|
|
|
|||||||
|
|||||||||
From the
We report cDNA cloning and characterization of the human and
mouse orthologs of the chicken YAP (Yes-associated protein) gene which
encodes a novel protein that binds to the SH3 (Src homology 3) domain
of the Yes proto-oncogene product. Sequence comparison between mouse,
human, and chicken YAP proteins showed an inserted sequence in the
mouse YAP that represented an imperfect repeat of an upstream sequence.
Further analysis of this sequence revealed a putative protein module
that is found in various structural, regulatory, and signaling
molecules in yeast, nematode, and mammals including human dystrophin.
Because one of the prominent features of this sequence motif is two
tryptophans (W), we named it the WW domain (Bork, P., and Sudol, M.
(1994) Trends Biochem. Sci. 19, 531-533). Since its
delineation, more proteins have been shown to contain this domain, and
we report here on the widespread distribution of the WW module and
present a discussion of its possible function. We have also shown that
the human YAP gene is well conserved among higher eukaryotes, but it
may not be conserved in yeast. Its expression at the RNA level in adult
human tissues is nearly ubiquitous, being relatively high in placenta,
prostate, ovary, and testis, but is not detectable in peripheral blood
leukocytes. Using fluorescence in situ hybridization on human
metaphase chromosomes and by analyzing rodent-human hybrids by Southern
blot hybridization and polymerase chain reaction amplification, we
mapped the human YAP gene to chromosome band 11q13, a region to which
the multiple endocrine neoplasia type 1 gene has been mapped.
One of the hallmarks of signal transduction processes is a
specific physical interaction between proteins carried out by well
demarcated and structured regions of the proteins, which are called
domains(1, 2, 3, 4) . Our research has
focused on molecular steps by which non-receptor-type protein-tyrosine
kinases of the Src family signal in normal and transformed
cells(4) . In recent years, much of the attention has been
concentrated on amino-terminal domains of protein-tyrosine kinases. At
least three distinct structural domains, termed SH2, SH3 (SH for Src
homology) and PH (for pleckstrin homology) are present in the
non-receptor-type protein-tyrosine kinases and are also found in a wide
variety of proteins implicated in signal transduction
processes(5, 6, 7, 8) . The SH2 domains
are known to interact specifically with phosphotyrosine-containing
proteins, and the resulting complexes are involved in signal
transduction events initiated by protein-tyrosine
kinases(1, 9) . The SH2 domain of Src protein-tyrosine
kinases is not only involved in substrate recognition but is also
necessary for the regulation of kinase activity through maintenance of
a repressed conformation of the protein-tyrosine
kinases(10, 11) . The SH3 domains mediate noncovalent
protein-protein interactions essential for cellular and intercellular
signaling(12, 13, 14, 15, 16, 17, 18, 19, 20, 21) .
For Src and other members of the family, it is presumed that binding of
specific proteins to their SH3 domains may result in the modulation of
their enzymatic activity and thus could be a part of the signaling
mechanism of cellular and oncogenic forms of the Src family
protein-tyrosine
kinases(22, 23, 24, 25, 26, 27, 28, 29) .
The PH domain was first defined as two repeats in pleckstrin, the major
substrate for serine/threonine phosphorylation by protein kinase C in
platelets(7, 8) . In contrast to SH3 and SH2, the PH
domain seems to bind a nonproteinaceous ligand, phosphatidylinositol
4,5-bisphosphate, implicating this domain in membrane-protein
interaction(30) .
Recently, we have identified, cloned, and
characterized the cDNA for a novel chicken protein that binds to the
SH3 (Src homology 3) domain of the Yes proto-oncogene
product(31) . The protein has a molecular mass of 65 kilodaltons
(kDa) and is phosphorylated in vivo on serine. We named it
YAP65 for Yes-associated protein of 65 kDa. Within the YAP65 (YAP for
short) sequence, we identified a proline-rich motif that is involved in
binding YAP to Yes kinase. YAP was also shown to bind to other
signaling molecules that contain SH3 domains including Nck, Crk, and
Src. In order to analyze the function of YAP in transgenic animals, we
have cloned mammalian orthologs of chicken YAP. Two interesting
findings resulted from our studies. First, the sequence comparison
between mouse, human, and chicken YAPs showed an inserted sequence in
mouse YAP representing an imperfect repeat of an upstream sequence.
Unexpectedly, this sequence showed significant similarity with various
regulatory and signaling molecules, and we have proposed that it may
form a novel domain involved in protein-protein
interaction(32) . In this report, we show the widespread
occurrence of this domain and point out new signaling molecules that
contain the WW module. Second, the human YAP (hYAP) gene was localized
to a short interval on chromosome 11q13 that harbors a gene for
multiple endocrine neoplasia type 1. We have also shown that the hYAP
gene is well conserved among higher eukaryotes and is expressed in most
tissues.
Hybrid DNAs were from previously
described rodent-human hybrid cell lines (37, 38, 39) or from the NIGMS Human Genetic
Mutant Cell Repository (Coriell Institute, Camden, NJ). Hybrids
retaining partial chromosomes 11 and 6 have also been
described(38, 39) . Hybrid DNAs were tested for the
presence of YAP specific human SstI and PstI
restriction fragments detected by radiolabeled hYAP probe using
standard Southern hybridization methods. In addition, oligonucleotide
primers were prepared for amplification of a 208-bp fragment of the
hYAP 3`-untranslated region (UTR) representing nucleotides 2135 through
2341. The forward primer, an 18-mer starting at position 2135 of the
cDNA sequence, was 5`GGAAATGGCCACTGCAGA3`, and the reverse primer, a
20-mer starting at position 2323, was 5`CCCTAAGCTAAAGCTAATCT3`. These
primers were used to amplify the hYAP 3`-UTR fragment from mouse,
hamster, human, and hybrid DNAs under the following cycling conditions:
94 °C, 5 min for denaturation; 30 cycles of 94 °C for 30 s and
72 °C for 30 s; and a final cycle at 72 °C for 5 min.
To further define the chromosome positions
of these loci, small panels of DNAs from hybrids carrying partial
chromosomes 11 or 6 were also tested for the presence of the YAP loci
with the results summarized in Fig. 5B. Because the hYAP
cognate locus was present in hybrid 7298 but absent in hybrid CE4, the
gene maps between the centromere and the CCND1/BCL1 locus on chromosome
11, whereas the hYAP-related locus maps to 6p21 to 6qter.
To confirm
and refine the above localizations, fluorescence in situ hybridization (FISH) with the hYAP cDNA probe was performed on
normal human metaphase chromosomes. Using FISH, we detected 51 signals
at chromosome 11q13 on 27 metaphases and only 12 signals on the
q-terminal one-third of chromosome 6. The FISH results are summarized
to the left of the chromosome idiograms shown in Fig. 5B.
Since the hYAP gene was mapped to 11q13,
centromeric to the BCL1 major breakpoint region, possibly within the
chromosomal region which is amplified in a significant fraction of
human mammary carcinomas, a panel of 17 mammary carcinoma cell line
DNAs was tested for evidence of amplification of the hYAP gene. Four of
these DNAs had shown amplification of the CCND1/BCL1 gene (from 3- to
10-fold), but none showed evidence of an amplified hYAP gene (data not
shown). Thus, the hYAP gene is most likely centromeric to the
chromosome region commonly amplified at 11q13 in mammary carcinomas.
The
domain turns out to be even more widespread than initially reported
(32). As many as 11 new sequences with WW modules have been recently
deposited in the gene banks (Fig. 6). Anticipating the number of
WW sequences to grow rapidly, we have provided updated information on
the WW domain via world wide web (www) (http://www.embl-
heidelber.de/
The new list of proteins with the WW motifs confirmed
our initial conclusion that like the SH2, SH3, and PH domains, the WW
domain occurs in a variety of structural and signaling molecules with
no apparent common functions. Three new proteins that contain the WW
domain could provide a clue to the role of this module in major
signaling pathways. One of the human proteins, named ORF1 (D29640),
contains a WW domain just upstream from the carboxyl-terminal sequence
that shows similarity to yeast Ras GTPase activator protein. A nematode (Caenorhabditis elegans) protein named 38D4 [Z46241]
harbors a WW domain at the amino terminus, followed by a PH domain in
the middle and a carboxyl-terminal sequence that is conserved in the
breakpoint cluster region, n-chimaerin, and p85 subunit of the
phosphoinositol 3-kinase(48, 49) . A gene product named
Msb1, with one WW domain, was isolated in a genetic screen in yeast and
was implicated in the MAP kinase pathway.
Our results describe the molecular cloning, expression, and
chromosomal localization of the human YAP gene, which encodes a protein
implicated in binding to the SH3 domain of the Yes tyrosine kinase. We
have also described cDNA cloning of the mouse YAP homolog, whose
sequence provided a clue for the identification of a novel protein
module, designated the WW domain(32) , which is present in
various regulatory, signaling, and structural molecules. The following
aspects of this work deserve further comment: (i) the expression
profile of YAP mRNA in human adult tissues, (ii) the high degree of
sequence conservation among YAPs from higher eukaryotes, (iii) the
chromosomal localization of the human YAP gene, and (iv) the widespread
occurrence of the WW domain and its possible role as a module mediating
protein-protein interaction.
The expression profile of YAP mRNA in
adult human tissues is broad with relatively high levels of the message
in placenta, prostate, testis, ovary, and small intestine (Fig. 4). We did not detect YAP mRNA in peripheral blood
leukocytes, and, in contrast to results obtained with chicken YAP,
relatively low levels of the mRNA were detected in adult human brain (Fig. 4, lane B). Two factors could account for the
quantitative difference observed in the brain tissues. First, in
chickens we used cerebellum and telencephalon for our studies and not
the entire brain, as was done in the mRNA preparation from the human
source. Second, the age of the chicken brain was 2 weeks, whereas the
sample of the human brain mRNA was from individuals of various ages and
sex. The size of hYAP mRNA was estimated at approximately 5 kb, which
is in good agreement with the size of its cDNA (5.1 kb, see Fig. 1).
The YAP sequence is highly conserved among higher
eukaryotes, as shown by sequence comparison among human, mouse, and
chicken YAP, as well as by ``Zoo-blot'' analysis. Our data
from the comparative Southern blot analysis on genomic DNA from yeast (S. cerevisiae) showed hybridization of hYAP cDNA with
distinct DNA bands on the blot. However, these bands coincided with the
so-called satellite DNA bands and therefore probably represented
signals of nonspecific hybridization, rather than hybridization with a
YAP homolog or a YAP-related gene present in yeast.
The human YAP
gene maps to chromosome 11q13 centromeric to the CCND1/BCL1 locus and
could thus be near the locus for the multiple endocrine neoplasia type
1 familial gene (MEN1)(50, 51, 52, 53) .
MEN1 is an autosomal dominant disorder characterized by a high
frequency of peptic ulcer disease and primary endocrine abnormalities
involving the pituitary, parathyroid gland, and pancreas. Schimke (54) postulated that the MEN1 mutation may involve derepression
of a ``primitive'' gene, possibly a proto-oncogene, coding
for a protein that promotes the growth of endocrine glands. A high
resolution radiation hybrid map of the proximal long arm of chromosome
11, containing the MEN1 and BCL1 gene loci, pointed to the sea proto-oncogene as one of the potential candidates for the MEN1
locus(55, 56) . The hYAP DNA probe should be a valuable
marker to refine the chromosomal map around the MEN1 locus and perhaps
to identify the MEN1 gene. The localization of hYAP to chromosome 11q13
also allows prediction of the location of the mouse ortholog on
chromosome 19 or 7 (Ref. 57).
The function of the WW domain in YAP
and in other proteins remains to be determined. The occurrence of the
domain in yeast proteins provides a powerful genetic system that could
be employed to analyze the function of the WW motif in vivo.
The rsp5 gene was identified as a suppressor of mutations in
the spt3 gene, which encodes a transcription factor that
interacts with TATA-binding protein (Ref. 47).
In speculating about the possible
function of the WW domain in the specific context of a given protein,
in addition to Rsp5 and Nedd-4, we would like to briefly mention three
other examples: dystrophin, Msb1, and YAP.
The human dystrophin gene
encodes a large molecule that is classified as a cytoskeletal protein,
based on its similarity to
The msb1 gene encodes a
424-amino-acid long protein that contains one WW domain. msb1 stands for ``mammalian suppressor of bck1''
because this gene was isolated as a suppressor of the bck1 mutation using a cDNA library prepared from human cells.
The role of the WW domain in YAP is not known, although one
could speculate that this module connects the Src family tyrosine
kinases with serine kinases(31) . The lack of an apparent
catalytic domain in YAP, the tandem location of the WW domain(s) and
the SH3 binding proline-rich motif, plus YAP expression in most tissues
are reminiscent properties of the adaptor-like molecules, Grb-2 or Crk.
We have recently isolated a chicken isoform of YAP with two WW domains
(see www update), providing suggestive evidence that mouse YAP is an
isoform generated by alternative splicing.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank
Special thanks are due to Hidesaburo Hanafusa for his
enthusiastic encouragement, support, and constructive advice concerning
our work on the ligand for the WW domain; Drs. Fred Winston, Anita
Hopper, Peter Pavlik, Peter Howley, Teresa Zoladek, and Kunihiro
Matsumoto for sharing with us unpublished results on the rsp5 and msb1 genes; Drs. Hartmut Oschkinat, Anne Ulrich,
Marko Hyvonen, and Matti Saraste for collaboration on the structure of
the WW domain and for permission to mention their preliminary data; Dr.
Stuart Aaronson for the gift of the human cDNA library; Henry Chen and
Dan Stieglitz for stimulating discussions and help with the preparation
of some parts of the manuscript; Drs. Hidesaburo Hanafusa, Tadashi
Yamamoto, Beatrice Knudsen, Peter Howley, Fred Winston, Andrea
Musacchio, and Matti Saraste for valuable comments on the first version
of the manuscript; Drs. Georges Calothy, Cecile Bougeret, Sahng-June
Kwak, and Paul Fehlner and Terry Solomon for insightful discussions on
the potential medical implications of our work on the WW motif in human
dystrophin; and Dr. Bonnie Kaiser for enthusiastic support.
Volume 270,
Number 24,
Issue of June 16, pp. 14733-14741, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
cDNA Cloning and Sequencing
A chicken YAP cDNA
corresponding to the coding region (31) was used as a probe to
screen a pCEV15 cDNA library derived from M426 human lung
embryonic fibroblast cells (a gift from Dr. Stuart Aaronson, Ref. 33)
and a 16-day mouse embryo cDNA library in
EXlox
(purchased from Novagen, Madison, WI). The low stringency
conditions of hybridization were as follows: 5
SSPE, 10
Denhardt's, 2% SDS, 0.2 mg/ml salmon sperm DNA, and 10
cpm/ml P-labeled cDNA at 65 °C overnight. The
filters were washed twice for 20 min at room temperature with 2
SSC, 0.05% SDS, and twice at 60 °C for 20 min with 0.1
SSC,
0.1% SDS. Both libraries contained phages with a plasmid portion that
carried the insert. The plasmids with inserts were easily rescued from
the
genome following published protocols(33, 34) .
The apparently complete sequence of the hYAP cDNA was contained in one
recombinant plasmid pCEV15-hYAP6 with a SalI-SalI
insert of 5 kb
()pairs. The complete sequence of
mouse YAP (mYAP) cDNA was contained in two overlapping clones,
pEXlox-mYAP6 (2.3-kb EcoRI-HindIII insert) and
pEXlox-mYAP20 (EcoRI-HindIII insert). Both strands of
the cDNA clones were analyzed by direct sequence analysis using the
Sanger method(35) .
Southern and Northern Blot Analysis
Southern blot
of genomic DNA from nine eukaryotic species was performed using the
same conditions as for cDNA library screening(36) . DNA sources
were as follows: human, rhesus monkey, Sprague-Dawley rat, BALB/c
mouse, dog, cow, rabbit, chicken, and Saccharomyces
cerevisiae. Except for yeast and human DNAs, all other genomic
DNAs were isolated from kidney tissue. Human DNA was isolated from
placental tissue. DNA was digested with EcoRI, run on a 0.7%
agarose gel, transferred to a charge-modified nylon membrane by
blotting, and fixed by UV irradiation. The cDNA insert of the hYAP5
plasmid or human 
-actin cDNA control probe were radioactively
labeled to a specific activity of approximately 2 10
cpm/µg and were used as a probe for Southern (hYAP probe) and
for Northern analysis (hYAP probe was used first, and, after stripping,
the probe for -actin was used). Poly(A) RNAs were
isolated from 16 different human tissues from healthy donors of both
sexes (Clontech Laboratory Inc.). The RNAs (2 µg/lane) were run on
a denaturing formaldehyde-1.2% agarose gel, transferred to a
charge-modified nylon membrane by blotting, and fixed by UV
irradiation. The hybridization conditions were: 5
SSPE, 10
Denhardt's solution, 100 µg/ml freshly denatured,
sheared salmon sperm DNA, 50% formamide, and 2% SDS at 42 °C
overnight(36) . The blots were washed for 30 min at room
temperature in 2
SSC, 0.05% SDS and for 1 h at 50 °C in 0.1
SSC, 0.1% SDS. Removal of the hYAP probe from the blot for
subsequent hybridization with the human
-actin probe was achieved
by incubating the blot for 10 min in sterile H
O containing
0.5% SDS that was heated to 90 °C.
Chromosomal Localization
For Southern blot
hybridization, the hYAP cDNA insert (hYAP6 clone) was isolated and
radiolabeled by random priming to a specific activity of 10 cpm/0.1 µg, and 10 cpm was used for each filter
hybridization; for FISH, the entire hYAP cDNA was labeled with biotin
by nick translation (36, 38).
Chromosomal Fluorescence in Situ Hybridization
(FISH)
The procedure used in this study has been described in
detail(38) . Probes were prepared by nick translation using
biotin-labeled 11-dUTP (BioNick Kit, Life Technologies, Inc.).
Hybridization of biotin-labeled probes was detected with fluorescein
isothiocyanate-conjugated avidin. Metaphase chromosomes were identified
by Hoechst-33528 staining and UV irradiation (365 nm), followed by
4`,6-diamidino-2-phenylindole staining to produce the banding pattern.
The fluorescent signal was observed with filter block I3
(BP450-490/LP515; Leitz Orthoplan) on the background of red
chromosomes stained with propidium iodide. Q-banding was observed with
filter block A (BP340-380/LP430).
Computer-aided Analysis of Protein
Sequences
Analyses of sequence homology and secondary structures
of the polypeptides were performed as described previously (40) using the following computer programs: BLASTP (41) for initial data base searches, PROFILES (42) and
PATTERNS (43) for selective identification of the current set of
the WW domains, PHD (44) for predicting secondary structures,
and MoST (45) for calculating a probability of matching the
alignment by chance.
Cloning of Human and Mouse YAPs
Using a cDNA
fragment encoding the chicken YAP as a probe, we screened phage
plaques of a human lung embryonic fibroblast cDNA library. Of 13
positive clones, two (hYAP5 and hYAP6) with the longest inserts
(approximately 3 and 5 kb long, respectively) were analyzed further.
Initial analysis of the DNA sequence showed that hYAP5 cDNA is included
within the hYAP6 clone. The result of direct sequence analysis of both
strands of the hYAP6 cDNA is shown in Fig. 1. The longest open
reading frame predicted a protein product of 493 amino acids with
significant sequence similarity to the chicken YAP (Fig. 2).
Figure 1:
Nucleotide and deduced amino acid
sequences of human YAP. The 5154-base pair human YAP cDNA encodes 493
amino acids and is terminated at nucleotide 1638 marked by an asterisk. A putative protein module, termed the WW domain, is underlined. A proline-rich sequence implicated in binding
between YAP and various SH3 domains is indicated with black
dots.
Figure 2:
Alignment of the human (HYAP),
mouse (MYAP) and chicken (YAP) YAP amino acid
sequences. Positions that differ in at least one amino acid are
indicated in bold. Spaces in the alignment were introduced
arbitrarily and are indicated with dots. The sequences
corresponding to the putative WW domain are underlined. Note
that in mYAP a second WW domain is present. Proline-rich sequences
implicated in binding between YAP and various SH3 domains are conserved
and indicated with a number sign.
In parallel experiments, we isolated a mouse ortholog of YAP using
the same chicken YAP cDNA as a probe. We screened a mouse embryo (16
day) cDNA library in the EXlox vector. Of 7 positive clones, 2
(mYAP6 and mYAP20) were shown to contain long inserts (approximately
2.3 and 3.6 kb long, respectively); the clones overlapped giving rise
to a 4-kb-long cDNA sequence terminating with a poly(A) stretch. As for
the hYAP, the longest open reading frame predicted a protein product
with significant sequence similarity to the chicken YAP. However, an
additional sequence of 38 amino acids was present in the middle of the
sequence (Fig. 2). Visual inspection of the insert sequence
suggested that it is an imperfect duplication of a sequence found
upstream (see underlined sequences in Fig. 1and Fig. 2). We have subjected this sequence to more detailed
analysis and found that the motif shares significant sequence and
structural similarities with sequences found in various regulatory and
signaling proteins(32) . Alignment of the chicken YAP, mYAP, and
hYAP also revealed long stretches of amino acid sequences that were
perfectly conserved (Fig. 2). Interestingly, the proline-rich
sequence (Fig. 2, indicated with a number sign),
implicated in binding chicken YAP to the SH3 domain of Yes, is 100%
conserved among the three sequences.
Evolutionary Conservation of YAP
A high degree of
sequence similarity between hYAP, mYAP, and chicken YAP was confirmed
by Southern blot analysis of the genomic DNAs digested with EcoRI enzyme (Fig. 3). Genomic DNA from other higher
eukaryotes also showed hybridization with the hYAP radioactive probe.
However, no specific signal was detected in yeast S.
cerevisiae.
Figure 3:
Southern blot analysis of genomic DNA from
nine eukaryotic species. The genomic DNA (4 µg) was digested with EcoRI, resolved on 0.7% agarose gel, transferred to a
charge-modified nylon membrane by blotting, and fixed by UV
irradiation. The DNA corresponding to the entire coding region of the
hYAP cDNA was used as a probe. Left panel (A-J) represents results of hybridization with the hYAP cDNA probe, and
the right panel (K-T) shows results of staining the
agarose gel with ethidium bromide to check for even DNA loading and
clear satellite bands. Lanes A and K contain HindIII DNA markers with sizes indicated in kilobases on the right side of the right panel. Lanes B and L contain human; C and M, monkey; D and N, rat; E and O, mouse; F and P, dog; G and Q, cow; H and R, rabbit; I and S, chicken; and J and T, yeast DNA. The exposure time was 4
days.
Expression of YAP Transcript
A major transcript of
approximately 5 kb was detected by Northern blot in various human
tissues. An additional band migrating below 2.4 kb was detected in some
of the tissues (see Fig. 4, lanes K, M, and O for example). The expression of hYAP mRNA is relatively high
in placenta, prostate, testis, ovary, and small intestine (Fig. 4, lanes C, K, L, M,
and N). Relatively lower levels of the message were found in
the brain, liver, and spleen (Fig. 4, lanes B, E, and I). We could not detect hYAP mRNA in the
preparation of human peripheral blood leukocytes even on overexposure
of the blot (Fig. 4, lane P).
Figure 4:
Northern blot analysis of
poly(A) RNA from 16 different human tissues.
Poly(A)
RNAs (2 µg each) from adult human tissues
were run on a denaturing formaldehyde-1.2% agarose gel, transferred to
a charge-modified nylon membrane by blotting, and fixed by UV
irradiation. The radiolabeled cDNA corresponding to the entire coding
region of the hYAP (insert of the hYAP6 clone) was used as a probe (upper panel). For normalization and to ensure the intactness
of the RNA, the blot was hybridized with a radiolabeled cDNA encoding
human
-actin (lower panel). Lane A, heart; B, brain; C, placenta; D, lung; E,
liver; F, skeletal muscle; G, kidney; H,
pancreas; I, spleen; J, thymus; K, prostate; L, testis; M, ovary; N, small intestine; O, colon; and P, peripheral blood leukocytes. An open arrow indicates hYAP mRNA. Two arrows indicate
-actin mRNAs. Note that heart and skeletal muscle and to lesser
degree prostate and small intestine contain an extra form of
-actin mRNA that is of 1.6-1.8 kb. The exposure times were 3
days for hYAP and 2 h for -actin.
Chromosomal Localization
The hYAP cDNA detected
two loci, one on chromosome 11 (11q13) and another on chromosome 6
(6q23-qter). When human DNA was digested with SstI restriction
enzyme and probed with radioactive hYAP cDNA, two strongly hybridizing
bands, one of 16 kb pairs and another migrating above 23 kb pairs, were
detected (not shown). In addition, we also observed less strongly
hybridizing bands. In the same analysis, rodent DNA digested with SstI and probed with hYAP cDNA showed fainter bands
distinguishable from the hYAP specific fragments (not shown). When DNAs
from a panel of rodent-human hybrids, each carrying a few human
chromosomes, were tested for the presence of the hYAP locus, it was
observed that the two strongly hybridizing bands segregated
independently and thus were on different chromosomes (not shown). The
results of the analysis of the rodent-human hybrid panel are summarized
in Fig. 5A. These data illustrate that one hYAP specific
locus maps to chromosome 11q and the other to chromosome 6. The less
strongly hybridizing bands did not seem to segregate with either of the
two major bands. The locus on chromosome 11q was the most intensely
hybridizing band and was thus presumed to represent the cognate hYAP
gene.
Figure 5:
Chromosomal localization of the hYAP gene. A, presence of the hYAP loci in a panel of 17 rodent-human
hybrids. DNA (10 µg) from various rodent-human hybrids was cleaved
with restriction enzyme SstI, electrophoresed, transferred to
nylon filter, and hybridized to radiolabeled hYAP cDNA probe. 
indicates that the hybrid named in the left column contains
the chromosome indicated in the upper row; ┌ indicates
the presence of the long arm of the chromosome (or part of the long arm
represented by a smaller fraction of stippling); ┘
indicates the presence of the short arm (or partial short arm) of the
chromosome; and indicates the absence of the chromosome listed
above the column. The column for chromosomes 6 and 11 are boldly
outlined and stippled to highlight correlation of the
presence of these chromosomes (or region of the chromosomes) with the
presence of the hYAP loci. The patterns of retention of the loci in the
panel are shown to the right of the figure where the presence
of a locus in a hybrid is indicated by a stippled box with a plus
sign, and the absence of a locus is indicated by an open box
enclosing a minus sign. B, regional chromosomal localization of
hYAP loci. Chromosome 6, the portion of chromosome 6 present
in specific hybrids is represented by the solid line to the
right of the chromosome 6 idiogram. Hybrids were tested by filter
hybridization as described under ``Experimental Procedures.''
The presence or absence of the hYAP-related locus is indicated below
the lines representing individual hybrids. The hYAP-related locus was
present only in hybrids which retained chromosome region
6p21-6qter in common. Results of fluorescence in situ hybridization (FISH) to normal human metaphases is illustrated to
the left of the chromosome 6 idiogram where each filled
circle represents two fluorescent signals. Chromosome 11,
hybrids carrying partial fragments of chromosome 11 are illustrated to
the right of the chromosome 11 idiogram with results of filter
hybridization to the hYAP cDNA shown below the lines representing
hybrids; the hYAP cognate locus is present only in hybrids which retain
11cen
11q13 in common. Hybrid CE4 retains a der 14 (14pter
14q32::11q13
11qter) from a B cell leukemia with a break
in the BCL1 major breakpoint region and is negative for the hYAP locus.
Thus, the hYAP gene is centromeric to the CCND1/BCL1 locus. Results of
FISH on normal human metaphases is illustrated to the left of
the chromosome 11 idiogram where each filled circle represents
two fluorescent signals.
In order to demonstrate that the 11q locus was indeed the
locus of the cognate gene, oligonucleotide primers flanking an
approximately 200-bp region of the 3`-UTR (cDNA positions
2135-2341, inclusive of primers) were synthesized and used in
polymerase chain reaction amplification with mouse, hamster, human, and
hybrid DNAs as templates. Amplification products were detected after
electrophoresis on 1.5% agarose gels containing ethidium bromide. No
product was amplified from rodent DNAs or from DNA hybrids containing
human chromosome 6 without chromosome 11, hybrid Nu9 for example. The
expected 200-bp fragment was observed after amplification from DNA
templates derived from human or hybrids retaining chromosome 11 but not
6, hybrids 734 and 7298 for example (data not shown). These data
suggest that the chromosome 6 locus represents a YAP-related locus
rather than a pseudogene.
Protein Domain
The presence of an extra sequence
in the murine YAP as compared to the human and chicken orthologs
focused our attention on this motif and led us to propose it as a new
protein module, the WW domain(32) . The domain appears to
contain -strands grouped around four conserved aromatic positions (Fig. 6). Two of these positions are most frequently occupied by
tryptophans, hence the name, the WW domain. Other important features of
the domain are a high content of polar amino acids and the presence of
prolines distributed preferentially toward both termini of the linear
sequence. One of the carboxyl-terminal prolines at the seventh amino
acid from the end is invariably conserved (Fig. 6). The length of
the WW domain was set at 38 residues, which corresponds to the length
of the second WW motif (the insert) identified in the mouse ortholog of
YAP (Fig. 2). Interestingly, the sequence similarity among WW
domains ends rather abruptly beyond the 38 amino acids. If indeed the
38 amino acids of the WW motif compose a structured domain, the size
would be relatively small compared with the SH2, SH3, or PH domain.
There are two other features of the WW motif which also suggest a
protein module. As with the SH3 domain, the WW sequence occurs
frequently in multiple repeats within the same molecule: from two
repeats in mouse YAP, for example, to four repeats in the human homolog
of Nedd-4 (Fig. 7). In addition, most of the proteins that
contain the WW motif(s) also contain other functional domains, either
catalytic or structural (e.g. Rsp5 and 38D4, see
``Discussion'').
Figure 6:
Alignment of selected WW domains. Computer
programs used in the analysis of the protein sequences and in
predicting their secondary structures were as described under
``Experimental Procedures.'' The consensus line displays
conserved features (capitals, conserved amino acids; h, hydrophobic; t, turn-like or polar). Two amino
acids, W and P, are 100% conserved in all WW domains listed and are
shown in bold. Dots indicate spaces introduced in order to
optimize the alignment. Question marks denote lack of the full
open reading frame for a given protein; therefore, the precise location
of the WW domain within a protein was not possible. (For more
information on the entries, see Ref. 32 and ``Results'' for
the availability of constantly updated information on the WW alignment
through the www network.)
Figure 7:
Modular structure of proteins containing
the WW domains. The WW domain is indicated by a black box. The
C2 domain is shared with some forms of protein kinase C,
synaptotagmins, and C. elegans Unc-13 protein; the HECT domain is found at the carboxyl termini of Rsp5, E6-AP, UreB1,
Nedd4, a hypothetical yeast protein (Ykbo), and 56G7 protein from C. elegans, and it encodes ubiquitin-protein ligase activity
(58-60); other catalytic domains shown are: Ras-GTPase
activator-like domain; breakpoint cluster region homology domain that
is shared with Grb-1, n-chimaerin, and other signaling
molecules (48, 49); and an ATP-dependent RNA helicase; PH,
pleckstrin homology domain; actin-binding domain shares similarity with
actinin and spectrin; the Y domain is common to Yo61 and Ykb2
and its function is not known; Mp domain shows similarity to a
fly muscle protein mp20; C/H indicates a region rich in
cysteine and histidine; P denotes a proline-rich region in YAP
implicated in binding to the SH3 domain of Yes, Src, and Nck (31). Dashed lines indicate that only partial sequence data were
available. For the purpose of clarity, some of the proteins and domains
were not drawn to scale.
Examination of the primary sequence of
the WW domains indicated that WW domains of YAP, Nedd-4 (Ref. 46), and
Rsp5 (Ref. 47) show more similarity to each other than to WW domains of
other proteins. It is likely that these domains share certain
functional features; for example, they could interact with similar
ligands or localize the proteins to similar cellular compartments. When
the repeats of the WW domains within the same protein are examined, the
second or third WW domain does not necessarily show as high a sequence
similarity to the first WW domain as one would expect from a recent
evolutionary duplication event, but does show a high similarity to WW
domains of other proteins. For example, the second domain in mYAP is
more similar to one of the WW domains of the yeast Rsp5 gene product
than to the first domain in mYAP (Fig. 6). This suggests that
multiple WW domains within the same molecule may not be redundant but
could have evolved to carry out subtly diverged functions.
bork/ww1.html) since December 1994. Both the
alignment and a diagram with the modular structure of proteins
containing the WW domain(s) ( Fig. 6and Fig. 7) are
available via www network and will be updated by us (P. B. and M. S.)
frequently.
()Taken
together, these data suggest an involvement of the WW domain in the Ras
and/or MAP kinase signaling pathways.
()It is unlikely that Rsp5 and Spt3 proteins interact,
since Rsp5 mutations suppress a deletion of Spt3. It is more likely
that this interaction is indirect because the rsp5 gene was
recently isolated by researchers in several other laboratories studying
various aspects of cytoplasmic signaling in yeast.
()One of the explanations for this apparent diversity
of roles in signaling could come from biochemical studies of Rsp5,
showing that its catalytic domain (designated HECT, Fig. 7) can form a high energy thioester bond with ubiquitin,
therefore proving that the Rsp5 protein is indeed a ubiquitin-protein
ligase(58, 59, 60) . It is likely that nedd-4, the gene whose expression is modulated during early
development of the central nervous system, encodes the similar
enzymatic activity as Rsp5 (60). Since ubiquitination is directly
related to protein metabolism, and the WW domains in Rsp5 and Nedd-4
could be considered as molecular adhesive to anchor the ligase to the
appropriate targets, one could speculate that a ligand for the WW
domain, in general, is of a proteinaceous nature and that this domain
represents a module mediating protein-protein interaction. Two types of
preliminary data support our hypothesis. (i) We have recently
identified and cloned two cDNAs for low molecular weight proteins that
bind specifically to the WW domain of hYAP.
()The
analyses of the partial DNA sequences of the putative ligands suggest
two novel gene products. We anticipate that as in the case of 3BP1 and
3BP2 proteins, and the SH3 domain of Abl(61) , the isolation of
two independent sequences by a functional assay will help us to define
the region that interacts directly with the WW domain. It is hoped that
the two sequences will share a significant sequence similarity over
this region. (ii) We have recently determined preliminary NMR spectra
of the WW domain of hYAP; the results suggest a structured
domain.()
-actinin and
-spectrin(62) . Mutations of this gene cause the
degenerative diseases, Duchenne and Becker muscular
dystrophies(62) . The WW domain of dystrophin is located in the
carboxyl-terminal part of this large protein, close to the site which
connects the molecule with membranes through the -dystroglycan
receptor(63) . Although the WW domain is extremely well
conserved among dystrophins from different vertebrates (100% between
human and chicken, for example) (64) and the preliminary data we
obtained recently on the existence of protein ligands and structure for
the WW domain are pointing to this part of the molecule as a putative
``signaling module,'' there is no direct evidence to support
our daring proposal of the WW domain as a signaling site in
dystrophin(32) . The current survey of available point mutations
and short deletions identified in the dystrophin (65) from
muscular dystrophy patients does not show any genetic lesions that
would map to the conserved residues within the WW domain, although it
is clear that any stop-codon mutation that maps before the WW domain
and abrogates the carboxyl terminus of dystrophin causes the more
severe, Duchenne type of dystrophy. With the availability of an animal
model for muscular dystrophy (mdx mice), one could gather genetic
evidence as to the role of the dystrophin WW module directly, through
transgenic approaches.
Yeast bck1 gene encodes a kinase (MAP kinase kinase
kinase), which functions downstream of Pkc1 (yeast protein kinase C)
and upstream of Mkk1/Mkk2 (MAP kinase kinase)(66) .
Surprisingly, the msb1 gene was also found to be able to
suppress the mpk1 (yeast MAP kinase) mutation. Therefore, it is possible that msb1 may function
downstream of mpk1. This genetic system provides a powerful
tool to assay the role of the WW domain in the protein kinase C and MAP
kinase pathways in yeast and to extend these studies to a mammalian
model.
()This
recent result suggests the presence of two isoforms of YAP in human as
well as in mouse. Since two putative ligand proteins for ``the
first'' WW domain of hYAP were identified, we hope that these
reagents will advance functional and structural studies of this new
module.
/EMBL Data Bank with accession number(s) X80507 (human
YAP65) and X80508 (mouse YAP65).
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  F. Zeng, J. Xu, and R. C. Harris Nedd4 mediates ErbB4 JM-a/CYT-1 ICD ubiquitination and degradation in MDCK II cells FASEB J, June 1, 2009; 23(6): 1935 - 1945. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Oka and M. Sudol Nuclear localization and pro-apoptotic signaling of YAP2 require intact PDZ-binding motif Genes Cells, May 1, 2009; 14(5): 607 - 615. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zhao, J. Kim, X. Ye, Z.-C. Lai, and K.-L. Guan Both TEAD-Binding and WW Domains Are Required for the Growth Stimulation and Oncogenic Transformation Activity of Yes-Associated Protein Cancer Res., February 1, 2009; 69(3): 1089 - 1098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kawahara, T. Hori, K. Chonabayashi, T. Oka, M. Sudol, and T. Uchiyama Kpm/Lats2 is linked to chemosensitivity of leukemic cells through the stabilization of p73 Blood, November 1, 2008; 112(9): 3856 - 3866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Oka, V. Mazack, and M. Sudol Mst2 and Lats Kinases Regulate Apoptotic Function of Yes Kinase-associated Protein (YAP) J. Biol. Chem., October 10, 2008; 283(41): 27534 - 27546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Omerovic, L. Santangelo, E. M.-R. Puggioni, J. Marrocco, C. Dall'Armi, C. Palumbo, F. Belleudi, L. Di Marcotullio, L. Frati, M.-R. Torrisi, et al. The E3 ligase Aip4/Itch ubiquitinates and targets ErbB-4 for degradation FASEB J, September 1, 2007; 21(11): 2849 - 2862. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Kulman, J. E. Harris, L. Xie, and E. W. Davie Proline-rich Gla protein 2 is a cell-surface vitamin K-dependent protein that binds to the transcriptional coactivator Yes-associated protein PNAS, May 22, 2007; 104(21): 8767 - 8772. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Leykauf, M. Salek, J. Bomke, M. Frech, W.-D. Lehmann, M. Durst, and A. Alonso Ubiquitin protein ligase Nedd4 binds to connexin43 by a phosphorylation-modulated process. J. Cell Sci., September 1, 2006; 119(Pt 17): 3634 - 3642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. I. Aqeilan, V. Donati, A. Palamarchuk, F. Trapasso, M. Kaou, Y. Pekarsky, M. Sudol, and C. M. Croce WW Domain-Containing Proteins, WWOX and YAP, Compete for Interaction with ErbB-4 and Modulate Its Transcriptional Function Cancer Res., August 1, 2005; 65(15): 6764 - 6772. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Mani and E. P. Gelmann The Ubiquitin-Proteasome Pathway and Its Role in Cancer J. Clin. Oncol., July 20, 2005; 23(21): 4776 - 4789. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Tian, D. Li, J. Dahl, J. You, and T. Benjamin Identification of TAZ as a Binding Partner of the Polyomavirus T Antigens J. Virol., November 15, 2004; 78(22): 12657 - 12664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Howell, C. Borchers, and S. L. Milgram Heterogeneous Nuclear Ribonuclear Protein U Associates with YAP and Regulates Its Co-activation of Bax Transcription J. Biol. Chem., June 18, 2004; 279(25): 26300 - 26306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Komuro, M. Nagai, N. E. Navin, and M. Sudol WW Domain-containing Protein YAP Associates with ErbB-4 and Acts as a Co-transcriptional Activator for the Carboxyl-terminal Fragment of ErbB-4 That Translocates to the Nucleus J. Biol. Chem., August 29, 2003; 278(35): 33334 - 33341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Serhan, N. Jourdan, S. Saleun, P. Moullier, and G. Duisit Characterization of Producer Cell-Dependent Restriction of Murine Leukemia Virus Replication J. Virol., June 5, 2002; 76(13): 6609 - 6617. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Patnaik and J. W. Wills In Vivo Interference of Rous Sarcoma Virus Budding by cis Expression of a WW Domain J. Virol., February 22, 2002; 76(6): 2789 - 2795. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Schmidt, R. Rudolph, and G. Bohm Binding of external ligands onto an engineered virus capsid Protein Eng. Des. Sel., October 1, 2001; 14(10): 769 - 774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dong, E. Loukinova, Z. Chen, L. Gangi, T. I. Chanturita, E. T. Liu, and C. Van Waes Molecular Profiling of Transformed and Metastatic Murine Squamous Carcinoma Cells by Differential Display and cDNA Microarray Reveals Altered Expression of Multiple Genes Related to Growth, Apoptosis, Angiogenesis, and the NF-{{kappa}}B Signal Pathway Cancer Res., June 1, 2001; 61(12): 4797 - 4808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Vassilev, K. J. Kaneko, H. Shu, Y. Zhao, and M. L. DePamphilis TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm Genes & Dev., May 15, 2001; 15(10): 1229 - 1241. [Abstract] [Full Text]
|
|
|
|
|
|
I. Landrieu, L. De Veylder, J.-S. Fruchart, B. Odaert, P. Casteels, D. Portetelle, M. Van Montagu, D. Inze, and G. Lippens The Arabidopsis thaliana PIN1At Gene Encodes a Single-domain Phosphorylation-dependent Peptidyl Prolyl cis/trans Isomerase J. Biol. Chem., March 31, 2000; 275(14): 10577 - 10581. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Mohler, S. M. Kreda, R. C. Boucher, M. Sudol, M. J. Stutts, and S. L. Milgram Yes-associated Protein 65 Localizes p62c-Yes to the Apical Compartment of Airway Epithelia by Association with EBP50 J. Cell Biol., November 15, 1999; 147(4): 879 - 890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. N. Harty, J. Paragas, M. Sudol, and P. Palese A Proline-Rich Motif within the Matrix Protein of Vesicular Stomatitis Virus and Rabies Virus Interacts with WW Domains of Cellular Proteins: Implications for Viral Budding J. Virol., April 1, 1999; 73(4): 2921 - 2929. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Kuriyama, H. Takano, L. Suzuki, H. Uchida, S. Kawano, H. Kuroiwa, and T. Kuroiwa Characterization of Chlamydomonas reinhardtii Zygote-Specific cDNAs That Encode Novel Proteins Containing Ankyrin Repeats and WW Domains Plant Physiology, March 1, 1999; 119(3): 873 - 884. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Garoff, R. Hewson, and D.-J. E. Opstelten Virus Maturation by Budding Microbiol. Mol. Biol. Rev., December 1, 1998; 62(4): 1171 - 1190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Puffer, S. C. Watkins, and R. C. Montelaro Equine Infectious Anemia Virus Gag Polyprotein Late Domain Specifically Recruits Cellular AP-2 Adapter Protein Complexes during Virion Assembly J. Virol., December 1, 1998; 72(12): 10218 - 10221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Kops, C. Eckerskorn, S. Hottenrott, G. Fischer, H. Mi, and M. Tropschug Ssp1, a Site-specific Parvulin Homolog from Neurospora crassa Active in Protein Folding J. Biol. Chem., November 27, 1998; 273(48): 31971 - 31976. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hirao, Y. Hata, N. Ide, M. Takeuchi, M. Irie, I. Yao, M. Deguchi, A. Toyoda, T. C. Sudhof, and Y. Takai A Novel Multiple PDZ Domain-containing Molecule Interacting with N-Methyl-D-aspartate Receptors and Neuronal Cell Adhesion Proteins J. Biol. Chem., August 14, 1998; 273(33): 21105 - 21110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Dowbenko, S. Spencer, C. Quan, and L. A. Lasky Identification of a Novel Polyproline Recognition Site in the Cytoskeletal Associated Protein, Proline Serine Threonine Phosphatase Interacting Protein J. Biol. Chem., January 9, 1998; 273(2): 989 - 996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Dobrosotskaya, R. K. Guy, and G. L. James MAGI-1, a Membrane-associated Guanylate Kinase with a Unique Arrangement of Protein-Protein Interaction Domains J. Biol. Chem., December 12, 1997; 272(50): 31589 - 31597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. R. Gavva, R. Gavva, K. Ermekova, M. Sudol, and C.-K. J. Shen Interaction of WW Domains with Hematopoietic Transcription Factor p45/NF-E2 and RNA Polymerase II J. Biol. Chem., September 26, 1997; 272(39): 24105 - 24108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. I. Chen, A. Einbond, S.-J. Kwak, H. Linn, E. Koepf, S. Peterson, J. W. Kelly, and M. Sudol Characterization of the WW Domain of Human Yes-associated Protein and Its Polyproline-containing Ligands J. Biol. Chem., July 4, 1997; 272(27): 17070 - 17077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Pirozzi, S. J. McConnell, A. J. Uveges, J. M. Carter, A. B. Sparks, B. K. Kay, and D. M. Fowlkes Identification of Novel Human WW Domain-containing Proteins by Cloning of Ligand Targets J. Biol. Chem., June 6, 1997; 272(23): 14611 - 14616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Adachi, Y. Takahashi, T. Hasebe, M. Shirouzu, S. Yokoyama, and K. Sutoh Dictyostelium IQGAP-related Protein Specifically Involved in the Completion of Cytokinesis J. Cell Biol., May 19, 1997; 137(4): 891 - 898. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Uetz, S. Fumagalli, D. James, and R. Zeller Molecular Interaction between Limb Deformity Proteins (Formins) and Src Family Kinases J. Biol. Chem., December 27, 1996; 271(52): 33525 - 33530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Landrieu, B. Odaert, J.-M. Wieruszeski, H. Drobecq, P. Rousselot-Pailley, D. Inze, and G. Lippens p13SUC1 and the WW Domain of PIN1 Bind to the Same Phosphothreonine-Proline Epitope J. Biol. Chem., January 5, 2001; 276(2): 1434 - 1438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Bedford, A. Frankel, M. B. Yaffe, S. Clarke, P. Leder, and S. Richard Arginine Methylation Inhibits the Binding of Proline-rich Ligands to Src Homology 3, but Not WW, Domains J. Biol. Chem., May 19, 2000; 275(21): 16030 - 16036. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |