JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by and Linda M. Boxer, L. J. M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by and Linda M. Boxer, L. J. M. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 22, Issue of June 2, pp. 13392-13398, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Transcription Factor, Nm23H2, Binds to and Activates the Translocated c-myc Allele in Burkitts Lymphoma (*)

Lin Ji, Magdalena Arcinas, and Linda M. Boxer (§)

From the (1) Center for Molecular Biology in Medicine, VAMC, Palo Alto, California 94304 and the Department of Medicine, Stanford University School of Medicine, Stanford, California 94305

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

We have identified an in vivo footprint over the PuF site on the translocated c-myc allele in Burkitt's lymphoma cells. The PuF site on the silent normal c-myc allele was unoccupied. We demonstrated by electrophoretic mobility shift assay, electrophoretic mobility shift assay with antibody, UV cross-linking followed by SDS-gel electrophoresis, and Western analysis that Nm23H2 in B cell nuclear extracts bound to the c-myc PuF site. Transfection experiments with c-myc promoter constructs in both DHL-9 and Raji cells revealed that the PuF site functioned as a positive regulatory element in B cells with a drop in activity with mutation of this site. Access to this site is blocked in the normal silent c-myc allele; these data suggest that the Nm23H2 protein is involved in deregulation of the translocated c-myc allele in Burkitt's lymphoma cells.


INTRODUCTION

In Burkitt's lymphoma cells, one c-myc allele is juxtaposed to either the immunoglobulin heavy chain locus or to one of the light chain loci. The translocated c-myc gene is expressed at high levels, while the normal c-myc allele is silent (1, 2, 3, 4) . In all of the cases with an intact c-myc transcription unit, there are structural alterations at the first exon/intron boundary (5, 6, 7, 8) , and c-myc transcription initiates preferentially at promoter P1 in contrast to normal cells in which the P2 promoter is the major transcriptional start site (9, 10) . In addition, the block to RNA elongation is not present in the translocated c-myc allele (11, 12, 13) .

The deregulated c-myc gene is believed to play a role in the pathogenesis of Burkitt's lymphoma. Transgenic mice that carried the c-myc gene linked to the immunoglobulin intron enhancer developed B cell malignancies (14, 15) . Furthermore, when lymphoblastoid cells immortalized by Epstein-Barr virus were transfected with a constitutively expressed c-myc gene, the cells became tumorigenic in nude mice (16) .

Although the mechanism of the deregulation of the translocated c-myc gene is unknown, regulatory elements of the immunoglobulin locus may play a role (17, 18) . We are studying the interplay between the c-myc and immunoglobulin regulatory elements, and we have previously described two NF-B sites in the c-myc gene that are occupied only on the translocated c-myc allele (19) . In this report, we characterize the role of the Nm23H2 transcription factor in the regulation of the translocated c-myc gene.

The nm23 gene products are involved in the control of tumor metastasis by mechanisms that are not known. In some cases, metastatic potential of tumor cells has been correlated with reduced nm23 expression (20-23). In other tumor types, overexpression of nm23 correlates with metastatic spread (24, 25, 26, 27, 28) . The nm23 gene products are also involved in the control of cell proliferation, differentiation, and development (29-31). These proteins contain nucleoside diphosphate kinase enzyme activity (32, 33, 34, 35) . Nm23 proteins interact with GTP-binding proteins (35, 36), and they also function as transcription factors (37) .

The transcription factor, PuF, was identified as the Nm23H2 protein (37). This transcription factor binds to a site at -142 to -115 upstream of the c-myc P1 promoter (the PuF site). It has been shown to regulate c-myc transcription in vitro and is required for in vitro transcription from both promoters P1 and P2 (38, 39) . The nucleoside diphosphate kinase enzyme activity is not required for the DNA binding and in vitro transcriptional activity of Nm23H2 (40) .

We have now demonstrated that the PuF site on the translocated c-myc allele in Burkitt's lymphoma is bound by protein in vivo while the PuF site on the silent normal c-myc allele is not. Transient transfection assays were performed to demonstrate that the PuF site functions as a positive regulatory element in B cells.


EXPERIMENTAL PROCEDURES

Cell Lines

DHL-9 is a B cell line that does not contain a translocation of the c-myc gene; Raji is a Burkitt's lymphoma cell line. They were grown in RPMI with 10% fetal bovine serum.

Plasmid Constructs

pMPCAT (41) , which contains c-myc residues -2328 to +936, was obtained from D. Levens (National Institutes of Health). Mutations were created in the nm23H2 site by PCR() mutagenesis (42). The primers used were 5`-site (MP1), CCTTCCACACGCTCCCCACC; 3`-site (MP2), CCTTCCCCACCCTCCGCACTCTC; double mutant (MP3), CCTTCCACACGCTCCGCACTCTC (the mutated bases are underlined). Mutations were confirmed by sequencing (Sequenase kit, U. S. Biochemical Corp.).

In Vivo Dimethyl Sulfate (DMS) Treatment and DNA Isolation

DNA isolation after DMS treatment was performed as previously described (19, 43, 44) . The DNA was digested with SacI, and agarose electrophoresis was performed to separate the translocated c-myc allele from the normal one. One lane of the gel was transferred to a filter; probes consisting of c-myc exons 2 and 3 and the immunoglobulin µ heavy-chain constant region were used sequentially to locate the two c-myc alleles. The DNA in these two regions was electroeluted from the gel. Cleavage with piperidine was performed according to the Maxam-Gilbert procedure (45) .

Ligation-mediated PCR

Chemically modified and cleaved DNA was then subjected to amplification by ligation-mediated PCR essentially as described by Mueller and Wold (46) , Pfeifer et al.(47) , and Garrity and Wold (48) . Sequenase was used for first strand synthesis, and Taq DNA polymerase was used for PCR. Conditions used for amplification were 95 °C for 2 min, 61 °C for 2 min, and 76 °C for 3 min. After 20-22 cycles of PCR, samples were hybridized with end-labeled primers (primer 3 of each primer set) and amplified by one more cycle of PCR. The reaction mixes were resolved in a 6% polyacrylamide denaturing gel. Footprinting on each strand was repeated at least four times with genomic DNA samples prepared from at least three separate batches of DMS-treated cells. The primers used for PCR were synthesized in an Applied Biosystems 380B DNA synthesizer and purified on Applied Biosystems oligonucleotide purification cartridges. The common linkers used were GCGGTGACCCGGGAGATCTGAATTC and GAATTCAGATC. The primers for the coding strand were GACCCTCGCATTATAAAGGGCCG, AAAGGGCCGGTGGGCGGAGATTAG, and AAAGGGCCGGTGGGCGGAGATTAGCG. The noncoding strand primers were GGAGAGGGTTTGAGAGGGAGC, GGCGCGCGTAGTTAATTCATGCGGC, andGGCGCGCGTAGTTAATTCATGCGGCTCTC.

Quantitation of footprints was performed as previously described (43) with ImageQuant software version 4.15 (Molecular Dynamics). Percent protection values of below 20% were considered too low and were not interpreted as footprints.

Electrophoretic Mobility Shift Assay (EMSA)

The double-stranded oligonucleotides used for EMSA are shown below. Mutated bases are underlined.

On-line formulae not verified for accuracy

OLIGONUCLEOTIDE PuF

On-line formulae not verified for accuracy

OLIGONUCLEOTIDE MP1

On-line formulae not verified for accuracy

OLIGONUCLEOTIDE MP2

On-line formulae not verified for accuracy

OLIGONUCLEOTIDE MP3

On-line formulae not verified for accuracy

OLIGONUCLEOTIDE Myb

The oligonucleotides were synthesized with 5` overhangs and end labeled with [-P]dCTP and Klenow. The F50 probe of the c-myc 5`-flanking region extended from -148 to -98 relative to promoter P1. Binding conditions were as follows: 12 mM HEPES, pH 7.9, 4 mM Tris, pH 7.5, 100 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 12% glycerol, 2 µg of poly(dI-dC), 1 µg of BSA, 0.5 ng (10 cpm) of end-labeled DNA oligonucleotide probe, and 15-20 µg of protein from crude nuclear extract. The binding reaction was conducted at room temperature for 15 min, and the samples were loaded onto a 0.5 Tris borate-EDTA, 5% polyacrylamide gel. Electrophoresis was performed at 30 mA at 4 °C. For the competition studies the indicated molar excess of unlabeled competitor oligonucleotide was added to the binding reaction. As a nonspecific competitor, an oligonucleotide containing the Myb binding site was used. For the supershifts, the binding reaction was performed as above with incubation for 15 min at room temperature. Antibody was added, and the incubation was continued for 1 h at 4 °C. The Nm23H1/Nm23H2 antibody recognizes a region in the homologous C-terminals of human Nm23H1 and Nm23H2. The polyclonal antibodies against Nm23H1/Nm23H2 and Ets-1 were obtained from Santa Cruz Biotechnology.

UV Cross-linking and SDS-Polyacrylamide Gel Electrophoresis

EMSA was performed as described above. The wet gel was exposed to film to locate the EMSA complexes. UV cross-linking was performed essentially as described (49) with a short wavelength UV light box at 4 °C for 30 min. Regions of the gel containing the complexes were cut out, and the individual complexes were eluted at room temperature overnight in 50 mM Tris-HCl, pH 7.9, 0.1% SDS, 0.1 mM EDTA, 5 mM dithiothreitol, 150 mM NaCl, 0.1 mg/ml BSA. The eluted protein was precipitated with 4 volumes of acetone, washed with ethanol, and air dried. After resuspension in Laemmli loading buffer, SDS-polyacrylamide gel electrophoresis was performed. The Amersham ECL kit was used for Western analysis.

In Vitro Methylation Interference

3`-End-labeled DNA fragment (labeled with Klenow polymerase at HindIII site on the antisense strand) or 5`-end-labeled oligonucleotide (labeled with T4 kinase on the antisense strand) was methylated with 0.5% DMS for 2 min at room temperature. This probe was used in EMSA as described above. The wet gel was exposed to locate the complexes, and both the bound and free probe were excised and transferred to DEAE membranes. The DNA was eluted and cleaved with piperidine, and equal counts of bound and free samples were resolved in a 15% acrylamide sequencing gel.

Transfections and Chloramphenicol Acetyltransferase Assays

Transfections were performed on cells in log phase. Cells were washed and resuspended in unsupplemented RPMI medium to a final concentration of 2 10 cells/ml and incubated for 10 min at room temperature after addition of 15 µg of DNA plus 10 µg of DEAE-dextran (50) . Electroporations were carried out with the Bio-Rad Gene Pulser at 350 mV, 960 microfarads. The cells were then incubated again for 10 min at room temperature. Transfected cells were cultured in 23 ml of supplemented RPMI for 48 h. Chloramphenicol acetyltransferase assays were performed in the standard manner (51) with a 2-h enzyme assay. Percent acetylation was quantified with a Molecular Devices phosphorimager. Variation in transfection efficiency was controlled for by cotransfection with Rous sarcoma virus--galactosidase. Each assay was performed at least three times in duplicate with at least two different plasmid preps. The average value with the standard deviation is plotted.


RESULTS

An in Vivo Footprint Is Located Near DNase Hypersensitive Site III-1

The translocated and normal c-myc alleles from Raji cells were separated by electrophoresis, and ligation-mediated PCR was performed on each one. With primer sets that cover the region surrounding DNase hypersensitive site III-1, we found a footprint on the translocated c-myc allele that was not present on the normal silent c-myc allele (Fig. 1). There were 13 guanine residues protected on the noncoding strand. There are no guanine residues in this region on the coding strand. The protected sequence contains consensus binding sites for several transcription factors, including Nm23H2, Sp-1, and AP-2.


Figure 1: In vivo footprint analysis by ligation-mediated PCR of the c-myc DNase hypersensitive site III-1 in Raji cells. The region illustrated is labeled by nucleotide number relative to the c-myc P1 promoter. V denotes in vitro methylated DNA (lane2 is from the normal c-myc allele, and lane4 is from the translocated allele), T denotes in vivo methylated DNA from the translocated c-myc allele, and N denotes in vivo methylated DNA from the normal c-myc allele. The protected guanines are marked by closedcircles. Protection of guanine is 56% at positions -117, -118, and -119; 82% at -121, -122, -123, and -124; 71% at -126, -127, and -128; and 65% at -130, -131, and -132.



Nm23H2 Binds to the Protected Sequence in Vitro

To determine which proteins in B cell nuclear extracts bound to the protected sequence, EMSA was performed. A 50-bp fragment (F50 probe) encompassing this region of the c-myc promoter and a 24-bp double-stranded oligonucleotide (PuF probe) were both labeled and used as probes in EMSA. Nuclear extracts were prepared from both DHL-9 and Raji B cell lines to determine whether there were any differences in the proteins present in Burkitt's cells versus a B cell line lacking a translocation of the c-myc gene. One major complex was formed with both DHL-9 and Raji nuclear extract and the F50 probe (C1 in Fig. 2A). Three complexes were formed with both B cell nuclear extracts and the oligonucleotide (C2, C3, and C4 in Fig. 2B). An excess of unlabeled cold self-competitor diminished the intensity of each of the complexes, while an irrelevant oligonucleotide, which contained the Myb binding site, had little effect on C1 and C2, but it did compete for formation of complexes C3 and C4 (Fig. 2, A and B). We believe that the C3 and C4 complexes are nonspecific interactions. The PuF probe competed for the formation of complex C1 seen with the F50 probe (Fig. 2A). An excess of unlabeled F50 probe competed for formation of complex C2 formed with the PuF probe (Fig. 2B). Thus, the same protein or proteins were most likely present in the C1 complex formed with the F50 fragment and the C2 complex formed with the PuF probe.


Figure 2: EMSA of the PuF binding site DNA fragment and oligonucleotide with B cell nuclear extracts. A, EMSA with the 50-bp DNA fragment (F50) as probe. Cold PuF DNA fragment (F50), PuF site oligonucleotide (PUF), and a c-Myb consensus binding site oligonucleotide (Myb) at the indicated molar excess were used as competitors. Lanes1-5, EMSA with DHL-9 nuclear extract; lanes6-10, EMSA with Raji nuclear extract. The predominant EMSA complex is labeled C1. B, EMSA with the 24-bp PuF binding site oligonucleotide (PUF) as probe. The molar excess of the cold PuF oligonucleotide, F50 DNA fragment, or Myb competitor in each lane is indicated. EMSA complexes are labeled C2-C4, respectively.



The F50 and PuF probes contain consensus binding sites for several transcription factors, so further studies were performed to identify the relevant proteins. An antibody that is reactive with both Nm23H1 and Nm23H2 was used in the EMSA to determine whether Nm23H2 protein was present in complexes C1-C4. As shown in Fig. 3, A and B, the addition of preimmune serum had little effect on either complex, while the antibody against Nm23H1/Nm23H2 disrupted both complexes C1 and C2. No supershifted complex was visible, so it is possible that the antibody interfered with the ability of Nm23H2 to bind to DNA. There was no consistent effect on complexes C3 and C4, and there was no effect with an irrelevant antibody against Ets-1 (Fig. 3, A and B).


Figure 3: Effect of antibodies on EMSA complexes formed with B cell nuclear extracts and the PuF binding site DNA fragment or oligonucleotide. A, effect of antibodies on the EMSA complexes formed with DHL-9 nuclear extract and PuF DNA fragment (F50) (lanes1-4) or oligonucleotide (PUF) (lanes5-8). Lanes1-5, without preimmune serum (-PI); lanes2 and 6, with preimmune serum (+PI); lanes3 and 7, with anti-PuF (Nm23H1/Nm23H2) antibody (+PUF); lanes4 and 8, with anti-Ets-1 antibody (+ETS1). The EMSA complexes C1-C4 are indicated by the arrow. B, effect of antibodies on the EMSA complexes formed with Raji nuclear extract and PuF DNA fragment or oligonucleotide. The lanes and complexes are labeled as described above for panelA.



To confirm that Nm23H2 bound to the F50 and PuF probes, UV cross-linking and Western analysis were performed. UV cross-linking followed by denaturing polyacrylamide gel electrophoresis was performed first. A protein of molecular mass 38 kDa was observed with both the complex C1 with the 50-bp F50 fragment and the complex C2 with the PuF oligonucleotide of the protected region (38 kDa in Fig. 4B). The 38-kDa protein reacted with the Nm23H1/Nm23H2 antibody on Western (Fig. 4A). In addition, protein which was present in the EMSA complex and was not UV cross-linked to DNA was also observed (17 kDa band in Fig. 4A). These two proteins correspond to the size of Nm23H2, either cross-linked to DNA (38 kDa) or free (17 kDa). The Western analysis performed without UV cross-linking of the protein to DNA demonstrated that the molecular mass of the protein in complexes C1 and C2 was 17 kDa (Fig. 4C). In both Western analyses, proteins of higher molecular mass reacted with the Nm23H1/Nm23H2 antibody (The 68-kDa protein is BSA, which is added to the elution buffer; there is some cross-reactivity of the antibody with BSA). The significance of the other proteins is not clear, and proteins of this size are not observed cross-linked to DNA (Fig. 4B). We conclude that Nm23H2 is present in complexes C1 and C2 and that there is no evidence for Nm23H2 in either the C3 or C4 complexes (Fig. 4, A-C).


Figure 4: Identification of the proteins that bind to the c-myc PuF site. A, Western blot analysis of the UV cross-linked EMSA complexes formed with B cell nuclear extracts and the c-myc PuF site using anti-PuF (Nm23H1/Nm23H2) polyclonal antibody. Lanes that contain proteins from the corresponding EMSA complexes (Fig. 2) are labeled as C1-C4, respectively. Lanes1-4, proteins from EMSA complexes formed with DHL-9 nuclear extract and PuF DNA fragment (C1) or oligonucleotide (C2-C4); lanes5-8, proteins from EMSA complexes formed with Raji nuclear extract and PuF DNA (C1) or oligonucleotide (C2-C4). The migration of molecular mass markers is shown on the left. The protein bands with a molecular mass of 38 and 17 kDa are identified as the UV cross-linked complex formed with Nm23H2 protein and DNA probe and the unbound Nm23H2 protein, respectively. The 68-kDa band is BSA, which is added to the elution buffer. There is some cross-reactivity of the antibody with BSA. B, denaturing SDS-polyacrylamide gel analysis of the UV cross-linked EMSA complexes formed with B cell nuclear extracts and the c-myc PuF site. The image was generated from the autoradiography of P-labeled bands on the same gel shown in panelA. The lanes are labeled as described above for panelA. The UV cross-linked EMSA complexes formed with Nm23H2 and the c-myc PuF site are indicated by the arrow; these complexes comigrate with the 38-kDa bands on the Western blot in panelA. C, Western blot analysis of the noncross-linked EMSA complexes formed with B cell nuclear extracts and the c-myc PuF site, using anti-PuF (Nm23H1/Nm23H2) polyclonal antibody. The lanes are labeled as described above for panelA. The unbound Nm23H2 protein shows a molecular mass of 17 kDa, as indicated by the arrow.



Protection of the PuF Binding Site Is Seen in Vitro

In vitro methylation interference was performed to locate the guanine residues required for protein binding in vitro. With the F50 probe, methylation of seven guanine residues interfered with protein binding (Fig. 5A). In complex C2 formed with the PuF probe, methylation of essentially all of the guanine residues interfered with protein binding (Fig. 5B). This is very similar to the pattern observed in vivo (Fig. 1).


Figure 5: Methylation interference analysis of protein-DNA complexes formed with B cell nuclear extracts and the c-myc PuF DNA fragment and oligonucleotide (antisense strands). A, methylation interference analysis of the protein-DNA complex formed with the PuF DNA fragment (F50) and B cell nuclear extracts. C1 corresponds to the EMSA complex C1; F, free probe (lanes1 and 3); B, protein-bound probe (lane2). The nucleotide sequence and position in the c-myc promoter region where methylation interference occurred are indicated. Bases that show strong protection are indicated by an asterisk, and bases that show weak protection are indicated by +. B, methylation interference analysis of protein-DNA complexes formed with the PuF oligonucleotide and B cell nuclear extracts. C2 corresponds to the EMSA complexes C2. The lanes are labeled as described above for panelA. G, G-specific cleavage products of the probe.



The Nm23H2 Site Is Functional in B Cells

The c-myc promoter is active in both DHL-9 and Raji cells. We had shown that Nm23H2 bound to the c-myc PuF site, and we wished to determine whether the Nm23H2 binding site had any functional activity in B cells. Mutations were introduced into either the 5`- or 3`-half of the PuF site (see Fig. 6A). Mutation of either the 5`- or 3`-half of the site decreased dramatically the binding of Nm23H2 protein in vitro (Fig. 7, A and B). No complex C2 was formed with either mutated oligonucleotide, and the mutated oligonucleotides were much weaker competitors against both the C1 and C2 complexes (Fig. 7, A and B).


Figure 6: Effect of mutated PuF site on the c-myc promoter activity. A, diagram of c-myc promoter-chloramphenicol acetyltransferase constructs used for transfection experiments. The location of the PuF site in the upstream region of the c-myc promoter is indicated. The residues involved in Nm23H2 protein binding are underlined. The mutants (MPUF1 and MPUF2) on either half of the PuF palindromic binding sequence are shown, and the mutated nucleotides are indicated by asterisks. Two deletion constructs of the c-myc promoter (DMC1 and DMC2) are also illustrated. B, transient transfection analysis of the c-myc promoter-chloramphenicol acetyltransferase mutant constructs. WT, wild-type c-myc promoter construct; MP1, mutant construct of the first half PuF binding sequence (MPUF1); MP2, mutant construct of the second half PuF binding sequence (MPUF2); MP3, the double mutant construct including both MP1 and MP2 mutated residues. The standard deviation for the MP3 construct in DHL-9 cells was 0.2; this value was too small to be plotted. C, transient transfection analysis of the deletion mutants of the c-myc promoter-chloramphenicol acetyltransferase constructs. DMC1, deletion construct at -148 of the c-myc promoter, which contains the PuF binding site; DMC2, deletion construct at -98 of the c-myc promoter, which lacks the PuF binding site.




Figure 7: Effect of mutated c-myc PuF sites on protein binding by EMSA. A, EMSA with Raji nuclear extract and the PuF DNA fragment and oligonucleotide as probes and the mutated oligonucleotides as competitors (100-fold molar excess). The probes and competitors used are indicated on the top of each lane. 0, without competitor; F50, 50-bp PuF site DNA fragment; PUF, PuF oligonucleotide; MP1, first mutant oligonucleotide of the PuF site; MP2, second mutant oligonucleotide of the PuF site; MP3, double mutant oligonucleotide of the PuF site. The EMSA complexes formed with the PuF probes and nuclear extract are labeled C1-C4 and are indicated by the arrows. B, EMSA with the mutated PuF oligonucleotides as probes and the wild type PuF DNA fragment or oligonucleotide as competitors. The lanes are labeled as described above for panelA.



Mutation of the 5`-half of the site decreased activity of the c-myc promoter by approximately 55% in both DHL-9 and Raji cells (Fig. 6B). Mutation of the 3`-half of the site decreased the c-myc promoter activity by approximately 65% in DHL-9 and Raji cells (Fig. 6B). Mutation of both the 5`- and 3`-halves of the sites simultaneously led to a drop in activity of approximately 75% (Fig. 6B). Deletion of a 50-bp region of the c-myc promoter, which encompasses the PuF site (-148 to -98, DMC1 mutant in Fig. 6A) resulted in a decrease in activity of approximately 85% in both B cell lines (Fig. 6C) relative to the -148 construct (DMC2 mutant in Fig. 6A). We conclude that the PuF site is active in B cells.


DISCUSSION

In vivo footprinting has been used to identify a region near DNase hypersensitive site III-1, which is protected on the translocated c-myc allele in Burkitt's lymphoma cells. The normal c-myc allele, which is transcriptionally silent, does not show any protection in this area. We have shown by several different techniques that Nm23H2 in B cell nuclear extracts binds to this sequence in vitro. The PuF transcription factor was originally identified and purified from HeLa cells (38) . PuF was subsequently shown to be identical to Nm23H2 (37) .

An antibody against Nm23H1/Nm23H2 disrupted the complexes formed in EMSA with both the F50 probe and the PuF oligonucleotide. No supershifted complex was visible; it is possible that binding of the antibody blocks the DNA binding domain of Nm23H2. Both preimmune serum and an antibody against Ets-1 had no effect on the EMSA complexes. A protein of molecular mass 17 kDa was shown to bind to both the F50 probe and the PuF oligonucleotide; this is the size of Nm23H2. In addition, Western analysis revealed that this protein was recognized by the Nm23H1/Nm23H2 antibody. Methylation interference revealed that the guanine residues in the PuF sequence were required for protein binding, and the footprint was very similar to the one we obtained in vivo. It is not clear why only guanine residues in the 3`-half of the PuF site interfere with binding in vitro with the F50 probe. Differences in secondary structure between the longer fragment and the shorter oligonucleotide may be involved. EMSA with the PuF oligonucleotide yielded three complexes, and only complex C2 contained Nm23H2 protein. A single complex with Nm23H2 was observed with the 50-bp fragment. Differences in protein binding between longer DNA fragments and shorter oligonucleotides has been observed previously for the PuF factor (38) .

We have demonstrated that the PuF site has functional activity in B cells. Mutation of either half of the site led to a drop in c-myc promoter activity of approximately 55-65%. Mutations of both halves simultaneously decreased promoter activity by 75%. Deletion of this region also caused a dramatic decrease in activity (approximately 85%).

We have previously observed an in vivo footprint over the PuF site in proliferating HL60 cells (43) . This footprint was not present in differentiated HL60 cells that no longer expressed c-myc. Our results in B cells demonstrate that this site functions as a positive regulatory region. These results are consistent with the findings in HL60 cells, although there is currently no evidence to suggest that the PuF site plays a role in retention or read-through of RNA polymerase II at the transcription start site (52, 53) .

Because the PuF site functions as a positive regulatory element in B cells, we speculate that it is involved in the expression of the translocated c-myc allele in Burkitt's lymphoma cells. This site is unoccupied in the normal c-myc allele. Previously identified differences in DNase I hypersensitive sites between the two c-myc alleles in Burkitt's lymphoma have been described (54-56). Of particular interest is the absence of DNase hypersensitive site III-1 in the normal c-myc allele. These results suggest that the chromatin conformation is different in each allele, and it is possible that the conformation of the normal allele prevents protein binding to the PuF site located close to DNase hypersensitive site III-1. It is also possible that differences in methylation of the two c-myc alleles account for the differential protein binding to the PuF site, which we have observed.

It is likely that the deregulation of the translocated c-myc allele is a consequence of interactions between the c-myc promoter region and regulatory elements of the immunoglobulin locus. We have previously identified two NF-B sites in the c-myc promoter that are occupied only on the translocated allele and that function as positive regulatory elements (19) . Regulatory elements in both the human immunoglobulin locus and the murine immunoglobulin heavy chain locus have been described that lead to increased c-myc expression and the shift in promoter usage from P2 to P1 (17, 18) . We are currently investigating the interaction between these regulatory elements and the transcription factor binding sites that we have identified on the translocated c-myc allele in Burkitt's lymphoma cells.


FOOTNOTES

*
This work was supported by National Institutes of Health Grants CA34233 and CA56764 and by a grant from the Department of Veterans Affairs. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Division of Hematology, S-161, Stanford University School of Medicine, Stanford, CA 94305-5112. Tel.: 415-493-5000 (ext. 3126); Fax: 415-858-3986; E-mail: hf.lmb@forsythe.stanford.edu.

The abbreviations used are: PCR, polymerase chain reaction; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift assay; BSA, bovine serum albumin; bp, base pairs.


REFERENCES
  1. ar-Rushdi, A., Nishikura, K., Erikson, J., Watt, R., Rovera, G., and Croce, C.(1983) Science 222, 390-393 [Abstract/Free Full Text]
  2. Cory, S.(1986) Adv. Cancer Res. 47, 189-234 [Medline] [Order article via Infotrieve]
  3. Hayday, A. C., Gillies, S. D., Saito, H., Wood, C., Wiman, D., Hayward, W. S., and Tonegawa, S.(1984) Nature 307, 334-340 [CrossRef][Medline] [Order article via Infotrieve]
  4. Nishikura, K., ar-Rushdi, A., Erikson, J., Watt, R., Rovera, G., and Croce, C. M.(1983) Proc. Natl. Acad. Sci. U. S. A. 80, 4822-4826 [Abstract/Free Full Text]
  5. Cesarman, E., Dalla-Favera, R., Bentley, D., and Groudine, M.(1987) Science 238, 1272-1275 [Abstract/Free Full Text]
  6. Pelicci, P. G., Knowles, D. M., Magrath, I., and Dalla-Favera, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 2984-2988 [Abstract/Free Full Text]
  7. Yu, B. W., Ichinose, I., Bonham, M. A., and Zajac-Kaye, M.(1993) J. Biol. Chem. 268, 19586-19592 [Abstract/Free Full Text]
  8. Zajac-Kaye, M., Gelmann, E. P., and Levens, D.(1988) Science 240, 1776-1780 [Abstract/Free Full Text]
  9. Battey, J., Moulding, C., Taub, R., Murphy, W., Stewart, T., Potter, H., Lenoir, G., and Leder, P.(1983) Cell 34, 779-787 [CrossRef][Medline] [Order article via Infotrieve]
  10. Taub, R., Moulding, C., Battey, J., Murphy, W., Vasicek, T., Lenoir, G. M., and Leder, P.(1984) Cell 36, 339-348 [CrossRef][Medline] [Order article via Infotrieve]
  11. Bentley, D. L., and Groudine, M.(1986) Nature 321, 702-706 [CrossRef][Medline] [Order article via Infotrieve]
  12. Eick, D., Polack, A., Kofler, E., and Bornkamm, G. W.(1988) Oncogene 3, 397-403 [Medline] [Order article via Infotrieve]
  13. Nepveu, A., and Marcu, K. B.(1986) EMBO J. 5, 2859-2865 [Medline] [Order article via Infotrieve]
  14. Adams, J. M., Harris, A. W., Pinkert, C. A., Corcoran, L. M., Alexander, W. S., Cory, S., Palmiter, R. D., and Brinster, R. L.(1985) Nature 318, 533-538 [CrossRef][Medline] [Order article via Infotrieve]
  15. Nussenzweig, M. D., Schmidt, E., Shaw, A. C., Sinn, E., Campos-Torres, J., Mathey-Prevot, B., Pattengale, P. K., and Leder, P.(1988) Nature 336, 446-450 [CrossRef][Medline] [Order article via Infotrieve]
  16. Lombardi, L., Newcomb, E. W., and Dalla-Favera, R.(1987) Cell 49, 161-170 [CrossRef][Medline] [Order article via Infotrieve]
  17. Madisen, L., and Groudine, M.(1994) Genes & Dev. 8, 2212-2226
  18. Polack, A., Feederle, R., Klobeck, G., and Hortnagel, K.(1993) EMBO J. 12, 3913-3920 [Medline] [Order article via Infotrieve]
  19. Ji, L., Arcinas, M., and Boxer, L. M.(1994) Mol. Cell. Biol. 14, 7967-7974 [Abstract/Free Full Text]
  20. Bevilacqua, G., Sobel, M. E., Liotta, L. A., and Steeg, P. S.(1989) Cancer Res. 49, 5185-5190 [Abstract/Free Full Text]
  21. Florenes, V. A., Aamdal, S., Myklebost, O., Maelandsmo, G. M., Bruland, O. S., and Fodstad, O.(1992) Cancer Res. 52, 6088-6091 [Abstract/Free Full Text]
  22. Nakayama, T., Ohtsuru, A., Nakao, K., Shima, M., Nakata, K., Watanabe, K., Ishii, N., Kimura, N., and Nagataki, S.(1992) J. Natl. Cancer Inst. 84, 1349-1354 [Abstract/Free Full Text]
  23. Hirayama, R., Sawai, S., Takagi, Y., Mishima, Y., Kimura, N., Shimada, N., Esaki, Y., Kurashima, C., Utsuyama, M., and Hirokawa, K.(1991) J. Natl. Cancer Inst. 83, 1249-1250 [Free Full Text]
  24. Engel, M., Theisinger, B., Seib, T., Seitz, G., Huwer, H., Zang, K. D., Welter, C., and Dooley, S.(1993) Int. J. Cancer 55, 375-379 [Medline] [Order article via Infotrieve]
  25. Hailat, N., Keim, D. R., Melhem, R. F., Zhu, X. X., Eckerskorn, C., Brodeur, G. M., Reynolds, C. P., Seeger, R. C., Lottspeich, F., Strahler, J. R., and Hanash, S. M.(1991) J. Clin. Invest. 88, 341-345
  26. Haut, M., Steeg, P. S., Willson, J. K., and Markowitz, S. D.(1991) J. Natl. Cancer Inst. 83, 712-716 [Abstract/Free Full Text]
  27. Leone, A., Flatow, U., VanHoutte, K., and Steeg, P. S.(1993) Oncogene 8, 2325-2333 [Medline] [Order article via Infotrieve]
  28. Myeroff, L. L., and Markowitz, S. D.(1993) J. Natl. Cancer Inst. 85, 147-152 [Abstract/Free Full Text]
  29. Keim, D., Hailat, N., Melhem, R., Zhu, X. X., Lascu, I., Veron, M., Strahler, J., and Hanash, S. M.(1992) J. Clin. Invest. 89, 919-924
  30. Lakso, M., Steeg, P. S., and Westphal, H.(1992) Cell Growth & Differ. 3, 873-879
  31. Okabe-Kado, J., Kasukabe, T., Honma, Y., Hayashi, M., and Hozumi, M. (1988) J. Biol. Chem. 263, 10994-10999 [Abstract/Free Full Text]
  32. Biggs, J., Hersperger, E., Steeg, P. S., Liotta, L. A., and Shearn, A. (1990) Cell 63, 933-940 [CrossRef][Medline] [Order article via Infotrieve]
  33. Gilles, A. M., Presecan, E., Vonica, A., and Lascu, I.(1991) J. Biol. Chem. 266, 8784-8789 [Abstract/Free Full Text]
  34. Lacombe, M. L., Sastre-Garau, X., Lascu, I., Vonica, A., Wallet, V., Thiery, J. P., and Veron, M.(1991) Eur. J. Cancer 27, 1302-1307
  35. Wallet, V., Mutzel, R., Troll, H., Barzu, O., Wurster, B., Veron, M., and Lacombe, M. L.(1990) J. Natl. Cancer Inst. 82, 1199-1202 [Abstract/Free Full Text]
  36. Bominaar, A. A., Molijn, A. C., Pestel, M., Veron, M., and Van Haastert, P. J.(1993) EMBO J. 12, 2275-2279 [Medline] [Order article via Infotrieve]
  37. Postel, E. H., Berberich, S. J., Flint, S. J., and Ferrone, C. A. (1993) Science 261, 478-480 [Abstract/Free Full Text]
  38. Postel, E. H., Mango, S. E., and Flint, S. J.(1989) Mol. Cell. Biol. 9, 5123-5133 [Abstract/Free Full Text]
  39. Postel, E. H.(1992) Ann. N. Y. Acad. Sci. 660, 57-63 [Abstract]
  40. Postel, E. H., and Ferrone, C. A.(1994) J. Biol. Chem. 269, 8627-8630 [Abstract/Free Full Text]
  41. Avigan, M. I., Strober, B., and Levens, D.(1990) J. Biol. Chem. 265, 18538-18545 [Abstract/Free Full Text]
  42. Higuchi, R.(1990) in PCR Protocols: A Guide to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds) pp. 177-183, Academic Press, Inc., San Diego
  43. Arcinas, M., and Boxer, L. M.(1994) Oncogene 9, 2699-2706 [Medline] [Order article via Infotrieve]
  44. Arcinas, M., Sizer, K. C., and Boxer, L. M.(1994) J. Biol. Chem. 269, 21919-21924 [Abstract/Free Full Text]
  45. Maxam, A. M., and Gilbert, W.(1980) Methods Enzymol. 65, 499-560 [Medline] [Order article via Infotrieve]
  46. Mueller, P. R., and Wold, B.(1989) Science 246, 780-786 [Abstract/Free Full Text]
  47. Pfeifer, G. P., Steigerwald, S. D., Mueller, P. R., Wold, B., and Riggs, A. D.(1989) Science 246, 810-813 [Abstract/Free Full Text]
  48. Garrity, P., and Wold, B.(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1021-1025 [Abstract/Free Full Text]
  49. Chodosh, L. A.(1988) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhle, K., eds) pp. 12.5.1-12.5.6, Green Publishing and Wiley-Interscience, New York
  50. Gauss, G. H., and Lieber, M. R.(1992) Nucleic Acids Res. 20, 6739-6740 [Free Full Text]
  51. Gorman, C. M., Moffat, L. F., and Howard, B. H.(1978) Mol. Cell. Biol. 2, 1044-1051
  52. Krumm, A., Meulia, T., Brunvand, M., and Groudine, M.(1992) Genes & Dev. 6, 2201-2213
  53. Strobl, L. J., and Eick, D.(1992) EMBO J. 11, 3307-3314 [Medline] [Order article via Infotrieve]
  54. Dyson, P. J., Littlewood, T. D., Forster, A., and Rabbitts, T. H. (1985) EMBO J. 4, 2885-2891 [Medline] [Order article via Infotrieve]
  55. Dyson, P. J., and Rabbitts, T. H.(1985) Proc. Natl. Acad. Sci. U. S. A. 82, 1984-1988 [Abstract/Free Full Text]
  56. Siebenlist, U., Hennighausen, L., Battey, J., and Leder, P.(1984) Cell 37, 381-391 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Clin. Pathol.Home page
G Brady, G J MacArthur, and P J Farrell
Epstein Barr virus and Burkitt lymphoma
J. Clin. Pathol., December 1, 2007; 60(12): 1397 - 1402.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
F Gadal, A Starzec, C Bozic, C Pillot-Brochet, S Malinge, V Ozanne, J Vicenzi, L Buffat, G Perret, F Iris, et al.
Integrative analysis of gene expression patterns predicts specific modulations of defined cell functions by estrogen and tamoxifen in MCF7 breast cancer cells
J. Mol. Endocrinol., February 1, 2005; 34(1): 61 - 75.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Johansson, A. MacKenzie-Hose, I. Andersson, and C. Knorpp
Structure and Mutational Analysis of a Plant Mitochondrial Nucleoside Diphosphate Kinase. Identification of Residues Involved in Serine Phosphorylation and Oligomerization
Plant Physiology, October 1, 2004; 136(2): 3034 - 3042.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Engel, S. Mazurek, E. Eigenbrodt, and C. Welter
Phosphoglycerate Mutase-derived Polypeptide Inhibits Glycolytic Flux and Induces Cell Growth Arrest in Tumor Cell Lines
J. Biol. Chem., August 20, 2004; 279(34): 35803 - 35812.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. L. Grand, T. J. Powell, R. B. Nagle, D. J. Bearss, D. Tye, M. Gleason-Guzman, and L. H. Hurley
Mutations in the G-quadruplex silencer element and their relationship to c-MYC overexpression, NM23 repression, and therapeutic rescue
PNAS, April 20, 2004; 101(16): 6140 - 6145.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. H. Postel and B. M. Abramczyk
Escherichia coli nucleoside diphosphate kinase is a uracil-processing DNA repair nuclease
PNAS, November 11, 2003; 100(23): 13247 - 13252.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Serafeim, M. J. Holder, G. Grafton, A. Chamba, M. T. Drayson, Q. T. Luong, C. M. Bunce, C. D. Gregory, N. M. Barnes, and J. Gordon
Selective serotonin reuptake inhibitors directly signal for apoptosis in biopsy-like Burkitt lymphoma cells
Blood, April 15, 2003; 101(8): 3212 - 3219.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Siddiqui-Jain, C. L. Grand, D. J. Bearss, and L. H. Hurley
Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription
PNAS, September 3, 2002; 99(18): 11593 - 11598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-M. Hu, M. Arcinas, and L. M. Boxer
A Myc-associated Zinc Finger Protein-related Factor Binding Site Is Required for the Deregulation of c-myc Expression by the Immunoglobulin Heavy Chain Gene Enhancers in Burkitt's Lymphoma
J. Biol. Chem., March 15, 2002; 277(12): 9819 - 9824.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Arcinas, C. A. Heckman, J. W. Mehew, and L. M. Boxer
Molecular Mechanisms of Transcriptional Control of bcl-2 and c-myc in Follicular and Transformed Lymphoma
Cancer Res., July 1, 2001; 61(13): 5202 - 5206.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Gounaris, S. Thomas, P. Najarro, and M. E. Selkirk
Secreted Variant of Nucleoside Diphosphate Kinase from the Intracellular Parasitic Nematode Trichinella spiralis
Infect. Immun., June 1, 2001; 69(6): 3658 - 3662.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. L. E. Galvis, S. Marttila, G. Håkansson, J. Forsberg, and C. Knorpp
Heat Stress Response in Pea Involves Interaction of Mitochondrial Nucleoside Diphosphate Kinase with a Novel 86-Kilodalton Protein
Plant Physiology, May 1, 2001; 126(1): 69 - 77.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Dachet, O. Poirier, F. Cambien, J. Chapman, and M. Rouis
New Functional Promoter Polymorphism, CETP/-629, in Cholesteryl Ester Transfer Protein (CETP) Gene Related to CETP Mass and High Density Lipoprotein Cholesterol Levels : Role of Sp1/Sp3 in Transcriptional Regulation
Arterioscler. Thromb. Vasc. Biol., February 1, 2000; 20(2): 507 - 515.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Niitsu, J. Okabe-Kado, T. Kasukabe, Y. Yamamoto-Yamaguchi, M. Umeda, and Y. Honma
Prognostic Implications of the Differentiation Inhibitory Factor nm23-H1 Protein in the Plasma of Aggressive Non-Hodgkin's Lymphoma
Blood, November 15, 1999; 94(10): 3541 - 3550.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. H. Postel
Cleavage of DNA by Human NM23-H2/Nucleoside Diphosphate Kinase Involves Formation of a Covalent Protein-DNA Complex
J. Biol. Chem., August 6, 1999; 274(32): 22821 - 22829.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Agou, S. Raveh, S. Mesnildrey, and M. Veron
Single Strand DNA Specificity Analysis of Human Nucleoside Diphosphate Kinase B
J. Biol. Chem., July 9, 1999; 274(28): 19630 - 19638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Schneider, Y. W. Xu, J. Janin, M. Veron, and D. Deville-Bonne
3'-Phosphorylated Nucleotides Are Tight Binding Inhibitors of Nucleoside Diphosphate Kinase Activity
J. Biol. Chem., October 30, 1998; 273(44): 28773 - 28778.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. Fiorentini, A. Fabbri, L. Falzano, A. Fattorossi, P. Matarrese, R. Rivabene, and G. Donelli
Clostridium difficile Toxin B Induces Apoptosis in Intestinal Cultured Cells
Infect. Immun., June 1, 1998; 66(6): 2660 - 2665.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Willems, D. R. Van Bockstaele, F. Lardon, M. Lenjou, G. Nijs, H.-W. Snoeck, Z. N. Berneman, and H. Slegers
Decrease in Nucleoside Diphosphate Kinase (NDPK/nm23) Expression during Hematopoietic Maturation
J. Biol. Chem., May 29, 1998; 273(22): 13663 - 13668.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. O. Lambeth, J. G. Mehus, M. A. Ivey, and B. I. Milavetz
Characterization and Cloning of a Nucleoside-diphosphate Kinase Targeted to Matrix of Mitochondria in Pigeon
J. Biol. Chem., September 26, 1997; 272(39): 24604 - 24611.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Lascu, S. Schaertl, C. Wang, C. Sarger, A. Giartosio, G. Briand, M.-L. Lacombe, and M. Konrad
A Point Mutation of Human Nucleoside Diphosphate Kinase A Found in Aggressive Neuroblastoma Affects Protein Folding
J. Biol. Chem., June 20, 1997; 272(25): 15599 - 15602.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M.P. Freije, P. Blay, N. J. MacDonald, R. E. Manrow, and P. S. Steeg
Site-directed Mutation of Nm23-H1. MUTATIONS LACKING MOTILITY SUPPRESSIVE CAPACITY UPON TRANSFECTION ARE DEFICIENT IN HISTIDINE-DEPENDENT PROTEIN PHOSPHOTRANSFERASE PATHWAYS IN VITRO
J. Biol. Chem., February 28, 1997; 272(9): 5525 - 5532.
[Abstract] [Full Text] [PDF]