Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacronique, V.
Right arrow Articles by Raymondjean, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacronique, V.
Right arrow Articles by Raymondjean, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 25, Issue of June 23, pp. 14989-14997, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification and Functional Characterization of an Erythroid-specific Enhancer in the L-type Pyruvate Kinase Gene (*)

Virginie Lacronique , Soledad Lopez , Lucile Miquerol , Arlette Porteu , Axel Kahn (§) , Michel Raymondjean

From the (1)Institut Cochin de Génétique Moléculaire, Unité 129 INSERM, Université René Descartes, 75014 Paris, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The rat L-type pyruvate kinase gene is transcribed either from promoter L in the liver or promoter L` in erythroid cells. We have now cloned and functionally characterized an erythroid-specific enhancer, mapped in the fetal liver as hypersensitive site B (HSSB) at 3.7 kilobases upstream from the promoter L`. Protein-DNA interactions were examined in the 200-base pair core of the site by in vivo footprinting experiments. In the fetal liver, footprints were revealed at multiple GATA and CACC/GT motifs, whose association is the hallmark of erythroid-specific regulatory sequences. Functional analysis of the HSSB element in transgenic mice revealed properties of a cell-restricted enhancer. Indeed, this element was able to activate the linked ubiquitous herpes simplex virus thymidine kinase promoter in erythroid tissues. The activation was also observed in a variety of nonerythroid tissues known to synthesize GATA-binding factors. In the context of L`-PK transgenes, HSSB was not needed for an erythroid-specific activation of the L` promoter, while it was required to stimulate the L` promoter activity to a proper level. Finally, HSSB cannot be replaced by strong ubiquitous viral or cellular enhancers, suggesting a preferential interaction of the HSSB region with the L` promoter.


INTRODUCTION

The use of alternative promoters is a common mechanism of tissue- and development-specific gene expression. The rat L-type pyruvate kinase gene (L-PK)()affords a good example of such a mechanism since it encodes two tissue-specific isoforms of a glycolytic enzyme (EC 2.7.1.40), transcribed from two alternative promoters, located 500 bp apart. These two promoters direct the transcription of erythroid- (L`) and liver-specific (L) mRNAs, which differ only by their first exon(1, 2) . In fact, the L promoter is also active in two other gluconeogenic tissues, i.e. the small intestine and proximal tubules of the kidney(3) . The L` promoter is strictly specific to erythroid cells. It is active in the fetal liver during its period of hematopoietic activity and in the adult bone marrow and spleen, which is an erythropoietic organ in rodents. In the liver, the amount of L`-mRNA decreases a few days after birth, when erythropoiesis stops in this organ. Sequences involved in the tissue-specific expression from the erythroid L` promoter have been characterized either in vitro(4) or in transient transfection assays(5) . Footprinting experiments and site-directed mutagenesis of a 300-bp proximal L` promoter fragment have revealed that the promoter requires a cluster of binding sites for the hematopoietic restricted protein GATA-1- and CACC/GT-binding factors (4, 5). In vivo, this region corresponds to a strong DNase I hypersensitive site (HSSA) detected in the fetal liver (6) (see Fig. 1A). Transcriptional activity of transgenes carrying this L` promoter plus 2.7 kb of 5`-flanking sequence, although specific to erythropoietic tissues such as fetal liver, spleen, and bone marrow, was low in all transgenic lines as compared to that of the endogenous gene(7) . Therefore, we hypothesized that the transgenic constructs used in these experiments were lacking an essential positive control element. Since a second DNase I erythroid-specific hypersensitive region (HSSB), previously identified far upstream from the gene, was lacking in all of these microinjected constructs(6, 7) , we decided to isolate the DNA fragment carrying HSSB and to investigate its effects on the expression from the L` promoter.


Figure 1: Mapping of an erythroid-specific DNase I HSSB and isolation of the rat genomic clone 3 spanning this site. A, the upper panel represents a schematic drawing of the rat L-type pyruvate kinase genomic clone and the DNase I hypersensitive sites flanking the gene (6) (not to scale). Rectangles indicate the position of the erythroid-specific first exon L` (shaded box) and the hepatic-specific first exon L (open box). The sensitive regions mapped in native chromatin of high expressing tissues are indicated by vertical arrows, in the fetal liver, used as a source of erythroid cells, and in the adult liver. Numbers below the sites indicate their locations relative to the erythroid cap site. The lower panel shows a partial restriction map of the rat 3 genomic clone (not to scale). The location of the 4.5-kb BamHI restriction fragment bearing the hypersensitive HSSB region is represented by an open box. This fragment was further subcloned and entirely sequenced. B, fine mapping of HSSB in the fetal liver chromatin. Nuclei from liver of 17-day-old rat embryos were treated with increasing amounts of DNase I prior to DNA isolation and digested with BamHI. The resulting blot was hybridized with a probe located either 5` (probe A) or 3` (probe B) of the HSSB region. The map indicates the positions of probes A and B (hatched boxes) and the lengths of restriction fragments generated. The HSSB position is indicated by arrow. This hypersensitive site B was not detected in nonexpressing tissues such as adult liver and brain (6) (data not shown).




MATERIALS AND METHODS

Library Screening and Sequencing

3 10 plaques of a EMBL3 rat genomic DNA library were screened with a 377-bp DNA fragment extending from -2721 to -2344 (arbitrarily, the L` start site of transcription will be referred to as (+1) throughout this report(7) . Filters were hybridized at 65 °C in the following mix: 3 SSC, 10% (w/v) polyethylene glycol, 1% (w/v) glycine, 1% (w/v) SDS, 0.2% (w/v) Ficoll, 0.2% (w/v) polyvinylpyrrolidone, supplemented with 50 µg/ml salmon sperm DNA, and washed in 2 SSC, 0.1% SDS at 65 °C. The probe was prepared and radiolabeled by PCR (8). Restriction mapping, combined with oligonucleotide hybridization, revealed that one genomic clone (3) contained the L` promoter and more than 15 kb of 5`-flanking sequences. A 4.5-kb BamHI restriction fragment was subsequently subcloned into pEMBL18+. The 5` end of this fragment (spanning from nt -5231 to -2721) was then sequenced on both strands by primer walking using the dideoxynucleotide chain-termination method with the Sequenase kit (U.S. Biochemical Corp.).

DNase I Hypersensitivity Analysis

Nuclei were isolated from 17-day-old rat liver fetuses and digested by increasing amounts of DNase I as previously described(6) . DNA samples were purified, digested by BamHI, and analyzed on a Southern blot by hybridization with a probe located either 5` (nt -5231 to -4850; probe A) or 3` (nt -3197 to -2721; probe B) of the HSSB site, labeled by random priming with [-P]dCTP.

Construction of Hybrid Genes

A pEMBL8+ plasmid containing the entire rat L-type pyruvate kinase gene plus 2.7 and 1.4 kb of the 5`- and 3`-flanking regions, respectively, was used to achieve two types of constructs(6, 7) . First, the PK minigene was created by excision of 4.7 kb between the first and ninth intron of the pyruvate kinase gene by BglII digestion and religation. The second type of constructs corresponded to three PK-Tag chimeric genes: (i) a PK-Tag hybrid gene containing 2.7 kb of 5`-regulatory sequences of the PK gene, controlling the expression of large T and little t SV40 antigens, whose expression in transgenic mice has been previously reported(3) ; (ii) enh SV40-PK-Tag, a hybrid gene containing the 72-bp repeats of enhancer SV40 spanning positions 95-270, inserted into the ClaI site(-532) of the PK-Tag construct; (iii) enh H-PK-Tag, a hybrid gene containing the H enhancer of the human aldolase A gene, extending from nt +2610 to +3100 of the published sequence (9) and subcloned into the ClaI site(-532) of the PK-Tag construct.

The erythroid-specific DNase I hypersensitive site HSSB was contained in a 4.5-kb BamHI fragment of the genomic clone 3, and subcloned into pEMBL18+. The resulting plasmid named HSSB-pEMBL18+ was taken as the source for two constructs. HSSB-PK minigene was constructed by inserting a KpnI fragment spanning from nt -989 to +9455 of the PK minigene into the KpnI site of HSSB-pEMBL18+; it contained 5225 bp of 5`-flanking region. HSSB-tk-CAT was obtained by insertion of a BamHI-EcoRI fragment spanning from nt -5230 to -3197, upstream of the CAT gene in pBLCAT2, which contains the thymidine kinase promoter (nt -105 to +51) and the SV40 early polyadenylation signal(10) .

Production and Detection of Transgenic Mice

Plasmid DNA was digested with HindIII and ScaI for the HSSB-PK minigene, HindIII and ClaI for HSSB-tk-CAT, XbaI and ClaI for tk-CAT, and EcoRI and PvuI for enh SV40-PK-Tag and enh H-PK-Tag. The different inserts excised from the plasmids were purified on Elutip-d columns (according to the instructions of the supplier Schleicher & Schuell) and microinjected into fertilized mouse eggs by the method reported by Tremp et al.(7) . Transgenic mice were detected by Southern blot analysis of 5 µg of DNA isolated from 2-week-old mouse tail biopsies, using appropriate restriction enzymes and probes. Transgene copy number was determined by scanning autoradiograms with a Shimatzu densitometer with determined amounts of the injected DNA as standard. Positive founders F mice were outbred to establish transgenic lines. All subsequent studies were performed on F mice and 12-18-day-old fetuses.

Isolation of Total RNA; RT-PCR Amplification and Nuclease S1 Protection Analyses

Total RNA was prepared from various tissues by the guanidium thiocyanate procedure(11) . First strand cDNA synthesis and PCR amplification were performed as described by Miquerol et al.(12) . The sequence of synthetic oligonucleotides used in PCR amplification experiments is: 5`-CACGCTTTGGAAGCATG-3`, which is complementary to a segment of the erythroid-specific first exon; 5`-CACATCATCTGCCCAGATGG-3`, complementary to a segment of exon 10. Oligonucleotides specific to the rat -actin gene were used as internal amplification standard. They allow for the amplification of both rat and mouse -actin mRNAs(12) . Amplification products were run through 6% (w/v) polyacrylamide gels, transferred onto a nylon membrane, and hybridized with radiolabeled specific oligonucleotides.

The template used for S1 nuclease protection assays was a 1944-bp KpnI-BglII fragment (nt -989 to +955, subcloned into M13mp18) encompassing the two promoters. To map the start sites of transcription of L` transcripts, an antisense single-stranded probe was synthesized by extension of a specific oligonucleotide complementary to nt +164 to +181, located in the first intron; the probe was excised by digestion with StyI(-160). To map the start sites of transcription of L transcripts, extension was made with a specific oligonucleotide complementary to nt +546 to +563. Located in the first intron downstream of the exon L, the probe was excised by digestion with NheI (+378). Both antisense probes were labeled by extension of the primers in the presence of two [-P]dNTPs adjacent to the 3` end of the oligonucleotides and the Klenow fragment of DNA polymerase I (quasi-end labeling, previously reported in Tremp et al.(7) . Nuclease S1-resistant hybrids were detected as described previously(7) .

CAT Assays

Tissue samples were treated as described by Cuif et al.(13) , and CAT activity was assayed according to the standard methods(14) . Specific activities were expressed as counts/min of reaction and per mg of protein.

In Vivo Footprinting

17-day-old rat fetal liver and adult brain were treated by DMS, and genomic DNA was purified as described previously(4) . Isolated nuclei were treated by DNase I as in standard DNase I hypersensitivity experiments(6) , but with 4-8 times reduced amounts of DNase I. Genomic DNA sequencing by ligation-mediated PCR method was performed according to Mueller and Wold(15) . Two sets of primers were used to obtain sequence information on both strands of the HSSB site. They were used for the Sequenase extension reaction (primer 1), the PCR amplification reaction (primer 2), and the labeling reaction (primers 3 and 4).

The primer set for the upper strand analysis was as follows: V1 -3520 to -3540: TAGCAGGCAAGTGCAGCTGTG; V2 -3527 to -3549: CAAGTGCAGCTGTGCTCTAGGCG; V3 -3541 to -3562: CTCTAGGCGGGAGGACACAGCC; V4 -3610 to -3630: AGAGAGCCGCGGCGGTCGGGC. The primer set for the lower strand analysis was as follows: V1R -3828 to -3809: GGCAGCAGAGTGCAACGTGC; V2R -3824 to -3802: GCAGAGTGCAACGTGCAGTTCGC; V3R -3817 to -3793: CAACGTGCAGTTCGCGTGCTACGGG; V4R -3735 to -3712: GATCATAGCACTCCGCGCAACCCC.


RESULTS

Cloning of a 5` Genomic Fragment of the L-PK Gene and Fine Mapping of the Erythroid-specific DNase I Hypersensitive Site (HSSB)

In order to characterize the erythroid-specific HSSB element, we isolated from a rat DNA genomic library a 20-kb clone (clone 3) containing the 5` distal region of the L-PK gene (Fig. 1A). This clone overlapped at its 3` end with our previous L-PK genomic clone and contained 15 kb of additional 5`-flanking sequence. A subsequent 4.5-kb BamHI restriction fragment was used to generate new probes (probes A and B) to accurately localize the previously described HSSB element (Fig. 1B). DNA purified from DNase I-treated nuclei of 17-day-old rat fetal livers, used as source of erythroid cells, was digested with BamHI, and the fragments were electrophoresed in agarose before Southern blotting and hybridization with either probe A or probe B, as shown in Fig. 1B. These experiments showed cleavage of the 4.5-kb genomic BamHI fragment to give diffuse bands at about 1.5 and 3 kb with the probe A and the probe B, respectively. These results, in good agreement with the previous data (6), have allowed us to delineate the hypersensitive site to a 200-bp region, extending from nt -3800 to -3600 upstream of the erythroid-specific cap site. Other experiments have failed to detect HSSB in rat adult liver and brain tissues (not shown). The complete sequence of the 200-bp core of HSSB is presented in Fig. 2.


Figure 2: Sequence and footprinting analyses of the 200-bp core HSSB region. Derived from data exemplified in Fig. 3 and from data not shown. A, nucleotide sequence of the HSSB region analyzed by in vivo footprinting assays (nt -3830 to -3540). Nucleotides are numbered relative to the erythroid cap site. The putative GATA- and CACC/GT-binding sites are indicated by bold type. The NF-E4-binding motif (around -3760) and Sp1-binding sequence (around -3620) are denoted by dotted lines. Since in vitro binding assays failed to give clear interactions, results are not represented here except for two DNase I hypersensitive nucleotides indicated by vertical arrows. The pattern of protection of in vivo DNase I footprinting is represented by horizontal bars. White and black circles indicate protected and hyperreactive residues in the in vivo DNase I footprint experiments, respectively. Most of these mapping data are obtained from analyses of the upper strand. Protection and hyperreactivities of the DMS reaction on both G and A residues are represented by white and black stars, respectively. B, distribution of nuclear factor-binding motifs mapped by in vivo footprinting assays. Consensus cis-regulatory sequences are indicated by shaded boxes and nonconsensus motifs are represented by clear boxes. Binding sites are oriented by arrows. Fetal liver-specific footprints (FL) are defined as I-VII, from the 5` end of HSSB and indicated by solid lines; footprints observed in brain tissue are indicated by broken lines.



Analysis of Protein-DNA Interactions on the 200-bp of HSSB (-3800 to -3600) in Erythroid Cells

The array of nuclear factors binding to the 200-bp core of the HSSB region was determined by in vivo footprinting analyses. To gain maximal information about protein-DNA interactions, we performed the in vivo analysis with two specific DNA cleavage methods: the DMS procedure, allowing for the identification of the nucleotides involved in protein-DNA contacts, and the DNase I procedure, as a complementary approach for the detection of protein occupancy on binding sites. Footprinting results are illustrated in Fig. 3. In vivo footprinting analysis showed interactions with nuclear proteins in erythroid cells, scattered all over the hypersensitive region. These interactions being more obvious on the upper strand than on the lower one, we present here data that concern only the upper strand. The in vivo interactions revealed by DMS reactivity consisted of hypersensitive residues rather than protected residues and were very weak compared with those obtained with in vivo DNase I cleavage. In vivo protein occupancy within the HSSB region is summarized in Fig. 2.


Figure 3: In vivo genomic footprinting of the upper strand of the HSSB region. A, in vivo DNase I footprinting of the 200-bp core of the site in the liver of 17-day-old rat fetuses. Lanes G represent in vitro DMS-methylated DNA of fetal liver, used as sequence ladder. Lanes FREE represent in vitro DNase I cleaved DNA of fetal liver, referred to as the control DNA. Lanes FETAL LIVER represent in vivo DNase I-cleaved DNA of fetal liver. Protected residues, numbered I-VII from the 5` end of the site, are indicated by brackets; protected and hypersensitive residues are indicated by white and black circles, respectively. In B, we present a close-up, indicated by two arrows, from the region spanning from nt -3800 to -3630. Vertical dotted lines present protected residues in brain tissue. C, in vivo DMS footprinting of the same region than in B. Protections and hyperreactivities of DMS reaction on both G and A residues are indicated by white and black stars, respectively.



DNase I in vivo footprinting analysis of the 200-bp core region revealed protein occupancy of seven boxes, numbered I-VII in Fig. 2and Fig. 4. Boxes II, IV, and V encompass several putative binding motifs for the erythroid nuclear factor GATA-1 (for review, see Ref. 16); two of them conforming the consensus sequence WGATAR and the others being significantly different from this motif (see Fig. 2). Boxes I and III consist of two putative CACC/GT motifs. These motifs have been characterized as binding sites for either ubiquitous factors Sp1 (17) and TEF2 (18) or the erythroid-specific EKLF (19) and CACD (20) proteins. Box VI corresponds to a GC-rich sequence, similar to the binding site for proteins of the Sp1 family. Finally, the sequence of the box VII does not give any clue on the nature of the cognate binding factor. Furthermore, a close examination of the 200-bp core fragment reveals additional elements related to GATA (nt -3653) and CACC/GT (nt -3576), but these motifs are not protected in the in vivo DNase I footprinting experiments (Fig. 2). Box I contains, in addition to the CACC/GT motif, a poly(pu) region homologous to the AGGAGGA sequence present in the promoter and enhancer of the chicken -globin gene(21) , and in the human A-globin gene 3` enhancer(22) . The AGGAGGA motif has been reported to interact with an erythroid-specific factor NF-E4, expressed during the late stages of definitive erythropoiesis(23) .


Figure 4: Maps of transgenic constructs. A, PK-minigene was created by a 4.7-kb internal deletion between the first and the ninth introns of the pyruvate kinase gene. It contains 2.7 kb of the 5`-flanking region. The HSSB-PK minigene was constructed by inserting a 10.4-kb long fragment of PK minigene into the KpnI cut HSSB-pEMBL18+ vector (see ``Materials and Methods''). It contains 5225 bp of the 5`-flanking region. Shadowed and white boxes represent the erythroid- and liver-specific exons, respectively. The arrowhead indicates the erythroid transcriptional start site of the L-PK gene (+1). B, schematic representation of PK-Tag transgenes. The PK-Tag microinjected construct derived from our previous L-PK genomic clone and expression in transgenic mice has been previously reported (3). The 72-bp repeats of SV40 enhancer and H enhancer of the human aldolase A gene (9) were fused to PK 5` regions at nt -532 of the PK-Tag construct. C, structure of the HSSB-tk-CAT hybrid gene. HSSB-tk-CAT was obtained by the insertion of a 2030-bp long fragment encompassing the HSSB site, upstream of the thymidine kinase promoter from HSV spanning from nt -105 to +51 and the CAT structural gene SV40 poly(A) cassette (hatched box). The designation of each mouse line and the corresponding copy number are given on the right.



The fetal liver protection pattern differs from the ones observed in the brain (Fig. 3) and the adult liver (not shown), in which the erythroid L` promoter is inactive. Nevertheless, some footprints can be observed in these two nonexpressing tissues, as already reported for the upstream enhancer 5` HS-2 of the human -globin genes cluster in nonerythroid cells(24) .

Tissue Specificity of Transgenes with 2.7 or 5.2 kb of 5`-Flanking Sequence

To examine the in vivo role of the HSSB region, we first established two series of transgenic mouse lines. Both series contained a minigene construct either with 2.7 kb (PK minigene) or 5.2 kb (HSSB-PK minigene) of 5`-flanking sequence, respectively. Transgenic founder mice were identified by Southern blot analysis, and the number of integrated copies was estimated for each line. Fig. 4presents all of the different PK transgenic lines analyzed, generally two lines for each constuct. All carried multiple intact copies, ranging from 2 to 50. Expression analysis was performed on F and F heterozygotes.

The accumulation of the L`-PK transcripts from the transgenes was examined in various tissues by RT-PCR and compared to that of the rat endogenous gene expression (Fig. 5). In the PK minigene line B49 harboring 2.7 kb of 5`-flanking region, the transgenic L` promoter was found to be active in erythropoietic tissues, i.e. the fetal liver, spleen and bone marrow of adult animals(7) . As it was observed for the endogenous gene in rat, this expression was undetectable in liver of newborn animals, reflecting the perinatal disappearance of erythroid cells from the liver (not shown). Transgenic L`-PK transcripts were also detected in various fetal tissues, probably due to the presence of circulating erythroblasts. This was also observed for the rat endogenous L`-PK transcripts. The analysis of the HSSB-PK minigene line 10 showed an expected developmental expression appropriately distributed in the different tissues. Thus, the tissue specificity was not modified by the presence or the absence of the erythroid-specific HSSB element.


Figure 5: RT-PCR analysis of L`-PK transcripts in tissues of rat and various transgenic mouse lines. 500 ng of total RNAs from adult and fetal tissues were used for RT-PCR amplifications. In rat, the L`-PK-specific amplified fragment is 493 bp long, whereas in trangenic PK minigene lines it corresponds to a 265-bp fragment. The mouse -actin-specific amplified fragment is 241 bp long. Polyacrylamide gel electrophoresis, blotting, and hybridization were performed as described under ``Materials and Methods.''



Influence of a Fragment Encompassing HSSB on the Level of Expression of L-PK Transgenes

We have already reported that the level of expression of L-PK transgenes was in good correlation with the number of integrated copies and seemed to be independent of the integration site(3, 6, 7) . This is consistent with results shown in Fig. 6. Indeed, the abundance of both L- and L`-specific RNA precursors, quantified by S1 nuclease protection assays in fetal liver of 16-day-old transgenic mice, was higher in line 10 (five copies; Fig. 6A, lane 4) than in line 3 (two copies; Fig. 6A, lane 7), and the abundance of L transcripts was higher in line B49 (50 copies; Fig. 6B, lane 8) than in lines 10 and 3 (Fig. 6B, lanes 4 and 7). In contrast, the accumulation of L` transcripts, appreciated by both RT-PCR (Fig. 5) and S1 nuclease protection assays (Fig. 6A), was roughly similar in line B49 devoid of the HSSB region (Fig. 6A, lane 8) and in line 10 (Fig. 6A, lane 4), while the number of integrated copies was 50 for the first line versus 5 for the latter one. These results suggest that the fragment encompassing HSSB could stimulate activity of the erythroid-specific promoter approximately 10-fold. This 10-fold stimulation is consistent with the previous report that transcription from the L` promoter in line B49 harboring a transgene devoid of HSSB was approximately 5% of that from the endogenous L` promoter(6) .


Figure 6: S1 nuclease analysis of L`-PK and L-PK precursor RNAs in different transgenic lines. The results presented in this figure were obtained on mice harboring the following transgenes: HSSB-PK minigene, PK minigene, PK-Tag, enhancer H-PK-Tag, and enhancer SV40-PK-Tag. To detect the L`-PK and L-PK precursor transcripts, we synthesized specific single-stranded probes by extension of oligonucleotide primers hybridizing with, respectively, nt +164 to +181 and nt +546 to +563, located in the first intron. Shaded and white boxes in the KpnI-BglII template represent the erythroid- and liver-specific exons, respectively. Both antisense probes were labeled in the 3` end of the primers. Probes are represented by extended arrows and stars show the labeled residues. No protected fragment was detectable when fetal liver RNA and adult liver RNA from nontransgenic mice were used as templates. A, the length of the protected fragment is 181 nt for L`-PK precursor transcripts, as estimated by comparison with the sequence (GATC reactions, left). 10 µg of total RNAs from fetal liver between the 12th and 18th day of gestation were used. Lane control corresponds to 10 µg of total RNAs from fetal rat liver at day 17 of gestation. B, the length of the protected fragment is 91 nt for L-PK precursor transcripts. Lane control corresponds to 10 µg of total RNAs from rat adult liver.



Influence of Ubiquitous Enhancers on the Activity of the L` Promoter in Transgenic Mice

Since the L` promoter is erythroid-specific by itself, we wondered whether the HSSB region could be replaced by viral or cellular strong ubiquitous enhancers. To answer this question, we used a different set of transgenic lines (PK-Tag) developed in our laboratory for the purpose of a targeted oncogenesis program(3, 12) . As presented in Fig. 4, these constructs were directed either by the 2.7 kb of the 5`-flanking sequence (PK-Tag), the 72 bp repeats of the SV40 enhancer (enh SV40-PK-Tag), or the enhancer H of the human aldolase A gene (enh H-PK-Tag)(9) . Both enhancers were located 0.5 kb upstream of the L` cap site. We compared three lines of transgenic mice, each of them harboring about five copies of the transgene. Tissue-specific patterns of expression of these three chimeric constructs were roughly similar (3).()As exemplified in Fig. 6A, both H and SV40 enhancers stimulated the activity of the L` promoter (compare lanes 10 and 11 to lane 9), but relatively inefficiently compared with the DNA fragment encompassing HSSB and present in the transgene of line 10 (lane 4), while the number of integrated copies was identical. These results provide some evidence that maximal expression from the L` promoter requires erythroid-specific elements shared by both promoter and HSSB regions.

It should be noted that the level of RNA precursors transcribed from the liver-specific L promoter did not vary in transgenic lines harboring about five copies of a transgene encompassing (HSSB-PK minigene) or not (PK-Tag) the HSSB region (Fig. 6B, lanes 4 and 9). This result indicates that the expression from the L promoter is independent of the presence of HSSB in hepatocytes. In contrast, the abundance of L-specific transcripts dramatically decreased in the lines harboring either the enhancer H or the SV40 enhancer (Fig. 6B, lanes 10 and 11), compared with the control line PK-Tag (lane 9). Both enh SV40-PK-Tag and enh H-PK-Tag constructs were devoid of the DNase I liver-specific hypersensitive site 2 (HSS2, see Fig. 1A), which is known to be needed for a maximal activity of the L promoter(13) . It appears, therefore, that the two ubiquitous enhancers are not able to mimic the HSS2-dependent cis-activation of the L promoter in hepatocytes.

The HSSB Element Confers an Erythroid-specific Expression on the Thymidine Kinase Promoter in Vivo

In an attempt to define more precisely the tissue-specific properties of the HSSB region, we tested its ability to stimulate transcription from an heterologous promoter. Therefore, we analyzed in erythropoietic and nonerythropoietic tissues the expression of a CAT reporter gene driven by the HSV thymidine kinase promoter fused or not to a 2-kb BamHI-EcoRI restriction fragment encompassing HSSB.

The levels of CAT activity were measured in various tissues for several individual mice and values are shown in . The two tk-CAT lines studied here did not express the CAT transgene at a detectable level (lines 81 and 87), and this has been confirmed in our laboratory for additional lines (not shown). Among the six HSSB-tk-CAT transgenic mouse lines established, two lines did not express the transgene, although stably inherited through the germ line (not shown). However, an important activation was clearly observed for each of the other four lines in erythroid fetal liver cells (see ). This activation began before day 10 of development and remained detectable until day 17. Afterward, CAT activity decreased with the concomitant disappearance of erythropoietic cells in the developing liver (not shown). These results demonstrate that HSSB can confer, in fetal liver, an erythroid-specific expression on a minimal promoter and thus behaves as a tissue-specific enhancer. In tissues expressing the L`-pyruvate kinase isoform during the adult life, i.e. spleen, bone marrow, and blood, CAT activity was barely detectable. Unexpectedly, we noticed a significant and reproductible activation of the thymidine kinase promoter in various adult nonerythropoietic tissues, such as the thymus in lines 2, 18, and 31, the cardiac muscle in lines 2 and 31, and the brain in lines 2 and 23. Although each HSSB-tk-CAT line behaves slightly differently, the ectopic expression of the transgene was restricted to the above tissues. This result might reflect a preferential activation of the minimal thymidine kinase promoter in a set of specific cell-types. This is, however, not the case, since the tk-CAT insert was insufficient for a constitutive expression when integrated to the genome. We favor the hypothesis of an HSSB enhancement activity in a restricted number of cell types. Indeed, the pattern of expression of HSSB-tk-CAT transgenes conforms to the presence of GATA-binding proteins in these tissues.


DISCUSSION

The L` pyruvate kinase is a glycolytic enzyme whose expression is restricted to erythropoietic tissues, i.e. the liver during the fetal life, the spleen (in rodents), and the bone marrow in the adult period(25) . The organization of the rat L-type pyruvate kinase gene shows one transcription unit and two tissue-restricted alternative promoters, located 500 bp apart, that direct the expression of the erythroid-specific (promoter L`) and hepatic-specific (promoter L) isoforms(1, 2, 3, 12) . From a DNase I hypersensitive analysis of the rat L-PK gene, we have deduced an original arrangement of hypersensitive elements, distributed within the 4 kb of its 5`-flanking sequence (see Fig. 1A). Two distal tissue-specific hypersensitive regions were found in high expressing tissues, i.e. the liver and erythroid cells, and referred to as HSS2 and HSSB, respectively. In vivo studies had already established that the distal liver-specific DNase I hypersensitive site, namely HSS2, although not necessary to direct a tissue-specific expression, was required to confer a quantitatively correct level of expression(13) , and this is confirmed in the present study (Fig. 6). With the aim of defining the regulatory properties of the distal erythroid-specific HSSB element in the L`-pyruvate kinase isoform expression, we isolated and sequenced this region. Footprinting experiments allowed us to reveal a cluster of binding motifs for CACC/GT and GATA proteins, on the 200-bp core of the site. Furthermore, the establishment of different transgenic lines has enabled us to demonstrate the functional role of HSSB as a specific transcriptional activator of the L` promoter.

The HSSB Core Region Shares Structural Organization in Common with Other Erythroid-specific Activating Regions

The in vivo occupied regulatory motifs of the HSSB region have revealed a highly conserved array of functional elements, mainly GATA and CACC/GT motifs, and also putative Sp1 and NF-E4 binding sites. Numerous studies have reported the contribution of GATA and CACC/GT motifs in the enhancer activity of erythroid-specific regulatory regions, active either in transient assays or in transgenic mice(22, 26, 27) . Therefore, their contribution to the enhancer activity of HSSB in erythroid cells is probable. It is generally accepted that the DNA-binding proteins minimally required to achieve an erythroid-specific enhancer activity are the hematopoietic transactivators GATA-1, NF-E2/AP-1-like(28) , and various combinations of ubiquitous factors including Sp1, AP1, USF, Ets, and CACC/GT-binding proteins as TEF2, CACD, or related factors(18, 20, 26, 27, 29) . In addition, it is now well documented that GATA binding motifs act in close cooperation with CACC/GT sequences (30, 31) and Sp1 sites (32) to mediate erythroid-specific gene activation. While the HSSB enhancer complies with most of the characteristics of erythroid enhancers, it lacks NF-E2/AP1-like binding motifs, described as a requirement for a maximal enhancer activity(27) . Moreover, in vivo footprinting analysis has revealed that, in addition to canonical GATA-1 binding sites, HSSB contains several nonconsensus GATA-1 motifs which are occupied in vivo (Fig. 2). Other nonconsensus GATA-1 motifs have been found in various erythroid regulatory elements (26, 33) and, in particular, in the L` promoter(4) . It has been recently established, by PCR-mediated random site selection, that members of the GATA proteins family bind a variety of motifs that significantly deviate from the WGATAR consensus motif, both in the core and/or in the flanking sequences(34, 35) . From these studies, it seems that the nonconsensus gcaAGATCata which is located at nt -3736 could potentially bind GATA-2 or GATA-3 factors, but not GATA-1. As GATA-2 seems to be involved in the definitive erythropoiesis (36) and in the control of terminal differentiation(37) , we could then hypothesize that the binding of GATA-2 is at this site.

The HSSB DNase I Hypersensitive Site Acts as a Strong Activating Region in Erythroid Cells

The function of the distal erythroid-specific HSSB hypersensitive region was investigated in transgenic mice. We first established that the presence of the HSSB region did not disturb the pattern of temporal and tissue-specific expression of the transgenes (Fig. 5). However, this region stimulates the L` promoter in the fetal liver by at least 10-fold (Fig. 6). These results indicate that, unlike what was reported for other cell-restricted enhancers(38, 39, 40) , a cooperation between the L` promoter and the HSSB region is not necessary for a strict cell-type specificity but is required for a proper activity of the promoter in the expressing tissues. It is worth noting that similar results have been obtained for the second promoter of the L-PK gene. Indeed, tissue-specific expression from the L promoter, although not dependent upon the presence of the liver-specific DNase I hypersensitive region HSS2, is strongly stimulated by a DNA fragment encompassing this element(13) . Both HSS2 and HSSB behave as tissue-restricted activating regions and are imperfectly replaced by either viral or cellular ubiquitous enhancers such as the 72-bp repeats of SV40 and the H region of the human aldolase A gene regulatory sequence(9) . These results could be explained by the requirement of interactions between tissue-specific factors bound on both upstream activating regions and proximal promoters in order to achieve an efficient activation. Such interplays between erythroid-specific enhancers and promoters have been especially well studied in -globin genes, where they are involved in the temporal and tissue-restricted control of expression of these genes, and depend upon the presence of appropriate erythroid stage-specific factors(41, 42, 43, 44) .

The HSSB Region, an Activating Region in Erythroid and GATA Protein-containing Tissues

The HSSB region confers on a CAT transgene directed by the -105-bp HSV tk promoter a strong activity in fetal liver, the most intense erythropoietic organ in fetus (). This result conforms to what was reported with other erythroid enhancers that can direct expression from heterologous promoters in transgenic mice in a tissue-specific manner(45, 46) . Among the erythroid enhancers reported so far, most of them have properties of tissue-restricted enhancer and can protect linked reporter genes from ``position effects.'' In contrast, the HSSB region confers on the linked reporter gene a tissue-restricted activity that is highly dependent on the integration site and is not related to the copy number. However, despite the apparent variability of the HSSB-tk-CAT transgene expression in the different transgenic lines, the expression was almost constant in the fetal liver. In addition, the expression of this transgene in some nonerythroid tissues can be correlated with the presence of GATA-binding proteins. To date, four GATA-binding factors with different tissue specificities have been characterized(47) . The abundant presence of GATA-3 in T-lymphoid cells (48, 49) and central nervous system(47) , and of GATA-4 in the cardiac muscle(50, 51) , may thus explain the ectopic activation of the HSSB-tk-CAT constructs in thymus, brain, and heart. The presence of numerous consensus and variant GATA motifs on the 200-bp core of HSSB is consistent with this hypothesis. However, in a native context, a stronger tissue specificity is achieved through interaction between this GATA-dependent upstream activating region and the strictly erythroid-specific L` promoter.

In conclusion, it appears that the arrangement of the regulatory elements responsible for either erythroid- or liver-specific transcription of the L-PK gene is strikingly symmetrical, both types of expression involving the interaction between a strictly tissue-specific promoter, active by itself at a low level in the proper tissues, and a upstream activating region whose effect is also tissue-restricted. In addition, these elements are interspersed and regularly disposed. Whether such a symmetrical arrangement has an evolutionary significance is unknown.

  
Table: CAT activity in various tissues of transgenic mice

Samples from homogenates of the indicated organs were assayed for CAT activity. 150 µg of proteins were assayed (except for the bone marrow, where 50 µg or less were used). Expression of the enhancerless tk-CAT constructs provided a control for the absence of detectable activity of the thymidine kinase promoter (spanning from nt -105 to +51) in the above tissues.



FOOTNOTES

*
This work was supported in part by grants from l' Association pour la Recherche sur le Cancer. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) X85791.

§
To whom correspondence should be addressed: Institut Cochin de Génétique Moléculaire, INSERM U129, 24 Rue du Faubourg St-Jacques, 75014 Paris, France. Tel.: 33-1-44 41 24 08; Fax: 33-1-44 41 24 21.

The abbreviations used are: L-PK, L-type pyruvate kinase; HSS, hypersensitive site; PCR, polymerase chain reaction; RT, reverse transcriptase; DMS, dimethyl sulfate; CAT, chloramphenicol acetyltransferase; HSV, hamster sarcoma virus; nt, nucletotide; bp, base pair; kb, kilobase pair.

L. Miquerol et al., unpublished data.


ACKNOWLEDGEMENTS

We thank Alexandra Henrion and Sophie Vaulont for their careful revision of the text.


REFERENCES
  1. Kahn, A., and Marie, J.(1982) Methods Enzymol.90, 131-141
  2. Noguchi, T., Yamada, K., Inoue, H., Matsuda, T., and Tanaka, T. (1987) J. Biol. Chem.262, 14366-14371 [Abstract/Free Full Text]
  3. Cartier, N., Miquerol, L., Tulliez, M., Lepetit, N., Levrat, F., Grimber, G., Briand, P., and Kahn, A.(1992) Oncogene7, 1413-1422 [Medline] [Order article via Infotrieve]
  4. Lacronique, V., Boquet, D., Lopez, S., Kahn, A., and Raymondjean, M. (1992) Nucleic Acids Res.20, 5669-5676 [Abstract/Free Full Text]
  5. Max-Audit, I., Eleouet, J.-F., and Romeo, P-H.(1993) J. Biol. Chem.268, 5431-5437 [Abstract/Free Full Text]
  6. Boquet, D., Vaulont, S., Tremp, G., Ripoche, A. M., Deagelen, D., Jami, J., Kahn, A., and Raymondjean, M.(1992) Eur. J. Biochem.207, 13-21 [Medline] [Order article via Infotrieve]
  7. Tremp, G., Boquet, D., Ripoche, A. M., Cognet, M., Lone, Y. C., Jami, J., Kahn, A., and Deagelen, D.(1989) J. Biol. Chem.264, 19904-19910 [Abstract/Free Full Text]
  8. Schowalter, D. B., and Sommer, S. S.(1989) Anal. Biochem.177, 90-94 [CrossRef][Medline] [Order article via Infotrieve]
  9. Concordet, J. P., Maire, P., Kahn, A., and Deagelen, D.(1991) Nucleic Acids Res.19, 4173-4180 [Abstract/Free Full Text]
  10. Luckow, B., and Schütz, G.(1987) Nucleic Acids Res.15, 5490 [Free Full Text]
  11. Chirgwin, J. M., Przybuyla, A. Z., MacDonald, R. Y., and Rutter, W. J. (1979) Biochemistry18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  12. Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., Raymondjean, M., and Kahn, A.(1994) J. Biol. Chem.269, 8944-8951 [Abstract/Free Full Text]
  13. Cuif, M. H., Cognet, M., Boquet, D., Tremp, G., Kahn, A., and Vaulont, S.(1992) Mol. Cell. Biol.12, 4852-4861 [Abstract/Free Full Text]
  14. Gorman, C., Moffat, L., and Howard, B.(1982) Mol. Cell. Biol.2, 1044-1051 [Abstract/Free Full Text]
  15. Mueller, P. R., and Wold, B.(1989) Science246, 780-786 [Abstract/Free Full Text]
  16. Orkin, S. H.(1992) Blood80, 575-581 [Free Full Text]
  17. Gidoni, D., Kadonaga, J. T., Barrera-Saldana, H., Takahashi, K., Chambon, P., and Tjian, R.(1985) Science230, 511-514 [Abstract/Free Full Text]
  18. Jarman, A. P., Wood, W. G., Sharpe, J. A., Gourdon, G., Ayyub, H., and Higgs, D. R.(1991) Mol. Cell. Biol.11, 4679-4689 [Abstract/Free Full Text]
  19. Miller, I. J., and Bieker, J. J.(1993) Mol. Cell. Biol.13, 2776-2786 [Abstract/Free Full Text]
  20. Hartzog, G., and Myers, R.(1993) Mol. Cell. Biol.13, 44-56 [Abstract/Free Full Text]
  21. Gallarda, J. L., Foley, K. P., Yang, Z., and Engel, J. D.(1989) Genes & Dev.3, 1845-1859
  22. Purucker, M., Bodine, D., Lin, H., McDonagh, K., and Nienhuis, A. W. (1990) Nucleic Acids Res.18, 7407-7415 [Abstract/Free Full Text]
  23. Yang, Z., and Engel, J. D.(1994) J. Biol. Chem.269, 10079-10087 [Abstract/Free Full Text]
  24. Reddy, P. M. S., Stamatoyannopoulos, G., Papayannopoulou, T., and Shen, C-K. J.(1994) J. Biol. Chem.269, 8287-8295 [Abstract/Free Full Text]
  25. Imamura, K., and Tanaka, T.(1982) Methods Enzymol.90, 150-164
  26. O'Prey, J., Ramsay, S., Chambers, I., and Harrison, P. R.(1993) Mol. Cell. Biol.13, 6290-6303 [Abstract/Free Full Text]
  27. Caterina, J. J., Ciavatta, D. J., Donze, D., Behringer, R. R., and Townes, T. M.(1994) Nucleic Acids Res.22, 1006-1011 [Abstract/Free Full Text]
  28. Mignotte, V., Wall, L., deBoer, E., Grosveld, F., and Romeo, P.-H. (1989) Nucleic Acids Res.17, 37-45 [Abstract/Free Full Text]
  29. Bresnick, E. H., and Felsenfeld, G.(1993) J. Biol. Chem.268, 18824-18834 [Abstract/Free Full Text]
  30. Frampton, J., Walker, M., Plumb, M., and Harrison, P. R.(1990) Mol. Cell. Biol.10, 3838-3842 [Abstract/Free Full Text]
  31. Walters, M., and Martin, D. I. K.(1992) Proc. Natl. Acad. Sci. U. S. A.89, 10444-10448 [Abstract/Free Full Text]
  32. Fisher, K-D., Haese, A., and Nowock, J.(1993) J. Biol. Chem.268, 23915-23923 [Abstract/Free Full Text]
  33. Strauss, E. C., and Orkin, S. H.(1992) Proc. Natl. Acad. Sci. U. S. A.89, 5809-5813 [Abstract/Free Full Text]
  34. Ko, L. J., and Engel, J. D.(1993) Mol. Cell. Biol.13, 4011-4022 [Abstract/Free Full Text]
  35. Merika, M., and Orkin, S. H.(1993) Mol. Cell. Biol.13, 3999-4010 [Abstract/Free Full Text]
  36. Tsai, S. F., Keller, G., Kuo, F. C., Weiss, M., Chen, J., Rosenblatt, M., Alt, F. W., and Orkin, S. H.(1994) Nature371, 221-226 [CrossRef][Medline] [Order article via Infotrieve]
  37. Briegel, K., Lim, K-C., Plank, C., Beug, H., Engel, J. D., and Zenke, M.(1993) Genes & Dev.7, 1097-1109
  38. Pinkert, C. A., Ornitz, D. M., Brinster, R. L., and Palmiter, R. D. (1987) Genes & Dev.1, 268-276
  39. Crenshaw, E. B., III, Kalla, K., Simmons, D. M., Swanson, L. W., and Rosenfeld, M. G.(1989) Genes & Dev.3, 959-972
  40. Son, H. J., Shahan, K., Rodriguez, M., Derman, E., and Costantini, F. (1991) Mol. Cell. Biol.11, 4244-4252 [Abstract/Free Full Text]
  41. Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N., and Grosveld, F.(1991) Genes & Dev.5, 1387-1394
  42. Foley, K. P., and Engel, J. D.(1992) Genes & Dev.6, 730-744
  43. Kim, C. G., Epner, E. M., Forrester, W. C., Groudine, M.(1992) Genes & Dev.6, 928-938
  44. Fraser, P., Pruzina, S., Antoniou, M., and Grosveld, F.(1993) Genes & Dev.7, 106-113
  45. Talbot, D., Collis, P., Antoniou, M., Vidal, M., Grosveld, F., and Greaves, D. R.(1989) Nature338, 1384-1388
  46. Reitman, M., Lee, E., Westphal, H., and Felsenfeld, G.(1990) Nature348, 749-752 [CrossRef][Medline] [Order article via Infotrieve]
  47. Yamamoto, M., Ko, L. J., Leonard, M. W., Beug, H., Orkin, S. H., and Engel, J. D.(1990) Genes & Dev.4, 1650-1662
  48. Ho, I. C., Vorhees, P., Marin, N., Oakley, B. K., Tsai, S. F., Orkin, S. H., and Leiden, J. M.(1991) EMBO J.10, 1187-1192 [Medline] [Order article via Infotrieve]
  49. Ko, L. J., Yamamoto, M., Leonard, M. W., George, K. M., Ting, P., and Engel, J. D.(1991) Mol. Cell. Biol.11, 2778-2784 [Abstract/Free Full Text]
  50. Arceci, R. J., King, A. A. J., Simon, M. C., Orkin, S. H., and Wilson, D. B.(1993) Mol. Cell. Biol.13, 2235-2246 [Abstract/Free Full Text]
  51. Kelley, C., Blumberg, H., Zon, L. I., and Evans, T.(1993) Development118, 817-827 [Abstract]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
haematolHome page
K. M.K. de Vooght, R. van Wijk, A. C. van Wesel, and W. W. van Solinge
Characterization of the -148C>T promoter polymorphism in PKLR
Haematologica, September 1, 2008; 93(9): 1407 - 1408.
[Full Text] [PDF]


Home page
haematolHome page
H. Kanno, T. Utsugisawa, S. Aizawa, T. Koizumi, K.-i. Aisaki, T. Hamada, H. Ogura, and H. Fujii
Transgenic rescue of hemolytic anemia due to red blood cell pyruvate kinase deficiency
Haematologica, June 1, 2007; 92(6): 731 - 737.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. C. Perkins, K. R. Peterson, G. Stamatoyannopoulos, H. E. Witkowska, and S. H. Orkin
Fetal expression of a human Agamma globin transgene rescues globin chain imbalance but not hemolysis in EKLF null mouse embryos
Blood, March 1, 2000; 95(5): 1827 - 1833.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. H. Surinya, T. C. Cox, and B. K. May
Identification and Characterization of a Conserved Erythroid-specific Enhancer Located in Intron 8 of the Human 5-Aminolevulinate Synthase 2 Gene
J. Biol. Chem., July 3, 1998; 273(27): 16798 - 16809.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. Lacronique, P. Varlet, P. Mayeux, A. Porteu, S. Gisselbrecht, A. Kahn, and C. Lacombe
Bcl-2 Targeted Overexpression Into the Erythroid Lineage of Transgenic Mice Delays But Does Not Prevent the Apoptosis of Erythropoietin-Deprived Erythroid Progenitors
Blood, October 15, 1997; 90(8): 3050 - 3056.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Newton, J. Mackay, and M. Crossley
The N-terminal Zinc Finger of the Erythroid Transcription Factor GATA-1 Binds GATC Motifs in DNA
J. Biol. Chem., September 14, 2001; 276(38): 35794 - 35801.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacronique, V.
Right arrow Articles by Raymondjean, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacronique, V.
Right arrow Articles by Raymondjean, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement