Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Philipson, L. H.
Right arrow Articles by Miller, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Philipson, L. H.
Right arrow Articles by Miller, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 24, Issue of June 16, pp. 14604-14610, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional Expression of an Epitope-tagged G protein-coupled K Channel (GIRK1) (*)

Louis H. Philipson (1)(§), Andrey Kuznetsov (1), Peter T. Toth (2), Joseph F. Murphy (3), Gabor Szabo (3), Gloria H. Ma (2), Richard J. Miller (2)

From the (1)Departments of Medicine and (2)Pharmacology and Physiology, The University of Chicago, Chicago, Illinois 60637 and the (3)Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville, Virginia 22908

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

An epitope-tagged form of an inwardly rectifying and G protein-coupled K channel (GIRK1-cp) was expressed at high levels in transfected mammalian cells. Immunoblot analysis of transfected human embryonic kidney cells (HEK293) and mouse insulinoma cells (TC3) revealed several GIRK1-cp polypeptides, including the major 59-kDa band, corresponding to the predicted mass of the GIRK1 polypeptide plus the epitope tag. Immunohistochemical staining using two anti-tag antibodies showed abundant immunoreactive material, which was predominantly concentrated in the perinuclear area in both transfected cell types. While functional GIRK1-cp message was present in poly(A)+ RNA prepared from HEK293 cells expressing GIRK1-cp protein, appropriate K currents could not be detected. In contrast, whole cell recordings made directly from transfected TC3 cells expressing GIRK1-cp revealed inwardly rectifying, pertussis toxin-sensitive currents activated by norepinephrine and galanin. Single channel recordings in excised patches of TC3 cells expressing GIRK1-cp showed rectifying K currents when activated by 50 µM guanosine 5`-O-(thiotriphosphate), with a slope conductance of 39.1 ± 1.0 picosiemens. This is the first report of stable heterologous expression of a functional G protein-coupled K channel in mammalian cells. The activity of an epitope-tagged channel in insulinoma cells demonstrates the utility of this system for further biochemical and biophysical analyses of G protein-K channel interactions.


INTRODUCTION

K channels are important effectors for signal transduction mediated by heterotrimeric guanine nucleotide-binding proteins (G proteins)(1, 2, 3) . These channels are found in a wide variety of cell types, where they play essential roles in the maintenance of the resting membrane potential, in the coupling of metabolism to cell excitability, and in shaping the action potential of excitable cells(4, 5) . G protein-coupled receptors probably bind to a membrane-bound effector complex, which includes the and subunits of G proteins in addition to the effector channel(6, 7) . The and subunits, each a group of related proteins, possess some effector specificity and activate the channel directly(8, 9, 10, 11) .

Several related G protein-coupled K channel cDNAs have recently been cloned from rat heart (GIRK1 or KGA), rat insulinoma, and mouse brain(12, 13, 14, 15) . The human GIRK1 gene (KCNJ3) has been localized to chromosome 2q24.1(14) . Expression of GIRK1 cDNA in Xenopus oocytes has facilitated the observation that GIRK1 is activated by GTPS,()and by the appropriate agonist when co-expressed with various seven-transmembrane receptors such as the M muscarinic receptor, the µ-, -, and -opioid receptors, and the serotonin (5-HT) 1A receptor(12, 13, 16, 45) . An important goal, however, remains: to express the functional GIRK1 channel in a stable mammalian cell line, a much more convenient and homologous system for biochemical and biophysical analyses of G-protein-K channel interactions.

The present study, describing the expression of the identical epitope-tagged GIRK1 channel in transfected human embryonic kidney (HEK293) and neuroendocrine (TC3 insulinoma) cells, revealed an interesting difference in the two different cell lines. Expression of the polypeptide produced by transient and stable transfection of cell lines was compared to that produced by injection of cRNA into Xenopus oocytes. While both the HEK293 cells and the TC3 cells transfected with GIRK1-cp produced GIRK1-cp polypeptides, only in the TC3-GIRK1-cp cells were appropriate currents consistently observed. These currents were activated by GTPS and were differentially activated by stimulation of specific endogenous G protein-linked receptors. The characteristics of the GIRK1 currents at the single channel level were consistent with those of cardiac atrial current I. These results show that GIRK1-cp was differentially expressed in these cell lines, suggesting that another component or subunit(s) are necessary for GIRK1 channel expression. The BTC3-GIRK1-cp cell line will be a useful system in which to further characterize G protein signal transduction via receptor-activated K channels.


MATERIALS AND METHODS

Construction of GIRK1-cp Fusion cDNA

GIRK1 cDNA was isolated from a rat insulinoma (RIN cell) cDNA library(14) . A three-primer variation of the polymerase chain reaction was employed to add the human proinsulin C-peptide coding sequences to the 3`-end of the GIRK1 coding region(17) . In a single 100-µl reaction, a GIRK1-containing plasmid (pGEM3z-GIRK1) was combined with pHINS, a plasmid containing the human proinsulin cDNA, together with a forward primer (100 pmol), a reverse primer (100 pmol) and a bridge primer (10 pmol). The 5`-oligonucleotide primer (CTGTGGCCGATTTGCCACCG) was designed to overlap the HindIII site at base pair 1417 of GIRK1 (counting the ATG start site). The 3`-primer (TTCCACAAGCTTACGCTACTGCAGGGACC) included 17 base pairs of the 3`-end of the C-peptide, a stop codon, and a HindIII site. The bridging primer (caggtcctctgcctcCGATGTGAAGCGGTC) included the 5`-end of the C-peptide (lowercase) and the 3`-end of the GIRK1 (uppercase), with a mutation changing the TAG (stop) to TCG (Ser). The reaction was amplified for 30 cycles at 94 °C for 1 min, 50 °C for 30 s, and 72 °C for 30 s. The 225-base pair product was purified, subcloned into the pCRII vector (Invitrogen), sequenced completely on both strands (Sequenase, USB), excised with HindIII, and ligated into the HindIII site (base pair 1417 of coding region) of GIRK1 previously subcloned into pCMV5(18) . The GIRK1-cp cDNA (1.7 kilobases) was excised and ligated into pBSKSII (Stratagene).

Functional Expression of GIRK1 and GIRK1-cp in Xenopus Oocytes

pGEM3z-GIRK1 was linearized with NdeI, and the cRNA was run off with SP6 RNA polymerase; pBSKSII-GIRK1-cp was linearized with XbaI, and the cRNA was run off with T3 RNA polymerase. -opioid receptor cRNA preparation, Xenopus oocytes injection, recording techniques, and buffers were essentially as described(19, 45) .

Transient and Stable Transfection of Cell Lines

HEK293 cells (American Type Culture Collection) maintained in Dulbecco's modified Eagle's medium (4.5 g/liter glucose with 5% supplemented bovine calf serum (Hyclone Laboratories, Inc.) were transfected by a calcium phosphate method (Transfection MBS mammalian transfection kit, Stratagene). TC3 cells were maintained as described and were transfected by electroporation(20, 21) . For selection of stable clones, cells co-transfected with pCMV5-GIRK1-cp and pSV2-neo were maintained in media supplemented with 0.4 mg/ml G418 (Life Technologies, Inc.) for HEK293 cells and 1.0 mg/ml for TC3 cells. Fifteen HEK293 and eight TC3 clones positive by immunostaining and Western blot were isolated and propagated; control clones were negative in both assays. TC3-GIRK1-cp-#4 and HEK293-GIRK1-cp-#21 were selected for further studies.

Immunohistochemical Detection of GIRK1-cp

Both cell types (HEK293 cells grown on poly-L-lysine (Sigma) coated plates) were fixed with 3% formaldehyde freshly prepared from paraformaldehyde (Aldrich) in phosphate-buffered saline (PBS, pH 7.4, 20 min, 37 °C), washed with PBS, then permeabilized with 0.1% Triton X-100 in PBS (5 min, 22 °C). After additional PBS washes, the cells were blocked with 2% bovine serum albumin in PBS (2% BSA) for 1 h at room temperature. HEK293 cells were treated initially with rabbit anti-human-C-peptide antisera (1:2000 to 1:5000 dilutions in 2% BSA), and TC3 cells (and in some experiments, the HEK293 cells) were first treated with rat monoclonal anti-human-C-peptide antibody, diluted 1:10 to 1:100, at 4 °C overnight (Id4)(22) . After additional washing steps, the second antibody was applied: either goat anti-rat IgG F(ab`) conjugated with horseradish peroxidase (1 h, 22 °C at 2 µg/ml, Jackson Immunoresearch Laboratories, Inc.), or goat biotinylated anti-rabbit IgG (10 µg/ml, Vector Laboratories, Inc.), as appropriate. The former complex was visualized with hydrogen peroxide and diaminobenzidene, and the latter complex was treated with avidin-biotinylated horseradish peroxidase complex (ABC kit, Vector Laboratories, Inc.) and similarly visualized.

Immunoblot Analyses

Cells were rinsed, collected in ice-cold homogenization buffer (0.25 M sucrose, 0.01 M HEPES, pH 7.4, containing 2 mM phenylmethylsulfonyl fluoride, 1 µM leupeptin, and 10 µM pepstatin), and then briefly homogenized (Potter homogenizer). The supernatant after low speed centrifugation (1000 g, 15 min) was collected, and the total membrane fraction pellet was obtained after centrifugation at 350,000 g (1 h, 4 °C). The resuspended pellet (10 mg/ml of protein in homogenization buffer) was divided into aliquots and stored at -80 °C. Total cell homogenates were obtained by direct lysis in SDS electrophoresis sample buffer (10 mM Tris HCl, pH 6.8, 2% SDS, 100 mM dithiothreitol, 10% glycerol) and analyzed by electrophoresis in 7.5% discontinuous polyacrylamide SDS gels(23) . Proteins were transferred to membranes (Immobilon P, Millipore Corp.), blocked with 5% dry milk, 0.1% Tween-20 in PBS for 3 h and incubated with anti-human C-peptide monoclonal antibody (4 °C, 18 h), washed, and incubated with goat anti-rat IgG F(ab`) horseradish peroxidase-conjugated second antibody (1:2000 dilution) (2 h, room temperature). In some experiments the rabbit anti-human-C-peptide antisera were employed with the appropriate second antibody. After further washing, the membrane was bathed in a chemiluminescence reagent (ECL detection reagent, Amersham Corp.) and briefly exposed (1 s to 30 min) to Kodak X-omat film. C-Labeled marker proteins (Rainbow protein markers, Amersham Corp.) were visualized by additional 24-h exposure.

Some samples were digested with N-glycanase (Genzyme) or calf intestinal alkaline phosphatase (NEB) before the addition of SDS sample buffer. For N-glycanase digestion, cell lysates were incubated in 50 mM Tris-HCl, pH 7.6, 0.17% SDS, 1.25% Nonidet P-40, 10 mM -mercaptoethanol, and 10 units/ml N-glycanase (24 h, 37 °C). For alkaline phosphatase digestions, lysates were incubated in 50 mM Tris-HCl, pH 7.6, 0.17% SDS, 10 µM -mercaptoethanol, and 100 units/ml calf intestinal phosphatase, with or without 100 mM NaF.

Whole Cell Recordings

Cells were dispersed using 1 mM EDTA and 0.7 mg/ml trypsin (Type III, bovine pancreas, Sigma) solution (1.5 min) and then replated on poly-L-lysine (Sigma) treated glass coverslips overnight. Membrane currents were recorded in the whole cell configuration using the Axopatch-1D voltage clamp amplifier. Patch pipettes (2.5-5 megaohms) were pulled from soft soda-lime capillary tubes and sylgard-coated (Dow Corning). Capacitative transients were canceled at 10 kHz, and their values were obtained directly, together with the series resistance values from the settings of the amplifier. Series resistance was routinely compensated by about 80%. Pulse generation, recordings, and data analysis were carried out using a custom modified C-CLAMP program for IBM-PC compatible computers (Indec, Sunnyvale, CA). Recordings were conducted at 22-25 °C using 200-ms voltage command pulses at 10-s intervals, filtered at 1 or 2 KHz, perfusion rate 2 ml/min.

Specific reagents were obtained as follows: pertussis toxin (RBI, Natick, MA), galanin (RBI, amino acids 1-16, porcine), 5`-N-ethylcarboxamidoadenosine (NECA, RBI), L-(-)-norepinephrine bitartrate (RBI), [D-Trp]somatostatin (Bachem), and yohimbine hydrochloride (Sigma).

Single Channel Electrophysiology

Experiments were performed utilizing both the inside-out excised patch, and the cell-attached mode of the patch clamp technique(24) . Cells were dispersed from culture flasks in 0.05% trypsin, 0.53 mM EDTA solution (5 min) and stored with serum for same day use. The glass bottom of the recording chamber (200 µl volume) was treated with poly-L-lysine (Sigma; 0.020 mg/ml, 10 min). Patch pipettes were pulled from quartz capillaries (1 mm outer diameter, 0.5 mm inner diameter) using a laser puller (Sutter Instrument Co., Model P-2000) to a resistance of 7-10 megaohms. Command potentials were applied, and data were digitized using a microprocessor controlled analog I/O board (DAP 800, Microstar Laboratories, sampling rate 2.8 KHz). Data, obtained using an Axopatch 200A amplifier (Axon instruments), were filtered at 1-2 KHz, recorded onto videotape (PCM-2 A/D VCR Adaptor, Instrutech), and analyzed using a commercial program (Transit, Baylor University).


RESULTS

Initial attempts to functionally express the native rat GIRK1 protein in Chinese hamster ovary cells yielded several stable cell lines that produced the appropriately sized mRNA in Northern blots, but no currents activated by GTPS were observed (data not shown). In order to further study the expression of this protein in heterologous expression systems we transferred a well characterized epitope tag we had employed previously, the C-peptide of human proinsulin(25) , to the COOH terminus of GIRK1, and termed the chimeric protein GIRK1-cp. When currents produced after microinjection of native GIRK1 cRNA or GIRK1-cp cRNA into Xenopus oocytes, co-injected with -opioid receptor cRNA, were compared, no detectable difference could be discerned upon activation with a specific agonist (Fig. 1, A and B). The currents obtained were also indistinguishable following oocyte co-injection experiments with GIRK1-cp and the M2 muscarinic receptor cRNAs.()These results suggested that elongation of the COOH terminus of the GIRK1 channel by 31 amino acids did not interfere with channel assembly or the opening of the channel by activated G protein subunits.


Figure 1: Expression of GIRK1-cp in Xenopus oocytes. Two-microelectrode voltage clamp recording of oocytes co-injected with -opioid receptor cRNA and authentic GIRK1 cRNA (A), GIRK1-cp cRNA (B), or poly(A) RNA purified from HEK 293-GIRK1-cp cells (C). In each case, the leftpanels show the currents obtained in high K bath alone, and the rightpanels show the activation of inward currents after addition of the -opioid receptor agonist U69593 (1 µM). The recording protocol employed seven pulses from a holding potential of -60 mV, duration 500 ms, pulse interval 10 s, with steps to 50, 20, -10, -40, -70, -100, and -130 mV. -opioid receptor cRNA and GIRK1 or GIRK1-cp cRNA (50 nl) or poly(A)RNA (50nl) were injected into each oocyte (GIRK1 cRNA, 5 ng/cell; -opioid receptor cRNA, 50 ng/cell). Oocytes were then incubated at 18 °C for 3-7 days before recording. The high K solution contained (in mM) 50 KCl, 35 NaCl, 1 NaHPO, 1 CaCl, 1 MgCl, 5 HEPES (pH 7.6).



We then sought to examine the expression of the GIRK1-cp protein in transfected mammalian cells. Expression in the HEK293 cells was compared with that obtained in an insulinoma cell (TC3), that expresses a variety of ion channels and receptors(20) . Transfected cell lines expressing GIRK1-cp were identified by positive staining with two different anti-human-C-peptide antibodies, one polyclonal and the other monoclonal. Both cell types yielded intensely stained stable cell lines, with some cells showing particularly dense staining of the perinuclear area (Fig. 2). Immunoblots of homogenates prepared from these cells showed that multiple peptides were visualized with the anti-tag antibody (Fig. 3). The two most prominent bands corresponded to the predicted size of the GIRK1-cp protein, 59 kDa, and a slightly larger protein of 62 kDa. Additional bands of higher MW were also noted, primarily in the HEK293 cells (Fig. 3, A and B). The 62-kDa band was completely eliminated by digestion with N-glycanase (Fig. 3C, lane4), but there was no difference following treatment with alkaline phosphatase (lane2).


Figure 2: Epitope-based detection of GIRK1-cp: immunohistochemical staining of GIRK1-cp transfected cells. Shown are photomicrographs of HEK293-GIRK1-cp (A) and TC3-GIRK1-cp cells (B), stained with the Id4 Ab as detailed under ``Materials and Methods.'' Cytoplasmic staining with some dense perinuclear patterns can be seen in panelA. A culture of mixed positive and negative TC3 cells was chosen for panelB to illustrate the intense cytoplasmic staining. No specific staining was observed in untransfected cells (same scale for both figures; bar, 100 µm).




Figure 3: Immunoblot detection of GIRK1-cp in transfected cells. Cell homogenates were solubilized, separated by SDS-polyacrylamide gel electrophoresis, and then analyzed in immunoblots treated with anti-C-peptide antibody and visualized by a chemiluminescent technique (see ``Materials and Methods'' for experimental details). A, homogenates from a transfected HEK-293-GIRK1-cp stable cell line. Lane1, homogenate of approximately 2 10 cells; lane2, 8 10 cells. B, homogenates from transiently transfected TC3-GIRK1-cp cells. Similar amounts of homogenates were applied to lanes1 and 2 as in panelA. C, effect of digestion of stable TC3-GIRK1-cp cell homogenates with N-glycanase and alkaline phosphatase. Equivalent amounts of homogenate corresponding to approximately 2 10 cells were applied to each lane. Lane1, untreated control; lane2, digestion with alkaline phosphatase; lane3, digestion with alkaline phosphatase in the presence of NaF; lane4, digestion with N-glycanase, lane5, mock N-glycanase digestion without added enzyme.



No specific currents induced by GIRK1-cp expression could be detected in the immunopositive HEK293 transfected cells, as will be further discussed below. However, poly(A) RNA prepared from these cells was found to direct the expression of inwardly rectifying currents in Xenopus oocytes. The poly(A) RNA was co-injected with -opioid receptor cRNA, and after incubation the oocytes were stimulated by the opioid agonist U69593 (Fig. 1C). These currents were indistinguishable from those recorded after the injection of in vitro transcribed GIRK1 or GIRK1-cp cRNA, also coinjected with -opioid receptor cRNA. Therefore, the GIRK1-cp cDNA directed the production of intact and functional message, but the protein that was translated in the HEK293 cells did not produce functional channels in the cell membrane.

In contrast, TC3-GIRK1-cp cells were found to express an inwardly rectifying current not seen in controls, which was then characterized by whole cell and single channel techniques. These cells also express other K channels, such as the mildly rectifying K-ATP channel, but the inclusion of 2 mM ATP in the pipette, as used in all of the whole cell experiments described here, is sufficient to block this channel(26, 27) . Endogenous receptors were tested for their ability to activate GIRK1-cp currents. Norepinephrine induced whole cell currents recorded from single TC3-GIRK1-cp-expressing cells (Fig. 4), but not from control cells. The subtracted currents shown in Fig. 4D are slowly inactivating and show strong inward rectification (panelE), consistent with the GIRK1 currents seen in Xenopus oocyte expression(12, 28) . Two additional hormones, galanin and somatostatin, that have been shown to open nucleotide-sensitive K channels in insulinoma cells, were tested for their ability to activate GIRK1-cp(29, 30) . As shown in Fig. 5, galanin activated the current almost as well as norepinephrine, a somatostatin analog did so to a much lesser extent, and an adenosine analog (NECA) did not. As expected, in whole cell recordings made in the absence of inhibitory concentrations of ATP, somatostatin did activate a sulfonylurea-sensitive K current in the nontransfected TC3 cells.()The activation of GIRK1-cp currents by norepinephrine was pertussis toxin-sensitive (Fig. 5, columnf), confirming the requirement for G-protein activation. The current activated by norepinephrine was mediated by specific stimulation of the adrenergic receptor, since the activation was reversibly blocked by the addition of 1 µM yohimbine (Fig. 6).


Figure 4: Norepinephrine-induced whole cell current recorded from a single TC3-GIRK1-cp transfected cell. A, the cell was held at 0 mV, and the displayed currents were evoked by voltage steps of 200 ms, which ranged from -120 mV to +80 mV, as shown in panelC. B, whole cell currents from the same cell after application of 30 µM norepinephrine. Currents were recorded after 30 s from the beginning of norepinephrine application (after the initial peak norepinephrine effect on the channel, activation became steady state; not shown). D, computer subtraction of the record traces in A from those in B. The evoked current (200 ms) consisted of 400 data points. E, Current versus Voltage (I versus E) plot of evoked currents. The last 30 data points of each current trace were averaged, and the averaged values were plotted. The internal pipette solution contained (in mM): 128 KCl, 20 HEPES, 1 MgCl, 0.1 CaCl, 1.1 EGTA, 2 MgATP, 0.3 GTP, pH 7.3 (with KOH, about 14 mM). The external solution contained (in mM): 140 KCl, 10 HEPES, 10 D-glucose, 2 CaCl, 1 MgCl, pH 7.4 (with KOH, about 5 mM). The osmolality was adjusted with sucrose to that of the culture media (310-317 mosm) and similarly the intracellular solution was set to 300 mosm.




Figure 5: The K current induced by the application of various agonists in control and TC3-GIRK1-cp-expressing cells. The bar graphs show the current amplitudes in whole cell recordings obtained from GIRK1-cp-expressing TC3 cells under the same protocol as in Fig. 4. Column a, currents recorded from control cells expressing the resistance gene (neo) but not GIRK1-cp in the presence of norepinephrine (30 µM, n = 6); columnsb-f, GIRK1-cp-expressing TC3 cells with norepinephrine (30 µM; n = 48) (column b) with galanin (100 nM; n = 19) (column c), or with somatostatin analog ([D-Trp8]somatostatin (300 nM; n = 8) (column d). Columne, lack of effect of NECA (300 nM; n = 9), an adenosine agonist; columnf, after overnight pertussis toxin treatment (200 ng/ml) and stimulation with norepinephrine (30 µM; n = 12).




Figure 6: The current induced by norepinephrine (L-NE) was antagonized by the -receptor antagonist, yohimbine. The response to norepinephrine in 140 mM K+ solution produced by 200-ms hyperpolarizing steps to -120 mV from V-h = 0 mV. Voltage steps were evoked at 10-s intervals. Currents were measured by the end of the voltage steps by averaging the last 30 data points and plotted. The graph shows the averaged steady state current as a function of time. Shown on the right are superimposed individual current traces before and during the application of drugs at the indicated time periods.



Channel activity was also assayed in cell-attached as well as excised patches of membranes, using standard single channel recording methods (24). In these experiments we compared the GIRK1-cp-induced single channel currents with that produced by the cardiac I channel. We could not find I-like activity in membranes of HEK293 cells stably transfected with GIRK1-cp immunopositive for the C-peptide tag (no channels observed in a total of 51 patches). The observation of other types of channels in these membranes, including those identifiable as ATP-activated or I potassium channels, tends to rule out technical problems such as ``sealing over'' of excised patches. Other maneuvers, such as the application of GTPS (9 patches), brain derived G protein subunits (10 patches), or trypsin treatment (16 patches) were without effect, although they have been reported to lead to channel activation(9, 10, 13, 31) . It would appear, therefore, that despite the observation of the GIRK1-cp protein expression by both immunohistochemical and immunoblot assays, currents carried by the channel could not be demonstrated in the HEK293 cells.

In contrast, the TC3-GIRK1-cp transfected line resulted in the appearance of significant I-like channel activity (15 patches in 118, or 13%). These patches were pulled from a cell line in which the percentage of immunopositive cells decreased from greater than 90% to only about 15% positive over a period of several months. Note that I-like channels could not be detected in control TC3 cells (0 out of 22 patches). Representative traces of single channel currents as a function of time are shown in Fig. 7. There was minimal activity in patches pulled from a TC3-GIRK1-cp cell directly into bath solution (uppertrace). An increase in activity in the same patch after application of 50 µM GTPS is shown in the middletrace (Fig. 7). The lowertrace shows currents activated in a different TC3-GIRK1-cp cell patch in the presence of 50 µM norepinephrine in the pipette and 1 mM GTP on the cytoplasmic side. It was thus evident that the TC3 cells transfected with GIRK1-cp and expressing the immunoreactive protein also had appropriate currents identifiable at the single channel level.


Figure 7: Single channel characteristics of GIRK1-cp in patches excised from TC3 cells expressing GIRK1-cp. Uppertrace shows the activity in a patch of membrane from a TC3 cell transfected with GIRK1-cp that had been excised into bath solution supplemented with 500 µM ATP and 100 µM GDP. Each trace is 12 s long. The middletrace illustrates the channel activity in the same patch in response to the addition of 50 µM GTPS to the bath solution. The bottomtrace is from a different experiment showing channel openings in a patch excised from a GIRK1-cp transfected cell, in the presence of 50 µM norepinephrine in the pipette solution (and 1 mM GTP and 500 µM ATP in the bath solution). Cells were bathed in, and patches excised into, bath solution, which contained (in mM): 140 KCl, 5 HEPES, 5 EGTA, 6 MgCl, pH 7.4 (with KOH, about 16 mM). The pipette solution consisted of 140 KCl, 5 CaCl, 20 HEPES, pH 7.4 (with KOH, about 5 mM).



The identity of the channels induced in the TC3-GIRK1-cp cells by GIRK1-cp was ascertained by examining single channel current voltage (I-V) relationships and single channel lifetimes. The I-V curve determined from our measurements of GIRK1-cp-induced channel activity in TC3 cells (data points) is compared in Fig. 8with that observed for I in bullfrog atrial myocytes (solidline). Both channels show essentially the same inward rectification. Single channel conductances were calculated from the slope of the linear part of the I-V curves. For the GIRK1-induced channels we find a conductance of 39.07 ± 1.03 pS, a value not significantly different from I in bullfrog atria, 38.92 ± 1.77 pS(32, 33) . Note that other K channels have characteristically different conductances, for example approximately 90 pS for the ATP-sensitive K channel or 31.7 ± 1.7 pS for I in guinea pig atria. A representative open time histogram for these channels in the TC3-GIRK1-cp cells is shown in Fig. 9. The histogram was fit with one exponential, yielding a mean open time of 2.69 ± 0.32 ms, similar to that measured for I channels in bullfrog atrial myocytes under comparable conditions, 2.25 ± 0.56 ms.()These considerations lead us to conclude that at the single channel level the GIRK1-cp-induced channels are indistinguishable from I.


Figure 8: Current voltage relationship of a group of experiments of the type shown in the second trace in Fig. 7. The solidline shows the single channel IV curve of the I channel activated in frog atrial myocytes by carbamylcholine. The similarity suggests that the channel expressed in TC3 cells has the same properties as I. The linear portion of the data gave a slope conductance of 39.1 ± 1.0 pS (n = 10).




Figure 9: Representative open time histogram of the GIRK1-cp channels in transfected TC3 cells. The open time distribution was fit with a single exponential yielding a mean open time of 3.80 ms for this particular patch. An average mean open time of 2.69 ± 0.32 ms was obtained from 10 different excised patches.




DISCUSSION

The cloning of a new family of cDNAs encoding G protein-linked K channels has facilitated the demonstration that these channels are expressed in specific cardiac, neuronal, and neuroendocrine cells and can couple to numerous receptors(12, 13, 14, 15, 16) . Until recently these channels have been functionally studied only in the Xenopus oocyte expression system, an extremely useful but limited approach to the study of ion channel-receptor interactions.

We have employed a 31-amino acid epitope tag to follow expression of the GIRK1-cp channel for the first time in transfected mammalian cells. The tag made no detectable difference in the functional characteristics of the channel, which, when co-expressed in Xenopus oocytes with either the M2 muscarinic or the -opioid receptor, could be activated normally by the appropriate agonist. Expression of the polypeptides produced by transient and stable cell lines was compared in immunoblots employing anti-tag antisera. These studies revealed the presence of several GIRK1-cp immunoreactive polypeptides, largely due to differential or incomplete glycosylation. This result suggests that the amino acid sequence NYTP beginning at residue 136 allows Asn, the only putative site for N-glycosylation in the GIRK1 sequence, to be at least partially glycosylated. Glycosylation occurs despite the presence of a C-terminal proline on the motif that has been observed to inhibit glycosylation in some proteins(34) . According to the deduced orientation of GIRK1 membrane-spanning domains, Asn does indeed fall in the extracellular loop(13) .

There was a striking difference in functional GIRK1 channel expression between the HEK293 cells and the TC3 insulinoma cells. These cell types were compared after our initial inability to demonstrate appropriate currents in Chinese hamster ovary fibroblast cells transfected with the native GIRK1 cDNA. HEK293 cells have been useful for the study of ion channel expression due to their low background of most kinds of ion channels. While both the HEK293 cells and the TC3 cells transfected with GIRK1-cp produced GIRK1-cp polypeptides, only the TC3-GIRK1-cp cells also produced currents that were consistent with an inwardly rectifying G protein-linked channel. These currents were activated by GTPS and, to different extents, by stimulation of specific endogenous G-protein-linked receptors. Characteristics of the TC3-GIRK1-cp currents at the single channel level were similar to those of cardiac atrial current I and were clearly distinguished from endogenous currents in TC3 cells.

One possibility to explain the difference in channel function in transfected cells is a restricted expression of appropriate G protein isoforms among the many that have been described(3) . Several studies have identified specific subunits involved in signal transduction pathways with particular receptors (e.g. Ref. 35). The adrenergic receptor was shown to interact with three G subunits (1, 2, 3) as well as G(36) , while galanin has also been shown to activate G subunits one, two, and three in RINm5f cells(37) . The somatostatin receptor SSTR2 was shown to selectively associate with G3 and G(38) . HEK293 cells endogenously express low levels of the SSTR2 somatostatin receptor and similar levels of G1 and G3 immunoreactivity but do not express G(38) . TC3 cells have also been shown to express the G proteins G, G, and G, by immunoblot(39) . Therefore, the two cell types employed here were likely to express the appropriate G protein subunits enabling them to couple to the receptors we tested. However, lack of expression may also be due to specific interactions between the subunits and the effector(7) .

Specific subunits and combinations have been found to have unique functions(8, 40, 41) . In rat pituitary GH3 cells, voltage-sensitive calcium channels were found to be coupled to the somatostatin receptor by the subtype and to the muscarinic receptor by the subtype(42) . However, we found that neither GTPS nor (mixed brain) could activate the GIRK1-cp channels expressed in the HEK293 cells. Even if the favored combination of G protein subunits for GIRK1 was not present in HEK293 cells, the addition of brain should have activated the channel. Also, we and others have shown that activation of native G protein-coupled inward rectifier channels has little specificity, so that the type of used is not likely to be the cause of the lack of channel function(10, 31) .

The difference in expression between the two cell lines may also be due to differential expression of an essential component for channel function. The possibility that additional subunits are required to produce GIRK1 currents has also been addressed recently by Krapivinsky et al.(43) . They concluded that another inward rectifier-like protein, CIR, forms a complex with GIRK1 protein in native atrial myocyte membranes, in co-transfected Chinese hamster ovary cells, and in the baculovirus expression system, and that both are required subunits of I.

Endogenous receptors and G proteins were evaluated for coupling to the GIRK1 channels in the TC3-GIRK1-cp-expressing cells. Receptor interactions were studied under conditions that are known to block opening of ATP-sensitive K channels that are present in these cells. The adrenergic receptor activation by norepinephrine was specific for the receptor, as shown by the reversible block with yohimbine and was abolished by pertussis toxin treatment. Galanin also activated the inward currents well, but somatostatin receptors did not couple nearly as well, suggesting a segregation of the G protein-receptor complex to specific effectors. The somatostatin receptor pathway has also been found to be distinct from norepinephrine and leu-enkaphalin-induced inhibition of the -conotoxin sensitive calcium channels in NG108-15 cells(44) . The latter two receptors were able to couple to a pertussis toxin-insensitive mutant of G, but the somatostatin receptor did not(44) .

In conclusion, we have for the first time functionally expressed an epitope-tagged GIRK1 channel in a stably transfected mammalian cell line. Extension of the protein by the 31-amino acid tag allowed the demonstration that modification of the carboxyl terminus did not impair channel assembly or G protein interactions. Expression of GIRK1 or GIRK1-cp in various cell lines revealed significant differences in the function of the channel protein, suggesting the presence of unidentified components of a regulatory or transport mechanism. The epitope-tagged channel in TC3 cells is ideally suited for further biochemical and biophysical analyses of these as yet unidentified elements of G protein-coupled K channel regulation.


FOOTNOTES

*
Funding was provided by the Marilyn M. Simpson Charitable Trust (to L. H. P.), National Institutes of Health Grants PO1 DK44840 (to L. H. P.), HL 37127 (to G. S.), and US PHS DA-02575, DA-02121, and MH-40165 (to R. J. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Medicine, University of Chicago, 5841 S. Maryland Ave., Chicago, IL 60637. Tel.: 312-702-9180; Fax: 312-702-9194; E-mail: l-philipson@uchicago.edu.

The abbreviations used are: GTPS, guanosine 5`-O-(thiotriphosphate); PBS, phosphate-buffered saline; NECA, 5`-N-ethylcarboxamidoadenosine; pS, picosiemens; C-peptide, C-peptide of proinsulin; GIRK1-cp, GIRK1 cDNA with C-peptide proinsulin tag; BSA, bovine serum albumin.

K. Hurley, L. H. Philipson, A. Kuznetsov, and D. J. Nelson, submitted for publication.

K. Hurley, L. H. Philipson, and D. J. Nelson, unpublished observations.

J. Murphy and G. Szabo, unpublished observations.


ACKNOWLEDGEMENTS

Rabbit anti-insulin C-peptide antisera were a generous gift of K. S. Polonsky. Opioid receptor cDNAs were kindly provided by G. I. Bell. TC3 cells were a gift of S. Efrat. We thank I. D. Dukes for a critical reading of the manuscript.


REFERENCES
  1. Breitwieser, G. E., and Szabo, G.(1985) Nature317, 538-540 [CrossRef][Medline] [Order article via Infotrieve]
  2. Brown, A. M., and Birnbaumer, L.(1990) Annu. Rev. Physiol.52, 197-213 [CrossRef][Medline] [Order article via Infotrieve]
  3. Hepler, J. R., and Gilman, A. G.(1992) Trends Biochem. Sci.17, 383-387 [CrossRef][Medline] [Order article via Infotrieve]
  4. Lewis, D. L., Lechleiter, J. D., Kim, D., Nanavati, C., and Clapham, D. E.(1990) Mayo Clin. Proc.65, 1127-1143 [Medline] [Order article via Infotrieve]
  5. Brown, A. M., Yatani, A., Kirsch, G., Okabe, K., VanDongen, A. M., and Birnbaumer, L.(1991) J. Bioenerg. Biomem.23, 499-507 [CrossRef][Medline] [Order article via Infotrieve]
  6. Chang, W. J., Ying, Y. S., Rothberg, K. G., Hooper, N. M., Turner, A. J., Gambliel, H. A., De, G. J., Mumby, S. M., Gilman, A. G., and Anderson, R. G.(1994) J. Cell Biol.126, 127-138 [Abstract/Free Full Text]
  7. Neubig, R. R.(1994) FASEB J.8, 939-946 [Abstract]
  8. Kleuss, C., Scherubl, H., Hescheler, J., Schultz, G., and Wittig, B. (1992) Nature358, 424-426 [CrossRef][Medline] [Order article via Infotrieve]
  9. Clapham, D. E., and Neer, E. J.(1993) Nature365, 403-406 [CrossRef][Medline] [Order article via Infotrieve]
  10. Wickman, K. D., Iniguez-Lluhi, J. A., Davenport, P. A., Taussig, R., Krapivinsky, G. B., Linder, M. E., Gilman, A. G., and Clapham, D. E.(1994) Nature368, 255-257 [CrossRef][Medline] [Order article via Infotrieve]
  11. Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Iniguez-Lluhi, J., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y.(1994) Nature370, 143-146 [CrossRef][Medline] [Order article via Infotrieve]
  12. Dascal, N., Schreibmayer, W., Lim, N. F., Wang, W., Chavkin, C., DiMagno, L., Labarca, C., Kieffer, B. L., Gaveriaux, R. C., Trollinger, D., Lester, H. A., and Davidson, N.(1993) Proc. Natl. Acad. Sci. U. S. A.90, 10235-10239 [Abstract/Free Full Text]
  13. Kubo, Y., Reuveny, E., Slesinger, P. A., Jan, Y. N., and Jan, L. Y. (1993) Nature364, 802-806 [CrossRef][Medline] [Order article via Infotrieve]
  14. Stoffel, M., Espinosa, R. I., Powell, K. L., Philipson, L. H., LeBeau, M. M., and Bell, G. I.(1994) Genomics21, 254-256 [CrossRef][Medline] [Order article via Infotrieve]
  15. Lesage, F., Duprat, F., Fink, M., Guillemare, E., Coppola, T., Lazdunski, M., and Hugnot, J. P.(1994) FEBS Lett.353, 37-42 [CrossRef][Medline] [Order article via Infotrieve]
  16. Chen, Y., and Yu, L.(1994) J. Biol. Chem.269, 7839-7842 [Abstract/Free Full Text]
  17. Yon, J., and Fried, M.(1989) Nuc. Acids Res.17, 4895 [Free Full Text]
  18. Andersson, S., Davis, D. L., Dahlback, H., Jornvall, H., and Russell, D. W.(1989) J. Biol. Chem.264, 8222-8229 [Abstract/Free Full Text]
  19. Philipson, L., Hice, R. E., Schaefer, K., LaMendola, J., Bell, G. I., Nelson, D. J., and Steiner, D. F.(1991) Proc. Natl. Acad. Sci. U. S. A.88, 53-57 [Abstract/Free Full Text]
  20. Efrat, S., Linde, S., Kofod, H., Spector, D., Delannoy, M., Grant, S., Hanahan, D., and Baekkesksov, S.(1988) Proc. Natl. Acad. Sci. U. S. A.85, 9037-9041 [Abstract/Free Full Text]
  21. Philipson, L. H., Rosenberg, M. P., Kuznetsov, A., Lancaster, M. E., Worley, J. F., III, Roe, M. W., and Dukes, I. D.(1994) J. Biol. Chem.269, 27787-27790 [Abstract/Free Full Text]
  22. Madsen, O. D., Cohen, R. M., Fitch, F. W., and Steiner, D. F. (1985) Endocrinology113, 2135-2144 [Abstract/Free Full Text]
  23. Laemmli, U. K.(1970) Nature227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  24. Hamill, O. P., Marty, A., Neher, E., and Sakmann, B.(1981) Pflügers Arch. Eur. J. Physiol.391, 85-100
  25. Philipson, L. H., Malayev, A., Kuznetsov, A., Chang, C., and Nelson, D. J.(1993) Biochim. Biophys. Acta1153, 111-121 [Medline] [Order article via Infotrieve]
  26. D'Ambra, R., Surana, M., Efrat, S., Starr, R. G., and Fleischer, N. (1990) Endocrinology126, 2815-2822 [Abstract/Free Full Text]
  27. Ashcroft, S. J. H., and Ashcroft, F. M.(1990) Cell. Signalling2, 197-214 [CrossRef][Medline] [Order article via Infotrieve]
  28. Kubo, Y., Baldwin, T. J., Jan, Y. N., and Jan, L. Y.(1993) Nature362, 127-133 [CrossRef][Medline] [Order article via Infotrieve]
  29. Dunne, M. J., Bullet, M. J., Li, G., Wollheim, C. B., and Peterson, C. B.(1989) EMBO J.8, 412-420
  30. de Weille, J. R., Schmid-Antomarchi, H., Fosset, M., and Lazdunski, M. (1989) Proc. Natl. Acad. Sci. U. S. A.86, 2971-2975 [Abstract/Free Full Text]
  31. Murphy, J. F., Graber, S. G., Garrison, J. C., and Szabo, G.(1993) FASEB J.7, A1138
  32. Nakayama, K., Fan, Z., Marumo, F., Sawanobori, T., and Hiraoka, M. (1991) Br. J. Pharm.103, 1641-1648 [Medline] [Order article via Infotrieve]
  33. Matsuda, H.(1991) J. Gen. Physiol.435, 83-99
  34. Gavel, Y., and Von, H. G.(1990) Protein Eng.3, 433-442 [Abstract/Free Full Text]
  35. Taussig, R., Iniguez-Lluhi, J., and Gilman, A. G.(1993) Science261, 218-221 [Abstract/Free Full Text]
  36. Okuma, Y., and Reisine, T.(1992) J. Biol. Chem.267, 14826-14831 [Abstract/Free Full Text]
  37. Gillison, S. L., and Sharp, G. W.(1994) Diabetes43, 24-32 [Abstract]
  38. Law, S. F., Yasuda, K., Bell, G. I., and Reisine, T.(1993) J. Biol. Chem.268, 10721-10727 [Abstract/Free Full Text]
  39. Baffy, G., Yang, L., Wolf, B. A., and Williamson, J. R.(1993) Diabetes42, 1878-1882 [Abstract]
  40. Kontani, K., Takahashi, K., Inanobe, A., Ui, M., and Katada, T.(1992) Arch. Biochem. Biophys.294, 527-533 [CrossRef][Medline] [Order article via Infotrieve]
  41. Ueda, N., Iniguez-Lluhi, J., Lee, E., Smrcka, A. V., Robishaw, J. D., and Gilman, A. G.(1994) J. Biol. Chem.269, 4388-4395 [Abstract/Free Full Text]
  42. Kleuss, C., Scherubl, H., Hescheler, J., Schultz, G., and Wittig, B. (1993) Science259, 832-834 [Abstract/Free Full Text]
  43. Krapivinsky, G., Gordon, E. A., Wickman, K., Velimirovic, B., Krapivinsky, L., and Clapham, D. E.(1995) Nature374, 135-141 [CrossRef][Medline] [Order article via Infotrieve]
  44. Taussig, R., Sanchez, S., Rifo, M., Gilman, A. G., and Belardetti, F. (1992) Neuron8, 799-809 [CrossRef][Medline] [Order article via Infotrieve]
  45. Ma, G. H., Miller, R. J., Kuznetsov, A., and Philipson, L. H.(1995) Mol. Pharmacol., in press

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Zhao, Q. Fang, S. G. Straub, and G. W. G. Sharp
Both Gi and Go Heterotrimeric G Proteins Are Required to Exert the Full Effect of Norepinephrine on the {beta}-Cell KATP Channel
J. Biol. Chem., February 29, 2008; 283(9): 5306 - 5316.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Sarac, P. Hou, K. M. Hurley, D. Hriciste, N. A. Cohen, and D. J. Nelson
Mutation of Critical GIRK Subunit Residues Disrupts N- and C-Termini Association and Channel Function
J. Neurosci., February 16, 2005; 25(7): 1836 - 1846.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Shankar, S. Murugappan, S. Kim, J. Jin, Z. Ding, K. Wickman, and S. P. Kunapuli
Role of G protein-gated inwardly rectifying potassium channels in P2Y12 receptor-mediated platelet functional responses
Blood, September 1, 2004; 104(5): 1335 - 1343.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. Yamada, A. Inanobe, and Y. Kurachi
G Protein Regulation of Potassium Ion Channels
Pharmacol. Rev., December 1, 1998; 50(4): 723 - 757.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. U. Ehrengruber, C. A. Doupnik, Y. Xu, J. Garvey, M. C. Jasek, H. A. Lester, and N. Davidson
Activation of heteromeric G protein-gated inward rectifier K+ channels overexpressed by adenovirus gene transfer inhibits the excitability of hippocampal neurons
PNAS, June 24, 1997; 94(13): 7070 - 7075.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Xu, J. Murphy, and A. d. S. Otero
Participation of Nucleoside-diphosphate Kinase in Muscarinic K+ Channel Activation Does Not Involve GTP Formation
J. Biol. Chem., August 30, 1996; 271(35): 21120 - 21125.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Philipson, L. H.
Right arrow Articles by Miller, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Philipson, L. H.
Right arrow Articles by Miller, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement