![]()
|
|
||||||||
From the
We have identified an in vivo footprint over the PuF
site on the translocated c-myc allele in Burkitt's
lymphoma cells. The PuF site on the silent normal c-myc allele
was unoccupied. We demonstrated by electrophoretic mobility shift
assay, electrophoretic mobility shift assay with antibody, UV
cross-linking followed by SDS-gel electrophoresis, and Western analysis
that Nm23H2 in B cell nuclear extracts bound to the c-myc PuF
site. Transfection experiments with c-myc promoter constructs
in both DHL-9 and Raji cells revealed that the PuF site functioned as a
positive regulatory element in B cells with a drop in activity with
mutation of this site. Access to this site is blocked in the normal
silent c-myc allele; these data suggest that the Nm23H2
protein is involved in deregulation of the translocated c-myc allele in Burkitt's lymphoma cells.
In Burkitt's lymphoma cells, one c-myc allele is
juxtaposed to either the immunoglobulin heavy chain locus or to one of
the light chain loci. The translocated c-myc gene is expressed
at high levels, while the normal c-myc allele is
silent
(1, 2, 3, 4) . In all of the cases
with an intact c-myc transcription unit, there are structural
alterations at the first exon/intron
boundary
(5, 6, 7, 8) , and c-myc transcription initiates preferentially at promoter P1 in contrast
to normal cells in which the P2 promoter is the major transcriptional
start site
(9, 10) . In addition, the block to RNA
elongation is not present in the translocated c-myc allele
(11, 12, 13) .
The deregulated
c-myc gene is believed to play a role in the pathogenesis of
Burkitt's lymphoma. Transgenic mice that carried the c-myc gene linked to the immunoglobulin intron enhancer developed B cell
malignancies
(14, 15) . Furthermore, when lymphoblastoid
cells immortalized by Epstein-Barr virus were transfected with a
constitutively expressed c-myc gene, the cells became
tumorigenic in nude mice
(16) .
Although the mechanism of the
deregulation of the translocated c-myc gene is unknown,
regulatory elements of the immunoglobulin locus may play a
role
(17, 18) . We are studying the interplay between the
c-myc and immunoglobulin regulatory elements, and we have
previously described two NF-
The nm23 gene products are involved in the
control of tumor metastasis by mechanisms that are not known. In some
cases, metastatic potential of tumor cells has been correlated with
reduced nm23 expression (20-23). In other tumor types,
overexpression of nm23 correlates with metastatic
spread
(24, 25, 26, 27, 28) . The
nm23 gene products are also involved in the control of cell
proliferation, differentiation, and development (29-31). These
proteins contain nucleoside diphosphate kinase enzyme
activity
(32, 33, 34, 35) . Nm23 proteins
interact with GTP-binding proteins (35, 36), and they also function as
transcription factors
(37) .
The transcription factor, PuF,
was identified as the Nm23H2 protein (37). This transcription factor
binds to a site at -142 to -115 upstream of the c-myc P1 promoter (the PuF site). It has been shown to regulate
c-myc transcription in vitro and is required for
in vitro transcription from both promoters P1 and
P2
(38, 39) . The nucleoside diphosphate kinase enzyme
activity is not required for the DNA binding and in vitro transcriptional activity of Nm23H2
(40) .
We have now
demonstrated that the PuF site on the translocated c-myc allele in Burkitt's lymphoma is bound by protein in vivo while the PuF site on the silent normal c-myc allele is
not. Transient transfection assays were performed to demonstrate that
the PuF site functions as a positive regulatory element in B cells.
Quantitation of footprints was
performed as previously described
(43) with ImageQuant software
version 4.15 (Molecular Dynamics). Percent protection values of below
20% were considered too low and were not interpreted as footprints.
On-line formulae not verified for accuracy OLIGONUCLEOTIDE PuF
On-line formulae not verified for accuracy OLIGONUCLEOTIDE MP1
On-line formulae not verified for accuracy OLIGONUCLEOTIDE MP2
On-line formulae not verified for accuracy OLIGONUCLEOTIDE MP3
On-line formulae not verified for accuracy OLIGONUCLEOTIDE Myb
The oligonucleotides were synthesized with 5` overhangs and end
labeled with [
In vivo footprinting has been used to identify a
region near DNase hypersensitive site III-1, which is protected on the
translocated c-myc allele in Burkitt's lymphoma cells.
The normal c-myc allele, which is transcriptionally silent,
does not show any protection in this area. We have shown by several
different techniques that Nm23H2 in B cell nuclear extracts binds to
this sequence in vitro. The PuF transcription factor was
originally identified and purified from HeLa cells
(38) . PuF was
subsequently shown to be identical to Nm23H2
(37) .
An
antibody against Nm23H1/Nm23H2 disrupted the complexes formed in EMSA
with both the F50 probe and the PuF oligonucleotide. No supershifted
complex was visible; it is possible that binding of the antibody blocks
the DNA binding domain of Nm23H2. Both preimmune serum and an antibody
against Ets-1 had no effect on the EMSA complexes. A protein of
molecular mass 17 kDa was shown to bind to both the F50 probe and the
PuF oligonucleotide; this is the size of Nm23H2. In addition, Western
analysis revealed that this protein was recognized by the Nm23H1/Nm23H2
antibody. Methylation interference revealed that the guanine residues
in the PuF sequence were required for protein binding, and the
footprint was very similar to the one we obtained in vivo. It
is not clear why only guanine residues in the 3`-half of the PuF site
interfere with binding in vitro with the F50 probe.
Differences in secondary structure between the longer fragment and the
shorter oligonucleotide may be involved. EMSA with the PuF
oligonucleotide yielded three complexes, and only complex C2 contained
Nm23H2 protein. A single complex with Nm23H2 was observed with the
50-bp fragment. Differences in protein binding between longer DNA
fragments and shorter oligonucleotides has been observed previously for
the PuF factor
(38) .
We have demonstrated that the PuF site
has functional activity in B cells. Mutation of either half of the site
led to a drop in c-myc promoter activity of approximately
55-65%. Mutations of both halves simultaneously decreased
promoter activity by 75%. Deletion of this region also caused a
dramatic decrease in activity (approximately 85%).
We have
previously observed an in vivo footprint over the PuF site in
proliferating HL60 cells
(43) . This footprint was not present in
differentiated HL60 cells that no longer expressed c-myc. Our
results in B cells demonstrate that this site functions as a positive
regulatory region. These results are consistent with the findings in
HL60 cells, although there is currently no evidence to suggest that the
PuF site plays a role in retention or read-through of RNA polymerase II
at the transcription start site
(52, 53) .
Because the
PuF site functions as a positive regulatory element in B cells, we
speculate that it is involved in the expression of the translocated
c-myc allele in Burkitt's lymphoma cells. This site is
unoccupied in the normal c-myc allele. Previously identified
differences in DNase I hypersensitive sites between the two c-myc alleles in Burkitt's lymphoma have been described
(54-56). Of particular interest is the absence of DNase
hypersensitive site III-1 in the normal c-myc allele. These
results suggest that the chromatin conformation is different in each
allele, and it is possible that the conformation of the normal allele
prevents protein binding to the PuF site located close to DNase
hypersensitive site III-1. It is also possible that differences in
methylation of the two c-myc alleles account for the
differential protein binding to the PuF site, which we have observed.
It is likely that the deregulation of the translocated c-myc allele is a consequence of interactions between the c-myc promoter region and regulatory elements of the immunoglobulin
locus. We have previously identified two NF-
B sites in the c-myc gene
that are occupied only on the translocated c-myc allele
(19) . In this report, we characterize the role of
the Nm23H2 transcription factor in the regulation of the translocated
c-myc gene.
Cell Lines
DHL-9 is a B cell line that
does not contain a translocation of the c-myc gene; Raji is a
Burkitt's lymphoma cell line. They were grown in RPMI with 10%
fetal bovine serum.
Plasmid Constructs
pMPCAT
(41) ,
which contains c-myc residues -2328 to +936, was
obtained from D. Levens (National Institutes of Health). Mutations were
created in the nm23H2 site by PCR
(
)
mutagenesis (42). The primers used were 5`-site (MP1),
CCTTCCACACGCTCCCCACC; 3`-site (MP2), CCTTCCCCACCCTCCGCACTCTC; double
mutant (MP3), CCTTCCACACGCTCCGCACTCTC (the mutated bases are
underlined). Mutations were confirmed by sequencing (Sequenase kit, U.
S. Biochemical Corp.).
In Vivo Dimethyl Sulfate (DMS) Treatment and DNA
Isolation
DNA isolation after DMS treatment was performed
as previously described
(19, 43, 44) . The DNA
was digested with SacI, and agarose electrophoresis was
performed to separate the translocated c-myc allele from the
normal one. One lane of the gel was transferred to a filter; probes
consisting of c-myc exons 2 and 3 and the immunoglobulin µ
heavy-chain constant region were used sequentially to locate the two
c-myc alleles. The DNA in these two regions was electroeluted
from the gel. Cleavage with piperidine was performed according to the
Maxam-Gilbert procedure
(45) .
Ligation-mediated PCR
Chemically modified
and cleaved DNA was then subjected to amplification by
ligation-mediated PCR essentially as described by Mueller and
Wold
(46) , Pfeifer et al.(47) , and Garrity and
Wold
(48) . Sequenase was used for first strand synthesis, and
Taq DNA polymerase was used for PCR. Conditions used for
amplification were 95 °C for 2 min, 61 °C for 2 min, and 76
°C for 3 min. After 20-22 cycles of PCR, samples were
hybridized with end-labeled primers (primer 3 of each primer set) and
amplified by one more cycle of PCR. The reaction mixes were resolved in
a 6% polyacrylamide denaturing gel. Footprinting on each strand was
repeated at least four times with genomic DNA samples prepared from at
least three separate batches of DMS-treated cells. The primers used for
PCR were synthesized in an Applied Biosystems 380B DNA synthesizer and
purified on Applied Biosystems oligonucleotide purification cartridges.
The common linkers used were GCGGTGACCCGGGAGATCTGAATTC and GAATTCAGATC.
The primers for the coding strand were GACCCTCGCATTATAAAGGGCCG,
AAAGGGCCGGTGGGCGGAGATTAG, and AAAGGGCCGGTGGGCGGAGATTAGCG. The noncoding
strand primers were GGAGAGGGTTTGAGAGGGAGC, GGCGCGCGTAGTTAATTCATGCGGC,
andGGCGCGCGTAGTTAATTCATGCGGCTCTC.
Electrophoretic Mobility Shift Assay
(EMSA)
The double-stranded oligonucleotides used for EMSA
are shown below. Mutated bases are underlined.
-P]dCTP and Klenow. The F50
probe of the c-myc 5`-flanking region extended from -148
to -98 relative to promoter P1. Binding conditions were as
follows: 12 mM HEPES, pH 7.9, 4 mM Tris, pH 7.5, 100
mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 12%
glycerol, 2 µg of poly(dI-dC), 1 µg of BSA, 0.5 ng (10
cpm) of end-labeled DNA oligonucleotide probe, and 15-20
µg of protein from crude nuclear extract. The binding reaction was
conducted at room temperature for 15 min, and the samples were loaded
onto a 0.5 Tris borate-EDTA, 5% polyacrylamide gel.
Electrophoresis was performed at 30 mA at 4 °C. For the competition
studies the indicated molar excess of unlabeled competitor
oligonucleotide was added to the binding reaction. As a nonspecific
competitor, an oligonucleotide containing the Myb binding site was
used. For the supershifts, the binding reaction was performed as above
with incubation for 15 min at room temperature. Antibody was added, and
the incubation was continued for 1 h at 4 °C. The Nm23H1/Nm23H2
antibody recognizes a region in the homologous C-terminals of human
Nm23H1 and Nm23H2. The polyclonal antibodies against Nm23H1/Nm23H2 and
Ets-1 were obtained from Santa Cruz Biotechnology.
UV Cross-linking and SDS-Polyacrylamide Gel
Electrophoresis
EMSA was performed as described above. The
wet gel was exposed to film to locate the EMSA complexes. UV
cross-linking was performed essentially as described
(49) with a
short wavelength UV light box at 4 °C for 30 min. Regions of the
gel containing the complexes were cut out, and the individual complexes
were eluted at room temperature overnight in 50 mM Tris-HCl,
pH 7.9, 0.1% SDS, 0.1 mM EDTA, 5 mM dithiothreitol,
150 mM NaCl, 0.1 mg/ml BSA. The eluted protein was
precipitated with 4 volumes of acetone, washed with ethanol, and air
dried. After resuspension in Laemmli loading buffer, SDS-polyacrylamide
gel electrophoresis was performed. The Amersham ECL kit was used for
Western analysis.
In Vitro Methylation
Interference
3`-End-labeled DNA fragment (labeled with
Klenow polymerase at HindIII site on the antisense strand) or
5`-end-labeled oligonucleotide (labeled with T4 kinase on the antisense
strand) was methylated with 0.5% DMS for 2 min at room temperature.
This probe was used in EMSA as described above. The wet gel was exposed
to locate the complexes, and both the bound and free probe were excised
and transferred to DEAE membranes. The DNA was eluted and cleaved with
piperidine, and equal counts of bound and free samples were resolved in
a 15% acrylamide sequencing gel.
Transfections and Chloramphenicol Acetyltransferase
Assays
Transfections were performed on cells in log phase.
Cells were washed and resuspended in unsupplemented RPMI medium to a
final concentration of 2 10
cells/ml and incubated
for 10 min at room temperature after addition of 15 µg of DNA plus
10 µg of DEAE-dextran
(50) . Electroporations were carried
out with the Bio-Rad Gene Pulser at 350 mV, 960 microfarads. The cells
were then incubated again for 10 min at room temperature. Transfected
cells were cultured in 23 ml of supplemented RPMI for 48 h.
Chloramphenicol acetyltransferase assays were performed in the standard
manner
(51) with a 2-h enzyme assay. Percent acetylation was
quantified with a Molecular Devices phosphorimager. Variation in
transfection efficiency was controlled for by cotransfection with Rous
sarcoma virus-
-galactosidase. Each assay was performed at least
three times in duplicate with at least two different plasmid preps. The
average value with the standard deviation is plotted.
An in Vivo Footprint Is Located Near DNase
Hypersensitive Site III-1
The translocated and normal
c-myc alleles from Raji cells were separated by
electrophoresis, and ligation-mediated PCR was performed on each one.
With primer sets that cover the region surrounding DNase hypersensitive
site III-1, we found a footprint on the translocated c-myc allele that was not present on the normal silent c-myc allele (Fig. 1). There were 13 guanine residues protected on
the noncoding strand. There are no guanine residues in this region on
the coding strand. The protected sequence contains consensus binding
sites for several transcription factors, including Nm23H2, Sp-1, and
AP-2.
Figure 1:
In vivo footprint analysis by
ligation-mediated PCR of the c-myc DNase hypersensitive site
III-1 in Raji cells. The region illustrated is labeled by nucleotide
number relative to the c-myc P1 promoter. V denotes
in vitro methylated DNA (lane2 is from the
normal c-myc allele, and lane4 is from the
translocated allele), T denotes in vivo methylated
DNA from the translocated c-myc allele, and N denotes
in vivo methylated DNA from the normal c-myc allele.
The protected guanines are marked by closedcircles.
Protection of guanine is 56% at positions -117, -118, and
-119; 82% at -121, -122, -123, and -124;
71% at -126, -127, and -128; and 65% at -130,
-131, and -132.
Nm23H2 Binds to the Protected Sequence in
Vitro
To determine which proteins in B cell nuclear
extracts bound to the protected sequence, EMSA was performed. A 50-bp
fragment (F50 probe) encompassing this region of the c-myc promoter and a 24-bp double-stranded oligonucleotide (PuF probe)
were both labeled and used as probes in EMSA. Nuclear extracts were
prepared from both DHL-9 and Raji B cell lines to determine whether
there were any differences in the proteins present in Burkitt's
cells versus a B cell line lacking a translocation of the
c-myc gene. One major complex was formed with both DHL-9 and
Raji nuclear extract and the F50 probe (C1 in
Fig. 2A). Three complexes were formed with both B cell
nuclear extracts and the oligonucleotide (C2, C3, and C4 in
Fig. 2B). An excess of unlabeled cold self-competitor
diminished the intensity of each of the complexes, while an irrelevant
oligonucleotide, which contained the Myb binding site, had little
effect on C1 and C2, but it did compete for formation of complexes C3
and C4 (Fig. 2, A and B). We believe that the
C3 and C4 complexes are nonspecific interactions. The PuF probe
competed for the formation of complex C1 seen with the F50 probe
(Fig. 2A). An excess of unlabeled F50 probe competed for
formation of complex C2 formed with the PuF probe
(Fig. 2B). Thus, the same protein or proteins were most
likely present in the C1 complex formed with the F50 fragment and the
C2 complex formed with the PuF probe.
Figure 2:
EMSA of the PuF binding site DNA fragment
and oligonucleotide with B cell nuclear extracts. A, EMSA with
the 50-bp DNA fragment (F50) as probe. Cold PuF DNA fragment (F50), PuF
site oligonucleotide (PUF), and a c-Myb consensus binding site
oligonucleotide (Myb) at the indicated molar excess were used as
competitors. Lanes1-5, EMSA with DHL-9 nuclear
extract; lanes6-10, EMSA with Raji nuclear
extract. The predominant EMSA complex is labeled C1.
B, EMSA with the 24-bp PuF binding site oligonucleotide (PUF)
as probe. The molar excess of the cold PuF oligonucleotide, F50 DNA
fragment, or Myb competitor in each lane is indicated. EMSA
complexes are labeled C2-C4,
respectively.
The F50 and PuF probes contain
consensus binding sites for several transcription factors, so further
studies were performed to identify the relevant proteins. An antibody
that is reactive with both Nm23H1 and Nm23H2 was used in the EMSA to
determine whether Nm23H2 protein was present in complexes C1-C4.
As shown in Fig. 3, A and B, the addition of
preimmune serum had little effect on either complex, while the antibody
against Nm23H1/Nm23H2 disrupted both complexes C1 and C2. No
supershifted complex was visible, so it is possible that the antibody
interfered with the ability of Nm23H2 to bind to DNA. There was no
consistent effect on complexes C3 and C4, and there was no effect with
an irrelevant antibody against Ets-1 (Fig. 3, A and
B).
Figure 3:
Effect of antibodies on EMSA complexes
formed with B cell nuclear extracts and the PuF binding site DNA
fragment or oligonucleotide. A, effect of antibodies on the
EMSA complexes formed with DHL-9 nuclear extract and PuF DNA fragment
(F50) (lanes1-4) or oligonucleotide (PUF)
(lanes5-8). Lanes1-5,
without preimmune serum (-PI); lanes2 and 6, with preimmune serum (+PI);
lanes3 and 7, with anti-PuF (Nm23H1/Nm23H2)
antibody (+PUF); lanes4 and
8, with anti-Ets-1 antibody (+ETS1). The EMSA
complexes C1-C4 are indicated by the arrow. B,
effect of antibodies on the EMSA complexes formed with Raji nuclear
extract and PuF DNA fragment or oligonucleotide. The lanes and
complexes are labeled as described above for panelA.
To confirm that Nm23H2 bound to the F50 and PuF probes,
UV cross-linking and Western analysis were performed. UV cross-linking
followed by denaturing polyacrylamide gel electrophoresis was performed
first. A protein of molecular mass 38 kDa was observed with both the
complex C1 with the 50-bp F50 fragment and the complex C2 with the PuF
oligonucleotide of the protected region (38 kDa in
Fig. 4B). The 38-kDa protein reacted with the
Nm23H1/Nm23H2 antibody on Western (Fig. 4A). In addition, protein
which was present in the EMSA complex and was not UV cross-linked to
DNA was also observed (17 kDa band in Fig. 4A). These two
proteins correspond to the size of Nm23H2, either cross-linked to DNA
(38 kDa) or free (17 kDa). The Western analysis performed without UV
cross-linking of the protein to DNA demonstrated that the molecular
mass of the protein in complexes C1 and C2 was 17 kDa (Fig. 4C).
In both Western analyses, proteins of higher molecular mass reacted
with the Nm23H1/Nm23H2 antibody (The 68-kDa protein is BSA, which is
added to the elution buffer; there is some cross-reactivity of the
antibody with BSA). The significance of the other proteins is not
clear, and proteins of this size are not observed cross-linked to DNA
(Fig. 4B). We conclude that Nm23H2 is present in
complexes C1 and C2 and that there is no evidence for Nm23H2 in either
the C3 or C4 complexes (Fig. 4, A-C).
Figure 4:
Identification of the proteins that bind
to the c-myc PuF site. A, Western blot analysis of
the UV cross-linked EMSA complexes formed with B cell nuclear extracts
and the c-myc PuF site using anti-PuF (Nm23H1/Nm23H2)
polyclonal antibody. Lanes that contain proteins from the
corresponding EMSA complexes (Fig. 2) are labeled as
C1-C4, respectively. Lanes1-4,
proteins from EMSA complexes formed with DHL-9 nuclear extract and PuF
DNA fragment (C1) or oligonucleotide (C2-C4); lanes5-8, proteins from EMSA complexes formed with Raji
nuclear extract and PuF DNA (C1) or oligonucleotide (C2-C4). The
migration of molecular mass markers is shown on the left. The
protein bands with a molecular mass of 38 and 17 kDa are identified as
the UV cross-linked complex formed with Nm23H2 protein and DNA probe
and the unbound Nm23H2 protein, respectively. The 68-kDa band is BSA,
which is added to the elution buffer. There is some cross-reactivity of
the antibody with BSA. B, denaturing SDS-polyacrylamide gel
analysis of the UV cross-linked EMSA complexes formed with B cell
nuclear extracts and the c-myc PuF site. The image was
generated from the autoradiography of P-labeled bands on
the same gel shown in panelA. The lanes are
labeled as described above for panelA. The UV
cross-linked EMSA complexes formed with Nm23H2 and the c-myc PuF site are indicated by the arrow; these complexes
comigrate with the 38-kDa bands on the Western blot in panelA. C, Western blot analysis of the
noncross-linked EMSA complexes formed with B cell nuclear extracts and
the c-myc PuF site, using anti-PuF (Nm23H1/Nm23H2) polyclonal
antibody. The lanes are labeled as described above for
panelA. The unbound Nm23H2 protein shows a molecular
mass of 17 kDa, as indicated by the
arrow.
Protection of the PuF Binding Site Is Seen in
Vitro
In vitro methylation interference was
performed to locate the guanine residues required for protein binding
in vitro. With the F50 probe, methylation of seven guanine
residues interfered with protein binding (Fig. 5A). In
complex C2 formed with the PuF probe, methylation of essentially all of
the guanine residues interfered with protein binding
(Fig. 5B). This is very similar to the pattern observed
in vivo (Fig. 1).
Figure 5:
Methylation interference analysis of
protein-DNA complexes formed with B cell nuclear extracts and the
c-myc PuF DNA fragment and oligonucleotide (antisense
strands). A, methylation interference analysis of the
protein-DNA complex formed with the PuF DNA fragment (F50) and B cell
nuclear extracts. C1 corresponds to the EMSA complex C1;
F, free probe (lanes1 and 3);
B, protein-bound probe (lane2). The
nucleotide sequence and position in the c-myc promoter region
where methylation interference occurred are indicated. Bases that show
strong protection are indicated by an asterisk, and bases that
show weak protection are indicated by +. B, methylation
interference analysis of protein-DNA complexes formed with the PuF
oligonucleotide and B cell nuclear extracts. C2 corresponds to
the EMSA complexes C2. The lanes are labeled as described
above for panelA. G, G-specific cleavage
products of the probe.
The Nm23H2 Site Is Functional in B
Cells
The c-myc promoter is active in both DHL-9
and Raji cells. We had shown that Nm23H2 bound to the c-myc PuF site, and we wished to determine whether the Nm23H2 binding
site had any functional activity in B cells. Mutations were introduced
into either the 5`- or 3`-half of the PuF site (see
Fig. 6A). Mutation of either the 5`- or 3`-half of the
site decreased dramatically the binding of Nm23H2 protein in vitro (Fig. 7, A and B). No complex C2 was
formed with either mutated oligonucleotide, and the mutated
oligonucleotides were much weaker competitors against both the C1 and
C2 complexes (Fig. 7, A and B).
Figure 6:
Effect of mutated PuF site on the
c-myc promoter activity. A, diagram of c-myc promoter-chloramphenicol acetyltransferase constructs used for
transfection experiments. The location of the PuF site in the upstream
region of the c-myc promoter is indicated. The residues
involved in Nm23H2 protein binding are underlined. The mutants
(MPUF1 and MPUF2) on either half of the PuF palindromic binding
sequence are shown, and the mutated nucleotides are indicated by
asterisks. Two deletion constructs of the c-myc promoter (DMC1 and DMC2) are also illustrated. B,
transient transfection analysis of the c-myc promoter-chloramphenicol acetyltransferase mutant constructs.
WT, wild-type c-myc promoter construct; MP1,
mutant construct of the first half PuF binding sequence (MPUF1);
MP2, mutant construct of the second half PuF binding sequence
(MPUF2); MP3, the double mutant construct including both MP1
and MP2 mutated residues. The standard deviation for the MP3 construct
in DHL-9 cells was 0.2; this value was too small to be plotted.
C, transient transfection analysis of the deletion mutants of
the c-myc promoter-chloramphenicol acetyltransferase
constructs. DMC1, deletion construct at -148 of the
c-myc promoter, which contains the PuF binding site;
DMC2, deletion construct at -98 of the c-myc promoter, which lacks the PuF binding
site.
Figure 7:
Effect
of mutated c-myc PuF sites on protein binding by EMSA.
A, EMSA with Raji nuclear extract and the PuF DNA fragment and
oligonucleotide as probes and the mutated oligonucleotides as
competitors (100-fold molar excess). The probes and competitors used
are indicated on the top of each lane. 0,
without competitor; F50, 50-bp PuF site DNA fragment;
PUF, PuF oligonucleotide; MP1, first mutant
oligonucleotide of the PuF site; MP2, second mutant
oligonucleotide of the PuF site; MP3, double mutant
oligonucleotide of the PuF site. The EMSA complexes formed with the PuF
probes and nuclear extract are labeled C1-C4 and are
indicated by the arrows. B, EMSA with the mutated PuF
oligonucleotides as probes and the wild type PuF DNA fragment or
oligonucleotide as competitors. The lanes are labeled as
described above for panelA.
Mutation of
the 5`-half of the site decreased activity of the c-myc promoter by approximately 55% in both DHL-9 and Raji cells
(Fig. 6B). Mutation of the 3`-half of the site decreased
the c-myc promoter activity by approximately 65% in DHL-9 and
Raji cells (Fig. 6B). Mutation of both the 5`- and
3`-halves of the sites simultaneously led to a drop in activity of
approximately 75% (Fig. 6B). Deletion of a 50-bp region
of the c-myc promoter, which encompasses the PuF site
(-148 to -98, DMC1 mutant in Fig. 6A)
resulted in a decrease in activity of approximately 85% in both B cell
lines (Fig. 6C) relative to the -148 construct
(DMC2 mutant in Fig. 6A). We conclude that the PuF site
is active in B cells.
B sites in the
c-myc promoter that are occupied only on the translocated
allele and that function as positive regulatory elements
(19) .
Regulatory elements in both the human immunoglobulin
locus and
the murine immunoglobulin heavy chain locus have been described that
lead to increased c-myc expression and the shift in promoter
usage from P2 to P1
(17, 18) . We are currently
investigating the interaction between these regulatory elements and the
transcription factor binding sites that we have identified on the
translocated c-myc allele in Burkitt's lymphoma cells.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
G Brady, G J MacArthur, and P J Farrell Epstein Barr virus and Burkitt lymphoma J. Clin. Pathol., December 1, 2007; 60(12): 1397 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Gadal, A Starzec, C Bozic, C Pillot-Brochet, S Malinge, V Ozanne, J Vicenzi, L Buffat, G Perret, F Iris, et al. Integrative analysis of gene expression patterns predicts specific modulations of defined cell functions by estrogen and tamoxifen in MCF7 breast cancer cells J. Mol. Endocrinol., February 1, 2005; 34(1): 61 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Johansson, A. MacKenzie-Hose, I. Andersson, and C. Knorpp Structure and Mutational Analysis of a Plant Mitochondrial Nucleoside Diphosphate Kinase. Identification of Residues Involved in Serine Phosphorylation and Oligomerization Plant Physiology, October 1, 2004; 136(2): 3034 - 3042. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Engel, S. Mazurek, E. Eigenbrodt, and C. Welter Phosphoglycerate Mutase-derived Polypeptide Inhibits Glycolytic Flux and Induces Cell Growth Arrest in Tumor Cell Lines J. Biol. Chem., August 20, 2004; 279(34): 35803 - 35812. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Grand, T. J. Powell, R. B. Nagle, D. J. Bearss, D. Tye, M. Gleason-Guzman, and L. H. Hurley Mutations in the G-quadruplex silencer element and their relationship to c-MYC overexpression, NM23 repression, and therapeutic rescue PNAS, April 20, 2004; 101(16): 6140 - 6145. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Postel and B. M. Abramczyk Escherichia coli nucleoside diphosphate kinase is a uracil-processing DNA repair nuclease PNAS, November 11, 2003; 100(23): 13247 - 13252. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Serafeim, M. J. Holder, G. Grafton, A. Chamba, M. T. Drayson, Q. T. Luong, C. M. Bunce, C. D. Gregory, N. M. Barnes, and J. Gordon Selective serotonin reuptake inhibitors directly signal for apoptosis in biopsy-like Burkitt lymphoma cells Blood, April 15, 2003; 101(8): 3212 - 3219. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Siddiqui-Jain, C. L. Grand, D. J. Bearss, and L. H. Hurley Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription PNAS, September 3, 2002; 99(18): 11593 - 11598. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Hu, M. Arcinas, and L. M. Boxer A Myc-associated Zinc Finger Protein-related Factor Binding Site Is Required for the Deregulation of c-myc Expression by the Immunoglobulin Heavy Chain Gene Enhancers in Burkitt's Lymphoma J. Biol. Chem., March 15, 2002; 277(12): 9819 - 9824. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arcinas, C. A. Heckman, J. W. Mehew, and L. M. Boxer Molecular Mechanisms of Transcriptional Control of bcl-2 and c-myc in Follicular and Transformed Lymphoma Cancer Res., July 1, 2001; 61(13): 5202 - 5206. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gounaris, S. Thomas, P. Najarro, and M. E. Selkirk Secreted Variant of Nucleoside Diphosphate Kinase from the Intracellular Parasitic Nematode Trichinella spiralis Infect. Immun., June 1, 2001; 69(6): 3658 - 3662. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. E. Galvis, S. Marttila, G. Håkansson, J. Forsberg, and C. Knorpp Heat Stress Response in Pea Involves Interaction of Mitochondrial Nucleoside Diphosphate Kinase with a Novel 86-Kilodalton Protein Plant Physiology, May 1, 2001; 126(1): 69 - 77. [Abstract] [Full Text] |
||||
![]() |
C. Dachet, O. Poirier, F. Cambien, J. Chapman, and M. Rouis New Functional Promoter Polymorphism, CETP/-629, in Cholesteryl Ester Transfer Protein (CETP) Gene Related to CETP Mass and High Density Lipoprotein Cholesterol Levels : Role of Sp1/Sp3 in Transcriptional Regulation Arterioscler. Thromb. Vasc. Biol., February 1, 2000; 20(2): 507 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Niitsu, J. Okabe-Kado, T. Kasukabe, Y. Yamamoto-Yamaguchi, M. Umeda, and Y. Honma Prognostic Implications of the Differentiation Inhibitory Factor nm23-H1 Protein in the Plasma of Aggressive Non-Hodgkin's Lymphoma Blood, November 15, 1999; 94(10): 3541 - 3550. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Postel Cleavage of DNA by Human NM23-H2/Nucleoside Diphosphate Kinase Involves Formation of a Covalent Protein-DNA Complex J. Biol. Chem., August 6, 1999; 274(32): 22821 - 22829. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Agou, S. Raveh, S. Mesnildrey, and M. Veron Single Strand DNA Specificity Analysis of Human Nucleoside Diphosphate Kinase B J. Biol. Chem., July 9, 1999; 274(28): 19630 - 19638. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schneider, Y. W. Xu, J. Janin, M. Veron, and D. Deville-Bonne 3'-Phosphorylated Nucleotides Are Tight Binding Inhibitors of Nucleoside Diphosphate Kinase Activity J. Biol. Chem., October 30, 1998; 273(44): 28773 - 28778. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fiorentini, A. Fabbri, L. Falzano, A. Fattorossi, P. Matarrese, R. Rivabene, and G. Donelli Clostridium difficile Toxin B Induces Apoptosis in Intestinal Cultured Cells Infect. Immun., June 1, 1998; 66(6): 2660 - 2665. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Willems, D. R. Van Bockstaele, F. Lardon, M. Lenjou, G. Nijs, H.-W. Snoeck, Z. N. Berneman, and H. Slegers Decrease in Nucleoside Diphosphate Kinase (NDPK/nm23) Expression during Hematopoietic Maturation J. Biol. Chem., May 29, 1998; 273(22): 13663 - 13668. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. Lambeth, J. G. Mehus, M. A. Ivey, and B. I. Milavetz Characterization and Cloning of a Nucleoside-diphosphate Kinase Targeted to Matrix of Mitochondria in Pigeon J. Biol. Chem., September 26, 1997; 272(39): 24604 - 24611. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Lascu, S. Schaertl, C. Wang, C. Sarger, A. Giartosio, G. Briand, M.-L. Lacombe, and M. Konrad A Point Mutation of Human Nucleoside Diphosphate Kinase A Found in Aggressive Neuroblastoma Affects Protein Folding J. Biol. Chem., June 20, 1997; 272(25): 15599 - 15602. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M.P. Freije, P. Blay, N. J. MacDonald, R. E. Manrow, and P. S. Steeg Site-directed Mutation of Nm23-H1. MUTATIONS LACKING MOTILITY SUPPRESSIVE CAPACITY UPON TRANSFECTION ARE DEFICIENT IN HISTIDINE-DEPENDENT PROTEIN PHOSPHOTRANSFERASE PATHWAYS IN VITRO J. Biol. Chem., February 28, 1997; 272(9): 5525 - 5532. [Abstract] [Full Text] [PDF] |
||||