Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hata, Y.
Right arrow Articles by Südhof, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hata, Y.
Right arrow Articles by Südhof, T. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 22, Issue of June 2, pp. 13022-13028, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel Ubiquitous Form of Munc-18 Interacts with Multiple Syntaxins
USE OF THE YEAST TWO-HYBRID SYSTEM TO STUDY INTERACTIONS BETWEEN PROTEINS INVOLVED IN MEMBRANE TRAFFIC (*)

Yutaka Hata , Thomas C. Südhof (§)

From the (1) Howard Hughes Medical Institute and Department of Molecular Genetics, The University of Texas Southwestern Medical School, Dallas, Texas 75235

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Munc-18-1 is a 67-kDa neuronal protein that binds tightly to syntaxin 1 and functions in synaptic vesicle exocytosis (Hata, Y., Slaughter, C. A., and Südhof, T. C. (1993a) Nature 366, 347-351). We have now characterized a new Munc-18 isoform, Munc-18-2, that exhibits 63% amino acid sequence identity with Munc-18-1. Munc-18-2 is expressed in most tissues, whereas Munc-18-1 is primarily expressed in brain. Using recombinant Munc-18-1 and Munc-18-2 produced in COS cells, we show that both forms of Munc-18 bind tightly to syntaxins 1A, 2, and 3 but not to syntaxin 4. In an independent approach to study the binding specificities of Munc-18-1 and Munc-18-2, we used the yeast two-hybrid system. This assay system depends on protein-protein interactions in the cell nucleus. We validated its utility for studying membrane trafficking proteins by testing well characterized interactions between cytosolic proteins that are known to be physiologically important in exocytosis. Strong interactions, such as the binding of syntaxins 1-4 with SNAP-25, were effectively detected by the yeast two-hybrid assay, but weak binding, such as the binding of syntaxins to synaptotagmin or of synaptotagmin to neurexins, was not. Studies on full-length and truncated forms of Munc-18s by the yeast two-hybrid system confirmed their interactions with syntaxins. Both the N and the C terminus of Munc-18 were essential for binding. Munc-18-1 and Munc-18-2 bind only to syntaxins 1A, 2, and 3 but not 4 and 5 by yeast-two hybrid system assays. Our studies demonstrate that neural and non-neural tissues have distinct forms of Munc-18, which may function in different types of exocytosis. The lack of specificity of the interactions between syntaxins and Munc-18s indicates that specificity of membrane trafficking reactions is not dependent on this interaction.


INTRODUCTION

The first step toward an understanding of the molecular mechanisms of membrane traffic is the identification of components of the trafficking machinery. The characterization of proteins with putative functions in exocytosis has particularly advanced at the synapse (reviewed in Jahn and Südhof(1994)). Originally, synaptic membrane traffic was thought to be mechanistically unique. Recent years, however, have demonstrated that many synapse-specific proteins have homologues in other cellular fusion reactions where they may perform analogous functions and vice versa. Thus, the mechanisms are probably similar for different types of membrane trafficking reactions, and the molecular components acting in these reactions are conserved between different reactions and different species (reviewed in Südhof et al.(1993) and Bennett and Scheller(1994)).

N-Ethylmaleimide sensitive factor (NSF)() is a cytosolic protein that is conserved from yeast to man and probably functions in most intracellular membrane fusion reactions, including that of synaptic vesicles (Rothman, 1994). NSF binds to specific receptor sites on membranes via soluble NSF-attachment proteins (SNAPs) that are also highly conserved between different trafficking reactions, although the membrane receptors for NSF-SNAPs may differ for different cellular compartments. Studies on the neuronal membrane receptors for NSF and -SNAP revealed that the synaptic vesicle protein synaptobrevin/vesicle-associated membrane protein and the plasma membrane proteins syntaxin and SNAP-25 (no relation to the SNAPs of NSF) are efficiently purified on immobilized -SNAP-NSF (Söllner et al., 1993). These three proteins do not individually bind -SNAP and NSF but form a tight, SDS-resistant complex (the ``core complex'') (Hayashi et al., 1994) that in turn binds -SNAP (McMahon and Südhof, 1995). Interestingly, the three components of the core complex are targets for different botulinum and tetanus toxins that block neurotransmitter release. These toxins inhibit the formation of the membrane-bridging core complex (Hayashi et al., 1994), suggesting that the core complex is required for exocytosis.

Syntaxin 1 is not only a key component of the core complex but also interacts with other proteins involved in synaptic vesicle exocytosis; Ca channels (Sheng et al., 1994), synaptotagmin I (Bennett et al., 1992; Yoshida et al., 1992), and Munc-18-1 (Hata et al., 1993a; also called n-sec1 (Pevsner et al., 1994a) or rb-sec1 (Garcia et al., 1994)). Munc-18-1 is a cytosolic brain protein that binds tightly to syntaxin 1. Munc-18-1 is likely to have an essential function in neurotransmitter release because mutations of its homologues in Drosophila and in Caenorhabditis elegans (called rop and unc-18, respectively) lead to a phenotype that suggests an inhibition of neurotransmitter release (Hosono et al., 1992; Harrison et al., 1994). A role for Munc-18 in exocytosis is supported by its distant homology to three proteins involved in the yeast secretory pathway, Sec1, Sly1, and Slp1 (Pelham, 1993). Biochemical studies have revealed that syntaxin 1 cannot simultaneously bind Munc-18-1 and SNAP-25, suggesting an ordered sequence in the interactions of syntaxin 1 with these two components of the fusion apparatus (Pevsner et al., 1994b). However, it seems unlikely that the only function of Munc-18-1 consists in an inhibitory role in the formation of the core complex, and the exact function of Munc-18-1 is currently unclear.

Since NSF and SNAPs are ubiquitous membrane trafficking proteins, it seems likely that non-neural tissues should also express homologues of the various interacting proteins. This has been shown for synaptobrevin and syntaxin. All cells tested express a ubiquitously distributed homologue of synaptobrevin, cellubrevin, that is also tetanus sensitive (McMahon et al., 1993). In addition to brain syntaxin 1, four other syntaxins with a widespread tissue distribution have been described (Bennett et al., 1993).

Munc-18-1 interacts strongly with syntaxin 1; both proteins are expressed at high levels only in brain (Hata et al., 1993a; Pevsner et al., 1994a, 1994b). However, the presence of homologues of syntaxin 1 and of synaptobrevin in all animal cells indicates a general role for syntaxins and its interacting partners in membrane traffic (Bennett et al., 1993; McMahon et al., 1993). This suggests that there may be additional forms of Munc-18 in non-neuronal membrane traffic. In the current study, we have identified a novel form of Munc-18 called Munc-18-2. We have studied the specificity and mechanism of the interaction of Munc-18s with different syntaxins to gain insight into the regions of Munc-18 that are required for binding and into the specificity of this interaction. Our data demonstrate that neuronal and non-neuronal trafficking pathways use distinct but homologous isoforms of Munc-18 with similar binding specificities for syntaxin.


MATERIALS AND METHODS

cDNA Cloning, Sequencing, and Sequence Analysis

cDNA libraries from rat intestine, thymus, and liver in ZAPII (Stratagene) were screened with random-primed DNA probes from rat Munc-18-1 (Hata et al., 1993a) at low stringency (30% formamide) (Südhof, 1990). Seven clones were isolated from the intestinal library and one from the liver and the thymus libraries and sequenced after subcloning into M13 vectors. DNA sequencing was performed by the dideoxy nucleotide chain termination method using fluorescently labeled primers and an ABI370A DNA sequencer. All but one clone initiated just after the starting ATG, and the single clone containing the putative initiator ATG had an intron, an artifactual occurrence that is not uncommon for cDNA libraries. Therefore, PCR primers corresponding to the putative translation start and termination codons were used to isolate the complete coding region as a PCR fragment (sequences of oligonucleotide primers: CGCGGATCCGAGGGGAAGATGGCGCCCT and GCGCTCGAGTCAGGGCAGGGCTATGTC). PCR was performed on rat brain cDNA as described (Ushkaryov and Südhof, 1993). The 1.8-kilobase fragment was subcloned into the TA cloning vector (Invitrogen) and sequenced. All sequences were analyzed on a PC using IntelliGenetics software. The nucleotide sequences of the cDNA clones were deposited in the GenBank data bank.

Construction of Bacterial and Eukaryotic Expression Vectors and Expression of Proteins in Bacteria and COS Cells

Bacterial expression vectors encoding GST-fusion proteins of the cytoplasmic domains of syntaxins 1A, 2, 3, 4, and 5 (pGexSynt1-Synt5) were constructed by PCR and standard recombinant DNA techniques in pGEX-KG (Sambrook et al., 1989; Hata et al., 1993a). GST-fusion proteins were expressed and purified on glutathione-agarose; GST-syntaxin 5 was insoluble and not studied further. For expression of Munc-18-1 and Munc-18-2 in COS cells, the coding region of the rat cDNAs were cloned into the vector pCMV5 (gift of Dr. David W. Russell, UT Southwestern Medical Center, Dallas). Plasmid DNA was transfected into COS cells using DEAE-dextran, and transfected COS cells were harvested 48-72 h after transfection. Analysis of the Binding of Recombinant Munc-18-1 and Munc-18-2 to Different GST-Syntaxin Fusion Proteins-Total solubilized homogenates were obtained from rat liver and brain as described and used for binding studies with recombinant GST-syntaxin fusion proteins (Hata et al., 1993a). To analyze binding of recombinant Munc-18-1 and Munc-18-2, COS cells transfected with control DNA or with Munc-18-1 and Munc-18-2 expression vectors were solubilized in 20 mM HEPES-NaOH, pH 8.0, 0.1 M NaCl, 0.5% Nonidet P-40, 0.1 g/liter phenylmethylsulfonyl fluoride, and 10 mg/liter leupeptin. Solubilized COS cell extract was incubated with various GST-fusion proteins attached to glutathione-agarose, centrifuged, washed three to five times in the solubilization buffer, and analyzed by SDS-PAGE followed by Coomassie Blue staining or immunoblotting.

Analysis of Protein-Protein Interactions by the Yeast Two-hybrid System

The full-length or partial coding regions of syntaxins 1A, 2, 3, 4, and 5, SNAP-25A, synaptotagmin I, and neurexin II were cloned into the bait and prey yeast expression vectors pBTM116 and pVP16 (Vojtek et al., 1993). The following vectors contain the following inserts (residue numbers are from the following sources: Munc-18s, Fig. 1; synaptotagmin I, Perin et al.(1990); SNAP-25A, Oyler et al.(1989); syntaxins, Bennett et al.(1993); neurexin II, Ushkaryov et al.(1992); synaptobrevin II, Südhof et al. (1989)): pBTMMunc-18-1, pVP16Munc-18-1, pBTMMunc-18-2, and pVP16Munc-18-2, the complete coding region (residues 1-594); pBTMMunc-18-1-2, residues 1-569; pBTMMunc-18-1-3, residues 1-529; pBTMMunc-18-1-4, residues 1-341; pBTMMunc-18-1-5, residues 99-594; pBTMMunc-18-1-6, residues 16-594; pBTMMunc-18-1-7, residues 1-100; pBTMMunc-18-1-8, residues 340-594; pBTMMunc-18-1-9, residues 99-529; pBTMMunc-18-1-10, residues 99-341; pBTMMunc-18-1-11, residues 16-341. pBTMSyntaxin 1A, 2, 3, 4, and 5 and the corresponding pVP16 constructs encode residues 1-265, 1-262, 1-260, 1-269, and 1-278, respectively, of syntaxins 1-5. pBTMSNAP-25A and pVP16SNAP-25A encode full-length SNAP-25A (residues 1-206). pBTMNe2A and pVP16Ne2a encode residues 1660-1715 of rat neurexin II. pBTMSyt-4 and pBTMSyt-9 encode residues 141-268 and 266-422 of rat synaptotagmin I, respectively, and pBTMSyt-8 and pVP16Syt-8 encode residues 120-422. pVP16Syb encodes residues 1-96 of bovine synaptobrevin. Yeast strain L40 (Vojtek et al., 1993) was transfected with bait and prey vectors using the lithium acetate method (Schiestl and Gietz, 1989). Transformants were plated on selection plates lacking uracil, tryptophan, and leucine. After 2 days of incubation at 30 °C, colonies were inoculated into supplemented minimal medium lacking uracil, tryptophan, and leucine and placed in a shaking incubator at 30 °C for 48 h. -Galactosidase assays were performed on yeast extracts with protein concentrations of 20-40 mg/liter per assay as described (Rose et al., 1990). RNA Blotting Analysis-RNA blotting analysis was performed essentially as described (Ushkaryov et al., 1992) using either total RNA from different rat tissues or commercially available blots (Clontech) containing total RNA from rat tissues.


Figure 1: Alignment of the amino acid sequences of rat Munc-18-2, rat Munc-18-1, Drosophila rop, and the unc-18 gene product from C. elegans. The amino acid sequences of the indicated proteins are shown in single letter amino acid code, identified on the left (r18-2, rat Munc-18-2; r18-1, rat Munc-18-1; Drop, Drosophila Rop protein (Harrison et al., 1994); unc18, C. elegans unc-18 gene product (Hosono et al., 1992)) and numbered on the right. Residues identical in three or all four of the sequences are shaded. The rat Munc-18-2 sequence was deduced from the nucleotide sequence of overlapping cDNA clones (data not shown). The serine at position 513 was present in only one clone and absent from three other sequenced clones; the nucleotide sequence surrounding it resembles the 3`-end of a splice acceptor site (GTCAGCAGT encoding VSS), suggesting alternative use of a duplicated splice acceptor site.



Miscellaneous Procedures

SDS-PAGE was performed according to Laemmli(1970) with antibodies previously described (Hata et al., 1993a). Protein assays were done with Coomassie Blue-based assay kit (Bio-Rad).


RESULTS

Identification of a Non-neuronal Isoform of Munc-18

We screened rat liver, intestine, and thymus cDNA libraries at low stringency with randomly labeled cDNA fragments from Munc-18-1 (Hata et al., 1993a). Multiple hybridization-positive clones were isolated. Sequencing revealed that they all encoded the same novel isoform of Munc-18 that we named Munc-18-2. The sequence of the coding region of Munc-18-2 was assembled from overlapping cDNA clones. The putative initiator methionine was identified in the cDNA sequence by comparison with the initiator methionine sequences of Munc-18-1 and its Drosophila and C. elegans homologues. The translated amino acid sequence of Munc-18-2 is shown in Fig. 1in an alignment with the sequences of rat Munc-18-1 and its Drosophila and C. elegans homologues unc-18 and rop.

Munc-18-2 is 63% identical with Munc-18-1, 55% identical with the Drosophila Rop protein, and 54% identical with the C. elegans unc-18 gene product. As previously described for Munc-18-1 (Hata et al., 1993a; Pevsner et al., 1994a; Garcia et al., 1994), Munc-18-2 is distantly related to the three yeast proteins Sec1, Sly1, and Slp1 that function in the yeast secretory pathway. The sequence homology of the Munc-18s with rop and unc-18 is evenly distributed over the entire protein, with blocks of identical amino acids separated by divergent sequences (Fig. 1), suggesting that the entire protein is functionally important.

A quantitative analysis of the relations between the different Munc-18 homologues was performed with the CLUSTAL program and is depicted in the form of a dendrogram in Fig. 2. This analysis demonstrates that Munc-18-1, 18-2, rop, and unc-18 form a closely related group of proteins that are distantly related to Sec1 and Sly1 and slightly less related to Slp1. Since Munc-18s are equally homologous to Sec1 and to Sly1, we do not know if Munc-18s are equivalent to only Sec1 or if they also functionally overlap with Sly1 and possibly Slp1. Therefore, we propose to name these proteins Munc-18s instead of mammalian Sec1 homologues. Tissue Distributions of Munc-18-1 and Munc-18-2-To study the tissue distributions of Munc-18-1 and Munc-18-2, RNA blots of total RNA from rat tissues were hybridized with P-labeled cDNA probes (Fig. 3). As previously described, Munc-18-1 is primarily expressed in brain, although testis also expresses significant levels (Fig. 3A). No differential expression of Munc-18-1 between different brain regions was observed in this experiment in which the brain was dissected into cerebellum, spinal cord, and forebrain. In contrast to Munc-18-1, Munc-18-2 mRNAs are expressed only at low levels in brain but could be detected in all tissues investigated (Fig. 3B). Two hybridizing mRNAs were observed in most tissues, possibly because of differential polyadenylation. Highest levels for Munc-18-2 were observed in spleen, lung, kidney, and testis. Thus, Munc-18-2 shows a more widespread distribution than Munc-18-1 and is expressed in visceral organs that lack high level expression of Munc-18-1. The expression of Munc-18-2 protein in liver was confirmed in experiments in which syntaxin binding proteins were affinity purified from liver using GST-syntaxin fusion proteins as previously described for brain (Hata et al. (1993a) and data not shown). Binding of Munc-18-1 and Munc-18-2 to Syntaxins 1A, 2, 3, and 4-Munc-18-2 is highly homologous to Munc-18-1, suggesting that Munc-18-2 may also bind to syntaxin. To test this hypothesis, Munc-18-1 and Munc-18-2 were expressed by transfection in COS cells. Membrane proteins from COS cells expressing either Munc-18-1 or Munc-18-2 and from control COS cells were solubilized in Nonidet P-40 and incubated with recombinant GST and GST-syntaxin fusion proteins attached to glutathione-agarose beads. Bound proteins were analyzed by SDS-PAGE followed by Coomassie Blue staining (Fig. 4).


Figure 2: Dendrogram analysis of the Munc-18/Sec1 family using the CLUSTAL program. The diagram depicts the degree of sequence difference between the indicated proteins; the length of the horizontallines corresponds to the sequence distance between the different proteins.




Figure 3: Tissue distribution of expression of Munc-18-1 and Munc-18-2 using RNA blotting. In A, 10 µg of total RNA from the indicated tissues was hybridized with a uniformly labeled probe from Munc-18-1. In B, a separate blot was hybridized with a probe from Munc-18-2. Positions of size markers are shown on the right. Hybridization of blots with ubiquitously expressed controls (cyclophilin and GAPDH) showed that each lane contained similar amounts of RNA (data not shown). kb, kilobases.




Figure 4: Binding of recombinant Munc-18-1 and Munc-18-2 to different syntaxins. Lysates from COS cells transfected with control DNA or with expression vectors encoding Munc-18-1 or Munc-18-2 were incubated with GST or with GST-syntaxins 1A, 2, 3, and 4 attached to glutathione-agarose and washed extensively. Proteins on the beads were analyzed by SDS-PAGE and Coomassie Blue staining. Endogenous GSTs from the COS cells (25-30 kDa) were the major proteins bound to glutathione-agarose in this experiment, but Munc-18-1 and Munc-18-2 (arrows) were co-precipitated with syntaxins as 67-kDa bands running above the GST-syntaxins only from cell lysates transfected with the appropriate expression vectors. Numbers on the left of the figures indicate positions of molecular weight markers.



No protein in the COS cell extracts bound specifically to GST alone. In contrast, incubation of the COS cell extracts with GST-syntaxins 1A, 2, and 3 led to the purification of Munc-18-1 and Munc-18-2 from the respective transfected cells but not from control cells (Fig. 4). GST-syntaxin 4 was only able to bind trace amounts of Munc-18-1 and Munc-18-2. The identification of the bound 67-kDa band from the transfected COS cells as Munc-18-1 or Munc-18-2 was confirmed by immunoblotting (data not shown). The fact that these proteins can be detected not only by sensitive immunoblotting but are also visible on Coomassie Blue-stained gels suggests that the interaction between them is of high affinity and stoichiometry.

Use of the Yeast Two-hybrid System to Measure Interactions between Proteins Implicated in Membrane Traffic

Most analyses of protein-protein interactions for the synaptic fusion complex have been performed using biochemical methods similar to those shown in the experiments in Fig. 4. The yeast two-hybrid system potentially provides a method of analyzing these interactions in vivo (Fields and Song, 1989). Proteins to be analyzed are cloned into bait and prey vectors (pBTM116 and pVP16, respectively) (Vojtek et al., 1993) and expressed in yeast as fusion proteins with a DNA binding domain and a transcription activation domain, respectively. When the two fusion proteins bind to each other in the yeast nuclei via their fused components, transcription of a selectable marker and a -galactosidase gene is activated. This binding can be selected for and measured as -galactosidase activity.

Since the yeast two-hydrid system measures nuclear protein-protein interactions, we decided to investigate its utility for analyzing interactions between the cytosolic domains of trafficking proteins by testing well characterized protein-protein interactions. The cytoplasmic domains of different syntaxins, neurexin II, synaptobrevin, three parts of synaptotagmin I, and full-length SNAP-25 were cloned into bait and prey vectors. Most sequences were cloned into both vectors to allow a pairwise analysis in both vector combinations. The strength of the interactions between the proteins encoded by these plasmids was determined by measuring activation of -galactosidase in yeast strains harboring both respective plasmids. These experiments confirmed the strong interaction between syntaxin 1A and SNAP-25 that was previously characterized biochemically (Hayashi et al., 1994). Very high levels of -galactosidase were observed with syntaxins 1A, 2, 3, and 4 but not with syntaxin 5, suggesting that only the presumptive plasma membrane syntaxins 1-4 but not the Golgi syntaxin 5 interacts strongly with SNAP-25 ().

As an internal control, the interactions of syntaxins with SNAP-25 were analyzed with either syntaxins in the prey vector and SNAP-25 in the bait vector or the other way around. Although the -galactosidase activities observed with the two vector combinations were similar and had the same rank order, they differed significantly. This suggests that the -galactosidase activities do not only depend on which the interaction of the proteins involved but also on which protein is expressed by the prey vector and which by the bait vector (). Thus, only matching series of plasmids can be compared with each other to estimate the relative affinity of their interactions.

Analysis of the interaction of syntaxins with synaptobrevin in the yeast two-hybrid system failed to detect binding despite the fact that these proteins interact with each other in vitro (Calakos et al., 1994; Hayashi et al., 1994). Similarly, different domains of synaptotagmin I do not interact with syntaxins or with the cytoplasmic domain of neurexin II in the yeast two-hybrid system, although they interact in vitro (Bennett et al., 1992; Yoshida et al., 1992; Hata et al., 1993b). These results suggest that the in vitro biochemical interaction assays, particularly if assessed by means of immunoblotting and not Coomassie Blue staining, are more sensitive than the yeast two-hybrid system in detecting protein-protein interactions.

In addition to analyzing interactions between different proteins, we also analyzed interactions of proteins with themselves by yeast two-hybrid system (). Surprisingly, SNAP-25 and syntaxin 1A were found to bind strongly to themselves, whereas syntaxins 2, 3, and 5 exhibited no such interaction and syntaxin 4 only a weak interaction. Furthermore, the C domains of synaptotagmin I also interacted weakly with themselves. It is unclear if SNAP-25 or syntaxin 1A form homomultimers physiologically, but such a homomultimerization could be potentially important in the functions of these proteins at the active zone. Analysis of the Interaction of Munc-18-1 and Munc-18-2 with Syntaxins Using the Yeast Two-hybrid System-Syntaxins 1A, 2, 3, 4, and 5 were analyzed for interactions with Munc-18-1 and Munc-18-2 in the yeast two-hybrid system. Again these analyses were performed in both vector combinations (). Similar but not identical results were obtained; syntaxins 1A, 2, and 3 interacted with both Munc-18s, whereas syntaxins 4 and 5 showed no significant activity in both vector combinations. The absolute values of -galactosidase activation differed considerably between vector combinations for the same pair of interacting proteins, confirming the observation that the type of vector combination has a major effect on the degree of -galactosidase activation. The yeast two-hybrid interaction data provide independent evidence for the conclusions from the biochemical experiments (Fig. 4), which demonstrated strong interactions between both Munc-18s and syntaxins 1A, 2, and 3 but not 4. In addition, syntaxin 5 (which could not be analyzed biochemically) is now shown in the yeast two-hybrid system not to interact with Munc-18s.

Munc-18s are rather large proteins, raising the possibility that they may have multiple functional domains and that only part of the proteins may be required for syntaxin binding. To investigate what sequences of Munc-18 are required for syntaxin binding, deleted versions of Munc-18-1 were tested in the yeast two-hybrid system. The extent of the deletions used in these assays is diagrammed in Fig. 5. Surprisingly, even small deletions at the N terminus (pBTM116Munc-18-1-6) or C terminus (pBTM116Munc-18-1-2) of Munc-18-1 completely abolished binding to syntaxin 1A. This result suggests that the full-length Munc-18-1 protein is required for binding and that Munc-18s do not have a simple multi-domain structure.


Figure 5: Structures of truncated Munc-18-1 proteins expressed in yeast for the two-hydrid analysis. Full-length Munc-18-1 is shown on top; the deletions introduced in different bait vectors are indicated below as hatchedregions in the bardiagram. The binding of the various truncated versions of Munc-18-1 to syntaxin 1 was analyzed in the yeast two-hybrid system as described in Table II.




DISCUSSION

Previous studies have established that Munc-18-1 (also called rb-sec1 and n-sec1) is an abundant nerve terminal protein that binds to syntaxin 1 and is likely to have an essential function in neurotransmitter release (Hata et al., 1993a; Garcia et al., 1994; Pevsner et al., 1994a). We have now investigated the possibility that non-neuronal tissues express a homologue of Munc-18-1 that interacts with the syntaxins found in these tissues (syntaxin 2-5; Bennett et al.(1993)). Our data show that visceral organs such as liver and kidney express a new isoform of Munc-18 named Munc-18-2. Munc-18-2 is homologous to Munc-18-1 (63% sequence identity) and ubiquitously present at low levels in all tissues investigated. Biochemical experiments with recombinant Munc-18-1 and Munc-18-2 from transfected COS cells and studies using the yeast two-hybrid system demonstrate that Munc-18-1 and Munc-18-2 interact with syntaxins 1A, 2, and 3 but not syntaxins 4 and 5. Sequence comparisons between different isoforms of Munc-18 and their Drosophila and C. elegans homologues reveal a patchy pattern of sequence conservations that is evenly distributed over the entire sequence, suggesting that the entire protein is functionally important. This suggestion is supported by yeast two-hybrid experiments, which demonstrated that the whole coding sequence of Munc-18-1 is required for its interaction with syntaxins. Thus, non-neuronal tissues express a novel Munc-18 isoform, Munc-18-2, that has the same binding specificity for syntaxins as Munc-18-1. It seems likely that Munc-18-2 performs functions in constitutive membrane trafficking reactions that are similar to those of Munc-18-1 in neurons, although the precise nature of these functions is unclear.

Mutants in Munc-18 homologues in Drosophila demonstrated that Munc-18 is essential for membrane traffic in those tissues that express it, in particular presynaptic nerve terminals (Harrison et al., 1994). In the nerve terminal, the synaptic plasma membrane protein syntaxin 1 serves as a central player in setting up membrane fusion. Syntaxin 1 has four protein binding activities that are probably essential for synaptic vesicle exocytosis. 1) It binds to Munc-18-1 as discussed above; 2) together with synaptobrevin and SNAP-25, syntaxin 1 forms the synaptic core complex that serves as a receptor for SNAPs and NSF (Söllner et al., 1993; McMahon and Südhof, 1995); 3) syntaxin 1A binds to N-type Ca channels, which may be important for the localization of syntaxin 1A or of the Ca channels to the synapse (Sheng et al., 1994); and 4) syntaxin 1A binds to synaptotagmin I (Bennett et al., 1992; Yoshida et al., 1992). Since synaptotagmin is essential for Ca-evoked neurotransmitter release (Geppert et al., 1994), this interaction may be important for release. It seems likely that the interaction of Munc-18-1 with syntaxin 1 precedes its binding to the core complex because SNAP-25 and Munc-18-1 cannot bind to syntaxin at the same time (Pevsner et al., 1994b). Thus, Munc-18s may have a function related to the formation of the core complex.

Three findings argue against a passive role for Munc-18s as mere inhibitors of fusion reactions. 1) Mutations in the Munc-18 homologues Sec1 in yeast and unc-18 in C. elegans lead to an accumulation of secretory and synaptic vesicles and not to a depletion (Novick et al., 1981);() 2) the analysis of the Drosophila rop mutants suggested an active role in membrane trafficking (Harrison et al., 1994); and 3) the N and the C terminus of Munc-18 is required for syntaxin binding. Since the Munc-18 sequence is much longer than other syntaxin binding sequences (e.g. -SNAP, SNAP-25, synaptobrevin), the conserved middle region of Munc-18s may have additional functions, possibly by mediating interactions with the Rab proteins as suggested for the Munc-18 homologue Sly1 in yeast (Dascher et al., 1991). Thus, the function of Munc-18 in membrane fusion is unclear but may very well consist of an active step in setting up the fusion reaction.

  
Table: Interactions between synaptic trafficking proteins in the yeast two-hybrid system

Yeast clones cotransformed with the pVP16 and pBTM116 vectors in the indicated combinations were selected on supplemented minimal plates lacking uracil, tryptophan, and leucine plates and grown in the presence of selection medium in liquid culture. -Galactosidase activity in the yeast lysates was measured in triplicate as described (Rose et al., 1990); data shown are in arbitrary units from three determinations ± S.D. Syt1A to 5, syntaxins 1-5; Syb, synaptobrevin; Syt4, -8, -9, synaptotagmin 4, 8, 9 constructs; Ne2A, neurexin 2.


  
Table: Interactions between Munc-18s and syntaxins in the yeast two-hybrid system

See legend to Table I for a description of the interaction measurements by -galactosidase assays. The inserts contained in the different Munc-18 clones are shown in Fig. 5.



FOOTNOTES

*
This work was supported by a postdoctoral fellowship (to Y. H.) from the Human Frontier Science Program. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) U20283.

§
To whom correspondence should be addressed.

The abbreviations used are: NSF, N-ethylmaleimide sensitive factor; GST, glutathione S-transferase; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; SNAP, soluble NSF attachment protein.

E. Jorgensen, personal communication.


ACKNOWLEDGEMENTS

We thank I. Leznicki, E. Borowicz, and A. Roth for excellent technical assistance. We thank Dr. Stan Hollenberg for plasmid pVP16, yeast strain L40, and invaluable advice; Drs. P. Bartel and S. Fields for plasmid pBTM116; Dr. R. Sternglanz for yeast strain AMR70; and Dr. R. H. Scheller for syntaxin cDNA clones.

Note Added in Proof-While this paper was in press, two reports were published describing the sequence of a murine Munc-18 isoform that probably constitutes the murine homologue for Muc-18-2 (Tellam, J., McIntosh, S., and James, D. E.(1995), J. Biol. Chem. 270, 5857-5863; Katagiri, H., Terasaki, J., Tomiyasu, M., Ishihara, H., Ogihara, T., Inukai, K., Fukushima, Y., Anai, M., Kikuchi, M., Miyazaki, J., Yazaki, Y., and Oka, Y.(1995), J. Biol. Chem. 270, 4963-4966).


REFERENCES
  1. Bennett, M. K., and Scheller, R. H.(1994) Annu. Rev. Biochem. 63, 63-100 [CrossRef][Medline] [Order article via Infotrieve]
  2. Bennett, M. K., Calakos, N., and Scheller, R. H.(1992) Science 257, 255-259 [Abstract/Free Full Text]
  3. Bennett, M. K., Garcia-Arraras, J. E., Elferink, L. A., Peterson, K., Fleming, A. M., Hazuka, C. D., and Scheller, R. H.(1993) Cell 74, 863-873 [CrossRef][Medline] [Order article via Infotrieve]
  4. Calakos, N., Bennett, M. K., Petersen, K. E., and Scheller, R. H. (1994) Science 263, 1146-1149 [Abstract/Free Full Text]
  5. Dascher, C., Ossig, R., Gallwitz, D., and Schmitt, H. D.(1991) Mol. Cell. Biol. 11, 872-885 [Abstract/Free Full Text]
  6. Fields, S., and Song, O.(1989) Nature 340, 245-246 [CrossRef][Medline] [Order article via Infotrieve]
  7. Garcia, E. P., Gatti, E., Butler, M., Burton, J., and De Camilli, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2003-2007 [Abstract/Free Full Text]
  8. Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F., and Südhof, T. C.(1994) Cell 79, 717-727 [CrossRef][Medline] [Order article via Infotrieve]
  9. Harrison, S. D., Broadie, K., van de Goor, J., and Rubin, G. M.(1994) Neuron 13, 555-566 [CrossRef][Medline] [Order article via Infotrieve]
  10. Hata, Y., Slaughter, C. A., and Südhof, T. C. (1993a) Nature 366, 347-351 [CrossRef][Medline] [Order article via Infotrieve]
  11. Hata, Y., Davletov, B., Petrenko, A. G., Jahn, R., and Südhof, T. C. (1993b) Neuron 10, 307-315 [CrossRef][Medline] [Order article via Infotrieve]
  12. Hayashi, T., McMahon, H., Yamasaki, S., Binz, T., Hata, Y., Südhof, T. C., and Niemann, H.(1994) EMBO J. 13, 5051-5061 [Medline] [Order article via Infotrieve]
  13. Hosono, R., Hekimi, S., Kamiya, Y., Sassa, T., Murakami, S., Nishiwaki, K., Miwa, J., Taketo, A., and Kodaira, K.-I.(1992) J. Neurochem. 58, 1517-1525 [CrossRef][Medline] [Order article via Infotrieve]
  14. Jahn, R., and Südhof, T. C.(1994) Annu. Rev. Neurosci. 17, 219-246 [CrossRef][Medline] [Order article via Infotrieve]
  15. Laemmli, U. K.(1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  16. McMahon, H. T., and Südhof, T. C.(1995) J. Biol. Chem. 270, 2213-2217 [Abstract/Free Full Text]
  17. McMahon, H. T., Ushkaryov, Y. A., Edelmann, L., Link, E., Binz, T., Niemann, H., Jahn, R., and Südhof, T. C.(1993) Nature 364, 346-349 [CrossRef][Medline] [Order article via Infotrieve]
  18. Novick, P., Ferro, S., and Scheckman, R.(1981) Cell 25, 461-469 [CrossRef][Medline] [Order article via Infotrieve]
  19. Oyler, G. A., Higgins, G. A., Hart, R. A., Battenberg, E., Billingsley, M., Bloom, F. E., and Wilson, M. C.(1989) J. Cell Biol. 109, 3039-3052 [Abstract/Free Full Text]
  20. Pelham, H. R. B.(1993) Nature 364, 582 [Medline] [Order article via Infotrieve]
  21. Perin, M. S., Fried, V. A., Mignery, G. A., Jahn, R., and Südhof, T. C.(1990) Nature 345, 260-261 [CrossRef][Medline] [Order article via Infotrieve]
  22. Pevsner, J., Hsu, S.-C., and Scheller, R. H. (1994a) Proc. Natl. Acad. Sci. U. S. A. 91, 1445-1449 [Abstract/Free Full Text]
  23. Pevsner, J., Hsu, S.-C., Braun, J. E. A., Calakos, N., Ting, A. E., Bennett, M. K., and Scheller, R. H. (1994b) Neuron 13, 353-361 [CrossRef][Medline] [Order article via Infotrieve]
  24. Rose, M. D., Winston, F., and Hieter, P.(1990) Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  25. Rothman, J.(1994) Nature 372, 55-63 [CrossRef][Medline] [Order article via Infotrieve]
  26. Sambrook, J., Fritsch, E. F., and Maniatis, T.(1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  27. Schiestl, R. H., and Gietz, R. D.(1989) Current Genetics 16, 339-346 [CrossRef][Medline] [Order article via Infotrieve]
  28. Sheng, Z.-H., Rettig, J., Takahashi, M., and Catterall, W. A.(1994) Neuron 13, 1303-1313 [CrossRef][Medline] [Order article via Infotrieve]
  29. Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J. E.(1993) Nature 362, 318-324 [CrossRef][Medline] [Order article via Infotrieve]
  30. Südhof, T. C.(1990) J. Biol. Chem. 265, 7849-7852 [Abstract/Free Full Text]
  31. Südhof, T. C., Baumert, M., Perin, M. M. S., and Jahn, R.(1989) Neuron 2, 1475-1481 [CrossRef][Medline] [Order article via Infotrieve]
  32. Südhof, T. C., De Camilli, P., Niemann, H., and Jahn, R.(1993) Cell 75, 1-4 [CrossRef][Medline] [Order article via Infotrieve]
  33. Ushkaryov, Y. A., and Südhof, T. C.(1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6410-6414 [Abstract/Free Full Text]
  34. Ushkaryov, Y. A., Petrenko, A. G., Geppert, M., and Südhof, T. C. (1992) Science 257, 50-56 [Abstract/Free Full Text]
  35. Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A.(1993) Cell 74, 205-214 [CrossRef][Medline] [Order article via Infotrieve]
  36. Yoshida, A., Oho, C., Omori, A., Kuwahara, R., Ito, T., and Takahashi, M.(1992) J. Biol. Chem. 267, 24925-24928 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
G. Procino, C. Barbieri, G. Tamma, L. De Benedictis, J. E. Pessin, M. Svelto, and G. Valenti
AQP2 exocytosis in the renal collecting duct - involvement of SNARE isoforms and the regulatory role of Munc18b
J. Cell Sci., June 15, 2008; 121(12): 2097 - 2106.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
L. Arunachalam, L. Han, N. G. Tassew, Y. He, L. Wang, L. Xie, Y. Fujita, E. Kwan, B. Davletov, P. P. Monnier, et al.
Munc18-1 Is Critical for Plasma Membrane Localization of Syntaxin1 but Not of SNAP-25 in PC12 Cells
Mol. Biol. Cell, February 1, 2008; 19(2): 722 - 734.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Umahara, S. Okada, E. Yamada, T. Saito, K. Ohshima, K. Hashimoto, M. Yamada, H. Shimizu, J. E. Pessin, and M. Mori
Tyrosine Phosphorylation of Munc18c Regulates Platelet-Derived Growth Factor-Stimulated Glucose Transporter 4 Translocation in 3T3L1 Adipocytes
Endocrinology, January 1, 2008; 149(1): 40 - 49.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Gulyas-Kovacs, H. de Wit, I. Milosevic, O. Kochubey, R. Toonen, J. Klingauf, M. Verhage, and J. B. Sorensen
Munc18-1: Sequential Interactions with the Fusion Machinery Stimulate Vesicle Docking and Priming
J. Neurosci., August 8, 2007; 27(32): 8676 - 8686.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. B.A. t. Beest, S. J. Chapin, D. Avrahami, and K. E. Mostov
The Role of Syntaxins in the Specificity of Vesicle Targeting in Polarized Epithelial Cells
Mol. Biol. Cell, December 1, 2005; 16(12): 5784 - 5792.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fukuda, A. Imai, T. Nashida, and H. Shimomura
Slp4-a/Granuphilin-a Interacts with Syntaxin-2/3 in a Munc18-2-dependent Manner
J. Biol. Chem., November 25, 2005; 280(47): 39175 - 39184.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Oh, B. A. Spurlin, J. E. Pessin, and D. C. Thurmond
Munc18c Heterozygous Knockout Mice Display Increased Susceptibility for Severe Glucose Intolerance
Diabetes, March 1, 2005; 54(3): 638 - 647.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Fu, A. P. Naren, X. Gao, G. U. Ahmmed, and A. B. Malik
Protease-activated Receptor-1 Activation of Endothelial Cells Induces Protein Kinase C{alpha}-dependent Phosphorylation of Syntaxin 4 and Munc18c: ROLE IN SIGNALING P-SELECTIN EXPRESSION
J. Biol. Chem., February 4, 2005; 280(5): 3178 - 3184.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Q. Li, A. Lau, T. J. Morris, L. Guo, C. B. Fordyce, and E. F. Stanley
A Syntaxin 1, G{alpha}o, and N-Type Calcium Channel Complex at a Presynaptic Nerve Terminal: Analysis by Quantitative Immunocolocalization
J. Neurosci., April 21, 2004; 24(16): 4070 - 4081.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Houng, J. Polgar, and G. L. Reed
Munc18-Syntaxin Complexes and Exocytosis in Human Platelets
J. Biol. Chem., May 23, 2003; 278(22): 19627 - 19633.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Martin-Verdeaux, I. Pombo, B. Iannascoli, M. Roa, N. Varin-Blank, J. Rivera, and U. Blank
Evidence of a role for Munc18-2 and microtubules in mast cell granule exocytosis
J. Cell Sci., January 15, 2003; 116(2): 325 - 334.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kauppi, G. Wohlfahrt, and V. M. Olkkonen
Analysis of the Munc18b-Syntaxin Binding Interface. USE OF A MUTANT Munc18b TO DISSECT THE FUNCTIONS OF SYNTAXINS 2 AND 3
J. Biol. Chem., November 8, 2002; 277(46): 43973 - 43979.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Sauvonnet, B. Pradet-Balade, J. A. Garcia-Sanz, and G. R. Cornelis
Regulation of mRNA Expression in Macrophages after Yersinia enterocolitica Infection. ROLE OF DIFFERENT Yop EFFECTORS
J. Biol. Chem., July 5, 2002; 277(28): 25133 - 25142.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Bustos, E. R. Kolen, L. Braiterman, A. J. Baines, F. S. Gorelick, and A. L. Hubbard
Synapsin I is expressed in epithelial cells: localization to a unique trans-Golgi compartment
J. Cell Sci., March 12, 2002; 114(20): 3695 - 3704.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Rowe, F. Calegari, E. Taverna, R. Longhi, and P. Rosa
Syntaxin 1A is delivered to the apical and basolateral domains of epithelial cells: the role of munc-18 proteins
J. Cell Sci., March 11, 2002; 114(18): 3323 - 3332.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. H. Gerber and T. C. Sudhof
Molecular Determinants of Regulated Exocytosis
Diabetes, February 1, 2002; 51(90001): S3 - 11.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Jantti, M. K. Aalto, M. Oyen, L. Sundqvist, S. Keranen, and H. Ronne
Characterization of temperature-sensitive mutations in the yeast syntaxin 1 homologues Sso1p and Sso2p, and evidence of a distinct function for Sso1p in sporulation
J. Cell Sci., January 15, 2002; 115(2): 409 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kawabe, H. Nakanishi, M. Asada, A. Fukuhara, K. Morimoto, M. Takeuchi, and Y. Takai
Pilt, a Novel Peripheral Membrane Protein at Tight Junctions in Epithelial Cells
J. Biol. Chem., December 14, 2001; 276(51): 48350 - 48355.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Riento, M. Kauppi, S. Keranen, and V. M. Olkkonen
Munc18-2, a Functional Partner of Syntaxin 3, Controls Apical Membrane Trafficking in Epithelial Cells
J. Biol. Chem., April 28, 2000; 275(18): 13476 - 13483.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M. Verhage, A. S. Maia, J. J. Plomp, A. B. Brussaard, J. H. Heeroma, H. Vermeer, R. F. Toonen, R. E. Hammer, T. K. van den Berg, M. Missler, et al.
Synaptic Assembly of the Brain in the Absence of Neurotransmitter Secretion
Science, February 4, 2000