JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, R.
Right arrow Articles by Sessa, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, R.
Right arrow Articles by Sessa, W. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 25, Issue of June 23, pp. 15320-15326, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional Analysis of the Human Endothelial Nitric Oxide Synthase Promoter
SP1 AND GATA FACTORS ARE NECESSARY FOR BASAL TRANSCRIPTION IN ENDOTHELIAL CELLS (*)

Rong Zhang , Wang Min , William C. Sessa (§)

From the (1)Department of Pharmacology and Molecular Cardiobiology Program, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, Connecticut 06536

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

To gain insights into the mechanisms of endothelial nitric oxide synthase (eNOS) gene expression, we have cloned the eNOS promoter and fused it to a luciferase reporter gene to map regions of the promoter important for basal transcription in bovine aortic endothelial cells (BAEC). Transfection of BAEC with F1 luciferase (LUC) (-1600 to +22 nucleotides) yielded a 35-fold increase in promoter. Progressive deletion from -1600 to -1033 (F2 and F3 LUC) did not significantly influence eNOS promoter activity. Further deletion from -1033 to -779 (F4 LUC) resulted in an approximate 40% reduction in basal promoter activity, and still further deletion from -779 to -494 (F5 LUC) did not markedly influence activity. Deletion from -494 to -166 (F6 LUC) reduced eNOS promoter activity by 40-50%. Specific mutation of the consensus GATA site(-230) in the F3 LUC construct reduced luciferase activity (by 25-30%). Gel shift analysis and antibody depletion using BAEC nuclear extracts demonstrated in vitro binding of GATA-2 to the oligonucleotide sequence containing the -230 GATA site. Next, we mutated the Sp1 site(-103) in the F3 and F6 LUC constructs and in the F3 GATA mutant construct. Expression of these Sp1 mutants in BAEC resulted in a 85-90% reduction in normalized luciferase activity. Gel shift and antibody supershift analysis using a BAEC nuclear extracts demonstrated four specific, DNA-protein complexes binding to the eNOS Sp-1 site, with the slowest migrating form composed of Sp1 and another nuclear protein. These data demonstrate that the Sp1 site is an important cis-element in the core eNOS promoter.


INTRODUCTION

The nitric oxide synthase (NOS)()family of proteins are a unique class of mammalian enzymes that metabolize L-arginine to form nitric oxide (NO) and the reaction by-product, L-citrulline(1) . Three distinct NOS isoforms have been described based on cloning of their cDNAs, genomic sequences, and chromosomal localization; neuronal NOS (nNOS), cytokine-inducible NOS (iNOS), and endothelial NOS (eNOS) (2). eNOS is the only member of the family that is N-myristoylated, a co-translational modification necessary for its particulate localization in endothelial cells(3) .

Very little is known about the regulation of NOS gene expression. The murine iNOS promoter contains cis-acting DNA elements that are targets of cytokine-activated transcription factors, NFB/Rel and IRF(4, 5, 6) . Similar cytokine-responsive cis-elements are also found in the 5`-upstream region of the human iNOS gene(7) . Expression of the human nNOS gene is regulated by two closely linked promoters that yield two primary transcripts that are spliced to mRNAs with different first exons and a common second exon(8) . Characterization of the factors necessary for basal or regulated expression of each promoter is not known. The human eNOS gene is organized into 26 exons, and the transcriptional start site determined, but the 5`-upstream putative promoter sequence has not been examined(9) . Preliminary characterization of the bovine eNOS promoter identified a 5`-upstream sequence that can drive the expression of a reporter gene, but detailed identification of the cis-elements necessary for expression were not determined(10) .

Recent data suggest that expression of the eNOS gene may be activated via a transcriptional mechanism. The hemodynamic force of shear stress in vitro(11) and chronic exercise in vivo(12) increases the expression of eNOS messenger RNA in endothelial cells. Additionally, subconfluent endothelial cells expressed 2-3 times more eNOS mRNA than do confluent cells(13) . Whether these effects are regulated transcriptionally or post-transcriptionally is not known. Therefore, in order to begin to elucidate such mechanisms, we have cloned the human eNOS promoter and identified the cis DNA sequences required for basal eNOS transcription in endothelial cells.


MATERIALS AND METHODS

Cloning of the eNOS Promoter

Two oligonucleotide primers designed based on the furthest 5`-upstream genomic sequence (5`-ATCTGATGCTGCC-3`) and 3`-downstream prior to the initiator methionine codon (5`-GTTACTGTGCGT-3`) from the cloned human eNOS gene (9) were used in a polymerase chain reaction (PCR) using Taq polymerase (Promega) with human genomic DNA (50 ng) as template. Denaturation, annealing, and elongation temperatures were 94, 60, and 72 °C for 1 min each for 30 cycles, respectively. The PCR product (approximately 1.6 kilobase pairs) was gel-purified and subcloned into the TA cloning vector for PCR products (Invitrogen). Alkaline denatured double-stranded plasmid DNA was sequenced on both strands by the Taq dye terminator method and analyzed on an Applied Biosystems 373 DNA sequencer.

Human eNOS Reporter Gene Constructs and Mutagenesis

The eNOS PCR product (F1) was subcloned into the KpnI/XhoI sites of the luciferase reporter gene vector, pGL2 (Promega). For generation of deletion mutants, the following forward primers (5` to 3` notation, each with a KpnI site (underlined) preceded by AA) were used in a PCR reaction with the full-length promoter (-1600 to +22) as template: F2, AA GGTACCACAGCCCGTTCCTTC (nt -1189); F3, AA GGTACCCCGTTTCTTTCTTAAACT (nt -1033); F4, AA GGTACCCTGCCTCAGCCCTAG (nt -779); F5, AA GGTACCGAGGTGAAGGAGAGA (nt -494); and F6, AA GGTACCGTGGAGCTGAGGCTT (nt -166) with the reverse primer (with a XhoI site at the 3` end) R1, CTCGAGGTTACTGTGCGTCCACTCT (+22 to +4). PCR products were gel-purified, digested, and subcloned into the KpnI/XhoI sites of the luciferase reporter gene vector. For generation of site-directed mutants of GATA and Sp1 cis-elements in the eNOS promoter, recombinant PCR with 2 rounds of amplification was performed as described previously(14) . The PCR primers (mutations of wild-type sequence appear in boldface) for the GATA mutation(-230) were GCTCCCACTTTAGAGCCTCAGT (sense) and GAGGCTCTAAAGTGGGAGC (antisense) and for the Sp1 mutation (-103) were GGATAGGGACTGGGCGAGG (sense) and CCTCGCCCAGTCCCTATCC (antisense). In brief, sense and antisense primers with the corresponding mutations were synthesized and incubated in separate reaction tubes with F3, F5, and F6 LUC as templates and one outside complementary primer from upstream or downstream of the mutation site, thus yielding two subfragments that each contained the appropriate mutation. Subfragments were end-filled and annealed, and a second round of PCR was performed using two outside primers. The PCR products were isolated and subcloned into the KpnI/XhoI sites of pGL2 as above. All constructs were verified by sequencing the inserts and flanking regions in the plasmid.

Cell Culture and Transfections

Bovine aortic endothelial cells (BAEC) were isolated as described previously (3) and cultured in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal bovine serum, 25 mML-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin sulfate (all from Life Technologies, Inc.) into six-well plastic tissue culture plates. Bovine aortic vascular smooth muscle cells (VSM) were isolated from medial explants after gentle removal of the endothelium and dissection of the adventitia. VSM were cultured in the above media into six-well plastic tissue culture dishes. Cells were identified as VSM by positive imunofluorescent staining for -actin and negative staining for eNOS. BAEC and VSM were used between passages 3 and 6 for transfections.

For transfection of BAEC and VSM with eNOS promoter constructs, cells (60-70% confluent) were preincubated in OptiMEM media (Life Technologies, Inc.) for 30 min at 37 °C. eNOS promoter plasmid DNAs (2 µg) and a plasmid containing SV40-driven -galactosidase (1 µg, to normalize for transfection efficiency) were mixed with Lipofectamine (Life Technologies, Inc., 6 µl/well) and incubated for 20 min at room temperature. The lipid-coated DNA was then added to each well containing 2 ml of OptiMEM media and incubated overnight. The next day, media were removed and replaced with complete media for an additional 24 h. BAEC were then lysed (400 µl), and extracts were centrifuged to remove unbroken cells and debris. Extracts were then used for measurement of luciferase (10 µl) or -galactosidase activities (40 µl). Luciferase activity was measured at least 3 times in duplicate using a Berthold luminometer, and -galactosidase was measured spectrophotometrically (at 420 nm) by the generation of o-nitrophenol from the substrate, o-nitrophenyl--D-galactopyranoside. All data were normalized as relative light units/-galactosdase activity.

Preparation of Nuclear Extracts

Nuclear extracts were prepared essentially as described previously(15) . BAEC (T75 flasks) were rinsed with cold phosphate-buffered saline, and cells were trypsinized and pelleted. Cell pellets were washed twice with cold phosphate-buffered saline, lysed by the addition of 500 µl of lysis buffer (10 mM HEPES, 1.5 mM MgCl, 10 mM KCl, 0.5% Nonidet P-40 containing 1 µg/ml leupeptin, 5 µg/ml aprotinin, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride) and were incubated at 4 °C for 10 min. Lysates were centrifuged, and nuclei were resuspended in buffer containing 20 mM HEPES, 420 mM NaCl, 1.5 mM MgCl, 0.2 mM EDTA, 25% glycerol with the above protease inhibitors and incubated at 4 °C for 30 min. Nuclei were centrifuged (10,000 rpm) for 10 min at 4 °C, and an equal volume of the supernatant was added to nuclear homogenization buffer containing 20 mM HEPES, 100 mM KCl, 0.2 mM EDTA, 20% glycerol with protease inhibitors, and extracts stored at -80 °C. Extracts were sonicated and clarified prior to use.

Electrophoretic Mobility Shift Assays

Oligonucleotide probes were prepared by annealling complementary strands of DNA overnight followed by purification on Sephadex G-25. Radioactive probes were end-labeled with [-P] ATP using T4 polynucleotide kinase (New England Biolabs) and purified prior to use. Typically, specific activities were 10 cpm/ng DNA. Nuclear extracts (4-10 µg) from BAEC were incubated in binding buffer (25 mM HEPES (pH 7.5), 50 mM KCl,1 mM dithiothreitol, 10 µM ZnSO, 0.2 mg/ml bovine serum albumin, 10% glycerol, and 0.1% Nonidet P-40) containing 1 µg of poly(dIdC) (Sigma) at room temperature for 10 min, and then the P-labeled oligonucleotide probe (approximately 5000 cpm or 50 fmol) was added for an additional 10 min in a total reaction volume of 15 µl. In competition studies, excess wild-type or mutant oligonucleotides were added in 50-fold molar excess prior to the addition of the P-labeled probe. The wild-type GATA probe (upper strand) used was 5`-GCTCCCACTTATCAGCCTCAGT-3`, and the mutant GATA probe was 5`-GCTCCCACTTTAGAGCCTCAGT-3`. In some experiments, an oligonucleotide probe that contains the cis-element for GATA-2 binding to the human endothelin-1 gene (hET-1) was used(16) . The hET-1 GATA probe (GATA site in boldface, from -145 to -123, upper strand) was: 5`-GGCCTGGCCCTTATCTCCGGCTTGC-3`. The wild-type Sp1 probe (upper strand) was 5`-GGATAGGGGCGGGGCGAGG-3`, and the mutant probe was 5`-GGATAGGGACTGGGCGAGG-3`.

To determine the composition of nuclear proteins that bound to GATA and Sp1-specific oligonucleotide sequences, immunodepletion or supershifting of the DNA-protein complexes were performed. For antibody depletion of GATA-2, 1.5 µl of preimmune or immune murine GATA-2 antisera (kindly provided by Drs. S. Orkin and F. Tsai, Children's Hospital, Boston, MA) was incubated with BAEC nuclear extracts for 2 h, and then the radiolabeled probe was added. To determine specificity of the GATA-2 antibody, COS cell were transfected with the human GATA-2 expression vector (pMT2-hGATA-2, kindly provided by Drs. S. Orkin and M. Crossley), and nuclear extracts were prepared for immunodepletion as above. Extracts from sham transfected COS cells did demonstrate the presence of specific DNA-protein complexes (data not shown). For supershift experiments, either nonimmune or Sp1 antisera (Santa Cruz Biotech, Inc) was incubated overnight at 4 °C with DNA-nuclear protein complexes, prior to electrophoresis. Authentic Sp1 (1 ng, Promega) was used to determine the specificity of the Sp1 antisera. All nuclear DNA-protein complexes were resolved on 6% nondenaturing polyacrylamide gels containing 7.5% glycerol in 0.25% Tris borate/EDTA buffer. Dried gels were exposed to Kodak XAR film for autoradiography.


RESULTS

Based on the most 5` sequence reported for the human eNOS gene (9), we designed PCR primers to amplify a stretch of DNA from -1600 to +22 bp using human genomic DNA as template. A 1600-bp PCR product was amplified in several experiments. The PCR product was subcloned, and several clones were restriction mapped and sequenced with identical results. Complete sequencing revealed a DNA sequence (Fig. 1) that is virtually identical (99.6-99.9%) to that previously reported with the following differences: G for A at -1541; no G at -1504 and -1511; A for T at -1469; A for C at -1469; A for G at -1443; C for G at -1411; C for G at -1039; G for A at -934; and C for T at -787 compared with Marsden et al.(9) . Our sequence was more similar to that reported by Robinson et al.(17) except a G for C at -1477, deleted G at -1244, and a C at -1211 and a C for G at -1038. None of these base substitutions or deletions were in consensus sequences for binding of known transcription factors.


Figure 1: Nucleotide sequence of the human eNOS promoter. The 1600-bp fragment was isolated and sequenced. The numbering is relative to the transcriptional start site (+1) as determined previously (9, 17). The nucleotide sequences for putative cis-acting elements are in boldface, underlined, and labeled. Arrows (labeled F1 through F6 and R1) above the nucleotide sequence depict forward and reverse primers used for generation of deletion mutants by PCR, respectively. Abbreviations for cis-elements are as follows: AP-1, activator protein 1; SRE-1, sterol regulatory element-1; AP-2, activator protein 2; RCE, retinoblastoma control element; SSRE, shear stress response element; NF-1, nuclear factor-1; and CRE, cAMP response element.



Previous analysis of the eNOS gene demonstrated that it contains a ``TATA-less'' 5`-upstream region with a single transcriptional start site 22 bp upstream of the initiator methionine codon (Fig. 1(9, 17) . In order to see if our construct was functional and to identify regions of the eNOS promoter important for basal and stimulated transcription in endothelial cells, a series of deletion constructs were made with progressively smaller fragments of the 5`-flanking sequence and cloned in front of the luciferase reporter gene (F1 through F6 LUC, see Fig. 1). LUC constructs were then transiently transfected into BAEC for determination of eNOS promoter activity.

Transfection of BAEC with F1 LUC, which contained the most 5` sequence, yielded a 35-fold increase in promoter activity (expressed as relative light units normalized to -galactosidase activity) relative to transfection with vector alone (Fig. 2). Progressive deletion from -1600 to -1033 did not significantly influence eNOS promoter activity, however there was tendency for a slight increase in promoter activity with the F2 LUC construct suggesting removal of an weakly negative regulatory region. F3 LUC(-1033) contained the minimal 5` DNA sequence necessary for full activation of the eNOS promoter, suggesting that the proximal cis-regulatory sites (see Fig. 1) do not contribute significantly to basal transcription of the eNOS promoter in BAEC.


Figure 2: Transient expression of human eNOS gene promoter activity in BAEC. Depicted on the leftside of the figure are the eNOS promoter-luciferase deletion constructs. eNOS promoter constructs (F1-F6 LUC) or vector alone (pGL2) were co-transfected with the SV40 driven -galactosidase plasmid and relative activities (LUC/-GAL) determined in cell lysates. On the right is relative activity of each of the constructs in BAEC. The data represent means ± S.E. of four experiments in duplicate using at least three different plasmid DNA preparations.



Further deletion from -1033 to -779 (F4 LUC) resulted in a approximate 40% reduction in basal promoter activity, whereas deleting down to -494 (F5 LUC) did not appreciably reduce activity further. However, deletion from -494 to -166 (F6 LUC) reduced eNOS promoter activity by 40-50% compared with F5 LUC and by 80% compared with F1 LUC in transfected BAEC. These data demonstrate that the major sites for binding or for cooperative interactions between cis-elements and transcription factors are located in the 5`-flanking region between -1033 and -779 and between -779 and -166 of the human eNOS promoter.

Deletion of the sequence between -494 and -166 significantly reduced luciferase expression in BAEC (by 40-50%), suggesting the presence of positive regulatory elements in this region. Since the expression of several endothelial genes (endothelin-1, P-selectin, vascular cell adhesion molecule-1, von Willebrand factor, Refs. 18-20) requires the presence of a consensus motif for transactivation by the GATA family of transcription factors (primarily GATA-2, Refs. 21, 22), we mutated the inverse GATA element in the human eNOS promoter at -230 from TATCA to TTAGA in two constructs, F3 and F5 LUC (Fig. 3). Expression of these mutant constructs in BAEC resulted in a modest inhibition (25-30%) of luciferase activity compared with F1 LUC expression and to the expression of the corresponding wild-type constructs. The weak inhibition of luciferase activity in the F3 GATA mutant suggests that other cis-acting elements alone or in concert with GATA elements are necessary for full promoter activity. Mutation of GATA(-230) in the F5 construct reduced luciferase activity to that observed with F6 LUC demonstrating that in the context of F5 LUC, the GATA element was necessary for activation.


Figure 3: Mutation of the GATA consensus site at -230 modestly reduces human eNOS gene promoter activity in transiently transfected BAEC. GATA site mutants were made by recombinant PCR using F3 and F5 LUC as templates. Depicted on the leftside are the full-length eNOS construct (F1LUC), F3, F5, and F6LUC constructs, and the corresponding F3and F5GATA mutant constructs. On the right is the relative activity of each construct as percent of that obtained with F1 LUC. The data represent means ± S.E. of three experiments in duplicate.



To confirm that the GATA element at -230 could bind nuclear proteins, we performed electrophoretic mobility shift assays using an a double-stranded oligonucleotide probe encompassing the putative GATA site (-239 to -218). As seen in Fig. 4A, incubation of nuclear extracts from BAEC with the P-labeled probe results in the appearance of a specific DNA-protein complex that is completely prevented by 50-fold molar excess of unlabeled probe. Preincubation of nuclei with a mutant double-stranded oligonucleotide GATA probe (based on the functional mutation in Fig. 3) did not interfere with the formation of the DNA-protein complex. An oligonucleotide probe derived from the GATA site in the hET-1 gene promoter prevented the formation of the DNA-protein complex, suggesting that the core GATA motif from human eNOS and hET-1 genes could bind the same nuclear proteins. Gel shift experiments using the P-labeled hET-1 GATA motif and BAEC nuclear extracts demonstrated the same size DNA-protein complex as seen using the eNOS probe. Co-incubation with double-stranded oligonucleotide probes containing wild-type, but not the mutant eNOS GATA site, prevented the formation of the specific DNA-protein complex. To confirm that the GATA-2 transcription factor binds to the eNOS GATA element, we performed immunodepletion of nuclear extracts with an antibody directed against GATA-2. Fig. 4B demonstrates that preincubation of nuclear extracts, prepared from COS cells transfected with the human GATA-2 cDNA or BAEC, with GATA-2 antisera but not preimmune sera, prevented the formation of a specific DNA-protein complex. Extracts prepared from COS cells transfected with vector alone (pMT2) did not demonstrate specific binding of the GATA containing oligonucleotide probe (data not shown).


Figure 4: Binding of an endothelial GATA factor to the human eNOS GATA element. In panelA, nuclear extracts from BAEC (4 µg) were incubated with a labeled double-stranded oligonucleotide probe containing the eNOS gene GATA consensus binding site (lanes1-4) or a labeled double-stranded probe containing the hET-1 gene GATA site (lanes5-8). Oligonucleotides used in competition reactions were present at 50-fold molar excess including cold, wild-type competitor (lanes2 and 6), mutant eNOS GATA competitor (lanes3 and 7), and wild-type ET-1 (lane4) and eNOS (lane8), respectively. In panelB, nuclear extracts from BAEC or COS cells expressing recombinant GATA-2 were preincubated with either preimmune sera or GATA-2 antisera prior to addition of the labeled probe. Only retarded bands are shown.



Because the GATA element at -230 could not account for activation of the eNOS promoter and since GATA elements can cooperate with GC-rich sequences that bind the Sp1 transcription factor(23, 24, 25) , we mutated the putative high affinity Sp1 site (-103, from GGGCGG to GGACTG) in the F3 and F6 LUC constructs and in the F3 GATA mutant construct (Fig. 5). Expression of the F3 Sp1 mutant in BAEC resulted in a 85-90% reduction in normalized luciferase activity. Moreover, mutation of the Sp1 site in the F3 GATA mutant reduced eNOS promoter activity further. Mutation of the Sp1 site in the F6 LUC construct abrogated luciferase activity to levels observed with transfection of vector alone (4% of activity remaining). These data suggest that the Sp1 site is an important and necessary cis-element in the core eNOS promoter and that the stimulatory effect of the GATA element can only be observed when the proximal Sp1 site is intact.


Figure 5: Mutation of the Sp1 site at -103 markedly attenuates human eNOS gene promoter activity in transiently transfected BAEC. Sp1 site mutants and the Sp1/GATA mutant were made by recombinant PCR using F3 (for both single and double mutants) and F6 LUC (for Sp1 mutant) as templates. Depicted on the leftside are the full-length eNOS construct (F1LUC), F3 and F6LUC constructs, the F3 and F6Sp1 mutants, and the F3GATA/Sp1 mutant. On the right is the relative activity of each construct as percent of that obtained with F1 LUC. The data represent the average of duplicate samples from a single experiment. Similar results were obtained in three additional experiments.



Electrophoretic mobility shift assays using a double-stranded oligonucleotide probe encompassing the eNOS Sp1 site (-109 to -99) demonstrated the presence of four specific DNA-protein complexes (1, 2, 3, and 4) in extracts from BAEC that are prevented by 50-fold molar excess of unlabeled probe (Fig. 6A). Preincubation of nuclear extracts with a mutant double-stranded oligonucleotide probe (based on the functional mutation in Fig. 5) did not interfere with the formation of the DNA-protein complexes. Furthermore, preincubation with the hET-1 GATA probe did not compete for specific interactions between nuclear proteins and the eNOS Sp1 site. To confirm that the Sp1 transcription factor binds to the eNOS Sp1 element, we performed antibody supershift analysis with an antibody directed against human Sp1. Fig. 6B shows that the Sp1 antibody shifted the mobility of purified Sp1 and the slowest migrating DNA-protein complex (complex 1) from BAEC. These results also demonstrate the complex 1 is composed of two DNA binding proteins, one of which is Sp1 (1a), and the other, 1b, is unidentified. Identical results were obtained in nuclear extracts from human umbilical vein endothelial cells (data not shown). These data directly demonstrate that Sp1 is binding to the eNOS Sp1 site. The composition of the nuclear proteins that bind to sites 1b, 2, 3 and 4 are currently under investigation.


Figure 6: Binding of an endothelial Sp1 factors to the human eNOS Sp1 element. In panelA, nuclear extracts from BAEC (4 µg) were incubated with a labeled double-stranded oligonucleotide probe containing the eNOS gene Sp1 consensus binding site (lanes1-4). Oligonucleotides used in competition reactions were present at 50-fold molar excess including wild-type competitor (lane2), mutant eNOS Sp1 competitor (lane3), and wild-type ET-1 (lane4). In panelB, BAEC DNA-protein complexes or authentic Sp1 were incubated with nonimmune or Sp1 antisera and incubated overnight as described. Only retarded bands are shown.



To examine if the eNOS promoter was expressed exclusively in endothelial cells, we transfected F1 LUC, F3 LUC, and F3 Sp1 mut LUC constructs into BAEC and VSM. Fig. 7demonstrates that the 1600-bp eNOS promoter fragment was expressed in both cell types. However, the level of expression was 3-4 times greater in BAEC than in VSM. Mutation of the Sp1 cis-element reduced the expression of F3 to a greater extent in BAEC than that observed in VSM.


Figure 7: Transient expression of human eNOS gene promoter activity in bovine aortic endothelial cells (EC) and VSM. eNOS promoter constructs (F1, F3, and F3 LUC) were co-transfected with the SV40-driven -galactosidase plasmid, and relative activities (LUC/-GAL) were determined in cell lysates. Data are presented as relative activity of each of the constructs in BAEC and VSM. The data represents means ± S.E. of four experiments in duplicate.




DISCUSSION

The present study demonstrates that basal eNOS transcription in endothelial cells requires the Sp1 binding site at -103, which is modulated by the GATA site at -230. Mutagenesis of the GATA site only marginally reduced eNOS promoter activity, whereas mutation of the Sp1 site dramatically reduced activity, suggesting that the GATA cis-element was operational only when the Sp1 site was intact. Electrophoretic mobility shift assays show the specific binding of nuclear proteins to oligonucleotides containing the GATA and Sp1 motifs. Moreover, we provide direct evidence, in vitro, for binding of GATA-2 and Sp1 transcription factors to their cognate sites.

There is precedence for Sp1 and GATA transcription factors cooperating to determine the expression of certain genes. For example, GATA-1-dependent activation of the human globin gene in erythroid cells occurs only in the presence of Sp1 binding motif(24) . In this model system, depletion of GATA-1 only partially reduced Sp1-dependent transcription; however, mutation of the Sp1 site completely abolished promoter activity as seen in the present study. Similar cooperation between GATA factors and Sp1 occurs with the human tal-1 gene, another gene with a restricted expression pattern in erythroid cells(25) . The mechanism of GATA-2 synergy with Sp1 in the context of the eNOS promoter fragment is presently unknown, but is presumably related to enhanced co-activation at the level of the basal transcriptional machinery composed of TATA binding protein, related associated factors, and RNA polymerase II. Additionally, the expression of GATA-2, the most abundant GATA family member in endothelial cells, in the presence of the ubiquitous transcription factor Sp1, may influence the pattern of eNOS expression.

In addition to GATA/Sp1 interactions as possible regulatory mechanisms for eNOS expression, the appearance of four specific complexes in mobility shift assays suggests multiple protein interactions at the Sp1 cis-element. Three members of the Sp1 family of zinc finger containing transcription factors are known, Sp1, Sp2, and Sp3(26) . Our supershift data (Fig. 6B) demonstrate that Sp1 binds to the eNOS Sp1 element and is the DNA binding protein in complex 1a. The appearance of complex 1b can only be seen (due to the intensity of complex 1) when Sp1 is supershifted. Since Sp3 binds to Sp1 GC-rich consensus sites and the molecular mass of Sp3 is close to Sp1 (100 and 110 kDa, respectively), it is likely that the Sp3 protein is found in complex 1b (26). More recently, the interaction between the retinoblastoma gene product (RB) and Sp1 sites has been described. Transactivation of the fourth promoter of the insulin-like growth factor gene and the c-jun promoter by RB occurs via an Sp1-dependent mechanism(27, 28) . Moreover, Sp1 can bind to either retinoblastoma control elements (CCACCC, see Fig. 1) or Sp1 sites (GGCGGG) equally efficaciously(27) . Mutation of the c-jun Sp1 binding consensus motif can abrogate Sp1-mediated transactivation by RB(28) . One mechanism for the potential interaction between RB and Sp1 is due to RB-liberating Sp1 from a negative regulatory protein, Sp1-I, thus allowing Sp1-dependent transcription(28) . Therefore, it is possible that RB, directly or indirectly, can mediate Sp1-dependent activation of the human eNOS promoter, supporting the concept that eNOS expression may be cell density- or cell cycle-dependent(13) .

eNOS was originally thought to be expressed exclusively in endothelial cells because the endothelium is the major source of nitric oxide for endothelium-dependent relaxation of vascular smooth muscle (2). eNOS is expressed in various rat tissues with the highest levels found in the atria, ventricle, lung, aorta, and uterus, and lesser amounts in brain regions and peripheral tissues(29) . Recently, eNOS has been localized in specific hippocampal neurons, epithelial cells, monocytes, and macrophages, demonstrating that a variety nonendothelial cells can express the gene(30, 31, 32, 33) . Cleary, vascular smooth muscle does not contain eNOS mRNA(34) . However, transfection of the eNOS promoter into cultured vascular smooth cells resulted in luciferase activity, albeit at lower levels, than that observed in endothelial cells (Fig. 7). These data suggest a similarity in the basal transcriptional machinery between endothelial and smooth muscle cells. However, the expression in endothelial cells was sustantially higher, possibly due to additional endothelial-specific enhancers. Alternatively, because only 1600 bp of genomic sequence was isolated, it is likely that additional upstream elements and intronic enhancers will affect the specificity of eNOS expression. The inability to achieve endothelial cell-specific expression with a variety of promoters from genes expressed in endothelial cells supports the idea that additional sequences or factors are necessary for a restricted pattern of expression(19, 21, 35, 36) .

In summary, we have cloned and expressed a functional promoter for the human eNOS gene and have demonstrated that Sp1 and GATA elements are necessary for basal transcription of this gene in endothelial cells. Moreover, Sp1 binding is absolutely required for promoter activity, while GATA-2 binding influences the level of expression. Further characterization of the other factors that bind to the Sp1 element, and footprinting of the -1033 to -779 region, will aid in characterizing the array of factors necessary for eNOS expression in endothelial cells.


FOOTNOTES

*
The Molecular Cardiobiology Program at Yale is supported by Lederle Pharmaceuticals. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) U24214.

§
Supported, in part, by Grant R29-HL51948 from the National Institutes of Health and by the Patrick and Catherine Weldon Donaghue Medical Research Foundation. To whom correspondence should be addressed: Boyer Center for Molecular Medicine, Yale University School of Medicine, Rm. 436D, 295 Congress Ave., New Haven, CT 06536. Tel.: 203-737-2291; Fax: 203-737-2290.

The abbreviations used are: NOS, nitric oxide synthase; nNOS, neuronal NOS; iNOS, cytokine-inducible NOS; eNOS, endothelial NOS; PCR, polymerase chain reaction; LUC, luciferase; BAEC, bovine aortic endothelial cells; VSM, vascular smooth muscle cells; bp, base pair(s); RB, retinoblastoma gene product.


ACKNOWLEDGEMENTS

We thank Dr. Christopher Hughes for helpful discussions on design of promoter constructs and the luciferase reporter gene system, and Drs. Jordan Pober and Dave Johnson for helpful suggestions. We thank Drs. Stuart Orkin, Merlin Crossley, and Fong-ying Tsai for the human GATA-2 expression vector and antibodies.


REFERENCES
  1. Nathan, C.(1992) FASEB J.6, 3051-3064 [Abstract]
  2. Sessa, W. C.(1994) J. Vasc. Res.31, 131-143 [Medline] [Order article via Infotrieve]
  3. Liu, J., and Sessa, W. C.(1994) J. Biol. Chem.269, 11691-11694 [Abstract/Free Full Text]
  4. Xie, Q., Kashiwabara, Y., and Nathan, C.(1994) J. Biol. Chem.269, 4705-4708 [Abstract/Free Full Text]
  5. Kamijo, R., Harada, H., Matsuyama, T., Bosland, M., Gerecitano, J., Shapiro, D., Le, J., Im, K. S., Kimura, T., Green, S., Mak, T. W., Tanaguchi, T., and Vilcek, J.(1994) Science263, 1612-1615 [Abstract/Free Full Text]
  6. Martin, E., Nathan, C., and Xie, Q. W.(1994) J. Exp. Med.180, 977-984 [Abstract/Free Full Text]
  7. Chartrain, N. A., Geller, D. A., Koty, P. P., Sitrin, N. F., Nussler, A. K., Hoffman, E. P., Billiar, T. R., Huchinson, N. I., and Mudgett, J. S.(1994) J. Biol. Chem.269, 6765-6722 [Abstract/Free Full Text]
  8. Xie, J., Roddy, P., Rife, T. K., Murad, F., and Yound, A. P.(1995) Proc. Natl. Acad. Sci. U. S. A.92, in press
  9. Marsden, P. A., Heng, H. Q., Scherer, S. W., Stewart, R. J., Hall, A. V., Shi, X. M., Tsui, L. C., and Schappert, K. T.(1993) J. Biol. Chem.268, 17478-17488 [Abstract/Free Full Text]
  10. Venema, R. C., Nishida, K., Alexander, R. W., Harrison, D. G., and Murphy, T. J.(1994) Biochim. Biophys. Acta1218, 413-420 [Medline] [Order article via Infotrieve]
  11. Nishida, K., Harrison, D. G., Navas, J. P., Fisher, A. A., Dochery, S. P., Uematsu, M., Nerem, R. M., Alexander, R. W., and Murphy, T. J. (1992) J. Clin. Invest.90, 2092-2096
  12. Sessa, W. C., Pritchard, K., Seyedi, N., Wang, J., and Hintze, T. H. (1994) Circ. Res.74, 349-353 [Abstract/Free Full Text]
  13. Arnal, J., Yamin, J., Dockery, S., and Harrison, D. G.(1994) Am. J. Physiol.267, C1381-C1388
  14. Higuchi, R., Krummel, B., and Saiki, R. K.(1988) Nucleic Acids Res.16, 7351-7367 [Abstract/Free Full Text]
  15. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G.(1983) Nucleic Acids Res.11, 1475-1489 [Abstract/Free Full Text]
  16. Lee, M. E., Bloch, K. D., Clifford, J. A., and Quertermous, T.(1990) J. Biol. Chem.265, 10446-10450 [Abstract/Free Full Text]
  17. Robinson, L. J., Weremowicz, S., Morton, C. C., and Michel, T.(1994) Genomics19, 350-357 [CrossRef][Medline] [Order article via Infotrieve]
  18. Pan, J., and McEver, R. P.(1993) J. Biol. Chem.268, 22600-22608 [Abstract/Free Full Text]
  19. Neish, A. S., Williams, A. J., Palmer, H. J., Whitley, M. Z., and Collins, T.(1992) J. Exp. Med.176, 1583-1593 [Abstract/Free Full Text]
  20. Assouline, Z., Kerbirou-Nabias, D. M., Pietu, G., Thomas, N., Bahnak, B., and Meyer, D.(1988) Biochem. Biophys. Res. Commun.156, 389-395 [CrossRef][Medline] [Order article via Infotrieve]
  21. Lee, M. E., Temizer, D. H., Clifford, J. A., and Quertermous, T.(1991) J. Biol. Chem.266, 16188-16192 [Abstract/Free Full Text]
  22. Dorfman, D. M., Wilson, D. B., Bruns, G. A., and Orkin, S. H.(1992) J. Biol. Chem.267, 1279-1285 [Abstract/Free Full Text]
  23. Kadonaga, J. T., Carner, K. R., Masiarz, F. R., and Tijian, R.(1987) Cell51, 1079-1090 [CrossRef][Medline] [Order article via Infotrieve]
  24. Fischer, K. D., Haese, A., and Nowock, J.(1993) J. Biol. Chem.268, 23915-23923 [Abstract/Free Full Text]
  25. Lecointe, N., Bernard, O., Naert, K., Larsen, C. J., Romeo, P. H., and Mathieu-Mahul, D.(1994) Oncogene9, 2623-2632 [Medline] [Order article via Infotrieve]
  26. Kingsley, C., and Winoto, A.(1992) Mol. Cell. Biol.12, 4251-4261 [Abstract/Free Full Text]
  27. Kim, S. J., Onwuta, U. S., Lee, Y., Li, R., Botchan, M. R., and Robbins, P. D.(1992) Mol. Cell. Biol.12, 2455-2463 [Abstract/Free Full Text]
  28. Chen, L. I., Nishinaka, T., Kwan, K., Kitabayashi, I., Yokoyama, K., Fu, F., Grunwald, S., and Chiu, R.(1994) Mol. Cell. Biol.14, 4380-4389 [Abstract/Free Full Text]
  29. Sessa, W. C., Harrison, J. K., Luthin, D. R., Pollock, J. S., and Lynch, K. R.(1993) Hypertension21, 934-938 [Abstract/Free Full Text]
  30. O'Dell, T. J., Huang, P. L., Dawson, T. D., Dinerman, J. L., Snyder, S. H., Kandel, E. R., and Fishman, M. C.(1994) Science265, 542-546 [Abstract/Free Full Text]
  31. Tracey, W. R., Pollock, J. S., Murad, F., Nakane, M., and Forstermann, U.(1994) Am. J. Physiol.266, C22-C28
  32. Shaul, P. W., North, A. J., Wu, L. C., Wells, L. B., Brannon, T. S., Lau, K. S., Michel, T., Margraf, L. R., and Star, R. A.(1994) J. Clin. Invest.94, 2231-2236
  33. Reiling, N., Ulmer, A. J., Duchrow, M., Ernst, M., Flad, H., and Hauschildt, S.(1994) Eur. J. Immunol.24, 1941-1944 [Medline] [Order article via Infotrieve]
  34. Sessa, W. C., Harrison, J. K., Barber, C. M., Zeng, D., Durieux, M. E., D'Angelo, D. D., Lynch, K. R., and Peach, M. J.(1992) J. Biol. Chem.267, 15274-15276 [Abstract/Free Full Text]
  35. Jahroudi, N., and Lynch, D. C.(1994) Mol. Cell. Biol.14, 999-1008 [Abstract/Free Full Text]
  36. Harats, D., Kurihara, H., Belloni, P., Oakley, H., Zober, A., Ackley, D., Cain, G., Kurihara, Y., Lawn, R., and Sigal, E.(1995) J. Clin. Invest.95, 1335-1344

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Kumar, X. Sun, S. Wedgwood, and S. M. Black
Hydrogen peroxide decreases endothelial nitric oxide synthase promoter activity through the inhibition of AP-1 activity
Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L370 - L377.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A.-M. Teichert, J. A. Scott, G. B. Robb, Y.-Q. Zhou, S.-N. Zhu, M. Lem, A. Keightley, B. M. Steer, A. C. Schuh, S. L. Adamson, et al.
Endothelial Nitric Oxide Synthase Gene Expression During Murine Embryogenesis: Commencement of Expression in the Embryo Occurs With the Establishment of a Unidirectional Circulatory System
Circ. Res., July 3, 2008; 103(1): 24 - 33.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando
Receptor-mediated tobacco toxicity: acceleration of sequential expression of {alpha}5 and {alpha}7 nicotinic receptor subunits in oral keratinocytes exposed to cigarette smoke
FASEB J, May 1, 2008; 22(5): 1356 - 1368.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al.
Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling
J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. Sud, S. Wedgwood, and S. M. Black
Protein kinase C{delta} regulates endothelial nitric oxide synthase expression via Akt activation and nitric oxide generation
Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L582 - L591.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Won, S.-N. Zhu, M. Chen, A.-M. Teichert, J. E. Fish, C. C. Matouk, M. Bonert, M. Ojha, P. A. Marsden, and M. I. Cybulsky
Relative Reduction of Endothelial Nitric-Oxide Synthase Expression and Transcription in Atherosclerosis-Prone Regions of the Mouse Aorta and in an in Vitro Model of Disturbed Flow
Am. J. Pathol., November 1, 2007; 171(5): 1691 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
T. Simoncini, X-D. Fu, A. Caruso, S. Garibaldi, C. Baldacci, M.S. Giretti, P. Mannella, M.I. Flamini, A.M. Sanchez, and A.R. Genazzani
Drospirenone increases endothelial nitric oxide synthesis via a combined action on progesterone and mineralocorticoid receptors
Hum. Reprod., August 1, 2007; 22(8): 2325 - 2334.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Schwartz, S. Osborne-Lawrence, L. Hahner, L. L. Gibson, A. K. Gormley, W. Vongpatanasin, W. Zhu, R. A. Word, D. Seetharam, S. Black, et al.
C-Reactive Protein Downregulates Endothelial NO Synthase and Attenuates Reendothelialization In Vivo in Mice
Circ. Res., May 25, 2007; 100(10): 1452 - 1459.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Wozniak, M. E. Boyer, J. A. Grass, Y. Lee, and E. H. Bresnick
Context-dependent GATA Factor Function: COMBINATORIAL REQUIREMENTS FOR TRANSCRIPTIONAL CONTROL IN HEMATOPOIETIC AND ENDOTHELIAL CELLS
J. Biol. Chem., May 11, 2007; 282(19): 14665 - 14674.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
Y. Dong and L. P. Thompson
Differential Expression of Endothelial Nitric Oxide Synthase in Coronary and Cardiac Tissue in Hypoxic Fetal Guinea Pig Hearts
Reproductive Sciences, October 1, 2006; 13(7): 483 - 490.
[Abstract] [PDF]


Home page
Obstet GynecolHome page
T. Simoncini, A. Caruso, S. Garibaldi, X.-D. Fu, M. S. Giretti, C. Baldacci, C. Scorticati, L. Fornari, P. Mannella, and A. R. Genazzani
Activation of nitric oxide synthesis in human endothelial cells using nomegestrol acetate.
Obstet. Gynecol., October 1, 2006; 108(4): 969 - 978.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Min, Y.-M. Jin, J.-S. Moon, M.-S. Sung, S. Ahn Jo, and I. Jo
Hypoxia-Induced Endothelial NO Synthase Gene Transcriptional Activation Is Mediated Through the Tax-Responsive Element in Endothelial Cells
Hypertension, June 1, 2006; 47(6): 1189 - 1196.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Niwano, M. Arai, N. Koitabashi, S. Hara, A. Watanabe, K. Sekiguchi, T. Tanaka, T. Iso, and M. Kurabayashi
Competitive Binding of CREB and ATF2 to cAMP/ATF Responsive Element Regulates eNOS Gene Expression in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., May 1, 2006; 26(5): 1036 - 1042.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-L. Yu, Y.-J. Chiang, Y.-C. Chen, M. Papetti, C.-G. Juo, A. I. Skoultchi, and J. J. Y. Yen
MAPK-mediated Phosphorylation of GATA-1 Promotes Bcl-XL Expression and Cell Survival
J. Biol. Chem., August 19, 2005; 280(33): 29533 - 29542.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. E. Fish, C. C. Matouk, A. Rachlis, S. Lin, S. C. Tai, C. D'Abreo, and P. A. Marsden
The Expression of Endothelial Nitric-oxide Synthase Is Controlled by a Cell-specific Histone Code
J. Biol. Chem., July 1, 2005; 280(26): 24824 - 24838.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Simoncini, P. Mannella, L. Fornari, A. Caruso, M. Y. Willis, S. Garibaldi, C. Baldacci, and A. R. Genazzani
Differential Signal Transduction of Progesterone and Medroxyprogesterone Acetate in Human Endothelial Cells
Endocrinology, December 1, 2004; 145(12): 5745 - 5756.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Sun and J. K. Liao
Induction of Angiogenesis by Heat Shock Protein 90 Mediated by Protein Kinase Akt and Endothelial Nitric Oxide Synthase
Arterioscler. Thromb. Vasc. Biol., December 1, 2004; 24(12): 2238 - 2244.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Cattaruzza, T. J. Guzik, W. Slodowski, A. Pelvan, J. Becker, M. Halle, A. B. Buchwald, K. M. Channon, and M. Hecker
Shear Stress Insensitivity of Endothelial Nitric Oxide Synthase Expression as a Genetic Risk Factor for Coronary Heart Disease
Circ. Res., October 15, 2004; 95(8): 841 - 847.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Chan, J. E. Fish, C. D'Abreo, S. Lin, G. B. Robb, A.-M. Teichert, F. Karantzoulis-Fegaras, A. Keightley, B. M. Steer, and P. A. Marsden
The Cell-specific Expression of Endothelial Nitric-oxide Synthase: A ROLE FOR DNA METHYLATION
J. Biol. Chem., August 13, 2004; 279(33): 35087 - 35100.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J.-W. Xu, K. Ikeda, and Y. Yamori
Upregulation of Endothelial Nitric Oxide Synthase by Cyanidin-3-Glucoside, a Typical Anthocyanin Pigment
Hypertension, August 1, 2004; 44(2): 217 - 222.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
S. SenBanerjee, Z. Lin, G. B. Atkins, D. M. Greif, R. M. Rao, A. Kumar, M. W. Feinberg, Z. Chen, D. I. Simon, F. W. Luscinskas, et al.
KLF2 Is a Novel Transcriptional Regulator of Endothelial Proinflammatory Activation
J. Exp. Med., May 17, 2004; 199(10): 1305 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Seki, K.-H. Hong, J. Yun, S.-J. Kim, and S. P. Oh
Isolation of a Regulatory Region of Activin Receptor-Like Kinase 1 Gene Sufficient for Arterial Endothelium-Specific Expression
Circ. Res., April 30, 2004; 94(8): e72 - e77.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Goya, S. Sumitani, X. Xu, T. Kitamura, H. Yamamoto, S. Kurebayashi, H. Saito, H. Kouhara, S. Kasayama, and I. Kawase
Peroxisome Proliferator-Activated Receptor {alpha} Agonists Increase Nitric Oxide Synthase Expression in Vascular Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., April 1, 2004; 24(4): 658 - 663.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. C. Tai, G. B. Robb, and P. A. Marsden
Endothelial Nitric Oxide Synthase: A New Paradigm for Gene Regulation in the Injured Blood Vessel
Arterioscler. Thromb. Vasc. Biol., March 1, 2004; 24(3): 405 - 412.
[Abstract] [Full Text]