|
Volume 270,
Number 22,
Issue of June 2, pp. 13022-13028, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel
Ubiquitous Form of Munc-18 Interacts with Multiple Syntaxins
USE OF THE YEAST TWO-HYBRID SYSTEM TO STUDY INTERACTIONS BETWEEN
PROTEINS INVOLVED IN MEMBRANE TRAFFIC (*)
Yutaka
Hata
,
Thomas
C.
Südhof (§)
From the
(1)
Howard Hughes Medical Institute and Department of
Molecular Genetics, The University of Texas Southwestern Medical
School, Dallas, Texas 75235
ABSTRACT
INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Munc-18-1 is a 67-kDa neuronal protein that binds tightly
to syntaxin 1 and functions in synaptic vesicle exocytosis (Hata, Y.,
Slaughter, C. A., and Südhof, T. C. (1993a) Nature 366,
347-351). We have now characterized a new Munc-18 isoform,
Munc-18-2, that exhibits 63% amino acid sequence identity with
Munc-18-1. Munc-18-2 is expressed in most tissues, whereas
Munc-18-1 is primarily expressed in brain. Using recombinant
Munc-18-1 and Munc-18-2 produced in COS cells, we show that
both forms of Munc-18 bind tightly to syntaxins 1A, 2, and 3 but not to
syntaxin 4. In an independent approach to study the binding
specificities of Munc-18-1 and Munc-18-2, we used the yeast
two-hybrid system. This assay system depends on protein-protein
interactions in the cell nucleus. We validated its utility for studying
membrane trafficking proteins by testing well characterized
interactions between cytosolic proteins that are known to be
physiologically important in exocytosis. Strong interactions, such as
the binding of syntaxins 1-4 with SNAP-25, were effectively
detected by the yeast two-hybrid assay, but weak binding, such as the
binding of syntaxins to synaptotagmin or of synaptotagmin to neurexins,
was not. Studies on full-length and truncated forms of Munc-18s by the
yeast two-hybrid system confirmed their interactions with syntaxins.
Both the N and the C terminus of Munc-18 were essential for binding.
Munc-18-1 and Munc-18-2 bind only to syntaxins 1A, 2, and 3
but not 4 and 5 by yeast-two hybrid system assays. Our studies
demonstrate that neural and non-neural tissues have distinct forms of
Munc-18, which may function in different types of exocytosis. The lack
of specificity of the interactions between syntaxins and Munc-18s
indicates that specificity of membrane trafficking reactions is not
dependent on this interaction.
INTRODUCTION
The first step toward an understanding of the molecular
mechanisms of membrane traffic is the identification of components of
the trafficking machinery. The characterization of proteins with
putative functions in exocytosis has particularly advanced at the
synapse (reviewed in Jahn and Südhof(1994)). Originally, synaptic
membrane traffic was thought to be mechanistically unique. Recent
years, however, have demonstrated that many synapse-specific proteins
have homologues in other cellular fusion reactions where they may
perform analogous functions and vice versa. Thus, the
mechanisms are probably similar for different types of membrane
trafficking reactions, and the molecular components acting in these
reactions are conserved between different reactions and different
species (reviewed in Südhof et al.(1993) and Bennett and
Scheller(1994)).
N-Ethylmaleimide sensitive factor
(NSF) ( )
is a cytosolic protein that is conserved
from yeast to man and probably functions in most intracellular membrane
fusion reactions, including that of synaptic vesicles (Rothman, 1994).
NSF binds to specific receptor sites on membranes via soluble
NSF-attachment proteins (SNAPs) that are also highly conserved between
different trafficking reactions, although the membrane receptors for
NSF-SNAPs may differ for different cellular compartments. Studies on
the neuronal membrane receptors for NSF and -SNAP revealed that
the synaptic vesicle protein synaptobrevin/vesicle-associated membrane
protein and the plasma membrane proteins syntaxin and SNAP-25 (no
relation to the SNAPs of NSF) are efficiently purified on immobilized
-SNAP-NSF (Söllner et al., 1993). These three
proteins do not individually bind -SNAP and NSF but form a tight,
SDS-resistant complex (the ``core complex'') (Hayashi et
al., 1994) that in turn binds -SNAP (McMahon and Südhof,
1995). Interestingly, the three components of the core complex are
targets for different botulinum and tetanus toxins that block
neurotransmitter release. These toxins inhibit the formation of the
membrane-bridging core complex (Hayashi et al., 1994),
suggesting that the core complex is required for exocytosis.
Syntaxin 1 is not only a key component of the core complex but also
interacts with other proteins involved in synaptic vesicle exocytosis;
Ca channels (Sheng et al., 1994),
synaptotagmin I (Bennett et al., 1992; Yoshida et
al., 1992), and Munc-18-1 (Hata et al., 1993a; also
called n-sec1 (Pevsner et al., 1994a) or rb-sec1 (Garcia
et al., 1994)). Munc-18-1 is a cytosolic brain protein
that binds tightly to syntaxin 1. Munc-18-1 is likely to have an
essential function in neurotransmitter release because mutations of its
homologues in Drosophila and in Caenorhabditis elegans (called rop and unc-18, respectively) lead to a phenotype that
suggests an inhibition of neurotransmitter release (Hosono et
al., 1992; Harrison et al., 1994). A role for Munc-18 in
exocytosis is supported by its distant homology to three proteins
involved in the yeast secretory pathway, Sec1, Sly1, and Slp1 (Pelham,
1993). Biochemical studies have revealed that syntaxin 1 cannot
simultaneously bind Munc-18-1 and SNAP-25, suggesting an ordered
sequence in the interactions of syntaxin 1 with these two components of
the fusion apparatus (Pevsner et al., 1994b). However, it
seems unlikely that the only function of Munc-18-1 consists in an
inhibitory role in the formation of the core complex, and the exact
function of Munc-18-1 is currently unclear.
Since NSF and
SNAPs are ubiquitous membrane trafficking proteins, it seems likely
that non-neural tissues should also express homologues of the various
interacting proteins. This has been shown for synaptobrevin and
syntaxin. All cells tested express a ubiquitously distributed homologue
of synaptobrevin, cellubrevin, that is also tetanus sensitive (McMahon
et al., 1993). In addition to brain syntaxin 1, four other
syntaxins with a widespread tissue distribution have been described
(Bennett et al., 1993).
Munc-18-1 interacts strongly
with syntaxin 1; both proteins are expressed at high levels only in
brain (Hata et al., 1993a; Pevsner et al., 1994a,
1994b). However, the presence of homologues of syntaxin 1 and of
synaptobrevin in all animal cells indicates a general role for
syntaxins and its interacting partners in membrane traffic (Bennett
et al., 1993; McMahon et al., 1993). This suggests
that there may be additional forms of Munc-18 in non-neuronal membrane
traffic. In the current study, we have identified a novel form of
Munc-18 called Munc-18-2. We have studied the specificity and
mechanism of the interaction of Munc-18s with different syntaxins to
gain insight into the regions of Munc-18 that are required for binding
and into the specificity of this interaction. Our data demonstrate that
neuronal and non-neuronal trafficking pathways use distinct but
homologous isoforms of Munc-18 with similar binding specificities for
syntaxin.
MATERIALS AND METHODS
cDNA libraries from rat intestine, thymus, and
liver in ZAPII (Stratagene) were screened with random-primed DNA
probes from rat Munc-18-1 (Hata et al., 1993a) at low
stringency (30% formamide) (Südhof, 1990). Seven clones were
isolated from the intestinal library and one from the liver and the
thymus libraries and sequenced after subcloning into M13 vectors. DNA
sequencing was performed by the dideoxy nucleotide chain termination
method using fluorescently labeled primers and an ABI370A DNA
sequencer. All but one clone initiated just after the starting ATG, and
the single clone containing the putative initiator ATG had an intron,
an artifactual occurrence that is not uncommon for cDNA libraries.
Therefore, PCR primers corresponding to the putative translation start
and termination codons were used to isolate the complete coding region
as a PCR fragment (sequences of oligonucleotide primers:
CGCGGATCCGAGGGGAAGATGGCGCCCT and GCGCTCGAGTCAGGGCAGGGCTATGTC). PCR was
performed on rat brain cDNA as described (Ushkaryov and Südhof,
1993). The 1.8-kilobase fragment was subcloned into the TA cloning
vector (Invitrogen) and sequenced. All sequences were analyzed on a PC
using IntelliGenetics software. The nucleotide sequences of the cDNA
clones were deposited in the GenBank data bank.
Bacterial expression vectors encoding GST-fusion
proteins of the cytoplasmic domains of syntaxins 1A, 2, 3, 4, and 5
(pGexSynt1-Synt5) were constructed by PCR and standard
recombinant DNA techniques in pGEX-KG (Sambrook et al., 1989;
Hata et al., 1993a). GST-fusion proteins were expressed and
purified on glutathione-agarose; GST-syntaxin 5 was insoluble and not
studied further. For expression of Munc-18-1 and Munc-18-2
in COS cells, the coding region of the rat cDNAs were cloned into the
vector pCMV5 (gift of Dr. David W. Russell, UT Southwestern Medical
Center, Dallas). Plasmid DNA was transfected into COS cells using
DEAE-dextran, and transfected COS cells were harvested 48-72 h
after transfection. Analysis of the Binding of Recombinant Munc-18-1 and
Munc-18-2 to Different GST-Syntaxin Fusion
Proteins-Total solubilized homogenates were obtained from
rat liver and brain as described and used for binding studies with
recombinant GST-syntaxin fusion proteins (Hata et al., 1993a).
To analyze binding of recombinant Munc-18-1 and Munc-18-2,
COS cells transfected with control DNA or with Munc-18-1 and
Munc-18-2 expression vectors were solubilized in 20 mM
HEPES-NaOH, pH 8.0, 0.1 M NaCl, 0.5% Nonidet P-40, 0.1 g/liter
phenylmethylsulfonyl fluoride, and 10 mg/liter leupeptin. Solubilized
COS cell extract was incubated with various GST-fusion proteins
attached to glutathione-agarose, centrifuged, washed three to five
times in the solubilization buffer, and analyzed by SDS-PAGE followed
by Coomassie Blue staining or immunoblotting.
The full-length or partial coding regions
of syntaxins 1A, 2, 3, 4, and 5, SNAP-25A, synaptotagmin I, and
neurexin II were cloned into the bait and prey yeast expression vectors
pBTM116 and pVP16 (Vojtek et al., 1993). The following vectors
contain the following inserts (residue numbers are from the following
sources: Munc-18s, Fig. 1; synaptotagmin I, Perin et
al.(1990); SNAP-25A, Oyler et al.(1989); syntaxins,
Bennett et al.(1993); neurexin II, Ushkaryov et
al.(1992); synaptobrevin II, Südhof et al. (1989)):
pBTMMunc-18-1, pVP16Munc-18-1, pBTMMunc-18-2, and
pVP16Munc-18-2, the complete coding region (residues
1-594); pBTMMunc-18-1-2, residues 1-569;
pBTMMunc-18-1-3, residues 1-529; pBTMMunc-18-1-4,
residues 1-341; pBTMMunc-18-1-5, residues 99-594;
pBTMMunc-18-1-6, residues 16-594; pBTMMunc-18-1-7,
residues 1-100; pBTMMunc-18-1-8, residues 340-594;
pBTMMunc-18-1-9, residues 99-529; pBTMMunc-18-1-10,
residues 99-341; pBTMMunc-18-1-11, residues 16-341.
pBTMSyntaxin 1A, 2, 3, 4, and 5 and the corresponding pVP16 constructs
encode residues 1-265, 1-262, 1-260, 1-269, and
1-278, respectively, of syntaxins 1-5. pBTMSNAP-25A and
pVP16SNAP-25A encode full-length SNAP-25A (residues 1-206).
pBTMNe2A and pVP16Ne2a encode residues 1660-1715 of rat neurexin
II. pBTMSyt-4 and pBTMSyt-9 encode residues 141-268 and
266-422 of rat synaptotagmin I, respectively, and pBTMSyt-8 and
pVP16Syt-8 encode residues 120-422. pVP16Syb encodes residues
1-96 of bovine synaptobrevin. Yeast strain L40 (Vojtek et
al., 1993) was transfected with bait and prey vectors using the
lithium acetate method (Schiestl and Gietz, 1989). Transformants were
plated on selection plates lacking uracil, tryptophan, and leucine.
After 2 days of incubation at 30 °C, colonies were inoculated into
supplemented minimal medium lacking uracil, tryptophan, and leucine and
placed in a shaking incubator at 30 °C for 48 h.
-Galactosidase assays were performed on yeast extracts with
protein concentrations of 20-40 mg/liter per assay as described
(Rose et al., 1990). RNA Blotting Analysis-RNA blotting analysis was performed
essentially as described (Ushkaryov et al., 1992) using either
total RNA from different rat tissues or commercially available blots
(Clontech) containing total RNA from rat tissues.
Figure 1:
Alignment of the amino acid sequences
of rat Munc-18-2, rat Munc-18-1, Drosophila rop,
and the unc-18 gene product from C. elegans. The
amino acid sequences of the indicated proteins are shown in single
letter amino acid code, identified on the left (r18-2, rat Munc-18-2; r18-1,
rat Munc-18-1; Drop, Drosophila Rop protein
(Harrison et al., 1994); unc18, C. elegans unc-18 gene product (Hosono et al., 1992)) and
numbered on the right. Residues identical in three or
all four of the sequences are shaded. The rat Munc-18-2
sequence was deduced from the nucleotide sequence of overlapping cDNA
clones (data not shown). The serine at position 513 was present in only
one clone and absent from three other sequenced clones; the nucleotide
sequence surrounding it resembles the 3`-end of a splice acceptor site
(GTCAGCAGT encoding VSS ), suggesting
alternative use of a duplicated splice acceptor
site.
SDS-PAGE was
performed according to Laemmli(1970) with antibodies previously
described (Hata et al., 1993a). Protein assays were done with
Coomassie Blue-based assay kit (Bio-Rad).
RESULTS
We screened rat liver, intestine, and thymus cDNA
libraries at low stringency with randomly labeled cDNA fragments from
Munc-18-1 (Hata et al., 1993a). Multiple
hybridization-positive clones were isolated. Sequencing revealed that
they all encoded the same novel isoform of Munc-18 that we named
Munc-18-2. The sequence of the coding region of Munc-18-2
was assembled from overlapping cDNA clones. The putative initiator
methionine was identified in the cDNA sequence by comparison with the
initiator methionine sequences of Munc-18-1 and its
Drosophila and C. elegans homologues. The translated
amino acid sequence of Munc-18-2 is shown in Fig. 1in an
alignment with the sequences of rat Munc-18-1 and its
Drosophila and C. elegans homologues unc-18 and rop.
Munc-18-2 is 63% identical with Munc-18-1, 55% identical
with the Drosophila Rop protein, and 54% identical with the
C. elegans unc-18 gene product. As previously described for
Munc-18-1 (Hata et al., 1993a; Pevsner et al.,
1994a; Garcia et al., 1994), Munc-18-2 is distantly
related to the three yeast proteins Sec1, Sly1, and Slp1 that function
in the yeast secretory pathway. The sequence homology of the Munc-18s
with rop and unc-18 is evenly distributed over the entire protein, with
blocks of identical amino acids separated by divergent sequences
(Fig. 1), suggesting that the entire protein is functionally
important.
A quantitative analysis of the relations between the
different Munc-18 homologues was performed with the CLUSTAL program and
is depicted in the form of a dendrogram in Fig. 2. This analysis
demonstrates that Munc-18-1, 18-2, rop, and unc-18 form a
closely related group of proteins that are distantly related to Sec1
and Sly1 and slightly less related to Slp1. Since Munc-18s are equally
homologous to Sec1 and to Sly1, we do not know if Munc-18s are
equivalent to only Sec1 or if they also functionally overlap with Sly1
and possibly Slp1. Therefore, we propose to name these proteins
Munc-18s instead of mammalian Sec1 homologues. Tissue Distributions of Munc-18-1 and
Munc-18-2-To study the tissue distributions of
Munc-18-1 and Munc-18-2, RNA blots of total RNA from rat
tissues were hybridized with P-labeled cDNA probes
(Fig. 3). As previously described, Munc-18-1 is primarily
expressed in brain, although testis also expresses significant levels
(Fig. 3A). No differential expression of Munc-18-1
between different brain regions was observed in this experiment in
which the brain was dissected into cerebellum, spinal cord, and
forebrain. In contrast to Munc-18-1, Munc-18-2 mRNAs are
expressed only at low levels in brain but could be detected in all
tissues investigated (Fig. 3B). Two hybridizing mRNAs
were observed in most tissues, possibly because of differential
polyadenylation. Highest levels for Munc-18-2 were observed in
spleen, lung, kidney, and testis. Thus, Munc-18-2 shows a more
widespread distribution than Munc-18-1 and is expressed in
visceral organs that lack high level expression of Munc-18-1. The
expression of Munc-18-2 protein in liver was confirmed in
experiments in which syntaxin binding proteins were affinity purified
from liver using GST-syntaxin fusion proteins as previously described
for brain (Hata et al. (1993a) and data not shown). Binding of Munc-18-1 and Munc-18-2 to Syntaxins 1A, 2,
3, and 4-Munc-18-2 is highly homologous to
Munc-18-1, suggesting that Munc-18-2 may also bind to
syntaxin. To test this hypothesis, Munc-18-1 and Munc-18-2
were expressed by transfection in COS cells. Membrane proteins from COS
cells expressing either Munc-18-1 or Munc-18-2 and from
control COS cells were solubilized in Nonidet P-40 and incubated with
recombinant GST and GST-syntaxin fusion proteins attached to
glutathione-agarose beads. Bound proteins were analyzed by SDS-PAGE
followed by Coomassie Blue staining (Fig. 4).
Figure 2:
Dendrogram analysis of the Munc-18/Sec1
family using the CLUSTAL program. The diagram depicts the degree of
sequence difference between the indicated proteins; the length of the horizontallines corresponds to the
sequence distance between the different
proteins.
Figure 3:
Tissue distribution of expression of
Munc-18-1 and Munc-18-2 using RNA blotting. In A,
10 µg of total RNA from the indicated tissues was hybridized with a
uniformly labeled probe from Munc-18-1. In B, a separate
blot was hybridized with a probe from Munc-18-2. Positions of
size markers are shown on the right. Hybridization of blots
with ubiquitously expressed controls (cyclophilin and GAPDH) showed
that each lane contained similar amounts of RNA (data not
shown). kb, kilobases.
Figure 4:
Binding of recombinant Munc-18-1 and
Munc-18-2 to different syntaxins. Lysates from COS cells
transfected with control DNA or with expression vectors encoding
Munc-18-1 or Munc-18-2 were incubated with GST or with
GST-syntaxins 1A, 2, 3, and 4 attached to glutathione-agarose and
washed extensively. Proteins on the beads were analyzed by SDS-PAGE and
Coomassie Blue staining. Endogenous GSTs from the COS cells
(25-30 kDa) were the major proteins bound to glutathione-agarose
in this experiment, but Munc-18-1 and Munc-18-2
(arrows) were co-precipitated with syntaxins as 67-kDa bands
running above the GST-syntaxins only from cell lysates transfected with
the appropriate expression vectors. Numbers on the left of the figures indicate positions of molecular weight
markers.
No protein in
the COS cell extracts bound specifically to GST alone. In contrast,
incubation of the COS cell extracts with GST-syntaxins 1A, 2, and 3 led
to the purification of Munc-18-1 and Munc-18-2 from the
respective transfected cells but not from control cells (Fig. 4).
GST-syntaxin 4 was only able to bind trace amounts of Munc-18-1
and Munc-18-2. The identification of the bound 67-kDa band from
the transfected COS cells as Munc-18-1 or Munc-18-2 was
confirmed by immunoblotting (data not shown). The fact that these
proteins can be detected not only by sensitive immunoblotting but are
also visible on Coomassie Blue-stained gels suggests that the
interaction between them is of high affinity and stoichiometry.
Most analyses of protein-protein interactions for the
synaptic fusion complex have been performed using biochemical methods
similar to those shown in the experiments in Fig. 4. The yeast
two-hybrid system potentially provides a method of analyzing these
interactions in vivo (Fields and Song, 1989). Proteins to be
analyzed are cloned into bait and prey vectors (pBTM116 and pVP16,
respectively) (Vojtek et al., 1993) and expressed in yeast as
fusion proteins with a DNA binding domain and a transcription
activation domain, respectively. When the two fusion proteins bind to
each other in the yeast nuclei via their fused components,
transcription of a selectable marker and a -galactosidase gene is
activated. This binding can be selected for and measured as
-galactosidase activity.
Since the yeast two-hydrid system
measures nuclear protein-protein interactions, we decided to
investigate its utility for analyzing interactions between the
cytosolic domains of trafficking proteins by testing well characterized
protein-protein interactions. The cytoplasmic domains of different
syntaxins, neurexin II, synaptobrevin, three parts of synaptotagmin I,
and full-length SNAP-25 were cloned into bait and prey vectors. Most
sequences were cloned into both vectors to allow a pairwise analysis in
both vector combinations. The strength of the interactions between the
proteins encoded by these plasmids was determined by measuring
activation of -galactosidase in yeast strains harboring both
respective plasmids. These experiments confirmed the strong interaction
between syntaxin 1A and SNAP-25 that was previously characterized
biochemically (Hayashi et al., 1994). Very high levels of
-galactosidase were observed with syntaxins 1A, 2, 3, and 4 but
not with syntaxin 5, suggesting that only the presumptive plasma
membrane syntaxins 1-4 but not the Golgi syntaxin 5 interacts
strongly with SNAP-25 ().
As an internal control, the
interactions of syntaxins with SNAP-25 were analyzed with either
syntaxins in the prey vector and SNAP-25 in the bait vector or the
other way around. Although the -galactosidase activities observed
with the two vector combinations were similar and had the same rank
order, they differed significantly. This suggests that the
-galactosidase activities do not only depend on which the
interaction of the proteins involved but also on which protein is
expressed by the prey vector and which by the bait vector
(). Thus, only matching series of plasmids can be compared
with each other to estimate the relative affinity of their
interactions.
Analysis of the interaction of syntaxins with
synaptobrevin in the yeast two-hybrid system failed to detect binding
despite the fact that these proteins interact with each other in
vitro (Calakos et al., 1994; Hayashi et al.,
1994). Similarly, different domains of synaptotagmin I do not interact
with syntaxins or with the cytoplasmic domain of neurexin II in the
yeast two-hybrid system, although they interact in vitro (Bennett et al., 1992; Yoshida et al., 1992;
Hata et al., 1993b). These results suggest that the in
vitro biochemical interaction assays, particularly if assessed by
means of immunoblotting and not Coomassie Blue staining, are more
sensitive than the yeast two-hybrid system in detecting protein-protein
interactions.
In addition to analyzing interactions between
different proteins, we also analyzed interactions of proteins with
themselves by yeast two-hybrid system (). Surprisingly,
SNAP-25 and syntaxin 1A were found to bind strongly to themselves,
whereas syntaxins 2, 3, and 5 exhibited no such interaction and
syntaxin 4 only a weak interaction. Furthermore, the C domains of synaptotagmin I also interacted weakly with
themselves. It is unclear if SNAP-25 or syntaxin 1A form homomultimers
physiologically, but such a homomultimerization could be potentially
important in the functions of these proteins at the active zone. Analysis of the Interaction of Munc-18-1 and Munc-18-2 with
Syntaxins Using the Yeast Two-hybrid System-Syntaxins 1A, 2, 3,
4, and 5 were analyzed for interactions with Munc-18-1 and
Munc-18-2 in the yeast two-hybrid system. Again these analyses
were performed in both vector combinations (). Similar but
not identical results were obtained; syntaxins 1A, 2, and 3 interacted
with both Munc-18s, whereas syntaxins 4 and 5 showed no significant
activity in both vector combinations. The absolute values of
-galactosidase activation differed considerably between vector
combinations for the same pair of interacting proteins, confirming the
observation that the type of vector combination has a major effect on
the degree of -galactosidase activation. The yeast two-hybrid
interaction data provide independent evidence for the conclusions from
the biochemical experiments (Fig. 4), which demonstrated strong
interactions between both Munc-18s and syntaxins 1A, 2, and 3 but not
4. In addition, syntaxin 5 (which could not be analyzed biochemically)
is now shown in the yeast two-hybrid system not to interact with
Munc-18s.
Munc-18s are rather large proteins, raising the
possibility that they may have multiple functional domains and that
only part of the proteins may be required for syntaxin binding. To
investigate what sequences of Munc-18 are required for syntaxin
binding, deleted versions of Munc-18-1 were tested in the yeast
two-hybrid system. The extent of the deletions used in these assays is
diagrammed in Fig. 5. Surprisingly, even small deletions at the N
terminus (pBTM116Munc-18-1-6) or C terminus
(pBTM116Munc-18-1-2) of Munc-18-1 completely abolished
binding to syntaxin 1A. This result suggests that the full-length
Munc-18-1 protein is required for binding and that Munc-18s do
not have a simple multi-domain structure.
Figure 5:
Structures of truncated Munc-18-1
proteins expressed in yeast for the two-hydrid analysis. Full-length
Munc-18-1 is shown on top; the deletions introduced in
different bait vectors are indicated below as hatchedregions in the bardiagram. The binding
of the various truncated versions of Munc-18-1 to syntaxin 1 was
analyzed in the yeast two-hybrid system as described in Table
II.
DISCUSSION
Previous studies have established that Munc-18-1 (also
called rb-sec1 and n-sec1) is an abundant nerve terminal protein that
binds to syntaxin 1 and is likely to have an essential function in
neurotransmitter release (Hata et al., 1993a; Garcia et
al., 1994; Pevsner et al., 1994a). We have now
investigated the possibility that non-neuronal tissues express a
homologue of Munc-18-1 that interacts with the syntaxins found in
these tissues (syntaxin 2-5; Bennett et al.(1993)). Our
data show that visceral organs such as liver and kidney express a new
isoform of Munc-18 named Munc-18-2. Munc-18-2 is homologous
to Munc-18-1 (63% sequence identity) and ubiquitously present at
low levels in all tissues investigated. Biochemical experiments with
recombinant Munc-18-1 and Munc-18-2 from transfected COS
cells and studies using the yeast two-hybrid system demonstrate that
Munc-18-1 and Munc-18-2 interact with syntaxins 1A, 2, and
3 but not syntaxins 4 and 5. Sequence comparisons between different
isoforms of Munc-18 and their Drosophila and C. elegans homologues reveal a patchy pattern of sequence conservations that
is evenly distributed over the entire sequence, suggesting that the
entire protein is functionally important. This suggestion is supported
by yeast two-hybrid experiments, which demonstrated that the whole
coding sequence of Munc-18-1 is required for its interaction with
syntaxins. Thus, non-neuronal tissues express a novel Munc-18 isoform,
Munc-18-2, that has the same binding specificity for syntaxins as
Munc-18-1. It seems likely that Munc-18-2 performs
functions in constitutive membrane trafficking reactions that are
similar to those of Munc-18-1 in neurons, although the precise
nature of these functions is unclear.
Mutants in Munc-18 homologues
in Drosophila demonstrated that Munc-18 is essential for
membrane traffic in those tissues that express it, in particular
presynaptic nerve terminals (Harrison et al., 1994). In the
nerve terminal, the synaptic plasma membrane protein syntaxin 1 serves
as a central player in setting up membrane fusion. Syntaxin 1 has four
protein binding activities that are probably essential for synaptic
vesicle exocytosis. 1) It binds to Munc-18-1 as discussed above;
2) together with synaptobrevin and SNAP-25, syntaxin 1 forms the
synaptic core complex that serves as a receptor for SNAPs and NSF
(Söllner et al., 1993; McMahon and Südhof, 1995); 3)
syntaxin 1A binds to N-type Ca channels, which may be
important for the localization of syntaxin 1A or of the Ca channels to the synapse (Sheng et al., 1994); and 4)
syntaxin 1A binds to synaptotagmin I (Bennett et al., 1992;
Yoshida et al., 1992). Since synaptotagmin is essential for
Ca -evoked neurotransmitter release (Geppert et
al., 1994), this interaction may be important for release. It
seems likely that the interaction of Munc-18-1 with syntaxin 1
precedes its binding to the core complex because SNAP-25 and
Munc-18-1 cannot bind to syntaxin at the same time (Pevsner
et al., 1994b). Thus, Munc-18s may have a function related to
the formation of the core complex.
Three findings argue against a
passive role for Munc-18s as mere inhibitors of fusion reactions. 1)
Mutations in the Munc-18 homologues Sec1 in yeast and unc-18 in C.
elegans lead to an accumulation of secretory and synaptic vesicles
and not to a depletion (Novick et al., 1981); ( )
2) the analysis of the Drosophila rop mutants
suggested an active role in membrane trafficking (Harrison et
al., 1994); and 3) the N and the C terminus of Munc-18 is required
for syntaxin binding. Since the Munc-18 sequence is much longer than
other syntaxin binding sequences (e.g. -SNAP, SNAP-25,
synaptobrevin), the conserved middle region of Munc-18s may have
additional functions, possibly by mediating interactions with the Rab
proteins as suggested for the Munc-18 homologue Sly1 in yeast (Dascher
et al., 1991). Thus, the function of Munc-18 in membrane
fusion is unclear but may very well consist of an active step in
setting up the fusion reaction.
Table:
Interactions between synaptic trafficking
proteins in the yeast two-hybrid system
Yeast clones cotransformed
with the pVP16 and pBTM116 vectors in the indicated combinations were
selected on supplemented minimal plates lacking uracil, tryptophan, and
leucine plates and grown in the presence of selection medium in liquid
culture. -Galactosidase activity in the yeast lysates was measured
in triplicate as described (Rose et al., 1990); data shown are
in arbitrary units from three determinations ± S.D. Syt1A to 5,
syntaxins 1-5; Syb, synaptobrevin; Syt4, -8, -9, synaptotagmin 4,
8, 9 constructs; Ne2A, neurexin 2.
Table:
Interactions
between Munc-18s and syntaxins in the yeast two-hybrid system
See
legend to Table I for a description of the interaction measurements by
-galactosidase assays. The inserts contained in the different
Munc-18 clones are shown in Fig. 5.
FOOTNOTES
- *
- This work was
supported by a postdoctoral fellowship (to Y. H.) from the Human
Frontier Science Program. The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been
submitted to the GenBank /EMBL Data Bank with accession number(s)
U20283.
- §
- To whom correspondence should be
addressed.
- The abbreviations used are: NSF,
N-ethylmaleimide sensitive factor; GST, glutathione
S-transferase; PCR, polymerase chain reaction; PAGE,
polyacrylamide gel electrophoresis; SNAP, soluble NSF attachment
protein.
- E. Jorgensen, personal communication.
ACKNOWLEDGEMENTS
We thank I. Leznicki, E. Borowicz, and A. Roth for
excellent technical assistance. We thank Dr. Stan Hollenberg for
plasmid pVP16, yeast strain L40, and invaluable advice; Drs. P. Bartel
and S. Fields for plasmid pBTM116; Dr. R. Sternglanz for yeast strain
AMR70; and Dr. R. H. Scheller for syntaxin cDNA clones.
Note Added in Proof-While this paper was in press, two reports
were published describing the sequence of a murine Munc-18 isoform that
probably constitutes the murine homologue for Muc-18-2 (Tellam, J.,
McIntosh, S., and James, D. E.(1995), J. Biol. Chem.
270, 5857-5863; Katagiri, H., Terasaki, J., Tomiyasu, M.,
Ishihara, H., Ogihara, T., Inukai, K., Fukushima, Y., Anai, M.,
Kikuchi, M., Miyazaki, J., Yazaki, Y., and Oka, Y.(1995), J. Biol.
Chem.
270, 4963-4966).
REFERENCES
- Bennett, M. K., and Scheller, R. H.(1994) Annu. Rev. Biochem. 63, 63-100
[CrossRef][Medline]
[Order article via Infotrieve]
- Bennett, M. K., Calakos, N., and Scheller, R. H.(1992) Science 257, 255-259
[Abstract/Free Full Text]
- Bennett, M. K., Garcia-Arraras, J. E., Elferink, L. A., Peterson, K., Fleming, A. M., Hazuka, C. D., and Scheller, R. H.(1993) Cell 74, 863-873
[CrossRef][Medline]
[Order article via Infotrieve]
- Calakos, N., Bennett, M. K., Petersen, K. E., and Scheller, R. H. (1994) Science 263, 1146-1149
[Abstract/Free Full Text]
- Dascher, C., Ossig, R., Gallwitz, D., and Schmitt, H. D.(1991) Mol. Cell. Biol. 11, 872-885
[Abstract/Free Full Text]
- Fields, S., and Song, O.(1989) Nature 340, 245-246
[CrossRef][Medline]
[Order article via Infotrieve]
- Garcia, E. P., Gatti, E., Butler, M., Burton, J., and De Camilli, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2003-2007
[Abstract/Free Full Text]
- Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F., and Südhof, T. C.(1994) Cell 79, 717-727
[CrossRef][Medline]
[Order article via Infotrieve]
- Harrison, S. D., Broadie, K., van de Goor, J., and Rubin, G. M.(1994) Neuron 13, 555-566
[CrossRef][Medline]
[Order article via Infotrieve]
- Hata, Y., Slaughter, C. A., and Südhof, T. C. (1993a) Nature 366, 347-351
[CrossRef][Medline]
[Order article via Infotrieve]
- Hata, Y., Davletov, B., Petrenko, A. G., Jahn, R., and Südhof, T. C. (1993b) Neuron 10, 307-315
[CrossRef][Medline]
[Order article via Infotrieve]
- Hayashi, T., McMahon, H., Yamasaki, S., Binz, T., Hata, Y., Südhof, T. C., and Niemann, H.(1994) EMBO J. 13, 5051-5061
[Medline]
[Order article via Infotrieve]
- Hosono, R., Hekimi, S., Kamiya, Y., Sassa, T., Murakami, S., Nishiwaki, K., Miwa, J., Taketo, A., and Kodaira, K.-I.(1992) J. Neurochem. 58, 1517-1525
[CrossRef][Medline]
[Order article via Infotrieve]
- Jahn, R., and Südhof, T. C.(1994) Annu. Rev. Neurosci. 17, 219-246
[CrossRef][Medline]
[Order article via Infotrieve]
- Laemmli, U. K.(1970) Nature 227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- McMahon, H. T., and Südhof, T. C.(1995) J. Biol. Chem. 270, 2213-2217
[Abstract/Free Full Text]
- McMahon, H. T., Ushkaryov, Y. A., Edelmann, L., Link, E., Binz, T., Niemann, H., Jahn, R., and Südhof, T. C.(1993) Nature 364, 346-349
[CrossRef][Medline]
[Order article via Infotrieve]
- Novick, P., Ferro, S., and Scheckman, R.(1981) Cell 25, 461-469
[CrossRef][Medline]
[Order article via Infotrieve]
- Oyler, G. A., Higgins, G. A., Hart, R. A., Battenberg, E., Billingsley, M., Bloom, F. E., and Wilson, M. C.(1989) J. Cell Biol. 109, 3039-3052
[Abstract/Free Full Text]
- Pelham, H. R. B.(1993) Nature 364, 582
[Medline]
[Order article via Infotrieve]
- Perin, M. S., Fried, V. A., Mignery, G. A., Jahn, R., and Südhof, T. C.(1990) Nature 345, 260-261
[CrossRef][Medline]
[Order article via Infotrieve]
- Pevsner, J., Hsu, S.-C., and Scheller, R. H. (1994a) Proc. Natl. Acad. Sci. U. S. A. 91, 1445-1449
[Abstract/Free Full Text]
- Pevsner, J., Hsu, S.-C., Braun, J. E. A., Calakos, N., Ting, A. E., Bennett, M. K., and Scheller, R. H. (1994b) Neuron 13, 353-361
[CrossRef][Medline]
[Order article via Infotrieve]
- Rose, M. D., Winston, F., and Hieter, P.(1990) Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
- Rothman, J.(1994) Nature 372, 55-63
[CrossRef][Medline]
[Order article via Infotrieve]
- Sambrook, J., Fritsch, E. F., and Maniatis, T.(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
- Schiestl, R. H., and Gietz, R. D.(1989) Current Genetics 16, 339-346
[CrossRef][Medline]
[Order article via Infotrieve]
- Sheng, Z.-H., Rettig, J., Takahashi, M., and Catterall, W. A.(1994) Neuron 13, 1303-1313
[CrossRef][Medline]
[Order article via Infotrieve]
- Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J. E.(1993) Nature 362, 318-324
[CrossRef][Medline]
[Order article via Infotrieve]
- Südhof, T. C.(1990) J. Biol. Chem. 265, 7849-7852
[Abstract/Free Full Text]
- Südhof, T. C., Baumert, M., Perin, M. M. S., and Jahn, R.(1989) Neuron 2, 1475-1481
[CrossRef][Medline]
[Order article via Infotrieve]
- Südhof, T. C., De Camilli, P., Niemann, H., and Jahn, R.(1993) Cell 75, 1-4
[CrossRef][Medline]
[Order article via Infotrieve]
- Ushkaryov, Y. A., and Südhof, T. C.(1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6410-6414
[Abstract/Free Full Text]
- Ushkaryov, Y. A., Petrenko, A. G., Geppert, M., and Südhof, T. C. (1992) Science 257, 50-56
[Abstract/Free Full Text]
- Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A.(1993) Cell 74, 205-214
[CrossRef][Medline]
[Order article via Infotrieve]
- Yoshida, A., Oho, C., Omori, A., Kuwahara, R., Ito, T., and Takahashi, M.(1992) J. Biol. Chem. 267, 24925-24928
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Procino, C. Barbieri, G. Tamma, L. De Benedictis, J. E. Pessin, M. Svelto, and G. Valenti
AQP2 exocytosis in the renal collecting duct - involvement of SNARE isoforms and the regulatory role of Munc18b
J. Cell Sci.,
June 15, 2008;
121(12):
2097 - 2106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Arunachalam, L. Han, N. G. Tassew, Y. He, L. Wang, L. Xie, Y. Fujita, E. Kwan, B. Davletov, P. P. Monnier, et al.
Munc18-1 Is Critical for Plasma Membrane Localization of Syntaxin1 but Not of SNAP-25 in PC12 Cells
Mol. Biol. Cell,
February 1, 2008;
19(2):
722 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Umahara, S. Okada, E. Yamada, T. Saito, K. Ohshima, K. Hashimoto, M. Yamada, H. Shimizu, J. E. Pessin, and M. Mori
Tyrosine Phosphorylation of Munc18c Regulates Platelet-Derived Growth Factor-Stimulated Glucose Transporter 4 Translocation in 3T3L1 Adipocytes
Endocrinology,
January 1, 2008;
149(1):
40 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gulyas-Kovacs, H. de Wit, I. Milosevic, O. Kochubey, R. Toonen, J. Klingauf, M. Verhage, and J. B. Sorensen
Munc18-1: Sequential Interactions with the Fusion Machinery Stimulate Vesicle Docking and Priming
J. Neurosci.,
August 8, 2007;
27(32):
8676 - 8686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B.A. t. Beest, S. J. Chapin, D. Avrahami, and K. E. Mostov
The Role of Syntaxins in the Specificity of Vesicle Targeting in Polarized Epithelial Cells
Mol. Biol. Cell,
December 1, 2005;
16(12):
5784 - 5792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fukuda, A. Imai, T. Nashida, and H. Shimomura
Slp4-a/Granuphilin-a Interacts with Syntaxin-2/3 in a Munc18-2-dependent Manner
J. Biol. Chem.,
November 25, 2005;
280(47):
39175 - 39184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Oh, B. A. Spurlin, J. E. Pessin, and D. C. Thurmond
Munc18c Heterozygous Knockout Mice Display Increased Susceptibility for Severe Glucose Intolerance
Diabetes,
March 1, 2005;
54(3):
638 - 647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Fu, A. P. Naren, X. Gao, G. U. Ahmmed, and A. B. Malik
Protease-activated Receptor-1 Activation of Endothelial Cells Induces Protein Kinase C{alpha}-dependent Phosphorylation of Syntaxin 4 and Munc18c: ROLE IN SIGNALING P-SELECTIN EXPRESSION
J. Biol. Chem.,
February 4, 2005;
280(5):
3178 - 3184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Li, A. Lau, T. J. Morris, L. Guo, C. B. Fordyce, and E. F. Stanley
A Syntaxin 1, G{alpha}o, and N-Type Calcium Channel Complex at a Presynaptic Nerve Terminal: Analysis by Quantitative Immunocolocalization
J. Neurosci.,
April 21, 2004;
24(16):
4070 - 4081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Houng, J. Polgar, and G. L. Reed
Munc18-Syntaxin Complexes and Exocytosis in Human Platelets
J. Biol. Chem.,
May 23, 2003;
278(22):
19627 - 19633.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Martin-Verdeaux, I. Pombo, B. Iannascoli, M. Roa, N. Varin-Blank, J. Rivera, and U. Blank
Evidence of a role for Munc18-2 and microtubules in mast cell granule exocytosis
J. Cell Sci.,
January 15, 2003;
116(2):
325 - 334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kauppi, G. Wohlfahrt, and V. M. Olkkonen
Analysis of the Munc18b-Syntaxin Binding Interface. USE OF A MUTANT Munc18b TO DISSECT THE FUNCTIONS OF SYNTAXINS 2 AND 3
J. Biol. Chem.,
November 8, 2002;
277(46):
43973 - 43979.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sauvonnet, B. Pradet-Balade, J. A. Garcia-Sanz, and G. R. Cornelis
Regulation of mRNA Expression in Macrophages after Yersinia enterocolitica Infection. ROLE OF DIFFERENT Yop EFFECTORS
J. Biol. Chem.,
July 5, 2002;
277(28):
25133 - 25142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Bustos, E. R. Kolen, L. Braiterman, A. J. Baines, F. S. Gorelick, and A. L. Hubbard
Synapsin I is expressed in epithelial cells: localization to a unique trans-Golgi compartment
J. Cell Sci.,
March 12, 2002;
114(20):
3695 - 3704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rowe, F. Calegari, E. Taverna, R. Longhi, and P. Rosa
Syntaxin 1A is delivered to the apical and basolateral domains of epithelial cells: the role of munc-18 proteins
J. Cell Sci.,
March 11, 2002;
114(18):
3323 - 3332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Gerber and T. C. Sudhof
Molecular Determinants of Regulated Exocytosis
Diabetes,
February 1, 2002;
51(90001):
S3 - 11.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Jantti, M. K. Aalto, M. Oyen, L. Sundqvist, S. Keranen, and H. Ronne
Characterization of temperature-sensitive mutations in the yeast syntaxin 1 homologues Sso1p and Sso2p, and evidence of a distinct function for Sso1p in sporulation
J. Cell Sci.,
January 15, 2002;
115(2):
409 - 420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawabe, H. Nakanishi, M. Asada, A. Fukuhara, K. Morimoto, M. Takeuchi, and Y. Takai
Pilt, a Novel Peripheral Membrane Protein at Tight Junctions in Epithelial Cells
J. Biol. Chem.,
December 14, 2001;
276(51):
48350 - 48355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Riento, M. Kauppi, S. Keranen, and V. M. Olkkonen
Munc18-2, a Functional Partner of Syntaxin 3, Controls Apical Membrane Trafficking in Epithelial Cells
J. Biol. Chem.,
April 28, 2000;
275(18):
13476 - 13483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Verhage, A. S. Maia, J. J. Plomp, A. B. Brussaard, J. H. Heeroma, H. Vermeer, R. F. Toonen, R. E. Hammer, T. K. van den Berg, M. Missler, et al.
Synaptic Assembly of the Brain in the Absence of Neurotransmitter Secretion
Science,
February 4, 2000 | |