oxygenase-1
Am J Physiol Renal Physiol, September 1, 2003; 285(3): F515 - F523.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Hill-Kapturczak, C. Voakes, J. Garcia, G. Visner, H. S. Nick, and A. Agarwal
A cis-Acting Region Regulates Oxidized Lipid-Mediated Induction of the Human Heme Oxygenase-1 Gene in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., August 1, 2003; 23(8): 1416 - 1422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Wright, J. J. Higgin, R. T. Raines, C. Steenbergen, and E. Murphy
Activation of the Prolyl Hydroxylase Oxygen-sensor Results in Induction of GLUT1, Heme Oxygenase-1, and Nitric-oxide Synthase Proteins and Confers Protection from Metabolic Inhibition to Cardiomyocytes
J. Biol. Chem., May 23, 2003; 278(22): 20235 - 20239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kietzmann, A. Samoylenko, and S. Immenschuh
Transcriptional Regulation of Heme Oxygenase-1 Gene Expression by MAP Kinases of th