|
Volume 270,
Number 25,
Issue of June 23, pp. 14989-14997, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification
and Functional Characterization of an Erythroid-specific Enhancer in
the L-type Pyruvate Kinase Gene (*)
Virginie
Lacronique
,
Soledad
Lopez
,
Lucile
Miquerol
,
Arlette
Porteu
,
Axel
Kahn (§)
,
Michel
Raymondjean
From the
(1)Institut Cochin de Génétique Moléculaire,
Unité 129 INSERM, Université René Descartes, 75014
Paris, France
ABSTRACT
INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The rat L-type pyruvate kinase gene is transcribed either from
promoter L in the liver or promoter L` in erythroid cells. We have now
cloned and functionally characterized an erythroid-specific enhancer,
mapped in the fetal liver as hypersensitive site B (HSSB) at 3.7
kilobases upstream from the promoter L`. Protein-DNA interactions were
examined in the 200-base pair core of the site by in vivo footprinting experiments. In the fetal liver, footprints were
revealed at multiple GATA and CACC/GT motifs, whose association is the
hallmark of erythroid-specific regulatory sequences. Functional
analysis of the HSSB element in transgenic mice revealed properties of
a cell-restricted enhancer. Indeed, this element was able to activate
the linked ubiquitous herpes simplex virus thymidine kinase promoter in
erythroid tissues. The activation was also observed in a variety of
nonerythroid tissues known to synthesize GATA-binding factors. In the
context of L`-PK transgenes, HSSB was not needed for an
erythroid-specific activation of the L` promoter, while it was required
to stimulate the L` promoter activity to a proper level. Finally, HSSB
cannot be replaced by strong ubiquitous viral or cellular enhancers,
suggesting a preferential interaction of the HSSB region with the L`
promoter.
INTRODUCTION
The use of alternative promoters is a common mechanism of
tissue- and development-specific gene expression. The rat L-type
pyruvate kinase gene (L-PK) ( )affords a good
example of such a mechanism since it encodes two tissue-specific
isoforms of a glycolytic enzyme (EC 2.7.1.40), transcribed from two
alternative promoters, located 500 bp apart. These two promoters direct
the transcription of erythroid- (L`) and liver-specific (L) mRNAs,
which differ only by their first exon(1, 2) . In fact,
the L promoter is also active in two other gluconeogenic tissues, i.e. the small intestine and proximal tubules of the
kidney(3) . The L` promoter is strictly specific to erythroid
cells. It is active in the fetal liver during its period of
hematopoietic activity and in the adult bone marrow and spleen, which
is an erythropoietic organ in rodents. In the liver, the amount of
L`-mRNA decreases a few days after birth, when erythropoiesis stops in
this organ. Sequences involved in the tissue-specific expression from
the erythroid L` promoter have been characterized either in vitro(4) or in transient transfection assays(5) .
Footprinting experiments and site-directed mutagenesis of a 300-bp
proximal L` promoter fragment have revealed that the promoter requires
a cluster of binding sites for the hematopoietic restricted protein
GATA-1- and CACC/GT-binding factors (4, 5). In vivo, this
region corresponds to a strong DNase I hypersensitive site (HSSA)
detected in the fetal liver (6) (see Fig. 1A).
Transcriptional activity of transgenes carrying this L` promoter plus
2.7 kb of 5`-flanking sequence, although specific to erythropoietic
tissues such as fetal liver, spleen, and bone marrow, was low in all
transgenic lines as compared to that of the endogenous gene(7) .
Therefore, we hypothesized that the transgenic constructs used in these
experiments were lacking an essential positive control element. Since a
second DNase I erythroid-specific hypersensitive region (HSSB),
previously identified far upstream from the gene, was lacking in all of
these microinjected constructs(6, 7) , we decided to
isolate the DNA fragment carrying HSSB and to investigate its effects
on the expression from the L` promoter.
Figure 1:
Mapping of an erythroid-specific DNase
I HSSB and isolation of the rat genomic clone 3 spanning this
site. A, the upper panel represents a schematic
drawing of the rat L-type pyruvate kinase genomic clone and the DNase I
hypersensitive sites flanking the gene (6) (not to scale). Rectangles indicate the position of the erythroid-specific
first exon L` (shaded box) and the hepatic-specific first exon
L (open box). The sensitive regions mapped in native chromatin
of high expressing tissues are indicated by vertical arrows,
in the fetal liver, used as a source of erythroid cells, and in the
adult liver. Numbers below the sites indicate their locations
relative to the erythroid cap site. The lower panel shows a
partial restriction map of the rat 3 genomic clone (not to scale).
The location of the 4.5-kb BamHI restriction fragment bearing
the hypersensitive HSSB region is represented by an open box.
This fragment was further subcloned and entirely sequenced. B,
fine mapping of HSSB in the fetal liver chromatin. Nuclei from liver of
17-day-old rat embryos were treated with increasing amounts of DNase I
prior to DNA isolation and digested with BamHI. The resulting
blot was hybridized with a probe located either 5` (probe A)
or 3` (probe B) of the HSSB region. The map indicates the
positions of probes A and B (hatched boxes) and the lengths of
restriction fragments generated. The HSSB position is indicated by arrow. This hypersensitive site B was not detected in
nonexpressing tissues such as adult liver and brain (6) (data not
shown).
MATERIALS AND METHODS
3
10 plaques of a EMBL3 rat genomic DNA library were
screened with a 377-bp DNA fragment extending from -2721 to
-2344 (arbitrarily, the L` start site of transcription will be
referred to as (+1) throughout this report(7) . Filters
were hybridized at 65 °C in the following mix: 3 SSC, 10%
(w/v) polyethylene glycol, 1% (w/v) glycine, 1% (w/v) SDS, 0.2% (w/v)
Ficoll, 0.2% (w/v) polyvinylpyrrolidone, supplemented with 50 µg/ml
salmon sperm DNA, and washed in 2 SSC, 0.1% SDS at 65 °C.
The probe was prepared and radiolabeled by PCR (8). Restriction
mapping, combined with oligonucleotide hybridization, revealed that one
genomic clone ( 3) contained the L` promoter and more than 15 kb of
5`-flanking sequences. A 4.5-kb BamHI restriction fragment was
subsequently subcloned into pEMBL18+. The 5` end of this fragment
(spanning from nt -5231 to -2721) was then sequenced on
both strands by primer walking using the dideoxynucleotide
chain-termination method with the Sequenase kit (U.S. Biochemical
Corp.).
Nuclei were
isolated from 17-day-old rat liver fetuses and digested by increasing
amounts of DNase I as previously described(6) . DNA samples were
purified, digested by BamHI, and analyzed on a Southern blot
by hybridization with a probe located either 5` (nt -5231 to
-4850; probe A) or 3` (nt -3197 to -2721; probe B) of
the HSSB site, labeled by random priming with
[ - P]dCTP.
A pEMBL8+
plasmid containing the entire rat L-type pyruvate kinase gene plus 2.7
and 1.4 kb of the 5`- and 3`-flanking regions, respectively, was used
to achieve two types of constructs(6, 7) . First, the PK
minigene was created by excision of 4.7 kb between the first and ninth
intron of the pyruvate kinase gene by BglII digestion and
religation. The second type of constructs corresponded to three PK-Tag
chimeric genes: (i) a PK-Tag hybrid gene containing 2.7 kb of
5`-regulatory sequences of the PK gene, controlling the expression of
large T and little t SV40 antigens, whose expression in transgenic mice
has been previously reported(3) ; (ii) enh SV40-PK-Tag, a hybrid
gene containing the 72-bp repeats of enhancer SV40 spanning positions
95-270, inserted into the ClaI site(-532) of the
PK-Tag construct; (iii) enh H-PK-Tag, a hybrid gene containing the H
enhancer of the human aldolase A gene, extending from nt +2610 to
+3100 of the published sequence (9) and subcloned into the ClaI site(-532) of the PK-Tag construct.
The
erythroid-specific DNase I hypersensitive site HSSB was contained in a
4.5-kb BamHI fragment of the genomic clone 3, and
subcloned into pEMBL18+. The resulting plasmid named
HSSB-pEMBL18+ was taken as the source for two constructs. HSSB-PK
minigene was constructed by inserting a KpnI fragment spanning
from nt -989 to +9455 of the PK minigene into the KpnI site of HSSB-pEMBL18+; it contained 5225 bp of
5`-flanking region. HSSB-tk-CAT was obtained by insertion of a BamHI-EcoRI fragment spanning from nt -5230 to
-3197, upstream of the CAT gene in pBLCAT2, which contains the
thymidine kinase promoter (nt -105 to +51) and the SV40
early polyadenylation signal(10) .
Plasmid DNA was digested with HindIII and ScaI for the HSSB-PK minigene, HindIII and ClaI for HSSB-tk-CAT, XbaI and ClaI for
tk-CAT, and EcoRI and PvuI for enh SV40-PK-Tag and
enh H-PK-Tag. The different inserts excised from the plasmids were
purified on Elutip-d columns (according to the instructions of the
supplier Schleicher & Schuell) and microinjected into fertilized
mouse eggs by the method reported by Tremp et al.(7) .
Transgenic mice were detected by Southern blot analysis of 5 µg of
DNA isolated from 2-week-old mouse tail biopsies, using appropriate
restriction enzymes and probes. Transgene copy number was determined by
scanning autoradiograms with a Shimatzu densitometer with determined
amounts of the injected DNA as standard. Positive founders F mice were outbred to establish transgenic lines. All subsequent
studies were performed on F mice and 12-18-day-old
fetuses.
Total RNA was prepared from various
tissues by the guanidium thiocyanate procedure(11) . First
strand cDNA synthesis and PCR amplification were performed as described
by Miquerol et al.(12) . The sequence of synthetic
oligonucleotides used in PCR amplification experiments is:
5`-CACGCTTTGGAAGCATG-3`, which is complementary to a segment of the
erythroid-specific first exon; 5`-CACATCATCTGCCCAGATGG-3`,
complementary to a segment of exon 10. Oligonucleotides specific to the
rat -actin gene were used as internal amplification standard. They
allow for the amplification of both rat and mouse -actin
mRNAs(12) . Amplification products were run through 6% (w/v)
polyacrylamide gels, transferred onto a nylon membrane, and hybridized
with radiolabeled specific oligonucleotides.
The template used for
S1 nuclease protection assays was a 1944-bp KpnI-BglII fragment (nt -989 to +955,
subcloned into M13mp18) encompassing the two promoters. To map the
start sites of transcription of L` transcripts, an antisense
single-stranded probe was synthesized by extension of a specific
oligonucleotide complementary to nt +164 to +181, located in
the first intron; the probe was excised by digestion with StyI(-160). To map the start sites of transcription of L
transcripts, extension was made with a specific oligonucleotide
complementary to nt +546 to +563. Located in the first intron
downstream of the exon L, the probe was excised by digestion with NheI (+378). Both antisense probes were labeled by
extension of the primers in the presence of two
[ - P]dNTPs adjacent to the 3` end of the
oligonucleotides and the Klenow fragment of DNA polymerase I (quasi-end
labeling, previously reported in Tremp et al.(7) .
Nuclease S1-resistant hybrids were detected as described
previously(7) .
Tissue samples were treated as
described by Cuif et al.(13) , and CAT activity was
assayed according to the standard methods(14) . Specific
activities were expressed as counts/min of reaction and per mg of
protein.
17-day-old rat fetal liver
and adult brain were treated by DMS, and genomic DNA was purified as
described previously(4) . Isolated nuclei were treated by DNase
I as in standard DNase I hypersensitivity experiments(6) , but
with 4-8 times reduced amounts of DNase I. Genomic DNA sequencing
by ligation-mediated PCR method was performed according to Mueller and
Wold(15) . Two sets of primers were used to obtain sequence
information on both strands of the HSSB site. They were used for the
Sequenase extension reaction (primer 1), the PCR amplification reaction
(primer 2), and the labeling reaction (primers 3 and 4).
The primer
set for the upper strand analysis was as follows: V1 -3520 to
-3540: TAGCAGGCAAGTGCAGCTGTG; V2 -3527 to -3549:
CAAGTGCAGCTGTGCTCTAGGCG; V3 -3541 to -3562:
CTCTAGGCGGGAGGACACAGCC; V4 -3610 to -3630:
AGAGAGCCGCGGCGGTCGGGC. The primer set for the lower strand analysis was
as follows: V1R -3828 to -3809: GGCAGCAGAGTGCAACGTGC; V2R
-3824 to -3802: GCAGAGTGCAACGTGCAGTTCGC; V3R -3817 to
-3793: CAACGTGCAGTTCGCGTGCTACGGG; V4R -3735 to -3712:
GATCATAGCACTCCGCGCAACCCC.
RESULTS
In order to characterize the erythroid-specific HSSB
element, we isolated from a rat DNA genomic library a 20-kb clone
(clone 3) containing the 5` distal region of the L-PK gene (Fig. 1A). This clone overlapped at its 3` end with our
previous L-PK genomic clone and contained 15 kb of additional
5`-flanking sequence. A subsequent 4.5-kb BamHI restriction
fragment was used to generate new probes (probes A and B) to accurately localize the previously described HSSB
element (Fig. 1B). DNA purified from DNase I-treated
nuclei of 17-day-old rat fetal livers, used as source of erythroid
cells, was digested with BamHI, and the fragments were
electrophoresed in agarose before Southern blotting and hybridization
with either probe A or probe B, as shown in Fig. 1B.
These experiments showed cleavage of the 4.5-kb genomic BamHI
fragment to give diffuse bands at about 1.5 and 3 kb with the probe A
and the probe B, respectively. These results, in good agreement with
the previous data (6), have allowed us to delineate the hypersensitive
site to a 200-bp region, extending from nt -3800 to -3600
upstream of the erythroid-specific cap site. Other experiments have
failed to detect HSSB in rat adult liver and brain tissues (not shown).
The complete sequence of the 200-bp core of HSSB is presented in Fig. 2.
Figure 2:
Sequence and footprinting analyses of the
200-bp core HSSB region. Derived from data exemplified in Fig. 3 and
from data not shown. A, nucleotide sequence of the HSSB region
analyzed by in vivo footprinting assays (nt -3830 to
-3540). Nucleotides are numbered relative to the erythroid cap
site. The putative GATA- and CACC/GT-binding sites are indicated by bold type. The NF-E4-binding motif (around -3760) and
Sp1-binding sequence (around -3620) are denoted by dotted
lines. Since in vitro binding assays failed to give clear
interactions, results are not represented here except for two DNase I
hypersensitive nucleotides indicated by vertical arrows. The
pattern of protection of in vivo DNase I footprinting is
represented by horizontal bars. White and black circles indicate protected and hyperreactive residues in the in vivo DNase I footprint experiments, respectively. Most of these mapping
data are obtained from analyses of the upper strand. Protection and
hyperreactivities of the DMS reaction on both G and A residues are
represented by white and black stars, respectively. B, distribution of nuclear factor-binding motifs mapped by in vivo footprinting assays. Consensus cis-regulatory
sequences are indicated by shaded boxes and nonconsensus
motifs are represented by clear boxes. Binding sites are
oriented by arrows. Fetal liver-specific footprints (FL) are defined as I-VII, from the 5` end of
HSSB and indicated by solid lines; footprints observed in
brain tissue are indicated by broken
lines.
The array
of nuclear factors binding to the 200-bp core of the HSSB region was
determined by in vivo footprinting analyses. To gain maximal
information about protein-DNA interactions, we performed the in
vivo analysis with two specific DNA cleavage methods: the DMS
procedure, allowing for the identification of the nucleotides involved
in protein-DNA contacts, and the DNase I procedure, as a complementary
approach for the detection of protein occupancy on binding sites.
Footprinting results are illustrated in Fig. 3. In vivo footprinting analysis showed interactions with nuclear proteins in
erythroid cells, scattered all over the hypersensitive region. These
interactions being more obvious on the upper strand than on the lower
one, we present here data that concern only the upper strand. The in vivo interactions revealed by DMS reactivity consisted of
hypersensitive residues rather than protected residues and were very
weak compared with those obtained with in vivo DNase I
cleavage. In vivo protein occupancy within the HSSB region is
summarized in Fig. 2.
Figure 3:
In vivo genomic footprinting of
the upper strand of the HSSB region. A, in vivo DNase
I footprinting of the 200-bp core of the site in the liver of
17-day-old rat fetuses. Lanes G represent in vitro DMS-methylated DNA of fetal liver, used as sequence ladder. Lanes FREE represent in vitro DNase I cleaved DNA of
fetal liver, referred to as the control DNA. Lanes FETAL LIVER represent in vivo DNase I-cleaved DNA of fetal liver.
Protected residues, numbered I-VII from the 5` end of the
site, are indicated by brackets; protected and hypersensitive
residues are indicated by white and black circles,
respectively. In B, we present a close-up, indicated by two arrows, from the region spanning from nt -3800 to
-3630. Vertical dotted lines present protected residues
in brain tissue. C, in vivo DMS footprinting of the
same region than in B. Protections and hyperreactivities of
DMS reaction on both G and A residues are indicated by white and black stars, respectively.
DNase I in vivo footprinting
analysis of the 200-bp core region revealed protein occupancy of seven
boxes, numbered I-VII in Fig. 2and Fig. 4.
Boxes II, IV, and V encompass several putative binding motifs for the
erythroid nuclear factor GATA-1 (for review, see Ref. 16); two of them
conforming the consensus sequence WGATAR and the others being
significantly different from this motif (see Fig. 2). Boxes I and
III consist of two putative CACC/GT motifs. These motifs have been
characterized as binding sites for either ubiquitous factors Sp1 (17) and TEF2 (18) or the erythroid-specific EKLF (19) and CACD (20) proteins. Box VI corresponds to a
GC-rich sequence, similar to the binding site for proteins of the Sp1
family. Finally, the sequence of the box VII does not give any clue on
the nature of the cognate binding factor. Furthermore, a close
examination of the 200-bp core fragment reveals additional elements
related to GATA (nt -3653) and CACC/GT (nt -3576), but
these motifs are not protected in the in vivo DNase I
footprinting experiments (Fig. 2). Box I contains, in addition to
the CACC/GT motif, a poly(pu) region homologous to the AGGAGGA sequence
present in the promoter and enhancer of the chicken -globin
gene(21) , and in the human A -globin gene 3`
enhancer(22) . The AGGAGGA motif has been reported to interact
with an erythroid-specific factor NF-E4, expressed during the late
stages of definitive erythropoiesis(23) .
Figure 4:
Maps of transgenic constructs. A, PK-minigene was created by a 4.7-kb internal deletion
between the first and the ninth introns of the pyruvate kinase gene. It
contains 2.7 kb of the 5`-flanking region. The HSSB-PK minigene was
constructed by inserting a 10.4-kb long fragment of PK minigene into
the KpnI cut HSSB-pEMBL18+ vector (see ``Materials
and Methods''). It contains 5225 bp of the 5`-flanking region. Shadowed and white boxes represent the erythroid- and
liver-specific exons, respectively. The arrowhead indicates
the erythroid transcriptional start site of the L-PK gene (+1). B, schematic representation of PK-Tag transgenes. The PK-Tag
microinjected construct derived from our previous L-PK genomic clone
and expression in transgenic mice has been previously reported (3). The
72-bp repeats of SV40 enhancer and H enhancer of the human aldolase A
gene (9) were fused to PK 5` regions at nt -532 of the PK-Tag
construct. C, structure of the HSSB-tk-CAT hybrid gene.
HSSB-tk-CAT was obtained by the insertion of a 2030-bp long fragment
encompassing the HSSB site, upstream of the thymidine kinase promoter
from HSV spanning from nt -105 to +51 and the CAT structural
gene SV40 poly(A) cassette (hatched box). The designation of
each mouse line and the corresponding copy number are given on the right.
The fetal liver
protection pattern differs from the ones observed in the brain (Fig. 3) and the adult liver (not shown), in which the erythroid
L` promoter is inactive. Nevertheless, some footprints can be observed
in these two nonexpressing tissues, as already reported for the
upstream enhancer 5` HS-2 of the human -globin genes cluster in
nonerythroid cells(24) .
To examine the in vivo role of the
HSSB region, we first established two series of transgenic mouse lines.
Both series contained a minigene construct either with 2.7 kb (PK
minigene) or 5.2 kb (HSSB-PK minigene) of 5`-flanking sequence,
respectively. Transgenic founder mice were identified by Southern blot
analysis, and the number of integrated copies was estimated for each
line. Fig. 4presents all of the different PK transgenic lines
analyzed, generally two lines for each constuct. All carried multiple
intact copies, ranging from 2 to 50. Expression analysis was performed
on F and F heterozygotes.
The accumulation
of the L`-PK transcripts from the transgenes was examined in various
tissues by RT-PCR and compared to that of the rat endogenous gene
expression (Fig. 5). In the PK minigene line B49 harboring 2.7 kb
of 5`-flanking region, the transgenic L` promoter was found to be
active in erythropoietic tissues, i.e. the fetal liver, spleen
and bone marrow of adult animals(7) . As it was observed for the
endogenous gene in rat, this expression was undetectable in liver of
newborn animals, reflecting the perinatal disappearance of erythroid
cells from the liver (not shown). Transgenic L`-PK transcripts were
also detected in various fetal tissues, probably due to the presence of
circulating erythroblasts. This was also observed for the rat
endogenous L`-PK transcripts. The analysis of the HSSB-PK minigene line
10 showed an expected developmental expression appropriately
distributed in the different tissues. Thus, the tissue specificity was
not modified by the presence or the absence of the erythroid-specific
HSSB element.
Figure 5:
RT-PCR analysis of L`-PK transcripts in
tissues of rat and various transgenic mouse lines. 500 ng of total RNAs
from adult and fetal tissues were used for RT-PCR amplifications. In
rat, the L`-PK-specific amplified fragment is 493 bp long, whereas in
trangenic PK minigene lines it corresponds to a 265-bp fragment. The
mouse -actin-specific amplified fragment is 241 bp long.
Polyacrylamide gel electrophoresis, blotting, and hybridization were
performed as described under ``Materials and
Methods.''
We have already reported that the
level of expression of L-PK transgenes was in good correlation with the
number of integrated copies and seemed to be independent of the
integration site(3, 6, 7) . This is consistent
with results shown in Fig. 6. Indeed, the abundance of both L-
and L`-specific RNA precursors, quantified by S1 nuclease protection
assays in fetal liver of 16-day-old transgenic mice, was higher in line
10 (five copies; Fig. 6A, lane 4) than in line
3 (two copies; Fig. 6A, lane 7), and the
abundance of L transcripts was higher in line B49 (50 copies; Fig. 6B, lane 8) than in lines 10 and 3 (Fig. 6B, lanes 4 and 7). In contrast,
the accumulation of L` transcripts, appreciated by both RT-PCR (Fig. 5) and S1 nuclease protection assays (Fig. 6A), was roughly similar in line B49 devoid of the
HSSB region (Fig. 6A, lane 8) and in line 10 (Fig. 6A, lane 4), while the number of
integrated copies was 50 for the first line versus 5 for the
latter one. These results suggest that the fragment encompassing HSSB
could stimulate activity of the erythroid-specific promoter
approximately 10-fold. This 10-fold stimulation is consistent with the
previous report that transcription from the L` promoter in line B49
harboring a transgene devoid of HSSB was approximately 5% of that from
the endogenous L` promoter(6) .
Figure 6:
S1 nuclease analysis of L`-PK and L-PK
precursor RNAs in different transgenic lines. The results presented in
this figure were obtained on mice harboring the following transgenes:
HSSB-PK minigene, PK minigene, PK-Tag, enhancer H-PK-Tag, and enhancer
SV40-PK-Tag. To detect the L`-PK and L-PK precursor transcripts, we
synthesized specific single-stranded probes by extension of
oligonucleotide primers hybridizing with, respectively, nt +164 to
+181 and nt +546 to +563, located in the first intron. Shaded and white boxes in the KpnI-BglII template represent the erythroid- and
liver-specific exons, respectively. Both antisense probes were labeled
in the 3` end of the primers. Probes are represented by extended
arrows and stars show the labeled residues. No protected
fragment was detectable when fetal liver RNA and adult liver RNA from
nontransgenic mice were used as templates. A, the length of
the protected fragment is 181 nt for L`-PK precursor transcripts, as
estimated by comparison with the sequence (GATC reactions, left). 10 µg of total RNAs from fetal liver between the
12th and 18th day of gestation were used. Lane control corresponds to 10 µg of total RNAs from fetal rat liver at day
17 of gestation. B, the length of the protected fragment is 91
nt for L-PK precursor transcripts. Lane control corresponds to
10 µg of total RNAs from rat adult
liver.
Since the L` promoter is
erythroid-specific by itself, we wondered whether the HSSB region could
be replaced by viral or cellular strong ubiquitous enhancers. To answer
this question, we used a different set of transgenic lines (PK-Tag)
developed in our laboratory for the purpose of a targeted oncogenesis
program(3, 12) . As presented in Fig. 4, these
constructs were directed either by the 2.7 kb of the 5`-flanking
sequence (PK-Tag), the 72 bp repeats of the SV40 enhancer (enh
SV40-PK-Tag), or the enhancer H of the human aldolase A gene (enh
H-PK-Tag)(9) . Both enhancers were located 0.5 kb upstream of
the L` cap site. We compared three lines of transgenic mice, each of
them harboring about five copies of the transgene. Tissue-specific
patterns of expression of these three chimeric constructs were roughly
similar (3). ( )As exemplified in Fig. 6A, both H and SV40 enhancers stimulated the
activity of the L` promoter (compare lanes 10 and 11 to lane 9), but relatively inefficiently compared with
the DNA fragment encompassing HSSB and present in the transgene of line
10 (lane 4), while the number of integrated copies was
identical. These results provide some evidence that maximal expression
from the L` promoter requires erythroid-specific elements shared by
both promoter and HSSB regions.
It should be noted that the level of
RNA precursors transcribed from the liver-specific L promoter did not
vary in transgenic lines harboring about five copies of a transgene
encompassing (HSSB-PK minigene) or not (PK-Tag) the HSSB region (Fig. 6B, lanes 4 and 9). This result
indicates that the expression from the L promoter is independent of the
presence of HSSB in hepatocytes. In contrast, the abundance of
L-specific transcripts dramatically decreased in the lines harboring
either the enhancer H or the SV40 enhancer (Fig. 6B, lanes 10 and 11), compared with the control line
PK-Tag (lane 9). Both enh SV40-PK-Tag and enh H-PK-Tag
constructs were devoid of the DNase I liver-specific hypersensitive
site 2 (HSS2, see Fig. 1A), which is known to
be needed for a maximal activity of the L promoter(13) . It
appears, therefore, that the two ubiquitous enhancers are not able to
mimic the HSS2-dependent cis-activation of the L promoter in
hepatocytes.
In an attempt to define
more precisely the tissue-specific properties of the HSSB region, we
tested its ability to stimulate transcription from an heterologous
promoter. Therefore, we analyzed in erythropoietic and
nonerythropoietic tissues the expression of a CAT reporter gene driven
by the HSV thymidine kinase promoter fused or not to a 2-kb BamHI-EcoRI restriction fragment encompassing HSSB.
The levels of CAT activity were measured in various tissues for
several individual mice and values are shown in . The two
tk-CAT lines studied here did not express the CAT transgene at a
detectable level (lines 81 and 87), and this has been confirmed in our
laboratory for additional lines (not shown). Among the six HSSB-tk-CAT
transgenic mouse lines established, two lines did not express the
transgene, although stably inherited through the germ line (not shown).
However, an important activation was clearly observed for each of the
other four lines in erythroid fetal liver cells (see ).
This activation began before day 10 of development and remained
detectable until day 17. Afterward, CAT activity decreased with the
concomitant disappearance of erythropoietic cells in the developing
liver (not shown). These results demonstrate that HSSB can confer, in
fetal liver, an erythroid-specific expression on a minimal promoter and
thus behaves as a tissue-specific enhancer. In tissues expressing the
L`-pyruvate kinase isoform during the adult life, i.e. spleen,
bone marrow, and blood, CAT activity was barely detectable.
Unexpectedly, we noticed a significant and reproductible activation of
the thymidine kinase promoter in various adult nonerythropoietic
tissues, such as the thymus in lines 2, 18, and 31, the cardiac muscle
in lines 2 and 31, and the brain in lines 2 and 23. Although each
HSSB-tk-CAT line behaves slightly differently, the ectopic expression
of the transgene was restricted to the above tissues. This result might
reflect a preferential activation of the minimal thymidine kinase
promoter in a set of specific cell-types. This is, however, not the
case, since the tk-CAT insert was insufficient for a constitutive
expression when integrated to the genome. We favor the hypothesis of an
HSSB enhancement activity in a restricted number of cell types. Indeed,
the pattern of expression of HSSB-tk-CAT transgenes conforms to the
presence of GATA-binding proteins in these tissues.
DISCUSSION
The L` pyruvate kinase is a glycolytic enzyme whose
expression is restricted to erythropoietic tissues, i.e. the
liver during the fetal life, the spleen (in rodents), and the bone
marrow in the adult period(25) . The organization of the rat
L-type pyruvate kinase gene shows one transcription unit and two
tissue-restricted alternative promoters, located 500 bp apart, that
direct the expression of the erythroid-specific (promoter L`) and
hepatic-specific (promoter L)
isoforms(1, 2, 3, 12) . From a DNase I
hypersensitive analysis of the rat L-PK gene, we have deduced an
original arrangement of hypersensitive elements, distributed within the
4 kb of its 5`-flanking sequence (see Fig. 1A). Two
distal tissue-specific hypersensitive regions were found in high
expressing tissues, i.e. the liver and erythroid cells, and
referred to as HSS2 and HSSB, respectively. In vivo studies
had already established that the distal liver-specific DNase I
hypersensitive site, namely HSS2, although not necessary to direct a
tissue-specific expression, was required to confer a quantitatively
correct level of expression(13) , and this is confirmed in the
present study (Fig. 6). With the aim of defining the regulatory
properties of the distal erythroid-specific HSSB element in the
L`-pyruvate kinase isoform expression, we isolated and sequenced this
region. Footprinting experiments allowed us to reveal a cluster of
binding motifs for CACC/GT and GATA proteins, on the 200-bp core of the
site. Furthermore, the establishment of different transgenic lines has
enabled us to demonstrate the functional role of HSSB as a specific
transcriptional activator of the L` promoter.
The in vivo occupied regulatory motifs of the HSSB region have revealed a
highly conserved array of functional elements, mainly GATA and CACC/GT
motifs, and also putative Sp1 and NF-E4 binding sites. Numerous studies
have reported the contribution of GATA and CACC/GT motifs in the
enhancer activity of erythroid-specific regulatory regions, active
either in transient assays or in transgenic
mice(22, 26, 27) . Therefore, their contribution
to the enhancer activity of HSSB in erythroid cells is probable. It is
generally accepted that the DNA-binding proteins minimally required to
achieve an erythroid-specific enhancer activity are the hematopoietic
transactivators GATA-1, NF-E2/AP-1-like(28) , and various
combinations of ubiquitous factors including Sp1, AP1, USF, Ets, and
CACC/GT-binding proteins as TEF2, CACD, or related
factors(18, 20, 26, 27, 29) . In
addition, it is now well documented that GATA binding motifs act in
close cooperation with CACC/GT sequences (30, 31) and
Sp1 sites (32) to mediate erythroid-specific gene activation.
While the HSSB enhancer complies with most of the characteristics of
erythroid enhancers, it lacks NF-E2/AP1-like binding motifs, described
as a requirement for a maximal enhancer activity(27) . Moreover, in vivo footprinting analysis has revealed that, in addition
to canonical GATA-1 binding sites, HSSB contains several nonconsensus
GATA-1 motifs which are occupied in vivo (Fig. 2). Other
nonconsensus GATA-1 motifs have been found in various erythroid
regulatory elements (26, 33) and, in particular, in the L`
promoter(4) . It has been recently established, by PCR-mediated
random site selection, that members of the GATA proteins family bind a
variety of motifs that significantly deviate from the WGATAR consensus
motif, both in the core and/or in the flanking
sequences(34, 35) . From these studies, it seems that
the nonconsensus gcaAGATCata which is located at nt -3736
could potentially bind GATA-2 or GATA-3 factors, but not GATA-1. As
GATA-2 seems to be involved in the definitive erythropoiesis (36) and in the control of terminal differentiation(37) ,
we could then hypothesize that the binding of GATA-2 is at this site.
The function of the distal
erythroid-specific HSSB hypersensitive region was investigated in
transgenic mice. We first established that the presence of the HSSB
region did not disturb the pattern of temporal and tissue-specific
expression of the transgenes (Fig. 5). However, this region
stimulates the L` promoter in the fetal liver by at least 10-fold (Fig. 6). These results indicate that, unlike what was reported
for other cell-restricted
enhancers(38, 39, 40) , a cooperation between
the L` promoter and the HSSB region is not necessary for a strict
cell-type specificity but is required for a proper activity of the
promoter in the expressing tissues. It is worth noting that similar
results have been obtained for the second promoter of the L-PK gene.
Indeed, tissue-specific expression from the L promoter, although not
dependent upon the presence of the liver-specific DNase I
hypersensitive region HSS2, is strongly stimulated by a DNA fragment
encompassing this element(13) . Both HSS2 and HSSB behave as
tissue-restricted activating regions and are imperfectly replaced by
either viral or cellular ubiquitous enhancers such as the 72-bp repeats
of SV40 and the H region of the human aldolase A gene regulatory
sequence(9) . These results could be explained by the
requirement of interactions between tissue-specific factors bound on
both upstream activating regions and proximal promoters in order to
achieve an efficient activation. Such interplays between
erythroid-specific enhancers and promoters have been especially well
studied in -globin genes, where they are involved in the temporal
and tissue-restricted control of expression of these genes, and depend
upon the presence of appropriate erythroid stage-specific
factors(41, 42, 43, 44) .
The HSSB region confers on a CAT
transgene directed by the -105-bp HSV tk promoter a strong
activity in fetal liver, the most intense erythropoietic organ in fetus (). This result conforms to what was reported with other
erythroid enhancers that can direct expression from heterologous
promoters in transgenic mice in a tissue-specific
manner(45, 46) . Among the erythroid enhancers reported
so far, most of them have properties of tissue-restricted enhancer and
can protect linked reporter genes from ``position effects.''
In contrast, the HSSB region confers on the linked reporter gene a
tissue-restricted activity that is highly dependent on the integration
site and is not related to the copy number. However, despite the
apparent variability of the HSSB-tk-CAT transgene expression in the
different transgenic lines, the expression was almost constant in the
fetal liver. In addition, the expression of this transgene in some
nonerythroid tissues can be correlated with the presence of
GATA-binding proteins. To date, four GATA-binding factors with
different tissue specificities have been characterized(47) . The
abundant presence of GATA-3 in T-lymphoid cells (48, 49) and central nervous system(47) , and of
GATA-4 in the cardiac muscle(50, 51) , may thus explain
the ectopic activation of the HSSB-tk-CAT constructs in thymus, brain,
and heart. The presence of numerous consensus and variant GATA motifs
on the 200-bp core of HSSB is consistent with this hypothesis. However,
in a native context, a stronger tissue specificity is achieved through
interaction between this GATA-dependent upstream activating region and
the strictly erythroid-specific L` promoter.
In conclusion, it
appears that the arrangement of the regulatory elements responsible for
either erythroid- or liver-specific transcription of the L-PK gene is
strikingly symmetrical, both types of expression involving the
interaction between a strictly tissue-specific promoter, active by
itself at a low level in the proper tissues, and a upstream activating
region whose effect is also tissue-restricted. In addition, these
elements are interspersed and regularly disposed. Whether such a
symmetrical arrangement has an evolutionary significance is unknown.
Table: CAT
activity in various tissues of transgenic mice
Samples from
homogenates of the indicated organs were assayed for CAT activity. 150
µg of proteins were assayed (except for the bone marrow, where 50
µg or less were used). Expression of the enhancerless tk-CAT
constructs provided a control for the absence of detectable activity of
the thymidine kinase promoter (spanning from nt -105 to +51)
in the above tissues.
FOOTNOTES
- *
- This work was supported in part by grants
from l' Association pour la Recherche sur le Cancer. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank /EMBL Data Bank with accession number(s) X85791.
- §
- To whom correspondence should be addressed:
Institut Cochin de Génétique Moléculaire, INSERM
U129, 24 Rue du Faubourg St-Jacques, 75014 Paris, France. Tel.: 33-1-44
41 24 08; Fax: 33-1-44 41 24 21.
- The
abbreviations used are: L-PK, L-type pyruvate kinase; HSS,
hypersensitive site; PCR, polymerase chain reaction; RT, reverse
transcriptase; DMS, dimethyl sulfate; CAT, chloramphenicol
acetyltransferase; HSV, hamster sarcoma virus; nt, nucletotide; bp,
base pair; kb, kilobase pair.
- L. Miquerol et al., unpublished data.
ACKNOWLEDGEMENTS
We thank Alexandra Henrion and Sophie Vaulont for
their careful revision of the text.
REFERENCES
- Kahn, A., and Marie, J.(1982) Methods Enzymol.90, 131-141
- Noguchi, T., Yamada, K., Inoue, H., Matsuda, T., and Tanaka, T. (1987) J. Biol. Chem.262, 14366-14371
[Abstract/Free Full Text]
- Cartier, N., Miquerol, L., Tulliez, M., Lepetit, N., Levrat, F., Grimber, G., Briand, P., and Kahn, A.(1992) Oncogene7, 1413-1422
[Medline]
[Order article via Infotrieve]
- Lacronique, V., Boquet, D., Lopez, S., Kahn, A., and Raymondjean, M. (1992) Nucleic Acids Res.20, 5669-5676
[Abstract/Free Full Text]
- Max-Audit, I., Eleouet, J.-F., and Romeo, P-H.(1993) J. Biol. Chem.268, 5431-5437
[Abstract/Free Full Text]
- Boquet, D., Vaulont, S., Tremp, G., Ripoche, A. M., Deagelen, D., Jami, J., Kahn, A., and Raymondjean, M.(1992) Eur. J. Biochem.207, 13-21
[Medline]
[Order article via Infotrieve]
- Tremp, G., Boquet, D., Ripoche, A. M., Cognet, M., Lone, Y. C., Jami, J., Kahn, A., and Deagelen, D.(1989) J. Biol. Chem.264, 19904-19910
[Abstract/Free Full Text]
- Schowalter, D. B., and Sommer, S. S.(1989) Anal. Biochem.177, 90-94
[CrossRef][Medline]
[Order article via Infotrieve]
- Concordet, J. P., Maire, P., Kahn, A., and Deagelen, D.(1991) Nucleic Acids Res.19, 4173-4180
[Abstract/Free Full Text]
- Luckow, B., and Schütz, G.(1987) Nucleic Acids Res.15, 5490
[Free Full Text]
- Chirgwin, J. M., Przybuyla, A. Z., MacDonald, R. Y., and Rutter, W. J. (1979) Biochemistry18, 5294-5299
[CrossRef][Medline]
[Order article via Infotrieve]
- Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., Raymondjean, M., and Kahn, A.(1994) J. Biol. Chem.269, 8944-8951
[Abstract/Free Full Text]
- Cuif, M. H., Cognet, M., Boquet, D., Tremp, G., Kahn, A., and Vaulont, S.(1992) Mol. Cell. Biol.12, 4852-4861
[Abstract/Free Full Text]
- Gorman, C., Moffat, L., and Howard, B.(1982) Mol. Cell. Biol.2, 1044-1051
[Abstract/Free Full Text]
- Mueller, P. R., and Wold, B.(1989) Science246, 780-786
[Abstract/Free Full Text]
- Orkin, S. H.(1992) Blood80, 575-581
[Free Full Text]
- Gidoni, D., Kadonaga, J. T., Barrera-Saldana, H., Takahashi, K., Chambon, P., and Tjian, R.(1985) Science230, 511-514
[Abstract/Free Full Text]
- Jarman, A. P., Wood, W. G., Sharpe, J. A., Gourdon, G., Ayyub, H., and Higgs, D. R.(1991) Mol. Cell. Biol.11, 4679-4689
[Abstract/Free Full Text]
- Miller, I. J., and Bieker, J. J.(1993) Mol. Cell. Biol.13, 2776-2786
[Abstract/Free Full Text]
- Hartzog, G., and Myers, R.(1993) Mol. Cell. Biol.13, 44-56
[Abstract/Free Full Text]
- Gallarda, J. L., Foley, K. P., Yang, Z., and Engel, J. D.(1989) Genes & Dev.3, 1845-1859
- Purucker, M., Bodine, D., Lin, H., McDonagh, K., and Nienhuis, A. W. (1990) Nucleic Acids Res.18, 7407-7415
[Abstract/Free Full Text]
- Yang, Z., and Engel, J. D.(1994) J. Biol. Chem.269, 10079-10087
[Abstract/Free Full Text]
- Reddy, P. M. S., Stamatoyannopoulos, G., Papayannopoulou, T., and Shen, C-K. J.(1994) J. Biol. Chem.269, 8287-8295
[Abstract/Free Full Text]
- Imamura, K., and Tanaka, T.(1982) Methods Enzymol.90, 150-164
- O'Prey, J., Ramsay, S., Chambers, I., and Harrison, P. R.(1993) Mol. Cell. Biol.13, 6290-6303
[Abstract/Free Full Text]
- Caterina, J. J., Ciavatta, D. J., Donze, D., Behringer, R. R., and Townes, T. M.(1994) Nucleic Acids Res.22, 1006-1011
[Abstract/Free Full Text]
- Mignotte, V., Wall, L., deBoer, E., Grosveld, F., and Romeo, P.-H. (1989) Nucleic Acids Res.17, 37-45
[Abstract/Free Full Text]
- Bresnick, E. H., and Felsenfeld, G.(1993) J. Biol. Chem.268, 18824-18834
[Abstract/Free Full Text]
- Frampton, J., Walker, M., Plumb, M., and Harrison, P. R.(1990) Mol. Cell. Biol.10, 3838-3842
[Abstract/Free Full Text]
- Walters, M., and Martin, D. I. K.(1992) Proc. Natl. Acad. Sci. U. S. A.89, 10444-10448
[Abstract/Free Full Text]
- Fisher, K-D., Haese, A., and Nowock, J.(1993) J. Biol. Chem.268, 23915-23923
[Abstract/Free Full Text]
- Strauss, E. C., and Orkin, S. H.(1992) Proc. Natl. Acad. Sci. U. S. A.89, 5809-5813
[Abstract/Free Full Text]
- Ko, L. J., and Engel, J. D.(1993) Mol. Cell. Biol.13, 4011-4022
[Abstract/Free Full Text]
- Merika, M., and Orkin, S. H.(1993) Mol. Cell. Biol.13, 3999-4010
[Abstract/Free Full Text]
- Tsai, S. F., Keller, G., Kuo, F. C., Weiss, M., Chen, J., Rosenblatt, M., Alt, F. W., and Orkin, S. H.(1994) Nature371, 221-226
[CrossRef][Medline]
[Order article via Infotrieve]
- Briegel, K., Lim, K-C., Plank, C., Beug, H., Engel, J. D., and Zenke, M.(1993) Genes & Dev.7, 1097-1109
- Pinkert, C. A., Ornitz, D. M., Brinster, R. L., and Palmiter, R. D. (1987) Genes & Dev.1, 268-276
- Crenshaw, E. B., III, Kalla, K., Simmons, D. M., Swanson, L. W., and Rosenfeld, M. G.(1989) Genes & Dev.3, 959-972
- Son, H. J., Shahan, K., Rodriguez, M., Derman, E., and Costantini, F. (1991) Mol. Cell. Biol.11, 4244-4252
[Abstract/Free Full Text]
- Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N., and Grosveld, F.(1991) Genes & Dev.5, 1387-1394
- Foley, K. P., and Engel, J. D.(1992) Genes & Dev.6, 730-744
- Kim, C. G., Epner, E. M., Forrester, W. C., Groudine, M.(1992) Genes & Dev.6, 928-938
- Fraser, P., Pruzina, S., Antoniou, M., and Grosveld, F.(1993) Genes & Dev.7, 106-113
- Talbot, D., Collis, P., Antoniou, M., Vidal, M., Grosveld, F., and Greaves, D. R.(1989) Nature338, 1384-1388
- Reitman, M., Lee, E., Westphal, H., and Felsenfeld, G.(1990) Nature348, 749-752
[CrossRef][Medline]
[Order article via Infotrieve]
- Yamamoto, M., Ko, L. J., Leonard, M. W., Beug, H., Orkin, S. H., and Engel, J. D.(1990) Genes & Dev.4, 1650-1662
- Ho, I. C., Vorhees, P., Marin, N., Oakley, B. K., Tsai, S. F., Orkin, S. H., and Leiden, J. M.(1991) EMBO J.10, 1187-1192
[Medline]
[Order article via Infotrieve]
- Ko, L. J., Yamamoto, M., Leonard, M. W., George, K. M., Ting, P., and Engel, J. D.(1991) Mol. Cell. Biol.11, 2778-2784
[Abstract/Free Full Text]
- Arceci, R. J., King, A. A. J., Simon, M. C., Orkin, S. H., and Wilson, D. B.(1993) Mol. Cell. Biol.13, 2235-2246
[Abstract/Free Full Text]
- Kelley, C., Blumberg, H., Zon, L. I., and Evans, T.(1993) Development118, 817-827
[Abstract]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. M.K. de Vooght, R. van Wijk, A. C. van Wesel, and W. W. van Solinge
Characterization of the -148C>T promoter polymorphism in PKLR
Haematologica,
September 1, 2008;
93(9):
1407 - 1408.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kanno, T. Utsugisawa, S. Aizawa, T. Koizumi, K.-i. Aisaki, T. Hamada, H. Ogura, and H. Fujii
Transgenic rescue of hemolytic anemia due to red blood cell pyruvate kinase deficiency
Haematologica,
June 1, 2007;
92(6):
731 - 737.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Perkins, K. R. Peterson, G. Stamatoyannopoulos, H. E. Witkowska, and S. H. Orkin
Fetal expression of a human Agamma globin transgene rescues globin chain imbalance but not hemolysis in EKLF null mouse embryos
Blood,
March 1, 2000;
95(5):
1827 - 1833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H. Surinya, T. C. Cox, and B. K. May
Identification and Characterization of a Conserved Erythroid-specific Enhancer Located in Intron 8 of the Human 5-Aminolevulinate Synthase 2 Gene
J. Biol. Chem.,
July 3, 1998;
273(27):
16798 - 16809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Lacronique, P. Varlet, P. Mayeux, A. Porteu, S. Gisselbrecht, A. Kahn, and C. Lacombe
Bcl-2 Targeted Overexpression Into the Erythroid Lineage of Transgenic Mice Delays But Does Not Prevent the Apoptosis of Erythropoietin-Deprived Erythroid Progenitors
Blood,
October 15, 1997;
90(8):
3050 - 3056.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Newton, J. Mackay, and M. Crossley
The N-terminal Zinc Finger of the Erythroid Transcription Factor GATA-1 Binds GATC Motifs in DNA
J. Biol. Chem.,
September 14, 2001;
276(38):
35794 - 35801.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|