|
Volume 270,
Number 24,
Issue of June 16, pp. 14604-14610, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional
Expression of an Epitope-tagged G protein-coupled K Channel (GIRK1) (*)
Louis H.
Philipson
(1)(§),
Andrey
Kuznetsov
(1),
Peter
T.
Toth
(2),
Joseph F.
Murphy
(3),
Gabor
Szabo
(3),
Gloria
H.
Ma
(2),
Richard J.
Miller
(2) From the
(1)Departments of Medicine and
(2)Pharmacology and Physiology, The University of
Chicago, Chicago, Illinois 60637 and the
(3)Department of Molecular Physiology and Biological
Physics, University of Virginia, Charlottesville, Virginia 22908
ABSTRACT
INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
An epitope-tagged form of an inwardly rectifying and G
protein-coupled K channel (GIRK1-cp) was expressed at
high levels in transfected mammalian cells. Immunoblot analysis of
transfected human embryonic kidney cells (HEK293) and mouse insulinoma
cells ( TC3) revealed several GIRK1-cp polypeptides, including the
major 59-kDa band, corresponding to the predicted mass of the GIRK1
polypeptide plus the epitope tag. Immunohistochemical staining using
two anti-tag antibodies showed abundant immunoreactive material, which
was predominantly concentrated in the perinuclear area in both
transfected cell types. While functional GIRK1-cp message was present
in poly(A)+ RNA prepared from HEK293 cells expressing GIRK1-cp
protein, appropriate K currents could not be detected.
In contrast, whole cell recordings made directly from transfected
TC3 cells expressing GIRK1-cp revealed inwardly rectifying,
pertussis toxin-sensitive currents activated by norepinephrine and
galanin. Single channel recordings in excised patches of TC3 cells
expressing GIRK1-cp showed rectifying K currents when
activated by 50 µM guanosine
5`-O-(thiotriphosphate), with a slope conductance of 39.1
± 1.0 picosiemens. This is the first report of stable
heterologous expression of a functional G protein-coupled K channel in mammalian cells. The activity of an epitope-tagged
channel in insulinoma cells demonstrates the utility of this system for
further biochemical and biophysical analyses of G protein-K channel interactions.
INTRODUCTION
K channels are important effectors for signal
transduction mediated by heterotrimeric guanine nucleotide-binding
proteins (G proteins)(1, 2, 3) . These channels
are found in a wide variety of cell types, where they play essential
roles in the maintenance of the resting membrane potential, in the
coupling of metabolism to cell excitability, and in shaping the action
potential of excitable cells(4, 5) . G protein-coupled
receptors probably bind to a membrane-bound effector complex, which
includes the and  subunits of G proteins in addition to
the effector channel(6, 7) . The and
subunits, each a group of related proteins, possess some effector
specificity and activate the channel
directly(8, 9, 10, 11) .
Several
related G protein-coupled K channel cDNAs have
recently been cloned from rat heart (GIRK1 or KGA), rat insulinoma, and
mouse brain(12, 13, 14, 15) . The human
GIRK1 gene (KCNJ3) has been localized to chromosome
2q24.1(14) . Expression of GIRK1 cDNA in Xenopus oocytes has facilitated the observation that GIRK1 is activated by
GTP S, ( )and by the appropriate agonist when
co-expressed with various seven-transmembrane receptors such as the
M muscarinic receptor, the µ-, -, and -opioid
receptors, and the serotonin (5-HT) 1A
receptor(12, 13, 16, 45) . An important
goal, however, remains: to express the functional GIRK1 channel in a
stable mammalian cell line, a much more convenient and homologous
system for biochemical and biophysical analyses of
G-protein-K channel interactions.
The present
study, describing the expression of the identical epitope-tagged GIRK1
channel in transfected human embryonic kidney (HEK293) and
neuroendocrine ( TC3 insulinoma) cells, revealed an interesting
difference in the two different cell lines. Expression of the
polypeptide produced by transient and stable transfection of cell lines
was compared to that produced by injection of cRNA into Xenopus oocytes. While both the HEK293 cells and the TC3 cells
transfected with GIRK1-cp produced GIRK1-cp polypeptides, only in the
TC3-GIRK1-cp cells were appropriate currents consistently
observed. These currents were activated by GTP S and were
differentially activated by stimulation of specific endogenous G
protein-linked receptors. The characteristics of the GIRK1 currents at
the single channel level were consistent with those of cardiac atrial
current I . These results show that GIRK1-cp was
differentially expressed in these cell lines, suggesting that another
component or subunit(s) are necessary for GIRK1 channel expression. The
BTC3-GIRK1-cp cell line will be a useful system in which to further
characterize G protein signal transduction via receptor-activated
K channels.
MATERIALS AND METHODS
GIRK1 cDNA
was isolated from a rat insulinoma (RIN cell) cDNA library(14) .
A three-primer variation of the polymerase chain reaction was employed
to add the human proinsulin C-peptide coding sequences to the 3`-end of
the GIRK1 coding region(17) . In a single 100-µl reaction, a
GIRK1-containing plasmid (pGEM3z-GIRK1) was combined with pHINS, a
plasmid containing the human proinsulin cDNA, together with a forward
primer (100 pmol), a reverse primer (100 pmol) and a bridge primer (10
pmol). The 5`-oligonucleotide primer (CTGTGGCCGATTTGCCACCG) was
designed to overlap the HindIII site at base pair 1417 of
GIRK1 (counting the ATG start site). The 3`-primer
(TTCCACAAGCTTACGCTACTGCAGGGACC) included 17 base pairs of the 3`-end of
the C-peptide, a stop codon, and a HindIII site. The bridging
primer (caggtcctctgcctcCGATGTGAAGCGGTC) included the 5`-end of the
C-peptide (lowercase) and the 3`-end of the GIRK1 (uppercase), with a
mutation changing the TAG (stop) to TCG (Ser). The reaction was
amplified for 30 cycles at 94 °C for 1 min, 50 °C for 30 s, and
72 °C for 30 s. The 225-base pair product was purified, subcloned
into the pCRII vector (Invitrogen), sequenced completely on both
strands (Sequenase, USB), excised with HindIII, and ligated
into the HindIII site (base pair 1417 of coding region) of
GIRK1 previously subcloned into pCMV5(18) . The GIRK1-cp cDNA
(1.7 kilobases) was excised and ligated into pBSKSII (Stratagene).
pGEM3z-GIRK1 was linearized with NdeI, and the
cRNA was run off with SP6 RNA polymerase;
pBSKSII -GIRK1-cp was linearized with XbaI,
and the cRNA was run off with T3 RNA polymerase. -opioid receptor
cRNA preparation, Xenopus oocytes injection, recording
techniques, and buffers were essentially as
described(19, 45) .
HEK293 cells (American Type Culture Collection) maintained
in Dulbecco's modified Eagle's medium (4.5 g/liter glucose
with 5% supplemented bovine calf serum (Hyclone Laboratories, Inc.)
were transfected by a calcium phosphate method (Transfection MBS
mammalian transfection kit, Stratagene). TC3 cells were maintained
as described and were transfected by
electroporation(20, 21) . For selection of stable
clones, cells co-transfected with pCMV5-GIRK1-cp and pSV2-neo were
maintained in media supplemented with 0.4 mg/ml G418 (Life
Technologies, Inc.) for HEK293 cells and 1.0 mg/ml for TC3 cells.
Fifteen HEK293 and eight TC3 clones positive by immunostaining and
Western blot were isolated and propagated; control clones were negative
in both assays. TC3-GIRK1-cp-#4 and HEK293-GIRK1-cp-#21 were
selected for further studies.
Both
cell types (HEK293 cells grown on poly-L-lysine (Sigma) coated
plates) were fixed with 3% formaldehyde freshly prepared from
paraformaldehyde (Aldrich) in phosphate-buffered saline (PBS, pH 7.4,
20 min, 37 °C), washed with PBS, then permeabilized with 0.1%
Triton X-100 in PBS (5 min, 22 °C). After additional PBS washes,
the cells were blocked with 2% bovine serum albumin in PBS (2% BSA) for
1 h at room temperature. HEK293 cells were treated initially with
rabbit anti-human-C-peptide antisera (1:2000 to 1:5000 dilutions in 2%
BSA), and TC3 cells (and in some experiments, the HEK293 cells)
were first treated with rat monoclonal anti-human-C-peptide antibody,
diluted 1:10 to 1:100, at 4 °C overnight (Id4)(22) . After
additional washing steps, the second antibody was applied: either goat
anti-rat IgG F(ab`) conjugated with horseradish peroxidase
(1 h, 22 °C at 2 µg/ml, Jackson Immunoresearch Laboratories,
Inc.), or goat biotinylated anti-rabbit IgG (10 µg/ml, Vector
Laboratories, Inc.), as appropriate. The former complex was visualized
with hydrogen peroxide and diaminobenzidene, and the latter complex was
treated with avidin-biotinylated horseradish peroxidase complex (ABC
kit, Vector Laboratories, Inc.) and similarly visualized.
Cells were rinsed, collected
in ice-cold homogenization buffer (0.25 M sucrose, 0.01 M HEPES, pH 7.4, containing 2 mM phenylmethylsulfonyl
fluoride, 1 µM leupeptin, and 10 µM
pepstatin), and then briefly homogenized (Potter homogenizer). The
supernatant after low speed centrifugation (1000 g, 15
min) was collected, and the total membrane fraction pellet was obtained
after centrifugation at 350,000 g (1 h, 4 °C). The
resuspended pellet (10 mg/ml of protein in homogenization buffer) was
divided into aliquots and stored at -80 °C. Total cell
homogenates were obtained by direct lysis in SDS electrophoresis sample
buffer (10 mM Tris HCl, pH 6.8, 2% SDS, 100 mM dithiothreitol, 10% glycerol) and analyzed by electrophoresis in
7.5% discontinuous polyacrylamide SDS gels(23) . Proteins were
transferred to membranes (Immobilon P, Millipore Corp.), blocked with
5% dry milk, 0.1% Tween-20 in PBS for 3 h and incubated with anti-human
C-peptide monoclonal antibody (4 °C, 18 h), washed, and incubated
with goat anti-rat IgG F(ab`) horseradish
peroxidase-conjugated second antibody (1:2000 dilution) (2 h, room
temperature). In some experiments the rabbit anti-human-C-peptide
antisera were employed with the appropriate second antibody. After
further washing, the membrane was bathed in a chemiluminescence reagent
(ECL detection reagent, Amersham Corp.) and briefly exposed (1 s to 30
min) to Kodak X-omat film. C-Labeled marker proteins
(Rainbow protein markers, Amersham Corp.) were visualized by additional
24-h exposure.
Some samples were digested with N-glycanase
(Genzyme) or calf intestinal alkaline phosphatase (NEB) before the
addition of SDS sample buffer. For N-glycanase digestion, cell
lysates were incubated in 50 mM Tris-HCl, pH 7.6, 0.17% SDS,
1.25% Nonidet P-40, 10 mM -mercaptoethanol, and 10
units/ml N-glycanase (24 h, 37 °C). For alkaline
phosphatase digestions, lysates were incubated in 50 mM Tris-HCl, pH 7.6, 0.17% SDS, 10 µM -mercaptoethanol, and 100 units/ml calf intestinal
phosphatase, with or without 100 mM NaF.
Cells were dispersed using 1
mM EDTA and 0.7 mg/ml trypsin (Type III, bovine pancreas,
Sigma) solution (1.5 min) and then replated on poly-L-lysine
(Sigma) treated glass coverslips overnight. Membrane currents were
recorded in the whole cell configuration using the Axopatch-1D voltage
clamp amplifier. Patch pipettes (2.5-5 megaohms) were pulled from
soft soda-lime capillary tubes and sylgard-coated (Dow Corning).
Capacitative transients were canceled at 10 kHz, and their values were
obtained directly, together with the series resistance values from the
settings of the amplifier. Series resistance was routinely compensated
by about 80%. Pulse generation, recordings, and data analysis were
carried out using a custom modified C-CLAMP program for IBM-PC
compatible computers (Indec, Sunnyvale, CA). Recordings were conducted
at 22-25 °C using 200-ms voltage command pulses at 10-s
intervals, filtered at 1 or 2 KHz, perfusion rate 2 ml/min.
Specific
reagents were obtained as follows: pertussis toxin (RBI, Natick, MA),
galanin (RBI, amino acids 1-16, porcine),
5`-N-ethylcarboxamidoadenosine (NECA, RBI), L-(-)-norepinephrine bitartrate (RBI),
[D-Trp ]somatostatin (Bachem), and
yohimbine hydrochloride (Sigma).
Experiments were
performed utilizing both the inside-out excised patch, and the
cell-attached mode of the patch clamp technique(24) . Cells were
dispersed from culture flasks in 0.05% trypsin, 0.53 mM EDTA
solution (5 min) and stored with serum for same day use. The glass
bottom of the recording chamber (200 µl volume) was treated with
poly-L-lysine (Sigma; 0.020 mg/ml, 10 min). Patch pipettes
were pulled from quartz capillaries (1 mm outer diameter, 0.5 mm inner
diameter) using a laser puller (Sutter Instrument Co., Model P-2000) to
a resistance of 7-10 megaohms. Command potentials were applied,
and data were digitized using a microprocessor controlled analog I/O
board (DAP 800, Microstar Laboratories, sampling rate 2.8 KHz). Data,
obtained using an Axopatch 200A amplifier (Axon instruments), were
filtered at 1-2 KHz, recorded onto videotape (PCM-2 A/D VCR
Adaptor, Instrutech), and analyzed using a commercial program (Transit,
Baylor University).
RESULTS
Initial attempts to functionally express the native rat GIRK1
protein in Chinese hamster ovary cells yielded several stable cell
lines that produced the appropriately sized mRNA in Northern blots, but
no currents activated by GTP S were observed (data not shown). In
order to further study the expression of this protein in heterologous
expression systems we transferred a well characterized epitope tag we
had employed previously, the C-peptide of human proinsulin(25) ,
to the COOH terminus of GIRK1, and termed the chimeric protein
GIRK1-cp. When currents produced after microinjection of native GIRK1
cRNA or GIRK1-cp cRNA into Xenopus oocytes, co-injected with
-opioid receptor cRNA, were compared, no detectable difference
could be discerned upon activation with a specific agonist (Fig. 1, A and B). The currents obtained were
also indistinguishable following oocyte co-injection experiments with
GIRK1-cp and the M2 muscarinic receptor cRNAs. ( )These results suggested that elongation of the COOH
terminus of the GIRK1 channel by 31 amino acids did not interfere with
channel assembly or the opening of the channel by activated G protein
subunits.
Figure 1:
Expression of GIRK1-cp in Xenopus oocytes. Two-microelectrode voltage clamp recording of oocytes
co-injected with -opioid receptor cRNA and authentic GIRK1 cRNA (A), GIRK1-cp cRNA (B), or poly(A) RNA purified from HEK 293-GIRK1-cp cells (C). In each
case, the leftpanels show the currents obtained in
high K bath alone, and the rightpanels show the activation of inward currents after addition of the
-opioid receptor agonist U69593 (1 µM). The recording
protocol employed seven pulses from a holding potential of -60
mV, duration 500 ms, pulse interval 10 s, with steps to 50, 20,
-10, -40, -70, -100, and -130 mV.
-opioid receptor cRNA and GIRK1 or GIRK1-cp cRNA (50 nl) or
poly(A) RNA (50nl) were injected into each oocyte
(GIRK1 cRNA, 5 ng/cell; -opioid receptor cRNA, 50
ng/cell). Oocytes were then incubated at 18 °C for 3-7 days
before recording. The high K solution contained (in
mM) 50 KCl, 35 NaCl, 1 Na HPO , 1
CaCl , 1 MgCl , 5 HEPES (pH
7.6).
We then sought to examine the expression of the GIRK1-cp
protein in transfected mammalian cells. Expression in the HEK293 cells
was compared with that obtained in an insulinoma cell ( TC3), that
expresses a variety of ion channels and receptors(20) .
Transfected cell lines expressing GIRK1-cp were identified by positive
staining with two different anti-human-C-peptide antibodies, one
polyclonal and the other monoclonal. Both cell types yielded intensely
stained stable cell lines, with some cells showing particularly dense
staining of the perinuclear area (Fig. 2). Immunoblots of
homogenates prepared from these cells showed that multiple peptides
were visualized with the anti-tag antibody (Fig. 3). The two most
prominent bands corresponded to the predicted size of the GIRK1-cp
protein, 59 kDa, and a slightly larger protein of 62 kDa. Additional
bands of higher MW were also noted, primarily in the HEK293 cells (Fig. 3, A and B). The 62-kDa band was
completely eliminated by digestion with N-glycanase (Fig. 3C, lane4), but there was no
difference following treatment with alkaline phosphatase (lane2).
Figure 2:
Epitope-based detection of GIRK1-cp:
immunohistochemical staining of GIRK1-cp transfected cells. Shown are
photomicrographs of HEK293-GIRK1-cp (A) and TC3-GIRK1-cp
cells (B), stained with the Id4 Ab as detailed under
``Materials and Methods.'' Cytoplasmic staining with some
dense perinuclear patterns can be seen in panelA. A
culture of mixed positive and negative TC3 cells was chosen for panelB to illustrate the intense cytoplasmic
staining. No specific staining was observed in untransfected cells
(same scale for both figures; bar, 100
µm).
Figure 3:
Immunoblot detection of GIRK1-cp in
transfected cells. Cell homogenates were solubilized, separated by
SDS-polyacrylamide gel electrophoresis, and then analyzed in
immunoblots treated with anti-C-peptide antibody and visualized by a
chemiluminescent technique (see ``Materials and Methods'' for
experimental details). A, homogenates from a transfected
HEK-293-GIRK1-cp stable cell line. Lane1, homogenate
of approximately 2 10 cells; lane2, 8 10 cells. B,
homogenates from transiently transfected TC3-GIRK1-cp cells.
Similar amounts of homogenates were applied to lanes1 and 2 as in panelA. C, effect
of digestion of stable TC3-GIRK1-cp cell homogenates with N-glycanase and alkaline phosphatase. Equivalent amounts of
homogenate corresponding to approximately 2 10 cells were applied to each lane. Lane1,
untreated control; lane2, digestion with alkaline
phosphatase; lane3, digestion with alkaline
phosphatase in the presence of NaF; lane4, digestion
with N-glycanase, lane5, mock N-glycanase digestion without added
enzyme.
No specific currents induced by GIRK1-cp
expression could be detected in the immunopositive HEK293 transfected
cells, as will be further discussed below. However, poly(A) RNA prepared from these cells was found to direct the expression
of inwardly rectifying currents in Xenopus oocytes. The
poly(A) RNA was co-injected with -opioid receptor
cRNA, and after incubation the oocytes were stimulated by the opioid
agonist U69593 (Fig. 1C). These currents were
indistinguishable from those recorded after the injection of in
vitro transcribed GIRK1 or GIRK1-cp cRNA, also coinjected with
-opioid receptor cRNA. Therefore, the GIRK1-cp cDNA directed the
production of intact and functional message, but the protein that was
translated in the HEK293 cells did not produce functional channels in
the cell membrane.
In contrast, TC3-GIRK1-cp cells were found
to express an inwardly rectifying current not seen in controls, which
was then characterized by whole cell and single channel techniques.
These cells also express other K channels, such as the
mildly rectifying K-ATP channel, but the inclusion of 2 mM ATP
in the pipette, as used in all of the whole cell experiments described
here, is sufficient to block this channel(26, 27) .
Endogenous receptors were tested for their ability to activate GIRK1-cp
currents. Norepinephrine induced whole cell currents recorded from
single TC3-GIRK1-cp-expressing cells (Fig. 4), but not from
control cells. The subtracted currents shown in Fig. 4D are slowly inactivating and show strong inward rectification (panelE), consistent with the GIRK1 currents seen in Xenopus oocyte expression(12, 28) . Two additional hormones, galanin and somatostatin, that have been
shown to open nucleotide-sensitive K channels in
insulinoma cells, were tested for their ability to activate
GIRK1-cp(29, 30) . As shown in Fig. 5, galanin
activated the current almost as well as norepinephrine, a somatostatin
analog did so to a much lesser extent, and an adenosine analog (NECA)
did not. As expected, in whole cell recordings made in the absence of
inhibitory concentrations of ATP, somatostatin did activate a
sulfonylurea-sensitive K current in the nontransfected
TC3 cells. ( )The activation of GIRK1-cp
currents by norepinephrine was pertussis toxin-sensitive (Fig. 5, columnf), confirming the requirement for G-protein
activation. The current activated by norepinephrine was mediated by
specific stimulation of the  adrenergic receptor,
since the activation was reversibly blocked by the addition of 1
µM yohimbine (Fig. 6).
Figure 4:
Norepinephrine-induced whole cell current
recorded from a single TC3-GIRK1-cp transfected cell. A,
the cell was held at 0 mV, and the displayed currents were evoked by
voltage steps of 200 ms, which ranged from -120 mV to +80
mV, as shown in panelC. B, whole cell
currents from the same cell after application of 30 µM norepinephrine. Currents were recorded after 30 s from the
beginning of norepinephrine application (after the initial peak
norepinephrine effect on the channel, activation became steady state;
not shown). D, computer subtraction of the record traces in A from those in B. The evoked current (200 ms)
consisted of 400 data points. E, Current versus Voltage (I versus E) plot of evoked currents. The last 30
data points of each current trace were averaged, and the averaged
values were plotted. The internal pipette solution contained (in
mM): 128 KCl, 20 HEPES, 1 MgCl , 0.1
CaCl , 1.1 EGTA, 2 MgATP, 0.3 GTP, pH 7.3 (with KOH, about
14 mM). The external solution contained (in mM): 140
KCl, 10 HEPES, 10 D-glucose, 2 CaCl , 1
MgCl , pH 7.4 (with KOH, about 5 mM). The
osmolality was adjusted with sucrose to that of the culture media
(310-317 mosm) and similarly the intracellular solution was set
to 300 mosm.
Figure 5:
The K current induced by
the application of various agonists in control and
TC3-GIRK1-cp-expressing cells. The bar graphs show the current
amplitudes in whole cell recordings obtained from GIRK1-cp-expressing
TC3 cells under the same protocol as in Fig. 4. Column a,
currents recorded from control cells expressing the resistance gene (neo) but not GIRK1-cp in the presence of norepinephrine (30
µM, n = 6); columnsb-f, GIRK1-cp-expressing TC3 cells with
norepinephrine (30 µM; n = 48) (column
b) with galanin (100 nM; n = 19) (column c), or with somatostatin analog
([D-Trp8]somatostatin (300 nM; n = 8) (column d). Columne, lack
of effect of NECA (300 nM; n = 9), an
adenosine agonist; columnf, after overnight
pertussis toxin treatment (200 ng/ml) and stimulation with
norepinephrine (30 µM; n =
12).
Figure 6:
The
current induced by norepinephrine (L-NE) was antagonized by
the  -receptor antagonist, yohimbine. The response to
norepinephrine in 140 mM K+ solution produced by 200-ms
hyperpolarizing steps to -120 mV from V-h = 0 mV. Voltage
steps were evoked at 10-s intervals. Currents were measured by the end
of the voltage steps by averaging the last 30 data points and plotted.
The graph shows the averaged steady state current as a function of
time. Shown on the right are superimposed individual current
traces before and during the application of drugs at the indicated time
periods.
Channel activity was also
assayed in cell-attached as well as excised patches of membranes, using
standard single channel recording methods (24). In these experiments we
compared the GIRK1-cp-induced single channel currents with that
produced by the cardiac I channel. We could not find
I -like activity in membranes of HEK293 cells stably
transfected with GIRK1-cp immunopositive for the C-peptide tag (no
channels observed in a total of 51 patches). The observation of other
types of channels in these membranes, including those identifiable as
ATP-activated or I potassium channels, tends to rule out
technical problems such as ``sealing over'' of excised
patches. Other maneuvers, such as the application of GTP S (9
patches), brain derived G protein  subunits (10 patches), or
trypsin treatment (16 patches) were without effect, although they have
been reported to lead to channel
activation(9, 10, 13, 31) . It would
appear, therefore, that despite the observation of the GIRK1-cp protein
expression by both immunohistochemical and immunoblot assays, currents
carried by the channel could not be demonstrated in the HEK293 cells.
In contrast, the TC3-GIRK1-cp transfected line resulted in the
appearance of significant I -like channel activity (15
patches in 118, or 13%). These patches were pulled from a cell line in
which the percentage of immunopositive cells decreased from greater
than 90% to only about 15% positive over a period of several months.
Note that I -like channels could not be detected in
control TC3 cells (0 out of 22 patches). Representative traces of
single channel currents as a function of time are shown in Fig. 7. There was minimal activity in patches pulled from a
TC3-GIRK1-cp cell directly into bath solution (uppertrace). An increase in activity in the same patch after
application of 50 µM GTP S is shown in the middletrace (Fig. 7). The lowertrace shows currents activated in a different TC3-GIRK1-cp cell
patch in the presence of 50 µM norepinephrine in the
pipette and 1 mM GTP on the cytoplasmic side. It was thus
evident that the TC3 cells transfected with GIRK1-cp and
expressing the immunoreactive protein also had appropriate currents
identifiable at the single channel level.
Figure 7:
Single channel characteristics of GIRK1-cp
in patches excised from TC3 cells expressing GIRK1-cp. Uppertrace shows the activity in a patch of membrane from a
TC3 cell transfected with GIRK1-cp that had been excised into bath
solution supplemented with 500 µM ATP and 100 µM GDP. Each trace is 12 s long. The middletrace illustrates the channel activity in the same patch in response to
the addition of 50 µM GTP S to the bath solution. The bottomtrace is from a different experiment showing
channel openings in a patch excised from a GIRK1-cp transfected cell,
in the presence of 50 µM norepinephrine in the pipette
solution (and 1 mM GTP and 500 µM ATP in the bath
solution). Cells were bathed in, and patches excised into, bath
solution, which contained (in mM): 140 KCl, 5 HEPES, 5 EGTA, 6
MgCl , pH 7.4 (with KOH, about 16 mM). The pipette
solution consisted of 140 KCl, 5 CaCl , 20 HEPES, pH 7.4
(with KOH, about 5 mM).
The identity of the
channels induced in the TC3-GIRK1-cp cells by GIRK1-cp was
ascertained by examining single channel current voltage (I-V)
relationships and single channel lifetimes. The I-V curve determined
from our measurements of GIRK1-cp-induced channel activity in TC3
cells (data points) is compared in Fig. 8with that observed for
I in bullfrog atrial myocytes (solidline). Both channels show essentially the same inward
rectification. Single channel conductances were calculated from the
slope of the linear part of the I-V curves. For the GIRK1-induced
channels we find a conductance of 39.07 ± 1.03 pS, a value not
significantly different from I in bullfrog atria,
38.92 ± 1.77 pS(32, 33) . Note that other
K channels have characteristically different
conductances, for example approximately 90 pS for the ATP-sensitive
K channel or 31.7 ± 1.7 pS for I in guinea pig atria. A representative open time histogram for
these channels in the TC3-GIRK1-cp cells is shown in Fig. 9.
The histogram was fit with one exponential, yielding a mean open time
of 2.69 ± 0.32 ms, similar to that measured for I channels in bullfrog atrial myocytes under comparable conditions,
2.25 ± 0.56 ms. ( )These considerations
lead us to conclude that at the single channel level the
GIRK1-cp-induced channels are indistinguishable from
I .
Figure 8:
Current voltage relationship of a group of
experiments of the type shown in the second trace in Fig. 7.
The solidline shows the single channel IV curve of
the I channel activated in frog atrial myocytes by
carbamylcholine. The similarity suggests that the channel expressed in
TC3 cells has the same properties as I . The
linear portion of the data gave a slope conductance of 39.1 ±
1.0 pS (n = 10).
Figure 9:
Representative open time histogram of the
GIRK1-cp channels in transfected TC3 cells. The open time
distribution was fit with a single exponential yielding a mean open
time of 3.80 ms for this particular patch. An average mean open time of
2.69 ± 0.32 ms was obtained from 10 different excised
patches.
DISCUSSION
The cloning of a new family of cDNAs encoding G
protein-linked K channels has facilitated the
demonstration that these channels are expressed in specific cardiac,
neuronal, and neuroendocrine cells and can couple to numerous
receptors(12, 13, 14, 15, 16) .
Until recently these channels have been functionally studied only in
the Xenopus oocyte expression system, an extremely useful but
limited approach to the study of ion channel-receptor interactions.
We have employed a 31-amino acid epitope tag to follow expression of
the GIRK1-cp channel for the first time in transfected mammalian cells.
The tag made no detectable difference in the functional characteristics
of the channel, which, when co-expressed in Xenopus oocytes
with either the M2 muscarinic or the -opioid receptor, could be
activated normally by the appropriate agonist. Expression of the
polypeptides produced by transient and stable cell lines was compared
in immunoblots employing anti-tag antisera. These studies revealed the
presence of several GIRK1-cp immunoreactive polypeptides, largely due
to differential or incomplete glycosylation. This result suggests that
the amino acid sequence NYTP beginning at residue 136 allows
Asn , the only putative site for N-glycosylation
in the GIRK1 sequence, to be at least partially glycosylated.
Glycosylation occurs despite the presence of a C-terminal proline on
the motif that has been observed to inhibit glycosylation in some
proteins(34) . According to the deduced orientation of GIRK1
membrane-spanning domains, Asn does indeed fall in the
extracellular loop(13) .
There was a striking difference in
functional GIRK1 channel expression between the HEK293 cells and the
TC3 insulinoma cells. These cell types were compared after our
initial inability to demonstrate appropriate currents in Chinese
hamster ovary fibroblast cells transfected with the native GIRK1 cDNA.
HEK293 cells have been useful for the study of ion channel expression
due to their low background of most kinds of ion channels. While both
the HEK293 cells and the TC3 cells transfected with GIRK1-cp
produced GIRK1-cp polypeptides, only the TC3-GIRK1-cp cells also
produced currents that were consistent with an inwardly rectifying G
protein-linked channel. These currents were activated by GTP S and,
to different extents, by stimulation of specific endogenous
G-protein-linked receptors. Characteristics of the TC3-GIRK1-cp
currents at the single channel level were similar to those of cardiac
atrial current I and were clearly distinguished from
endogenous currents in TC3 cells.
One possibility to explain
the difference in channel function in transfected cells is a restricted
expression of appropriate G protein isoforms among the many that have
been described(3) . Several studies have identified specific
subunits involved in signal transduction pathways with particular
receptors (e.g. Ref. 35). The  adrenergic
receptor was shown to interact with three G subunits (1, 2, 3) as well as
G (36) , while galanin has also been shown to
activate G subunits one, two, and three in RINm5f
cells(37) . The somatostatin receptor SSTR2 was shown to
selectively associate with G 3 and
G (38) . HEK293 cells endogenously express low
levels of the SSTR2 somatostatin receptor and similar levels of
G 1 and G 3 immunoreactivity but do not
express G (38) . TC3 cells have also been
shown to express the G proteins G , G ,
and G , by immunoblot(39) . Therefore, the two
cell types employed here were likely to express the appropriate G
protein subunits enabling them to couple to the receptors we
tested. However, lack of expression may also be due to specific
interactions between the subunits and the effector(7) .
Specific subunits and  combinations have been found
to have unique functions(8, 40, 41) . In rat
pituitary GH3 cells, voltage-sensitive calcium channels were found to
be coupled to the somatostatin receptor by the  subtype and to the muscarinic receptor by the  subtype(42) . However, we found that neither GTP S nor
 (mixed brain) could activate the GIRK1-cp channels expressed
in the HEK293 cells. Even if the favored combination of G protein
subunits for GIRK1 was not present in HEK293 cells, the addition of
brain  should have activated the channel. Also, we and others
have shown that  activation of native G protein-coupled
inward rectifier channels has little  specificity, so that
the type of  used is not likely to be the cause of the lack
of channel function(10, 31) .
The difference in
expression between the two cell lines may also be due to differential
expression of an essential component for channel function. The
possibility that additional subunits are required to produce GIRK1
currents has also been addressed recently by Krapivinsky et
al.(43) . They concluded that another inward rectifier-like
protein, CIR, forms a complex with GIRK1 protein in native atrial
myocyte membranes, in co-transfected Chinese hamster ovary cells, and
in the baculovirus expression system, and that both are required
subunits of I .
Endogenous receptors and G proteins
were evaluated for coupling to the GIRK1 channels in the
TC3-GIRK1-cp-expressing cells. Receptor interactions were studied
under conditions that are known to block opening of ATP-sensitive
K channels that are present in these cells. The
adrenergic receptor activation by norepinephrine was specific for the
 receptor, as shown by the reversible block with
yohimbine and was abolished by pertussis toxin treatment. Galanin also
activated the inward currents well, but somatostatin receptors did not
couple nearly as well, suggesting a segregation of the G
protein-receptor complex to specific effectors. The somatostatin
receptor pathway has also been found to be distinct from norepinephrine
and leu-enkaphalin-induced inhibition of the -conotoxin sensitive
calcium channels in NG108-15 cells(44) . The latter two
receptors were able to couple to a pertussis toxin-insensitive mutant
of G , but the somatostatin receptor did
not(44) .
In conclusion, we have for the first time
functionally expressed an epitope-tagged GIRK1 channel in a stably
transfected mammalian cell line. Extension of the protein by the
31-amino acid tag allowed the demonstration that modification of the
carboxyl terminus did not impair channel assembly or G protein
interactions. Expression of GIRK1 or GIRK1-cp in various cell lines
revealed significant differences in the function of the channel
protein, suggesting the presence of unidentified components of a
regulatory or transport mechanism. The epitope-tagged channel in
TC3 cells is ideally suited for further biochemical and
biophysical analyses of these as yet unidentified elements of G
protein-coupled K channel regulation.
FOOTNOTES
- *
- Funding was provided by the Marilyn M. Simpson
Charitable Trust (to L. H. P.), National Institutes of Health Grants
PO1 DK44840 (to L. H. P.), HL 37127 (to G. S.), and US PHS DA-02575,
DA-02121, and MH-40165 (to R. J. M.). The costs of publication of this
article were defrayed in part by the payment of page charges. This
article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Dept. of Medicine, University of Chicago, 5841 S. Maryland Ave.,
Chicago, IL 60637. Tel.: 312-702-9180; Fax: 312-702-9194; E-mail:
l-philipson@uchicago.edu.
- The
abbreviations used are: GTP
S, guanosine
5`-O-(thiotriphosphate); PBS, phosphate-buffered saline; NECA,
5`-N-ethylcarboxamidoadenosine; pS, picosiemens; C-peptide,
C-peptide of proinsulin; GIRK1-cp, GIRK1 cDNA with C-peptide proinsulin
tag; BSA, bovine serum albumin.
- K. Hurley, L.
H. Philipson, A. Kuznetsov, and D. J. Nelson, submitted for
publication.
- K. Hurley, L. H. Philipson, and D.
J. Nelson, unpublished observations.
- J. Murphy
and G. Szabo, unpublished observations.
ACKNOWLEDGEMENTS
Rabbit anti-insulin C-peptide antisera were a generous
gift of K. S. Polonsky. Opioid receptor cDNAs were kindly provided by
G. I. Bell. TC3 cells were a gift of S. Efrat. We thank I. D.
Dukes for a critical reading of the manuscript.
REFERENCES
- Breitwieser, G. E., and Szabo, G.(1985) Nature317, 538-540
[CrossRef][Medline]
[Order article via Infotrieve]
- Brown, A. M., and Birnbaumer, L.(1990) Annu. Rev. Physiol.52, 197-213
[CrossRef][Medline]
[Order article via Infotrieve]
- Hepler, J. R., and Gilman, A. G.(1992) Trends Biochem. Sci.17, 383-387
[CrossRef][Medline]
[Order article via Infotrieve]
- Lewis, D. L., Lechleiter, J. D., Kim, D., Nanavati, C., and Clapham, D. E.(1990) Mayo Clin. Proc.65, 1127-1143
[Medline]
[Order article via Infotrieve]
- Brown, A. M., Yatani, A., Kirsch, G., Okabe, K., VanDongen, A. M., and Birnbaumer, L.(1991) J. Bioenerg. Biomem.23, 499-507
[CrossRef][Medline]
[Order article via Infotrieve]
- Chang, W. J., Ying, Y. S., Rothberg, K. G., Hooper, N. M., Turner, A. J., Gambliel, H. A., De, G. J., Mumby, S. M., Gilman, A. G., and Anderson, R. G.(1994) J. Cell Biol.126, 127-138
[Abstract/Free Full Text]
- Neubig, R. R.(1994) FASEB J.8, 939-946
[Abstract]
- Kleuss, C., Scherubl, H., Hescheler, J., Schultz, G., and Wittig, B. (1992) Nature358, 424-426
[CrossRef][Medline]
[Order article via Infotrieve]
- Clapham, D. E., and Neer, E. J.(1993) Nature365, 403-406
[CrossRef][Medline]
[Order article via Infotrieve]
- Wickman, K. D., Iniguez-Lluhi, J. A., Davenport, P. A., Taussig, R., Krapivinsky, G. B., Linder, M. E., Gilman, A. G., and Clapham, D. E.(1994) Nature368, 255-257
[CrossRef][Medline]
[Order article via Infotrieve]
- Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Iniguez-Lluhi, J., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y.(1994) Nature370, 143-146
[CrossRef][Medline]
[Order article via Infotrieve]
- Dascal, N., Schreibmayer, W., Lim, N. F., Wang, W., Chavkin, C., DiMagno, L., Labarca, C., Kieffer, B. L., Gaveriaux, R. C., Trollinger, D., Lester, H. A., and Davidson, N.(1993) Proc. Natl. Acad. Sci. U. S. A.90, 10235-10239
[Abstract/Free Full Text]
- Kubo, Y., Reuveny, E., Slesinger, P. A., Jan, Y. N., and Jan, L. Y. (1993) Nature364, 802-806
[CrossRef][Medline]
[Order article via Infotrieve]
- Stoffel, M., Espinosa, R. I., Powell, K. L., Philipson, L. H., LeBeau, M. M., and Bell, G. I.(1994) Genomics21, 254-256
[CrossRef][Medline]
[Order article via Infotrieve]
- Lesage, F., Duprat, F., Fink, M., Guillemare, E., Coppola, T., Lazdunski, M., and Hugnot, J. P.(1994) FEBS Lett.353, 37-42
[CrossRef][Medline]
[Order article via Infotrieve]
- Chen, Y., and Yu, L.(1994) J. Biol. Chem.269, 7839-7842
[Abstract/Free Full Text]
- Yon, J., and Fried, M.(1989) Nuc. Acids Res.17, 4895
[Free Full Text]
- Andersson, S., Davis, D. L., Dahlback, H., Jornvall, H., and Russell, D. W.(1989) J. Biol. Chem.264, 8222-8229
[Abstract/Free Full Text]
- Philipson, L., Hice, R. E., Schaefer, K., LaMendola, J., Bell, G. I., Nelson, D. J., and Steiner, D. F.(1991) Proc. Natl. Acad. Sci. U. S. A.88, 53-57
[Abstract/Free Full Text]
- Efrat, S., Linde, S., Kofod, H., Spector, D., Delannoy, M., Grant, S., Hanahan, D., and Baekkesksov, S.(1988) Proc. Natl. Acad. Sci. U. S. A.85, 9037-9041
[Abstract/Free Full Text]
- Philipson, L. H., Rosenberg, M. P., Kuznetsov, A., Lancaster, M. E., Worley, J. F., III, Roe, M. W., and Dukes, I. D.(1994) J. Biol. Chem.269, 27787-27790
[Abstract/Free Full Text]
- Madsen, O. D., Cohen, R. M., Fitch, F. W., and Steiner, D. F. (1985) Endocrinology113, 2135-2144
[Abstract/Free Full Text]
- Laemmli, U. K.(1970) Nature227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Hamill, O. P., Marty, A., Neher, E., and Sakmann, B.(1981) Pflügers Arch. Eur. J. Physiol.391, 85-100
- Philipson, L. H., Malayev, A., Kuznetsov, A., Chang, C., and Nelson, D. J.(1993) Biochim. Biophys. Acta1153, 111-121
[Medline]
[Order article via Infotrieve]
- D'Ambra, R., Surana, M., Efrat, S., Starr, R. G., and Fleischer, N. (1990) Endocrinology126, 2815-2822
[Abstract/Free Full Text]
- Ashcroft, S. J. H., and Ashcroft, F. M.(1990) Cell. Signalling2, 197-214
[CrossRef][Medline]
[Order article via Infotrieve]
- Kubo, Y., Baldwin, T. J., Jan, Y. N., and Jan, L. Y.(1993) Nature362, 127-133
[CrossRef][Medline]
[Order article via Infotrieve]
- Dunne, M. J., Bullet, M. J., Li, G., Wollheim, C. B., and Peterson, C. B.(1989) EMBO J.8, 412-420
- de Weille, J. R., Schmid-Antomarchi, H., Fosset, M., and Lazdunski, M. (1989) Proc. Natl. Acad. Sci. U. S. A.86, 2971-2975
[Abstract/Free Full Text]
- Murphy, J. F., Graber, S. G., Garrison, J. C., and Szabo, G.(1993) FASEB J.7, A1138
- Nakayama, K., Fan, Z., Marumo, F., Sawanobori, T., and Hiraoka, M. (1991) Br. J. Pharm.103, 1641-1648
[Medline]
[Order article via Infotrieve]
- Matsuda, H.(1991) J. Gen. Physiol.435, 83-99
- Gavel, Y., and Von, H. G.(1990) Protein Eng.3, 433-442
[Abstract/Free Full Text]
- Taussig, R., Iniguez-Lluhi, J., and Gilman, A. G.(1993) Science261, 218-221
[Abstract/Free Full Text]
- Okuma, Y., and Reisine, T.(1992) J. Biol. Chem.267, 14826-14831
[Abstract/Free Full Text]
- Gillison, S. L., and Sharp, G. W.(1994) Diabetes43, 24-32
[Abstract]
- Law, S. F., Yasuda, K., Bell, G. I., and Reisine, T.(1993) J. Biol. Chem.268, 10721-10727
[Abstract/Free Full Text]
- Baffy, G., Yang, L., Wolf, B. A., and Williamson, J. R.(1993) Diabetes42, 1878-1882
[Abstract]
- Kontani, K., Takahashi, K., Inanobe, A., Ui, M., and Katada, T.(1992) Arch. Biochem. Biophys.294, 527-533
[CrossRef][Medline]
[Order article via Infotrieve]
- Ueda, N., Iniguez-Lluhi, J., Lee, E., Smrcka, A. V., Robishaw, J. D., and Gilman, A. G.(1994) J. Biol. Chem.269, 4388-4395
[Abstract/Free Full Text]
- Kleuss, C., Scherubl, H., Hescheler, J., Schultz, G., and Wittig, B. (1993) Science259, 832-834
[Abstract/Free Full Text]
- Krapivinsky, G., Gordon, E. A., Wickman, K., Velimirovic, B., Krapivinsky, L., and Clapham, D. E.(1995) Nature374, 135-141
[CrossRef][Medline]
[Order article via Infotrieve]
- Taussig, R., Sanchez, S., Rifo, M., Gilman, A. G., and Belardetti, F. (1992) Neuron8, 799-809
[CrossRef][Medline]
[Order article via Infotrieve]
- Ma, G. H., Miller, R. J., Kuznetsov, A., and Philipson, L. H.(1995) Mol. Pharmacol., in press
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Zhao, Q. Fang, S. G. Straub, and G. W. G. Sharp
Both Gi and Go Heterotrimeric G Proteins Are Required to Exert the Full Effect of Norepinephrine on the {beta}-Cell KATP Channel
J. Biol. Chem.,
February 29, 2008;
283(9):
5306 - 5316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sarac, P. Hou, K. M. Hurley, D. Hriciste, N. A. Cohen, and D. J. Nelson
Mutation of Critical GIRK Subunit Residues Disrupts N- and C-Termini Association and Channel Function
J. Neurosci.,
February 16, 2005;
25(7):
1836 - 1846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shankar, S. Murugappan, S. Kim, J. Jin, Z. Ding, K. Wickman, and S. P. Kunapuli
Role of G protein-gated inwardly rectifying potassium channels in P2Y12 receptor-mediated platelet functional responses
Blood,
September 1, 2004;
104(5):
1335 - 1343.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yamada, A. Inanobe, and Y. Kurachi
G Protein Regulation of Potassium Ion Channels
Pharmacol. Rev.,
December 1, 1998;
50(4):
723 - 757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. U. Ehrengruber, C. A. Doupnik, Y. Xu, J. Garvey, M. C. Jasek, H. A. Lester, and N. Davidson
Activation of heteromeric G protein-gated inward rectifier K+ channels overexpressed by adenovirus gene transfer inhibits the excitability of hippocampal neurons
PNAS,
June 24, 1997;
94(13):
7070 - 7075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Xu, J. Murphy, and A. d. S. Otero
Participation of Nucleoside-diphosphate Kinase in Muscarinic K+ Channel Activation Does Not Involve GTP Formation
J. Biol. Chem.,
August 30, 1996;
271(35):
21120 - 21125.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|