|
Volume 270,
Number 27,
Issue of July 07, pp. 16347-16354, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A 43-kDa Protein
Related to c-Erb A 1 Is Located in the Mitochondrial Matrix of Rat
Liver (*)
Chantal
Wrutniak
(1),
Isabelle
Cassar-Malek
(1),
Sophie
Marchal
(1),
Anne
Rascle
(2),
Sandrine
Heusser
(3),
Jean-Marie
Keller
(3),
Jacques
Fléchon
(4),
Michel
Daua
(3),
Jacques
Samarut
(2),
Jacques
Ghysdael
(5),
Gérard
Cabello
(1)(§) From the
(1)Laboratoire de Différenciation
Cellulaire et Croissance, Unité d'Endocrinologie
Cellulaire, Institut National de la Recherche Agronomique (INRA), place
Viala, 34060 Montpellier Cedex 1, the
(2)Laboratoire de Biologie Moléculaire et
Cellulaire, CNRS UMR 40, INRA, Ecole Normale Supèrieure Lyon, 46
allée d'Italie, 69364 Lyon Cedex 07, the
(3)Laboratoire de Biologie Cellulaire du
Développement, Université de Nancy I, BP 239, 54506
Vandoeuvre-lès-Nancy Cedex, the
(4)Laboratoire de Biologie Cellulaire et
Moléculaire, INRA, Domaine de Vilvert, 78352 Jouy en Josas
Cedex, and the
(5)Laboratoire d'Oncogenèse Virale et
Cellulaire, URA D1443, Institut Curie, 91405 Orsay Cedex, France
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
In order to characterize Sterling's triiodothyronine
(T ) mitochondrial receptor using photoaffinity labeling, we
observed two specific T -binding proteins in the inner
membrane (28 kDa) and in the matrix (43 kDa) of rat liver mitochondria.
Western blots and immunoprecipitation using antibodies raised against
the T -binding domain of the T nuclear receptor
c-Erb A 1 indicated that at least the 43-kDa protein was c-Erb A
1-related. In addition, gel mobility shift assays demonstrated the
occurrence of a c-Erb A 1-related mitochondrial protein that
specifically binds to a natural or a palindromic thyroid-responsive
element. Moreover, this protein specifically binds to a direct repeat 2
sequence located in the D-loop of the mitochondrial genome.
Furthermore, electron microscopy studies allowed the direct observation
of a c-Erb A-related protein in mitochondria. Lastly, the relative
amounts of the 43-kDa protein related to c-Erb A 1 were in good
correlation with the known mitochondrial mass in three typical tissues.
Interestingly, expression of a truncated form of the c-Erb A 1
nuclear receptor in CV1 cells was associated with a mitochondrial
localization and a stimulation of mitochondrial activity. These results
supply evidence of the localization of a member of the nuclear receptor
superfamily in the mitochondrial matrix involved in the regulation of
mitochondrial activity that could act as a mitochondrial
T -dependent transcription factor.
INTRODUCTION
The regulation of mitochondrial function by thyroid hormone is
well documented. Triiodothyronine (T ) ( )increases the number of mitochondria (Gustafsson et al., 1965; Kadenbach, 1966; Jakovilcic et al.,
1978) and the mitochondrial protein synthesis (Mutvei et al.,
1989a). Therefore, this hormone is considered to be the major regulator
of mammalian mitochondrial biogenesis (Mutvei et al., 1989a).
T also stimulates the mitochondrial metabolism (Soboll et al., 1992) and particularly oxidative phosphorylations
(Sterling et al., 1977, 1980). More recently, Hafner et
al.(1990) have shown that thyroid hormone could control state 3
respiration. Some of these effects could involve the activation of
mitochondrial gene transcription induced by T (De Leo et al., 1976; Martino et al., 1986; Mutvei et
al., 1989b) and the increase in the mRNA of mitochondrial
cytochrome c oxidase subunit levels (Van Itallie, 1990).
In
addition, an early mitochondrial T uptake after
[ I]T administration has been
reported in electron microscopy studies (Sterling et al.,
1984b). In agreement with this observation, evidence of at least one
high affinity T -binding site was provided by
[ I]T binding studies in the
mitochondria (Sterling and Milch, 1975; Goglia et al., 1981;
Hashizume and Ichikawa, 1982), suggesting that a T mitochondrial receptor (K =
10 M ; molecular mass =
28 kDa) is located in the organelle's inner membrane (Sterling et al., 1978).
However, the involvement of a direct pathway
in the mitochondrial action of T is still debated.
Therefore, the characterization of the mitochondrial T receptor could be an important tool to verify the existence of
such a pathway. The ADP/ATP translocator has been proposed as a
putative T mitochondrial receptor (Sterling, 1986).
Unfortunately, in agreement with Rasmussen et al.(1989), we
were unable to observe any T binding activity of this
protein, neither in mitochondria nor by testing the purified protein
(kindly provided by Dr. Brandolin, Grenoble, France).
Nuclear
T receptors are encoded by two different loci leading to
the synthesis of three T -binding proteins (c-Erb A 1,
2, and 1) sharing homology in the DNA-binding and
ligand-binding domains. In addition to the full-length 46-kDa c-Erb A
1 protein, Bigler and Eisenman(1988) have reported the occurrence
of several smaller size cellular c-Erb A proteins in chicken
erythroid cells, some of which display an extranuclear location. On the
basis of these observations, we searched for the presence of protein(s)
related to c-Erb A in mitochondria, and we report here the existence in
the mitochondrial matrix of a 43-kDa protein related to c-Erb A 1
with thyroid-responsive element (T RE) and T binding activities.
EXPERIMENTAL PROCEDURES
Male Wistar rats (body
weight, 200 g) were injected with Triton WR 1339 (75 mg of
Triton/100 g of body weight in order to reduce lysosome
density) 4 days before euthanasia. Animals were sacrificed after a 16-h
period of food deprivation to reduce cellular stocks of lipids and
glycogen. Liver mitochondria were prepared by differential
centrifugations and purified using a sucrose gradient (1.02/1.68 M) according to Fleischer and Kervina(1974) and
Szczesna-Kaczmarek(1990). Mitoplast, inner membrane, outer membrane,
and matrix fractions were obtained using digitonin and Lubrol, as
described previously by Greenawalt(1974). Lysosome, microsome, plasma
membrane, and nuclei fractions were obtained according to Fleischer and
Kervina(1974).
The purity of mitochondrial preparations was tested
by measuring the specific activities of acid phosphatase (lysosomes; De
Duve(1967)), glucose-6-phosphatase (microsomes; Morré(1971)),
and 5`-nucleotidase (plasma membranes; Morré(1971)). Monoamine
oxidase (outer membrane; Ragan et al.(1987)), malate
dehydrogenase (matrix; Ragan et al.(1987)), and succinate
dehydrogenase (inner membrane; Morré(1971)) were also measured
to test the submitochondrial fractions (data not shown).
Nuclear
contaminations were assessed by Western blots of specific nuclear
proteins (lamin A, CREB, and c-Erb A ). Lamin A was detected using
an antibody kindly provided by Höger et al. (1991) and
revealed using a second antibody linked to alkaline phosphatase. c-Erb
A was detected using RHTII antiserum and revealed by I-protein A. CREB was detected using anti-rat CREB
(rabbit polyclonal antiserum, UBI, Lake Placid, NY) and revealed using
the ECL kit (Amersham Corp.).
Electron micrograph was performed on
purified rat liver mitochondria. The pellet was fixed by 1%
glutaraldehyde/1% paraformaldehyde in phosphate buffer, washed in PBS,
postfixed in OsO , and embedded in Epon.
T -binding proteins were detected using a
[ I]T photoaffinity label derivative
(T -PAL), which covalently binds to these proteins after
ultraviolet irradiation. [ I]T -PAL
was synthetized and protein labeling was performed according to
Horowitz and Samuels(1988). The 100-µg protein samples were
electrophoresed in a SDS-10% polyacrylamide gel (Laemmli, 1970) and
autoradiographed. T -PAL labeling was performed without and
with a previous incubation of mitochondrial proteins with a 1000-fold
molar excess of cold T -PAL in order to assess labeling
specificity.
Western blots of mitochondrial proteins were performed
using two different rabbit antisera (IRS 21 and RHTII). IRS 21 is
directed against a bacterially expressed protein containing 99 amino
acid residues of MS2 polymerase fused to the 96 amino acid residues of
the hormone-binding domain of the human c-Erb A 1 nuclear T receptor (Goldberg et al., 1988). RHTII antiserum is
raised against the following amino acid sequence:
Glu-Cys-Pro-Thr-Glu-Leu-Phe-Pro-Pro-Leu-Phe-Leu-Glu-Val-Phe-Glu
(399-414 of c-Erb A 1 xenopus receptor, 392-407 of
c-Erb A 1 chicken receptor, 391-406 of c-Erb A 1 rat
receptor, and 440-455 of c-Erb A rat receptor).
Immunoprecipitation of
[ I]T -PAL-binding proteins was
performed with IRS 21 antiserum (Sambrook et al., 1989).
Prior to gel mobility shift assays, purified mitochondria were lysed
at 4 °C for 60 min with two volumes of solution A (10 mM Hepes, pH 7.9, 0.4 M KCl, 1.5 mM MgCl , 0.2 mM EDTA, 0.5 mM
dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 25%
glycerol, 0.5% Nonidet P40). After centrifugation of the lysate
(130,000 g for 60 min), the supernatant was dialyzed
in solution B (20 mM Hepes, pH 7.9, 1 mM MgCl , 0.5 mM dithiothreitol, 0.5 mM
phenylmethylsulfonyl fluoride, 20% glycerol) with 50 mM KCl
and was loaded onto a heparin-agarose column equilibrated in solution
B/50 mM KCl. The column was washed with solution B/50 mM KCl and eluted with solution B/300 mM KCl. Fractions
containing proteins were pooled and concentrated by precipitation with
ammonium sulfate. After centrifugation, the pellet was suspended and
then dialyzed in solution B/50 mM KCl.
Gel mobility shift
assays were performed according to Graupner et al.(1989) using
a P-labeled palindromic T RE as a probe
(GATCCTCAGGTCATGACCTGAA). Specificity of DNA binding was tested by
competition with 200 ng of cold palindromic T RE or with a
similar amount of a mutated carbonic anhydrase II T RE
unable to bind nuclear T receptors (Pal-I:
GATCCGAGTGGTGATTCAACTGCTA). A natural T RE (Pal-2)
identified on the upstream sequence (-669/-650) of the
anhydrase carbonic II gene (Disela et al., 1991) was also
tested.
Similar experiments were performed using a synthetic
oligonucleotide (TAGCCGTCAAGGCATGAAGGTCAGCAC) corresponding to a direct
repeat sequence (DR2) (Bogazzi et al., 1994) observed in the
rat D-loop (15923-15949) according to the complete nucleotide
sequence of the Rattus norvegicus mitochondrial genome
(Gadaleta et al., 1989).
Electron microscopy was
performed on Wistar rat liver preparations (cryoultramicrotomy and
immunolabeling). Specimens were fixed with 4% paraformaldehyde/0.1%
glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, for 1 h at 4
°C. The fixed specimens were infused with 2.3 M sucrose,
rapidly frozen. Ultrathin frozen sections (80 nm) were prepared and
transferred onto Formvar films on electron microscope grids. They were
washed with 0.1 M phosphate buffer, pH 7.4, containing 0.65 M NaCl, 0.05% Tween 20, and 0.5% ovalbumin and then incubated
with RHTII antiserum (diluted 1/1000 in PBS) for 45 min. After the
washes, the sections were incubated for 45 min with goat anti-rabbit
antiserum diluted 1/25 in 20 mM Tris buffer, pH 7.6,
containing 0.65 M NaCl, 0.05% Tween 20, and 0.5% ovalbumin.
Ultrathin sections were then osmicated, dehydrated, stained with 1%
aqueous uranyl acetate, and examined in a Zeiss EM902 electron
microscope.
Simian CV1 cells
(ATCC CCL 70) were maintained in Dulbecco's modified
Eagle's medium supplemented with 10% fetal calf serum. Cells were
carefully washed in PBS and fixed for 10 min in freshly prepared 3%
(w/v) paraformaldehyde with 0.05% Tween 20. The cells were again washed
in PBS and incubated in methanol for 10 min at -20 °C. Cells
were then incubated in 50 mM glycine for 5 min and washed in
PBS. Fixed cells were blocked for 20 min in normal goat serum and
incubated in a mixture of rabbit RHTII antiserum (final dilution 1/100)
and monoclonal antibody against mitochondria (anti-mitok, Chemicon
International, Inc.; final dilution, 1/30) in PBS plus 0.5% bovine
serum albumin for 1 h. After washing for 3 5 min in PBS with
0.1% Tween 20, cells were incubated with a rhodamine-conjugated goat
anti-mouse antibody and a fluorescein-conjugated goat anti-rabbit
antibody. After a final 3 5 min wash in PBS with 0.1% Tween 20,
culture dishes were mounted and photographed using a standard Zeiss
Axiophot immunofluorescence microscope.
CV1 cells stably expressing truncated Erb A protein
were obtained by transfecting plasmid pF1 met1 (kindly provided by
Bigler and Eisenman; Bigler et al.(1992)). One day prior to
transfection, the cells were plated at 5 10 cells/10-cm dish. DNA was transfected into those cells by the
Ca (PO ) coprecipitation method with
pSV-neo as a selectable marker. Individual clones were grown in the
presence of G418 (800 µg/ml).
Mitochondrial
activity was observed in living cells by measurement of rhodamine 123
uptake (Johnson et al., 1980) as a marker of mitochondrial
membrane potential (Chen, 1988) and of cytochrome oxidase activity
(Wharton and Tzagaloff, 1967).
RESULTS
Electron microscopy examination did not demonstrate
the occurrence of extramitochondrial components in our preparations (Fig. 1A). Measurements of specific activities of acid
phosphatase, glucose-6-phosphatase, and 5`-nucleotidase demonstrate
that contaminations by lysosome, microsome, and membrane proteins were
always minimal (5.2, 9.8, and 4.3%, respectively; Fig. 1B).
Figure 1:
Assessment of the purity of
mitochondrial preparations. A, electron micrograph of purified
rat liver mitochondria. All the recognizable organelles are
mitochondria showing different degrees of density of the matrix and of
dilatation of the cristae ( 18,000). B, specific
activities of acid phosphatase (lysosomes), glucose-6-phosphatase
(microsomes), and 5`-nucleotidase (plasma membranes) in mitochondrial (Mito) preparations. Data are presented as the means of 10
different experiments. C, Western blot of nuclei and
mitochondrial preparations using an antibody raised against a specific
nuclear protein, lamin A. Lane 1, 100 µg of mitochondrial
protein; lane 2, 200 µg of mitochondrial protein; lane
3, 10 µg of nuclear protein. D, Western blot of
nuclei and mitochondrial preparations using RHTII antiserum. Lane
1, 50 µg of nuclear protein; lane 2, 50 µg of
mitochondrial protein. E, Western blot of nuclei and
mitochondrial preparations using an antiserum raised against rat CREB. Lane 1, 400 µg of mitochondrial protein; lane 2,
200 µg of mitochondrial protein; lane 3, 5 µg of
nuclear protein; lane 4, 10 µg of nuclear protein; lane 5, 20 µg of nuclear protein; lane 6, 50
µg of nuclear protein; lane 7, 100 µg of nuclear
protein. In each case, mitochondrial and nuclei preparations were
obtained from the same fresh sample of rat
liver.
Moreover, a nucleus-specific protein, lamin
A, was not detected by Western blot in 100 and 200 µg of
mitochondrial proteins, whereas it was clearly apparent in 10 µg of
nuclear proteins (Fig. 1C). Similarly, the nuclear
cAMP-dependent transcription factor CREB was easily detected in 10
µg of nuclear proteins and was on the brink of detection in 5
µg of nuclear proteins; however, it was not detected in 400 and 200
µg of mitochondrial proteins (Fig. 1D). In addition,
although RHTII antiserum recognizes the c-Erb A 1 and forms
of T nuclear receptors, in our mitochondrial preparations,
we were unable to detect c-Erb A , the major isoform in liver
nuclei (Fig. 1E).
We searched for T -binding proteins
in purified mitochondrial preparations from rat liver. In all samples,
three proteins were identified by
[ I]T -PAL labeling (Fig. 2A) with apparent molecular mass in
SDS-polyacrylamide gel electrophoresis of approximately 43, 41, and 28
kDa. In agreement with the data of Rasmussen et al.(1989), a
T -PAL signal could not be detected in the 30-kDa range,
indicating that the ADP/ATP translocator is unlikely to bind T significantly. Furthermore, a purified preparation of the ADP/ATP
translocator could not be labeled after incubation in the presence of
[ I]T -PAL (data not shown). Labeling
of the 43-, 41-, and 28-kDa proteins is specific, because it is
competed with a 1000-fold excess of unlabeled T -PAL (Fig. 2A).
Figure 2:
Detection of T binding and
c-Erb A 1 proteins in rat liver mitochondria. A,
photoaffinity labeling (T -PAL) of 100 µg mitochondrial
proteins. T -PAL labeling was performed without (lane
1) and with (lane 2) a previous incubation of
mitochondrial proteins with a 1000-fold molar excess of cold
T -PAL in order to assess labeling specificity. B,
Western blot of mitochondrial proteins using IRS 21 antibody (100
µg of protein/well). C, intramitochondrial localization of
c-Erb A 1-related protein shown on Western blot using IRS 21
antiserum. M, purified mitochondria, Mp, mitoplast
fraction, Mi, inner membranes; Ma, matrix fraction. D, Western blot of mitoplast (Mp), matrix (Ma), and inner membrane (Mi) proteins using RHTII
antiserum (100 µg of protein/well). E, immunoprecipitation
of a [ I]T -PAL-labeled protein by
IRS 21 antiserum. Lane1, IRS 21 alone; lane
2, IRS 21 previously incubated with a large excess of MS2-Erb A
protein. F, the 43-kDa protein is specifically detected
by IRS 21 antiserum in purified mitochondria (100 µg of
protein/well). Lane 1, IRS 21 antiserum; lane 2,
MS2/c-Erb A peptide preabsorbed IRS 21 antiserum; lane 3, MS2
antiserum. G, RHTII antiserum also specifically detects a
43-kDa protein in purified mitochondria (100 µg of protein/well). Lane 1, RHTII antiserum; lane 2, preimmune RHTII
serum. H, specific mitochondrial localization of the 43-kDa
c-Erb A-related protein. Western blots using IRS 21 antiserum were
performed on 50-µg protein samples. Lane 1, mitochondria; lane 2, lysosomes; lane 3, plasma membranes; lane
4, microsomes; lane 5, nuclei.
Similarly sized proteins (43, 41, and 28
kDa) were observed by immunoblotting analysis of mitochondrial extracts
using IRS 21, a specific anti-Erb A antibody (Fig. 2B). IRS 21 is directed against a bacterially
expressed MS2 polymerase/c-Erb A fusion protein. Blockade of
c-Erb A IRS 21 antibody with its nominal antigen or the use of an
antibody directed against the MS2-encoded domain of the fusion protein
indicated that antibody binding to the 41-kDa protein was not specific (Fig. 2F). In addition, Western blot performed with
RHTII antiserum only specifically detected a 43-kDa protein in
mitochondrial preparations (Fig. 2G).
Following
mitochondrial subfractionation, we showed that 43 and-28-kDa proteins
were detected by T -PAL labeling (data not shown) and
Western blots (IRS 21, Fig. 2C) in the mitoplast
fraction. Whereas the 28-kDa protein was for the most part localized in
the inner membrane, the 43-kDa protein showed a major localization in
the matrix, although lower relative amounts could be detected in the
inner membrane fraction. Interestingly, Western blots performed with
RHTII antiserum also detected a 43-kDa protein in the mitochondrial
matrix (Fig. 2D). As verified by Western blots (IRS 21),
no signal corresponding to the 43-kDa protein appeared on lysosome,
microsome, membrane, and nuclear preparations (Fig. 2H),
demonstrating a specific mitochondrial localization.
Using IRS 21
antibody and T -PAL-labeled mitochondrial preparations, we
were able to immunoprecipitate a 43-kDa
[ I]T -PAL-labeled protein. This did
not significantly occur when the antibody was preincubated with an
excess of the MS2/Erb A protein (Fig. 2E).
Therefore, the 43-kDa T -binding protein was identified to
be immunologically related to the 43-kDa protein detected by Western
blot. In agreement with this set of data, using RHTII antibody in
electron microscopy studies, we have directly observed a specific liver
mitochondrial labeling, which does not appear when using the preimmune
serum or the c-Erb A preabsorbed antiserum (Fig. 3).
Figure 3:
Observation of a protein related to c-Erb
A in rat liver mitochondria by electron microscopy ( 42,000). M, mitochondria; RER, rough endoplasmic reticulum. A, preimmune RHTII serum. B, c-Erb A peptide
preabsorbed RHTII antiserum. C, RHTII
antiserum.
In order
to further extend similarities between the mitochondrial 43-kDa protein
and the c-Erb A 1 nuclear receptor, we analyzed the DNA binding
properties of the mitochondrial protein. The 43-kDa
[ I]T -PAL-labeled mitochondrial
protein bound to DNA cellulose and to heparin-agarose columns (data not
shown). Gel mobility shift assays performed with mitochondrial
preparations partially purified on heparin-agarose showed that a
protein or a protein complex binds to a palindromic T RE (Fig. 4, A and B) and a natural T RE
identified on the chicken carbonic anhydrase II gene (data not shown).
An excess of cold T RE was found to compete binding to the
probe, whereas a similar molar excess of a mutated T RE
unable to bind T receptors did not, thus demonstrating
specificity of the binding (Fig. 4A). Moreover, in
contrast to nonspecific antisera (raised against MS2 and rat ADP/ATP
translocator), IRS 21 and RHTII antisera suppressed the signal observed
for mitochondrial extracts (Fig. 4B). Because RHTII
antiserum only detects the 43-kDa protein in heparin-agarose purified
mitochondrial extracts, these results demonstrate that the 43-kDa
protein also shares strong homology in the DNA-binding domain with the
nuclear T receptors.
Figure 4:
A
mitochondrial protein partly purified on heparin-agarose specifically
binds to a palindromic T RE. A, gel mobility shift
assays (2 µg of mitochondrial protein). Lane 1, labeled
alone; lane 2, labeled T RE and mitochondrial
extract; lane 3, competition with 200 ng of a cold mutated
T RE (Pal-1); lane 4, competition with 200
ng of cold T RE (TREp). B, specific
recognition by c-Erb A antisera of the mitochondrial
T RE-binding protein. Lanes 1 and 6,
mitochondrial extracts. Mitochondrial extracts were preincubated with
RHTII (lane 2), IRS 21 (lane 3), MS2 antiserum (lane 4), or rat ADP/ATP translocator (lane 5)
antiserum.
Interestingly, a similar
retardation band was observed after interaction of
heparin-agarose-purified mitochondrial extracts with a DR2 sequence
located in the D-loop of the rat mitochondrial genome (Fig. 5).
This result clearly indicated that the 43-kDa protein binds to a
specific sequence residing in the D-loop area, which contains the
promotors and is not transcribed.
Figure 5:
The
mitochondrial protein related to c-Erb A binds to a specific DR2
sequence located on the D-loop of mitochondrial genome. Gel mobility
shift assays (2 µg of mitochondrial protein) are shown. Lanes
1-5, DR2 probe. Mitochondrial extracts were preincubated
with IRS21 (lane 1) or RHTII (lane 2) antisera. Lane 3, competition with 200 ng of cold DR2; lane 4,
competition with 200 ng of cold mutated T RE (Pal-1); lane 6, mitochondrial extract and labeled
palindromic T RE (TREpal).
Because
Sterling et al.(1977) reported the absence of mitochondrial
T receptors in adult rat brain, we performed photoaffinity
labeling and Western blots of rat brain mitochondrial proteins. As
shown in Fig. 6A, the 43-kDa protein was not detected in
these preparations.
Figure 6:
The mitochondrial amounts of the 43-kDa
protein related to c-Erb A 1 display cell specificity. A,
adult rat brain mitochondria (100 µg of protein/well). Lane
1, T -PAL labeling; lane 2, Western blot using
RHTII antiserum. B, relative amounts of the 43-kDa c-Erb A
1 protein in mitochondrial extracts (30 µg of protein) of
white adipose tissue (lane 1), brown adipose tissue (lane
2), or liver (lane 3).
We have compared the amounts of the 43-kDa
protein in mitochondria obtained from three tissues showing great
differences in mitochondrial mass: brown adipose tissue, liver, and
white adipose tissue in decreasing order. This study was performed
using purified mitochondria from 12-day-old rabbits, in which brown and
white adipose tissues are easily collected simultaneously. We showed
that the relative mitochondrial amounts of the 43-kDa protein are
higher in brown adipose tissue than in liver and are higher in liver
than in white adipose tissue (Fig. 6B). Therefore, a
clear relationship exists between the mitochondrial mass and the amount
of the 43-kDa protein in the mitochondrion, thus suggesting an
important mitochondrial function for this protein.
Because the
43-kDa protein shared strong homology in the DNA and
T -binding domains with the nuclear T receptors,
the lower molecular weight of the mitochondrial protein could be
explained by deletion of the hinge region or of the N-terminal domain
of c-Erb A 1 receptor. However, Lin et al.(1992) have
reported that deletion of the hinge region abolished T binding activity of the protein. Therefore, using the
pF1 met1 plasmid, we overexpressed in CV1 cells a truncated c-Erb A
1 protein lacking the N-terminal domain (A/B domains) of the
nuclear receptor. Interestingly, we observed a strong increase in
mitochondrial staining by RHTII antibody when compared with control
cells (transfected with the empty vector, pEMSV; Fig. 7). This
result strongly suggested that the overexpressed protein displayed a
major mitochondrial location.
Figure 7:
An overexpressed truncated c-Erb A 1
protein displays a mitochondrial location in CV1 cells.
Cytoimmunofluorescence studies ( 400) are shown. A,
staining of control CV1 cells by RHTII antibody. B, staining
of CV1 cells overexpressing the c-Erb A truncated protein by RHTII
antibody. C, same field as in B labeled with a
monoclonal antibody against mitochondria
(anti-mitok).
Lastly, overexpression of the
truncated protein induced a strong stimulation of rhodamine 123 uptake (Fig. 8A) and cytochrome oxidase activity (Fig. 8B). All these data clearly indicated that a
mitochondrial truncated c-Erb A 1 protein strongly affects the
organelle function.
Figure 8:
An overexpressed truncated c-Erb A 1
protein stimulates mitochondrial activity. A, living cells
stained with rhodamine 123. a, control CV1; b,
pF1 met1-transfected CV1 cells. B, cytochrome oxidase
activity in control (open bar) and truncated c-Erb A
expressing CV1 cells (hatched bar)
DISCUSSION
Our data recording mitochondrial T -binding
proteins confirm the results of the Sterling group, who reported the
presence of a 28-kDa T -binding protein in the mitochondrial
inner membrane. In addition, we show that a 43-kDa
T -binding protein is present in the mitochondrial matrix.
This binding site was not observed by the Sterling group, probably
because purification steps leading to the concept of a 28-kDa
mitochondrial receptor were performed using inner membrane preparations
after discarding matrix proteins (Sterling et al., 1984a).
Furthermore, we report here that at least one mitochondrial
T -binding protein is related to c-Erb A-encoded nuclear
receptors.
Among these T -binding proteins, we also
observed a 41-kDa protein obviously not related to c-Erb A nuclear
receptors. We observed by T -PAL binding (data not shown)
that it was also detected in microsome, plasma membrane, and lysosome
preparations, thus ruling out a specific mitochondrial localization.
Our results concerning the 28-kDa T -binding protein are not
fully conclusive; the recognition specificity by IRS 21 remains
unclear, and we were unable to immunoprecipitate this protein by IRS 21
and to detect it by RHTII antiserum. However, these negative data could
be explained by the very low amounts of the 28-kDa protein recorded
into mitochondria. By contrast, the mitochondrial 43-kDa protein is
clearly related to the c-Erb A 1 nuclear receptor. Antisera raised
against two different amino acid sequences of the T -binding
domain of c-Erb A specifically detect this protein in the matrix.
Moreover, a 43-kDa T -binding protein is specifically
immunoprecipitated by IRS 21 antiserum. Lastly, gel retardation
experiments demonstrate that this mitochondrial protein binds to
T REs DNA sequences. This set of data strongly suggests that
this protein shares homology in the DNA binding and
T -binding domains with c-Erb A nuclear receptors.
The
identification of a protein related to c-Erb A 1 in the
mitochondrion is not the consequence of contamination of our
preparations by nuclei or components of other cell compartments because (a) Contaminations by lysosome, microsome, and membrane
proteins were always minimal, as verified by measurements of specific
markers. (b) Nucleus-specific proteins lamin A and CREB were
not detected in our mitochondrial preparations. (c) RHTII
antibody recognizes c-Erb A 1 and forms; although the
form is at least four times more abundant than the 1 form in rat
liver nuclei (Schwartz et al., 1992; Rodd et al.,
1992), we were unable to detect c-Erb A in our mitochondrial
preparations. If the localization of a c-Erb A protein into the
mitochondrion was the result of nuclear contaminations, a major
form would be detected. (d) As verified by Western blot, the
signal corresponding to the 43-kDa protein appeared only in
mitochondrial preparations. (e) Treatment of mitochondria with
trypsin did not affect the 43-kDa signal in Western blot experiments
(data not shown). (f) In situ electron microscopy
studies bring direct evidence of the presence of a protein related to
c-Erb A in the mitochondrion. Indeed, the 43-kDa protein related to
c-Erb A 1 displays a specific mitochondrial localization.
Interestingly, we observed that the T -binding 43-kDa
protein related to c-Erb A 1 was not detectable in adult rat brain
mitochondria, in agreement with the previously reported lack of T receptors in these mitochondria (Sterling et al., 1977).
In addition, the positive relation recorded between the amounts of this
protein into the organelle and the mitochondrial mass of three
characteristic tissues strongly suggests a possible involvement of the
43-kDa protein in the regulation of mitochondriogenesis, a
T -regulated process (Gustafsson et al., 1965;
Kadenbach, 1966; Jakovilcic et al., 1978).
All these data
strongly suggest that the 43-kDa protein is a putative T mitochondrial receptor. This hypothesis is well supported by the
additional observation that overexpression of a truncated c-Erb A
1 protein displaying a mitochondrial localization induced a strong
stimulation of the organelle activity assessed by rhodamine 123 uptake
and cytochrome oxidase activity, a well known target of T influence at the mitochondrial level.
The origin and function
of this protein is finally questioned. Taking into account the sequence
of the mitochondrial genome in several species, the 43-kDa protein
related to c-Erb A 1 is clearly encoded by a nuclear gene and is
translocated into the mitochondrion.
To date, five different
c-erb A mRNAs have been identified in rats, encoding c-Erb A
1, 2, 1, 2, and 3 (v II) proteins. Despite
intensive studies, no additional mRNAs have been identified that could
lead to the specific synthesis of a 43-kDa c-Erb A 1 protein.
Using polymerase chain reaction in rat liver mRNAs preparations, we
were also unable to detect c-erb A 1 mRNAs other than
that encoding the 46-kDa protein (data not shown). Nevertheless, the
possibility of such a mRNA could not be excluded.
Another
possibility is raised by the observation of Sap et al.(1986)
that in vitro translation of a chicken c-erb A 1
mRNA gives rise to two major proteins with molecular mass of 46 kDa (as
expected) and approximately 40 kDa. The same was observed by these
workers after transfection of the c-erb A 1 cDNA in
chicken embryo fibroblasts. Therefore, the c-erb A 1 mRNA
can encode two proteins. Additional support is supplied by the
identification of several c-Erb A 1 proteins in cells (Bigler and
Eisenman, 1988), and the observation that some of them have an
extranuclear localization. In addition, Bigler et al.(1992)
reported that the smaller receptor forms are generated by alternative
translational initiations at internal AUGs in full-length erb A 1 mRNA. Therefore, we suggest that the mitochondrial 43 kDa
T -binding protein could be the product of the mRNA
c-erb A 1 using an internal AUG. In agreement with this
hypothesis, we observed that overexpression of a truncated c-Erb A
1 protein corresponding to the product obtained by utilization of
the first internal AUG lead to the synthesis of a mitochondrial protein
inducing a stimulation of mitochondrial activity.
Interestingly, the
43-kDa T -binding protein is localized in the mitochondrial
matrix and thus is in physical contact with mitochondrial DNA. Several
studies reported that T stimulates mitochondrial gene
transcription (De Leo et al., 1976; Martino et al.,
1986; Mutvei et al., 1989b). We have shown that this 43-kDa
protein is strongly related to the c-Erb A 1 nuclear receptor, a
well known T -dependent transcription factor. This protein
displayed a sequence-specific DNA binding activity and particularly is
able to bind to a specific sequence of the mitochondrial D-loop.
Therefore, it could be proposed that the 43-kDa T -binding
protein could be the first hormone-dependent transcription factor
identified in the mitochondrion.
In conclusion, our work suggests
the presence of a T mitochondrial receptor, which has the
truncated form of the T nuclear receptor c-Erb A 1 in
the mitochondrial matrix, which could act as a T -dependent
transcription factor. This hypothesis could explain the specific action
of thyroid hormone on the mitochondria, particularly the stimulation of
mitochondrial gene transcription induced by T .
FOOTNOTES
- *
- This work was supported in part by a grant from
l'Association Franaise contre les Myopathies. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Tel.: 33-67612219; Fax: 33-67545694.
- The
abbreviations used are: T
, triiodothyronine;
T -PAL, T -photoaffinity labeling;
T RE, thyroid-responsive element; PBS, phosphate-buffered
saline; CREB, cAMP-responsive element-binding protein; DR2, direct
repeat 2.
ACKNOWLEDGEMENTS
We acknowledge Dr. Bigler and Dr. Eisenman for the
gift of the pF1 met1 plasmid and Dr. Brandolin and Dr. Vignais
(Grenoble, France) for the gift of purified ADP/ATP translocator and
ADP/ATP translocator antibody and for critical reading of the
manuscript.
REFERENCES
- Bigler, J., and Eisenman, R. N. (1988) Mol. Cell. Biol.8, 4155-4161
[Abstract/Free Full Text]
- Bigler, J., Hokanson, W., and Eisenman, R. N. (1992) Mol. Cell. Biol.12, 2406-2417
[Abstract/Free Full Text]
- Bogazzi, F., Hudson, L. D., and Nikodem, V. M. (1994) J. Biol. Chem.269, 11683-11686
[Abstract/Free Full Text]
- Chen, L. B. (1988) Annu. Rev. Cell Biol.4, 155-181
[CrossRef]
- De Duve, C. (1967) Methods Enzymol.10, 7-18
- De Leo, T., Di Meo, S., Barletta, A., Martino, G., and Goglia, F. (1976) Pfluegers Arch. Eur. J. Physiol.366, 73-77
[CrossRef][Medline]
[Order article via Infotrieve]
- Disela, C., Glineur, C., Bugge, T., Sap, J., Stengl, G., Dodgson, J., Stunnenberg, H., Beug, H., and Zenke, M. (1991) Genes & Dev.5, 2033-2047
- Fleischer, S., and Kervina, M. (1974) Methods Enzymol.31, 6-41
[Medline]
[Order article via Infotrieve]
- Gadaleta, G., Pepe, G., De Candia, G., Quagliariello, C., Sbis, E., and Saccone, C. (1989) J. Mol. Evol.28, 497-516
[Medline]
[Order article via Infotrieve]
- Goglia, F., Torresani, J., Bugli, P., Barletta, A., and Liverini, G. (1981) Pfluegers Arch. Eur. J. Physiol.390, 120-124
[CrossRef][Medline]
[Order article via Infotrieve]
- Goldberg, Y., Glineur, C., Gesquiere, J. C., Riconart, A., Sap, J., Vennström, B., and Ghysdael, J. (1988) EMBO J.7, 2425-2433
[Medline]
[Order article via Infotrieve]
- Graupner, G., Wills, K. N., Tzukerman, M., Zhang, X., and Pfahl, M. (1989) Nature340, 653-656
[CrossRef][Medline]
[Order article via Infotrieve]
- Greenawalt, J. W. (1974) Methods Enzymol.31, 310-323
[Medline]
[Order article via Infotrieve]
- Gustafsson, R., Tata, J. R., Lindberg, J., and Ernster, L. (1965) J. Cell Biol.26, 555-578
[Abstract/Free Full Text]
- Hafner, P. R., Brown, G. C., and Brand, M. D. (1990) Biochem. J.265, 731-734
[Medline]
[Order article via Infotrieve]
- Hashizume, K., and Ichikawa, K. (1982) Biochem. Biophys. Res. Commun.106, 920-926
[CrossRef][Medline]
[Order article via Infotrieve]
- Höger, T. I., Grund, C., Franke, W. W., and Krohne, G. (1991) Europ. J. Cell Biol.54, 150-156
[Medline]
[Order article via Infotrieve]
- Horowitz, Z. D., and Samuels, H. H. (1988) Affinity Labeling and Cloning of Steroid and Thyroid Hormone Receptors (Gronemeyer, H., ed) pp 79-83, Ellis Horwood Ltd, Chichester, UK
- Jakovilcic, S., Swift, H. H., Gross, N. J., and Rabinowitz, R. (1978) J. Cell Biol.77, 887-901
[Abstract/Free Full Text]
- Johnson, L. V., Walsh, M. L., and Chen, L. B. (1980) Proc. Natl. Acad. Sci. U. S. A.77, 990-994
[Abstract/Free Full Text]
- Kadenbach, B. (1966) Regulation of Metabolic Processes in Mitochondria (Targer, J. M., Papa, S., Quagliariello, E., and Slater, E. C., eds) pp 508-517, Elsevier Science Publishers B.V., Amsterdam
- Laemmli, U. K. (1970) Nature227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Lin, K. H., Ashizawa, K., and Cheng, S. (1992) Proc. Natl. Acad. Sci. U. S. A.89, 7737-7741
[Abstract/Free Full Text]
- Martino, G., Covello, C., De Giovanni, R., Filipelli, R., and Pitrelli, G. (1986) Mol. Biol. Rep.11, 205-211
[CrossRef][Medline]
[Order article via Infotrieve]
- Morré, D. J. (1971) Methods Enzymol.22, 130-145
- Mutvei, A., Husman, B., Andersson, G., and Nelson, B. D. (1989a) Acta Endocrinol.121, 223-228
- Mutvei, A., Kuzela, S., and Nelson, B. D. (1989b) Eur. J. Biochem.180, 235-240
[Medline]
[Order article via Infotrieve]
- Ragan, C. I., Wilson, M. T., Darley-Usmar, V. M., and Lowe, P. M. (1987) Mitochondria: A Practical Approach (Darley-Usmar, V. M., Rickwood, D., and Wilson, M. T., eds) pp 79-112, IRL Press, Oxford
- Rasmussen, U. B., Köhrle, J., Rokos, H., and Hesch, R. D. (1989) FEBS Lett.255, 385-390
[CrossRef][Medline]
[Order article via Infotrieve]
- Rodd, C., Schwartz, H. L., Strait, K. A., and Oppenheimer, J. H. (1992) Endocrinology131, 2559-2564
[Abstract/Free Full Text]
- Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Coning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H., and Vennström, B. (1986) Nature324, 635-640
[CrossRef][Medline]
[Order article via Infotrieve]
- Schwartz, H. L., Strait, K. A., Ling, N. C., and Oppenheimer, J. H. (1992) J. Biol. Chem.267, 11794-11799
[Abstract/Free Full Text]
- Soboll, S., Horst, C., Hummerich, H., Schumacher, J. P., and Seitz, H. J. (1992) Biochem. J.281, 171-173
- Sterling, K. (1986) Endocrinology119, 292-295
[Abstract/Free Full Text]
- Sterling, K., and Milch, P. O. (1975) Proc. Natl. Acad. Sci U. S. A.72, 3225-3229
[Abstract/Free Full Text]
- Sterling, K., Milch, P. O., Brenner, M. A., and Lazarus, J. H. (1977) Science197, 996-999
[Abstract/Free Full Text]
- Sterling, K., Lazarus, J. H., Milch, P. O., Sakurada, T., and Brenner, M. A. (1978) Science201, 1126-1129
[Abstract/Free Full Text]
- Sterling, K., Brenner, M. A., and Sakurada, T. (1980) Science210, 340-343
[Abstract/Free Full Text]
- Sterling, K., Campbell, G. A., and Brenner, M. A. (1984a) Acta Endocrinol.105, 391-397
- Sterling, K., Campbell, G. A., Taliadouros, G. S., and Nunez, E. A. (1984b) Cell Tissue Res.236, 321-325
[CrossRef][Medline]
[Order article via Infotrieve]
- Szczesna-Kaczmarek, A. (1990) Intl. J. Biochem.22, 617-620
[CrossRef][Medline]
[Order article via Infotrieve]
- Van Itallie, C. M. (1990) Endocrinology127, 55-62
[Abstract/Free Full Text]
- Wharton, D. C., and Tzagaloff, A. (1967) Methods Enzymol.10, 245-250
[CrossRef]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. C. Scarpulla
Transcriptional Paradigms in Mammalian Mitochondrial Biogenesis and Function
Physiol Rev,
April 1, 2008;
88(2):
611 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Facucho-Oliveira, J. Alderson, E. C. Spikings, S. Egginton, and J. C. St. John
Mitochondrial DNA replication during differentiation of murine embryonic stem cells
J. Cell Sci.,
November 15, 2007;
120(22):
4025 - 4034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Busson, L. Daury, P. Seyer, S. Grandemange, L. Pessemesse, F. Casas, C. Wrutniak-Cabello, and G. Cabello
Avian MyoD and c-Jun Coordinately Induce Transcriptional Activity of the 3,5,3'-Triiodothyronine Nuclear Receptor c-ErbA{alpha}1 in Proliferating Myoblasts
Endocrinology,
July 1, 2006;
147(7):
3408 - 3418.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Yen
Thyroid hormones and 3,5-diiodothyropropionic Acid: new keys for new locks.
Endocrinology,
April 1, 2006;
147(4):
1598 - 1601.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Casas, M. Busson, S. Grandemange, P. Seyer, A. Carazo, L. Pessemesse, C. Wrutniak-Cabello, and G. Cabello
Characterization of a Novel Thyroid Hormone Receptor {alpha} Variant Involved in the Regulation of Myoblast Differentiation
Mol. Endocrinol.,
April 1, 2006;
20(4):
749 - 763.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Grandemange, P. Seyer, A. Carazo, P. Becuwe, L. Pessemesse, M. Busson, C. Marsac, P. Roger, F. Casas, G. Cabello, et al.
Stimulation of Mitochondrial Activity by p43 Overexpression Induces Human Dermal Fibroblast Transformation
Cancer Res.,
May 15, 2005;
65(10):
4282 - 4291.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison
Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors
Mol. Endocrinol.,
May 1, 2005;
19(5):
1213 - 1230.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Saelim, L. M. John, J. Wu, J. S. Park, Y. Bai, P. Camacho, and J. D. Lechleiter
Nontranscriptional modulation of intracellular Ca2+ signaling by ligand stimulated thyroid hormone receptor
J. Cell Biol.,
December 6, 2004;
167(5):
915 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Maniura-Weber, S. Goffart, H. L. Garstka, J. Montoya, and R. J. Wiesner
Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells
Nucleic Acids Res.,
November 16, 2004;
32(20):
6015 - 6027.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Q. Chen, M. Delannoy, C. Cooke, and J. D. Yager
Mitochondrial localization of ER{alpha} and ER{beta} in human MCF7 cells
Am J Physiol Endocrinol Metab,
June 1, 2004;
286(6):
E1011 - E1022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Garstka, W. E. Schmitt, J. Schultz, B. Sogl, B. Silakowski, A. Perez-Martos, J. Montoya, and R. J. Wiesner
Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA
Nucleic Acids Res.,
September 1, 2003;
31(17):
5039 - 5047.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. LOSEL, E. FALKENSTEIN, M. FEURING, A. SCHULTZ, H.-C. TILLMANN, K. ROSSOL-HASEROTH, and M. WEHLING
Nongenomic Steroid Action: Controversies, Questions, and Answers
Physiol Rev,
July 1, 2003;
83(3):
965 - 1016.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. CASAS, L. DAURY, S. GRANDEMANGE, M. BUSSON, P. SEYER, R. HATIER, A. CARAZO, G. CABELLO, and C. WRUTNIAK-CABELLO
Endocrine regulation of mitochondrial activity: involvement of truncated RXR{alpha} and c-Erb A{alpha}1 proteins
FASEB J,
March 1, 2003;
17(3):
426 - 436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev,
July 1, 2001;
81(3):
1097 - 1142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R. Short, J. Nygren, R. Barazzoni, J. Levine, and K. S. Nair
T3 increases mitochondrial ATP production in oxidative muscle despite increased expression of UCP2 and -3
Am J Physiol Endocrinol Metab,
May 1, 2001;
280(5):
E761 - E769.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Hood
Plasticity in Skeletal, Cardiac, and Smooth Muscle: Invited Review: Contractile activity-induced mitochondrial biogenesis in skeletal muscle
J Appl Physiol,
March 1, 2001;
90(3):
1137 - 1157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rochard, A. Rodier, F. Casas, I. Cassar-Malek, S. Marchal-Victorion, L. Daury, C. Wrutniak, and G. Cabello
Mitochondrial Activity Is Involved in the Regulation of Myoblast Differentiation through Myogenin Expression and Activity of Myogenic Factors
J. Biol. Chem.,
January 28, 2000;
275(4):
2733 - 2744.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Casas, P. Rochard, A. Rodier, I. Cassar-Malek, S. Marchal-Victorion, R. J. Wiesner, G. Cabello, and C. Wrutniak
A Variant Form of the Nuclear Triiodothyronine Receptor c-ErbAalpha 1 Plays a Direct Role in Regulation of Mitochondrial RNA Synthesis
Mol. Cell. Biol.,
December 1, 1999;
19(12):
7913 - 7924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Enriquez, P. Fernandez-Silva, N. Garrido-Perez, M. J. Lopez-Perez, A. Perez-Martos, and J. Montoya
Direct Regulation of Mitochondrial RNA Synthesis by Thyroid Hormone
Mol. Cell. Biol.,
January 1, 1999;
19(1):
657 - 670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Vega-Nunez, A. M. Alvarez, A. Menendez-Hurtado, A. Santos, and A. Perez-Castillo
Neuronal Mitochondrial Morphology and Transmembrane Potential Are Severely Altered by Hypothyroidism during Rat Brain Development
Endocrinology,
September 1, 1997;
138(9):
3771 - 3778.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|