![]()
|
|
||||||||
From the
To gain insights into the mechanisms of endothelial nitric oxide
synthase (eNOS) gene expression, we have cloned the eNOS promoter and
fused it to a luciferase reporter gene to map regions of the promoter
important for basal transcription in bovine aortic endothelial cells
(BAEC). Transfection of BAEC with F1 luciferase (LUC) (-1600 to
+22 nucleotides) yielded a 35-fold increase in promoter.
Progressive deletion from -1600 to -1033 (F2 and F3 LUC)
did not significantly influence eNOS promoter activity. Further
deletion from -1033 to -779 (F4 LUC) resulted in an
approximate 40% reduction in basal promoter activity, and still further
deletion from -779 to -494 (F5 LUC) did not markedly
influence activity. Deletion from -494 to -166 (F6 LUC)
reduced eNOS promoter activity by 40-50%. Specific mutation of
the consensus GATA site(-230) in the F3 LUC construct reduced
luciferase activity (by 25-30%). Gel shift analysis and antibody
depletion using BAEC nuclear extracts demonstrated in vitro binding of GATA-2 to the oligonucleotide sequence containing the
-230 GATA site. Next, we mutated the Sp1 site(-103) in the
F3 and F6 LUC constructs and in the F3 GATA mutant construct.
Expression of these Sp1 mutants in BAEC resulted in a 85-90%
reduction in normalized luciferase activity. Gel shift and antibody
supershift analysis using a BAEC nuclear extracts demonstrated four
specific, DNA-protein complexes binding to the eNOS Sp-1 site, with the
slowest migrating form composed of Sp1 and another nuclear protein.
These data demonstrate that the Sp1 site is an important cis-element in
the core eNOS promoter.
The nitric oxide synthase (NOS)
Very little is known
about the regulation of NOS gene expression. The murine iNOS promoter
contains cis-acting DNA elements that are targets of cytokine-activated
transcription factors, NF
Recent data suggest that expression of the eNOS gene may be
activated via a transcriptional mechanism. The hemodynamic force of
shear stress in vitro(11) and chronic exercise in
vivo(12) increases the expression of eNOS messenger RNA in
endothelial cells. Additionally, subconfluent endothelial cells
expressed 2-3 times more eNOS mRNA than do confluent
cells(13) . Whether these effects are regulated
transcriptionally or post-transcriptionally is not known. Therefore, in
order to begin to elucidate such mechanisms, we have cloned the human
eNOS promoter and identified the cis DNA sequences required for basal
eNOS transcription in endothelial cells.
For
transfection of BAEC and VSM with eNOS promoter constructs, cells
(60-70% confluent) were preincubated in OptiMEM media (Life
Technologies, Inc.) for 30 min at 37 °C. eNOS promoter plasmid DNAs
(2 µg) and a plasmid containing SV40-driven
To determine the
composition of nuclear proteins that bound to GATA and Sp1-specific
oligonucleotide sequences, immunodepletion or supershifting of the
DNA-protein complexes were performed. For antibody depletion of GATA-2,
1.5 µl of preimmune or immune murine GATA-2 antisera (kindly
provided by Drs. S. Orkin and F. Tsai, Children's Hospital,
Boston, MA) was incubated with BAEC nuclear extracts for 2 h, and then
the radiolabeled probe was added. To determine specificity of the
GATA-2 antibody, COS cell were transfected with the human GATA-2
expression vector (pMT2-hGATA-2, kindly provided by Drs. S. Orkin and
M. Crossley), and nuclear extracts were prepared for immunodepletion as
above. Extracts from sham transfected COS cells did demonstrate the
presence of specific DNA-protein complexes (data not shown). For
supershift experiments, either nonimmune or Sp1 antisera (Santa Cruz
Biotech, Inc) was incubated overnight at 4 °C with DNA-nuclear
protein complexes, prior to electrophoresis. Authentic Sp1 (1 ng,
Promega) was used to determine the specificity of the Sp1 antisera. All
nuclear DNA-protein complexes were resolved on 6% nondenaturing
polyacrylamide gels containing 7.5% glycerol in 0.25% Tris borate/EDTA
buffer. Dried gels were exposed to Kodak XAR film for autoradiography.
Based on the most 5` sequence reported for the human eNOS
gene (9), we designed PCR primers to amplify a stretch of DNA from
-1600 to +22 bp using human genomic DNA as template. A
1600-bp PCR product was amplified in several experiments. The PCR
product was subcloned, and several clones were restriction mapped and
sequenced with identical results. Complete sequencing revealed a DNA
sequence (Fig. 1) that is virtually identical (99.6-99.9%)
to that previously reported with the following differences: G for A at
-1541; no G at -1504 and -1511; A for T at
-1469; A for C at -1469; A for G at -1443; C for G at
-1411; C for G at -1039; G for A at -934; and C for T
at -787 compared with Marsden et al.(9) . Our
sequence was more similar to that reported by Robinson et al.(17) except a G for C at -1477, deleted G at
-1244, and a C at -1211 and a C for G at -1038. None
of these base substitutions or deletions were in consensus sequences
for binding of known transcription factors.
Transfection of BAEC with F1 LUC, which contained
the most 5` sequence, yielded a 35-fold increase in promoter activity
(expressed as relative light units normalized to
Deletion of
the sequence between -494 and -166 significantly reduced
luciferase expression in BAEC (by 40-50%), suggesting the
presence of positive regulatory elements in this region. Since the
expression of several endothelial genes (endothelin-1, P-selectin,
vascular cell adhesion molecule-1, von Willebrand factor, Refs.
18-20) requires the presence of a consensus motif for
transactivation by the GATA family of transcription factors (primarily
GATA-2, Refs. 21, 22), we mutated the inverse GATA element in the human
eNOS promoter at -230 from TATCA to TTAGA in two
constructs, F3 and F5 LUC (Fig. 3). Expression of these mutant
constructs in BAEC resulted in a modest inhibition (25-30%) of
luciferase activity compared with F1 LUC expression and to the
expression of the corresponding wild-type constructs. The weak
inhibition of luciferase activity in the F3 GATA mutant suggests that
other cis-acting elements alone or in concert with GATA elements are
necessary for full promoter activity. Mutation of GATA(-230) in
the F5 construct reduced luciferase activity to that observed with F6
LUC demonstrating that in the context of F5 LUC, the GATA element was
necessary for activation.
The present study demonstrates that basal eNOS transcription
in endothelial cells requires the Sp1 binding site at -103, which
is modulated by the GATA site at -230. Mutagenesis of the GATA
site only marginally reduced eNOS promoter activity, whereas mutation
of the Sp1 site dramatically reduced activity, suggesting that the GATA
cis-element was operational only when the Sp1 site was intact.
Electrophoretic mobility shift assays show the specific binding of
nuclear proteins to oligonucleotides containing the GATA and Sp1
motifs. Moreover, we provide direct evidence, in vitro, for
binding of GATA-2 and Sp1 transcription factors to their cognate sites.
There is precedence for Sp1 and GATA transcription factors
cooperating to determine the expression of certain genes. For example,
GATA-1-dependent activation of the human
In
addition to GATA/Sp1 interactions as possible regulatory mechanisms for
eNOS expression, the appearance of four specific complexes in mobility
shift assays suggests multiple protein interactions at the Sp1
cis-element. Three members of the Sp1 family of zinc finger containing
transcription factors are known, Sp1, Sp2, and Sp3(26) . Our
supershift data (Fig. 6B) demonstrate that Sp1 binds to
the eNOS Sp1 element and is the DNA binding protein in complex 1a. The
appearance of complex 1b can only be seen (due to the intensity of
complex 1) when Sp1 is supershifted. Since Sp3 binds to Sp1 GC-rich
consensus sites and the molecular mass of Sp3 is close to Sp1 (100 and
110 kDa, respectively), it is likely that the Sp3 protein is found in
complex 1b (26). More recently, the interaction between the
retinoblastoma gene product (RB) and Sp1 sites has been described.
Transactivation of the fourth promoter of the insulin-like growth
factor gene and the c-jun promoter by RB occurs via an
Sp1-dependent mechanism(27, 28) . Moreover, Sp1 can bind
to either retinoblastoma control elements (CCACCC, see Fig. 1) or
Sp1 sites (GGCGGG) equally efficaciously(27) . Mutation of the
c-jun Sp1 binding consensus motif can abrogate Sp1-mediated
transactivation by RB(28) . One mechanism for the potential
interaction between RB and Sp1 is due to RB-liberating Sp1 from a
negative regulatory protein, Sp1-I, thus allowing Sp1-dependent
transcription(28) . Therefore, it is possible that RB, directly
or indirectly, can mediate Sp1-dependent activation of the human eNOS
promoter, supporting the concept that eNOS expression may be cell
density- or cell cycle-dependent(13) .
eNOS was originally
thought to be expressed exclusively in endothelial cells because the
endothelium is the major source of nitric oxide for
endothelium-dependent relaxation of vascular smooth muscle (2). eNOS is
expressed in various rat tissues with the highest levels found in the
atria, ventricle, lung, aorta, and uterus, and lesser amounts in brain
regions and peripheral tissues(29) . Recently, eNOS has been
localized in specific hippocampal neurons, epithelial cells, monocytes,
and macrophages, demonstrating that a variety nonendothelial cells can
express the gene(30, 31, 32, 33) .
Cleary, vascular smooth muscle does not contain eNOS mRNA(34) .
However, transfection of the eNOS promoter into cultured vascular
smooth cells resulted in luciferase activity, albeit at lower levels,
than that observed in endothelial cells (Fig. 7). These data
suggest a similarity in the basal transcriptional machinery between
endothelial and smooth muscle cells. However, the expression in
endothelial cells was sustantially higher, possibly due to additional
endothelial-specific enhancers. Alternatively, because only 1600 bp of
genomic sequence was isolated, it is likely that additional upstream
elements and intronic enhancers will affect the specificity of eNOS
expression. The inability to achieve endothelial cell-specific
expression with a variety of promoters from genes expressed in
endothelial cells supports the idea that additional sequences or
factors are necessary for a restricted pattern of
expression(19, 21, 35, 36) .
In
summary, we have cloned and expressed a functional promoter for the
human eNOS gene and have demonstrated that Sp1 and GATA elements are
necessary for basal transcription of this gene in endothelial cells.
Moreover, Sp1 binding is absolutely required for promoter activity,
while GATA-2 binding influences the level of expression. Further
characterization of the other factors that bind to the Sp1 element, and
footprinting of the -1033 to -779 region, will aid in
characterizing the array of factors necessary for eNOS expression in
endothelial cells.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank
We thank Dr. Christopher Hughes for helpful
discussions on design of promoter constructs and the luciferase
reporter gene system, and Drs. Jordan Pober and Dave Johnson for
helpful suggestions. We thank Drs. Stuart Orkin, Merlin Crossley, and
Fong-ying Tsai for the human GATA-2 expression vector and antibodies.
Volume 270,
Number 25,
Issue of June 23, pp. 15320-15326, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
SP1 AND GATA FACTORS ARE NECESSARY FOR BASAL TRANSCRIPTION IN
ENDOTHELIAL CELLS (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(
)family
of proteins are a unique class of mammalian enzymes that metabolize L-arginine to form nitric oxide (NO) and the reaction
by-product, L-citrulline(1) . Three distinct NOS
isoforms have been described based on cloning of their cDNAs, genomic
sequences, and chromosomal localization; neuronal NOS (nNOS),
cytokine-inducible NOS (iNOS), and endothelial NOS (eNOS) (2). eNOS is
the only member of the family that is N-myristoylated, a
co-translational modification necessary for its particulate
localization in endothelial cells(3) .
B/Rel and
IRF(4, 5, 6) . Similar cytokine-responsive
cis-elements are also found in the 5`-upstream region of the human iNOS
gene(7) . Expression of the human nNOS gene is regulated by two
closely linked promoters that yield two primary transcripts that are
spliced to mRNAs with different first exons and a common second
exon(8) . Characterization of the factors necessary for basal or
regulated expression of each promoter is not known. The human eNOS gene
is organized into 26 exons, and the transcriptional start site
determined, but the 5`-upstream putative promoter sequence has not been
examined(9) . Preliminary characterization of the bovine eNOS
promoter identified a 5`-upstream sequence that can drive the
expression of a reporter gene, but detailed identification of the
cis-elements necessary for expression were not determined(10) .
Cloning of the eNOS Promoter
Two oligonucleotide
primers designed based on the furthest 5`-upstream genomic sequence
(5`-ATCTGATGCTGCC-3`) and 3`-downstream prior to the initiator
methionine codon (5`-GTTACTGTGCGT-3`) from the cloned human eNOS gene
(9) were used in a polymerase chain reaction (PCR) using Taq polymerase (Promega) with human genomic DNA (50 ng) as template.
Denaturation, annealing, and elongation temperatures were 94, 60, and
72 °C for 1 min each for 30 cycles, respectively. The PCR product
(approximately 1.6 kilobase pairs) was gel-purified and subcloned into
the TA cloning vector for PCR products (Invitrogen). Alkaline denatured
double-stranded plasmid DNA was sequenced on both strands by the Taq dye terminator method and analyzed on an Applied
Biosystems 373 DNA sequencer.
Human eNOS Reporter Gene Constructs and
Mutagenesis
The eNOS PCR product (F1) was subcloned into the KpnI/XhoI sites of the luciferase reporter gene
vector, pGL2 (Promega). For generation of deletion mutants, the
following forward primers (5` to 3` notation, each with a KpnI
site (underlined) preceded by AA) were used in a PCR reaction with the
full-length promoter (-1600 to +22) as template: F2, AA GGTACCACAGCCCGTTCCTTC (nt -1189); F3, AA GGTACCCCGTTTCTTTCTTAAACT (nt -1033); F4, AA GGTACCCTGCCTCAGCCCTAG (nt -779); F5, AA GGTACCGAGGTGAAGGAGAGA (nt -494); and F6, AA GGTACCGTGGAGCTGAGGCTT (nt -166) with the reverse primer
(with a XhoI site at the 3` end) R1, CTCGAGGTTACTGTGCGTCCACTCT (+22 to +4). PCR products
were gel-purified, digested, and subcloned into the KpnI/XhoI sites of the luciferase reporter gene
vector. For generation of site-directed mutants of GATA and Sp1
cis-elements in the eNOS promoter, recombinant PCR with 2 rounds of
amplification was performed as described previously(14) . The
PCR primers (mutations of wild-type sequence appear in boldface) for
the GATA mutation(-230) were GCTCCCACTTTAGAGCCTCAGT
(sense) and GAGGCTCTAAAGTGGGAGC (antisense) and for the Sp1
mutation (-103) were GGATAGGGACTGGGCGAGG (sense)
and CCTCGCCCAGTCCCTATCC (antisense). In brief, sense and
antisense primers with the corresponding mutations were synthesized and
incubated in separate reaction tubes with F3, F5, and F6 LUC as
templates and one outside complementary primer from upstream or
downstream of the mutation site, thus yielding two subfragments that
each contained the appropriate mutation. Subfragments were end-filled
and annealed, and a second round of PCR was performed using two outside
primers. The PCR products were isolated and subcloned into the KpnI/XhoI sites of pGL2 as above. All constructs were
verified by sequencing the inserts and flanking regions in the plasmid.
Cell Culture and Transfections
Bovine aortic
endothelial cells (BAEC) were isolated as described previously (3) and cultured in Dulbecco's modified Eagle's
medium containing 10% heat-inactivated fetal bovine serum, 25
mML-glutamine, 100 units/ml penicillin, and 100
µg/ml streptomycin sulfate (all from Life Technologies, Inc.) into
six-well plastic tissue culture plates. Bovine aortic vascular smooth
muscle cells (VSM) were isolated from medial explants after gentle
removal of the endothelium and dissection of the adventitia. VSM were
cultured in the above media into six-well plastic tissue culture
dishes. Cells were identified as VSM by positive imunofluorescent
staining for
-actin and negative staining for eNOS. BAEC and VSM
were used between passages 3 and 6 for transfections.
-galactosidase (1
µg, to normalize for transfection efficiency) were mixed with
Lipofectamine (Life Technologies, Inc., 6 µl/well) and incubated
for 20 min at room temperature. The lipid-coated DNA was then added to
each well containing 2 ml of OptiMEM media and incubated overnight. The
next day, media were removed and replaced with complete media for an
additional 24 h. BAEC were then lysed (400 µl), and extracts were
centrifuged to remove unbroken cells and debris. Extracts were then
used for measurement of luciferase (10 µl) or
-galactosidase
activities (40 µl). Luciferase activity was measured at least 3
times in duplicate using a Berthold luminometer, and
-galactosidase was measured spectrophotometrically (at 420 nm) by
the generation of o-nitrophenol from the substrate, o-nitrophenyl-
-D-galactopyranoside. All data
were normalized as relative light units/
-galactosdase activity.
Preparation of Nuclear Extracts
Nuclear extracts
were prepared essentially as described previously(15) . BAEC
(T75 flasks) were rinsed with cold phosphate-buffered saline, and cells
were trypsinized and pelleted. Cell pellets were washed twice with cold
phosphate-buffered saline, lysed by the addition of 500 µl of lysis
buffer (10 mM HEPES, 1.5 mM MgCl
, 10
mM KCl, 0.5% Nonidet P-40 containing 1 µg/ml leupeptin, 5
µg/ml aprotinin, 1 mM dithiothreitol, 0.5 mM
phenylmethylsulfonyl fluoride) and were incubated at 4 °C for 10
min. Lysates were centrifuged, and nuclei were resuspended in buffer
containing 20 mM HEPES, 420 mM NaCl, 1.5 mM
MgCl
, 0.2 mM EDTA, 25% glycerol with the above
protease inhibitors and incubated at 4 °C for 30 min. Nuclei were
centrifuged (10,000 rpm) for 10 min at 4 °C, and an equal volume of
the supernatant was added to nuclear homogenization buffer containing
20 mM HEPES, 100 mM KCl, 0.2 mM EDTA, 20%
glycerol with protease inhibitors, and extracts stored at -80
°C. Extracts were sonicated and clarified prior to use.
Electrophoretic Mobility Shift
Assays
Oligonucleotide probes were prepared by annealling
complementary strands of DNA overnight followed by purification on
Sephadex G-25. Radioactive probes were end-labeled with
[-
P] ATP using T4 polynucleotide kinase
(New England Biolabs) and purified prior to use. Typically, specific
activities were 10
cpm/ng DNA. Nuclear extracts (4-10
µg) from BAEC were incubated in binding buffer (25 mM HEPES (pH 7.5), 50 mM KCl,1 mM dithiothreitol,
10 µM ZnSO
, 0.2 mg/ml bovine serum albumin,
10% glycerol, and 0.1% Nonidet P-40) containing 1 µg of
poly(dIdC) (Sigma) at room temperature for 10 min, and then the
P-labeled oligonucleotide probe (approximately 5000 cpm or
50 fmol) was added for an additional 10 min in a total reaction volume
of 15 µl. In competition studies, excess wild-type or mutant
oligonucleotides were added in 50-fold molar excess prior to the
addition of the
P-labeled probe. The wild-type GATA probe
(upper strand) used was 5`-GCTCCCACTTATCAGCCTCAGT-3`, and the
mutant GATA probe was 5`-GCTCCCACTTTAGAGCCTCAGT-3`. In some
experiments, an oligonucleotide probe that contains the cis-element for
GATA-2 binding to the human endothelin-1 gene (hET-1) was
used(16) . The hET-1 GATA probe (GATA site in boldface, from
-145 to -123, upper strand) was:
5`-GGCCTGGCCCTTATCTCCGGCTTGC-3`. The wild-type Sp1 probe (upper
strand) was 5`-GGATAGGGGCGGGGCGAGG-3`, and the mutant
probe was 5`-GGATAGGGACTGGGCGAGG-3`.
Figure 1:
Nucleotide sequence of the human eNOS
promoter. The 1600-bp fragment was isolated and sequenced. The
numbering is relative to the transcriptional start site (+1) as
determined previously (9, 17). The nucleotide sequences for putative
cis-acting elements are in boldface, underlined, and labeled. Arrows (labeled F1 through F6 and R1) above the nucleotide sequence depict
forward and reverse primers used for generation of deletion mutants by
PCR, respectively. Abbreviations for cis-elements are as follows: AP-1, activator protein 1; SRE-1, sterol regulatory
element-1; AP-2, activator protein 2; RCE,
retinoblastoma control element; SSRE, shear stress response
element; NF-1, nuclear factor-1; and CRE, cAMP
response element.
Previous analysis of the
eNOS gene demonstrated that it contains a ``TATA-less''
5`-upstream region with a single transcriptional start site 22 bp
upstream of the initiator methionine codon (Fig. 1(9, 17) . In order to see if our construct
was functional and to identify regions of the eNOS promoter important
for basal and stimulated transcription in endothelial cells, a series
of deletion constructs were made with progressively smaller fragments
of the 5`-flanking sequence and cloned in front of the luciferase
reporter gene (F1 through F6 LUC, see Fig. 1). LUC constructs
were then transiently transfected into BAEC for determination of eNOS
promoter activity.
-galactosidase
activity) relative to transfection with vector alone (Fig. 2).
Progressive deletion from -1600 to -1033 did not
significantly influence eNOS promoter activity, however there was
tendency for a slight increase in promoter activity with the F2 LUC
construct suggesting removal of an weakly negative regulatory region.
F3 LUC(-1033) contained the minimal 5` DNA sequence necessary for
full activation of the eNOS promoter, suggesting that the proximal
cis-regulatory sites (see Fig. 1) do not contribute significantly
to basal transcription of the eNOS promoter in BAEC.
Figure 2:
Transient expression of human eNOS gene
promoter activity in BAEC. Depicted on the leftside of the figure are the eNOS promoter-luciferase deletion
constructs. eNOS promoter constructs (F1-F6 LUC) or vector
alone (pGL2) were co-transfected with the SV40 driven
-galactosidase plasmid and relative activities (LUC/
-GAL) determined in cell lysates. On the right is relative activity of each of the constructs in BAEC. The data
represent means ± S.E. of four experiments in duplicate using at
least three different plasmid DNA
preparations.
Further
deletion from -1033 to -779 (F4 LUC) resulted in a
approximate 40% reduction in basal promoter activity, whereas deleting
down to -494 (F5 LUC) did not appreciably reduce activity
further. However, deletion from -494 to -166 (F6 LUC)
reduced eNOS promoter activity by 40-50% compared with F5 LUC and
by 80% compared with F1 LUC in transfected BAEC. These data demonstrate
that the major sites for binding or for cooperative interactions
between cis-elements and transcription factors are located in the
5`-flanking region between -1033 and -779 and between
-779 and -166 of the human eNOS promoter.
Figure 3:
Mutation of the GATA consensus site at
-230 modestly reduces human eNOS gene promoter activity in
transiently transfected BAEC. GATA site mutants were made by
recombinant PCR using F3 and F5 LUC as templates. Depicted on the leftside are the full-length eNOS construct (F1LUC), F3, F5, and F6LUC constructs, and the corresponding F3and F5GATA mutant constructs. On the right is the
relative activity of each construct as percent of that obtained with F1
LUC. The data represent means ± S.E. of three experiments in
duplicate.
To confirm that the GATA element at
-230 could bind nuclear proteins, we performed electrophoretic
mobility shift assays using an a double-stranded oligonucleotide probe
encompassing the putative GATA site (-239 to -218). As seen
in Fig. 4A, incubation of nuclear extracts from BAEC
with the P-labeled probe results in the appearance of a
specific DNA-protein complex that is completely prevented by 50-fold
molar excess of unlabeled probe. Preincubation of nuclei with a mutant
double-stranded oligonucleotide GATA probe (based on the functional
mutation in Fig. 3) did not interfere with the formation of the
DNA-protein complex. An oligonucleotide probe derived from the GATA
site in the hET-1 gene promoter prevented the formation of the
DNA-protein complex, suggesting that the core GATA motif from human
eNOS and hET-1 genes could bind the same nuclear proteins. Gel shift
experiments using the
P-labeled hET-1 GATA motif and BAEC
nuclear extracts demonstrated the same size DNA-protein complex as seen
using the eNOS probe. Co-incubation with double-stranded
oligonucleotide probes containing wild-type, but not the mutant eNOS
GATA site, prevented the formation of the specific DNA-protein complex.
To confirm that the GATA-2 transcription factor binds to the eNOS GATA
element, we performed immunodepletion of nuclear extracts with an
antibody directed against GATA-2. Fig. 4B demonstrates
that preincubation of nuclear extracts, prepared from COS cells
transfected with the human GATA-2 cDNA or BAEC, with GATA-2 antisera
but not preimmune sera, prevented the formation of a specific
DNA-protein complex. Extracts prepared from COS cells transfected with
vector alone (pMT2) did not demonstrate specific binding of the GATA
containing oligonucleotide probe (data not shown).
Figure 4:
Binding of an endothelial GATA factor to
the human eNOS GATA element. In panelA, nuclear
extracts from BAEC (4 µg) were incubated with a labeled
double-stranded oligonucleotide probe containing the eNOS gene GATA
consensus binding site (lanes1-4) or a labeled
double-stranded probe containing the hET-1 gene GATA site (lanes5-8). Oligonucleotides used in competition
reactions were present at 50-fold molar excess including cold,
wild-type competitor (lanes2 and 6), mutant
eNOS GATA competitor (lanes3 and 7), and
wild-type ET-1 (lane4) and eNOS (lane8), respectively. In panelB, nuclear
extracts from BAEC or COS cells expressing recombinant GATA-2 were
preincubated with either preimmune sera or GATA-2 antisera prior to
addition of the labeled probe. Only retarded bands are
shown.
Because the GATA
element at -230 could not account for activation of the eNOS
promoter and since GATA elements can cooperate with GC-rich sequences
that bind the Sp1 transcription
factor(23, 24, 25) , we mutated the putative
high affinity Sp1 site (-103, from GGGCGG to
GGACTG) in the F3 and F6 LUC constructs and in the F3
GATA mutant construct (Fig. 5). Expression of the F3 Sp1 mutant
in BAEC resulted in a 85-90% reduction in normalized luciferase
activity. Moreover, mutation of the Sp1 site in the F3 GATA mutant
reduced eNOS promoter activity further. Mutation of the Sp1 site in the
F6 LUC construct abrogated luciferase activity to levels observed with
transfection of vector alone (4% of activity remaining). These data
suggest that the Sp1 site is an important and necessary cis-element in
the core eNOS promoter and that the stimulatory effect of the GATA
element can only be observed when the proximal Sp1 site is intact.
Figure 5:
Mutation of the Sp1 site at -103
markedly attenuates human eNOS gene promoter activity in transiently
transfected BAEC. Sp1 site mutants and the Sp1/GATA mutant were made by
recombinant PCR using F3 (for both single and double mutants) and F6
LUC (for Sp1 mutant) as templates. Depicted on the leftside are the full-length eNOS construct (F1LUC), F3 and F6LUC constructs, the F3 and F6Sp1 mutants,
and the F3GATA/Sp1 mutant. On the right is the relative activity of each construct as percent of that
obtained with F1 LUC. The data represent the average of duplicate
samples from a single experiment. Similar results were obtained in
three additional experiments.
Electrophoretic mobility shift assays using a double-stranded
oligonucleotide probe encompassing the eNOS Sp1 site (-109 to
-99) demonstrated the presence of four specific DNA-protein
complexes (1, 2, 3, and 4) in
extracts from BAEC that are prevented by 50-fold molar excess of
unlabeled probe (Fig. 6A). Preincubation of nuclear
extracts with a mutant double-stranded oligonucleotide probe (based on
the functional mutation in Fig. 5) did not interfere with the
formation of the DNA-protein complexes. Furthermore, preincubation with
the hET-1 GATA probe did not compete for specific interactions between
nuclear proteins and the eNOS Sp1 site. To confirm that the Sp1
transcription factor binds to the eNOS Sp1 element, we performed
antibody supershift analysis with an antibody directed against human
Sp1. Fig. 6B shows that the Sp1 antibody shifted the
mobility of purified Sp1 and the slowest migrating DNA-protein complex
(complex 1) from BAEC. These results also demonstrate the complex 1 is
composed of two DNA binding proteins, one of which is Sp1 (1a), and the other, 1b, is unidentified. Identical
results were obtained in nuclear extracts from human umbilical vein
endothelial cells (data not shown). These data directly demonstrate
that Sp1 is binding to the eNOS Sp1 site. The composition of the
nuclear proteins that bind to sites 1b, 2, 3 and 4 are currently under investigation.
Figure 6:
Binding of an endothelial Sp1 factors to
the human eNOS Sp1 element. In panelA, nuclear
extracts from BAEC (4 µg) were incubated with a labeled
double-stranded oligonucleotide probe containing the eNOS gene Sp1
consensus binding site (lanes1-4).
Oligonucleotides used in competition reactions were present at 50-fold
molar excess including wild-type competitor (lane2),
mutant eNOS Sp1 competitor (lane3), and wild-type
ET-1 (lane4). In panelB, BAEC
DNA-protein complexes or authentic Sp1 were incubated with nonimmune or
Sp1 antisera and incubated overnight as described. Only retarded bands
are shown.
To examine if
the eNOS promoter was expressed exclusively in endothelial cells, we
transfected F1 LUC, F3 LUC, and F3 Sp1 mut LUC constructs into BAEC and
VSM. Fig. 7demonstrates that the 1600-bp eNOS promoter fragment
was expressed in both cell types. However, the level of expression was
3-4 times greater in BAEC than in VSM. Mutation of the Sp1
cis-element reduced the expression of F3 to a greater extent in BAEC
than that observed in VSM.
Figure 7:
Transient expression of human eNOS gene
promoter activity in bovine aortic endothelial cells (EC) and VSM. eNOS promoter constructs (F1, F3, and F3 LUC) were
co-transfected with the SV40-driven
-galactosidase plasmid, and
relative activities (LUC/
-GAL) were determined in cell lysates.
Data are presented as relative activity of each of the constructs in
BAEC and VSM. The data represents means ± S.E. of four
experiments in duplicate.
globin gene in erythroid
cells occurs only in the presence of Sp1 binding motif(24) . In
this model system, depletion of GATA-1 only partially reduced
Sp1-dependent transcription; however, mutation of the Sp1 site
completely abolished promoter activity as seen in the present study.
Similar cooperation between GATA factors and Sp1 occurs with the human tal-1 gene, another gene with a restricted expression pattern
in erythroid cells(25) . The mechanism of GATA-2 synergy with
Sp1 in the context of the eNOS promoter fragment is presently unknown,
but is presumably related to enhanced co-activation at the level of the
basal transcriptional machinery composed of TATA binding protein,
related associated factors, and RNA polymerase II. Additionally, the
expression of GATA-2, the most abundant GATA family member in
endothelial cells, in the presence of the ubiquitous transcription
factor Sp1, may influence the pattern of eNOS expression.
/EMBL Data Bank with accession number(s) U24214.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
S. Kumar, X. Sun, S. Wedgwood, and S. M. Black Hydrogen peroxide decreases endothelial nitric oxide synthase promoter activity through the inhibition of AP-1 activity Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L370 - L377. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-M. Teichert, J. A. Scott, G. B. Robb, Y.-Q. Zhou, S.-N. Zhu, M. Lem, A. Keightley, B. M. Steer, A. C. Schuh, S. L. Adamson, et al. Endothelial Nitric Oxide Synthase Gene Expression During Murine Embryogenesis: Commencement of Expression in the Embryo Occurs With the Establishment of a Unidirectional Circulatory System Circ. Res., July 3, 2008; 103(1): 24 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando Receptor-mediated tobacco toxicity: acceleration of sequential expression of {alpha}5 and {alpha}7 nicotinic receptor subunits in oral keratinocytes exposed to cigarette smoke FASEB J, May 1, 2008; 22(5): 1356 - 1368. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al. Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sud, S. Wedgwood, and S. M. Black Protein kinase C{delta} regulates endothelial nitric oxide synthase expression via Akt activation and nitric oxide generation Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L582 - L591. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Won, S.-N. Zhu, M. Chen, A.-M. Teichert, J. E. Fish, C. C. Matouk, M. Bonert, M. Ojha, P. A. Marsden, and M. I. Cybulsky Relative Reduction of Endothelial Nitric-Oxide Synthase Expression and Transcription in Atherosclerosis-Prone Regions of the Mouse Aorta and in an in Vitro Model of Disturbed Flow Am. J. Pathol., November 1, 2007; 171(5): 1691 - 1704. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Simoncini, X-D. Fu, A. Caruso, S. Garibaldi, C. Baldacci, M.S. Giretti, P. Mannella, M.I. Flamini, A.M. Sanchez, and A.R. Genazzani Drospirenone increases endothelial nitric oxide synthesis via a combined action on progesterone and mineralocorticoid receptors Hum. Reprod., August 1, 2007; 22(8): 2325 - 2334. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schwartz, S. Osborne-Lawrence, L. Hahner, L. L. Gibson, A. K. Gormley, W. Vongpatanasin, W. Zhu, R. A. Word, D. Seetharam, S. Black, et al. C-Reactive Protein Downregulates Endothelial NO Synthase and Attenuates Reendothelialization In Vivo in Mice Circ. Res., May 25, 2007; 100(10): 1452 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Wozniak, M. E. Boyer, J. A. Grass, Y. Lee, and E. H. Bresnick Context-dependent GATA Factor Function: COMBINATORIAL REQUIREMENTS FOR TRANSCRIPTIONAL CONTROL IN HEMATOPOIETIC AND ENDOTHELIAL CELLS J. Biol. Chem., May 11, 2007; 282(19): 14665 - 14674. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dong and L. P. Thompson Differential Expression of Endothelial Nitric Oxide Synthase in Coronary and Cardiac Tissue in Hypoxic Fetal Guinea Pig Hearts Reproductive Sciences, October 1, 2006; 13(7): 483 - 490. [Abstract] [PDF] |
||||
![]() |
T. Simoncini, A. Caruso, S. Garibaldi, X.-D. Fu, M. S. Giretti, C. Baldacci, C. Scorticati, L. Fornari, P. Mannella, and A. R. Genazzani Activation of nitric oxide synthesis in human endothelial cells using nomegestrol acetate. Obstet. Gynecol., October 1, 2006; 108(4): 969 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Min, Y.-M. Jin, J.-S. Moon, M.-S. Sung, S. Ahn Jo, and I. Jo Hypoxia-Induced Endothelial NO Synthase Gene Transcriptional Activation Is Mediated Through the Tax-Responsive Element in Endothelial Cells Hypertension, June 1, 2006; 47(6): 1189 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Niwano, M. Arai, N. Koitabashi, S. Hara, A. Watanabe, K. Sekiguchi, T. Tanaka, T. Iso, and M. Kurabayashi Competitive Binding of CREB and ATF2 to cAMP/ATF Responsive Element Regulates eNOS Gene Expression in Endothelial Cells Arterioscler. Thromb. Vasc. Biol., May 1, 2006; 26(5): 1036 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Yu, Y.-J. Chiang, Y.-C. Chen, M. Papetti, C.-G. Juo, A. I. Skoultchi, and J. J. Y. Yen MAPK-mediated Phosphorylation of GATA-1 Promotes Bcl-XL Expression and Cell Survival J. Biol. Chem., August 19, 2005; 280(33): 29533 - 29542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Fish, C. C. Matouk, A. Rachlis, S. Lin, S. C. Tai, C. D'Abreo, and P. A. Marsden The Expression of Endothelial Nitric-oxide Synthase Is Controlled by a Cell-specific Histone Code J. Biol. Chem., July 1, 2005; 280(26): 24824 - 24838. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Simoncini, P. Mannella, L. Fornari, A. Caruso, M. Y. Willis, S. Garibaldi, C. Baldacci, and A. R. Genazzani Differential Signal Transduction of Progesterone and Medroxyprogesterone Acetate in Human Endothelial Cells Endocrinology, December 1, 2004; 145(12): 5745 - 5756. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun and J. K. Liao Induction of Angiogenesis by Heat Shock Protein 90 Mediated by Protein Kinase Akt and Endothelial Nitric Oxide Synthase Arterioscler. Thromb. Vasc. Biol., December 1, 2004; 24(12): 2238 - 2244. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cattaruzza, T. J. Guzik, W. Slodowski, A. Pelvan, J. Becker, M. Halle, A. B. Buchwald, K. M. Channon, and M. Hecker Shear Stress Insensitivity of Endothelial Nitric Oxide Synthase Expression as a Genetic Risk Factor for Coronary Heart Disease Circ. Res., October 15, 2004; 95(8): 841 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chan, J. E. Fish, C. D'Abreo, S. Lin, G. B. Robb, A.-M. Teichert, F. Karantzoulis-Fegaras, A. Keightley, B. M. Steer, and P. A. Marsden The Cell-specific Expression of Endothelial Nitric-oxide Synthase: A ROLE FOR DNA METHYLATION J. Biol. Chem., August 13, 2004; 279(33): 35087 - 35100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Xu, K. Ikeda, and Y. Yamori Upregulation of Endothelial Nitric Oxide Synthase by Cyanidin-3-Glucoside, a Typical Anthocyanin Pigment Hypertension, August 1, 2004; 44(2): 217 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. SenBanerjee, Z. Lin, G. B. Atkins, D. M. Greif, R. M. Rao, A. Kumar, M. W. Feinberg, Z. Chen, D. I. Simon, F. W. Luscinskas, et al. KLF2 Is a Novel Transcriptional Regulator of Endothelial Proinflammatory Activation J. Exp. Med., May 17, 2004; 199(10): 1305 - 1315. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Seki, K.-H. Hong, J. Yun, S.-J. Kim, and S. P. Oh Isolation of a Regulatory Region of Activin Receptor-Like Kinase 1 Gene Sufficient for Arterial Endothelium-Specific Expression Circ. Res., April 30, 2004; 94(8): e72 - e77. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Goya, S. Sumitani, X. Xu, T. Kitamura, H. Yamamoto, S. Kurebayashi, H. Saito, H. Kouhara, S. Kasayama, and I. Kawase Peroxisome Proliferator-Activated Receptor {alpha} Agonists Increase Nitric Oxide Synthase Expression in Vascular Endothelial Cells Arterioscler. Thromb. Vasc. Biol., April 1, 2004; 24(4): 658 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Tai, G. B. Robb, and P. A. Marsden Endothelial Nitric Oxide Synthase: A New Paradigm for Gene Regulation in the Injured Blood Vessel Arterioscler. Thromb. Vasc. Biol., March 1, 2004; 24(3): 405 - 412. [Abstract] [Full Text] |
||||