JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wrutniak, C.
Right arrow Articles by Cabello, Gér.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wrutniak, C.
Right arrow Articles by Cabello, Gér.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 27, Issue of July 07, pp. 16347-16354, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A 43-kDa Protein Related to c-Erb A 1 Is Located in the Mitochondrial Matrix of Rat Liver (*)

Chantal Wrutniak (1), Isabelle Cassar-Malek (1), Sophie Marchal (1), Anne Rascle (2), Sandrine Heusser (3), Jean-Marie Keller (3), Jacques Fléchon (4), Michel Daua (3), Jacques Samarut (2), Jacques Ghysdael (5), Gérard Cabello (1)(§)

From the (1)Laboratoire de Différenciation Cellulaire et Croissance, Unité d'Endocrinologie Cellulaire, Institut National de la Recherche Agronomique (INRA), place Viala, 34060 Montpellier Cedex 1, the (2)Laboratoire de Biologie Moléculaire et Cellulaire, CNRS UMR 40, INRA, Ecole Normale Supèrieure Lyon, 46 allée d'Italie, 69364 Lyon Cedex 07, the (3)Laboratoire de Biologie Cellulaire du Développement, Université de Nancy I, BP 239, 54506 Vandoeuvre-lès-Nancy Cedex, the (4)Laboratoire de Biologie Cellulaire et Moléculaire, INRA, Domaine de Vilvert, 78352 Jouy en Josas Cedex, and the (5)Laboratoire d'Oncogenèse Virale et Cellulaire, URA D1443, Institut Curie, 91405 Orsay Cedex, France

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

In order to characterize Sterling's triiodothyronine (T) mitochondrial receptor using photoaffinity labeling, we observed two specific T-binding proteins in the inner membrane (28 kDa) and in the matrix (43 kDa) of rat liver mitochondria. Western blots and immunoprecipitation using antibodies raised against the T-binding domain of the T nuclear receptor c-Erb A 1 indicated that at least the 43-kDa protein was c-Erb A 1-related. In addition, gel mobility shift assays demonstrated the occurrence of a c-Erb A 1-related mitochondrial protein that specifically binds to a natural or a palindromic thyroid-responsive element. Moreover, this protein specifically binds to a direct repeat 2 sequence located in the D-loop of the mitochondrial genome. Furthermore, electron microscopy studies allowed the direct observation of a c-Erb A-related protein in mitochondria. Lastly, the relative amounts of the 43-kDa protein related to c-Erb A 1 were in good correlation with the known mitochondrial mass in three typical tissues. Interestingly, expression of a truncated form of the c-Erb A 1 nuclear receptor in CV1 cells was associated with a mitochondrial localization and a stimulation of mitochondrial activity. These results supply evidence of the localization of a member of the nuclear receptor superfamily in the mitochondrial matrix involved in the regulation of mitochondrial activity that could act as a mitochondrial T-dependent transcription factor.


INTRODUCTION

The regulation of mitochondrial function by thyroid hormone is well documented. Triiodothyronine (T)()increases the number of mitochondria (Gustafsson et al., 1965; Kadenbach, 1966; Jakovilcic et al., 1978) and the mitochondrial protein synthesis (Mutvei et al., 1989a). Therefore, this hormone is considered to be the major regulator of mammalian mitochondrial biogenesis (Mutvei et al., 1989a). T also stimulates the mitochondrial metabolism (Soboll et al., 1992) and particularly oxidative phosphorylations (Sterling et al., 1977, 1980). More recently, Hafner et al.(1990) have shown that thyroid hormone could control state 3 respiration. Some of these effects could involve the activation of mitochondrial gene transcription induced by T (De Leo et al., 1976; Martino et al., 1986; Mutvei et al., 1989b) and the increase in the mRNA of mitochondrial cytochrome c oxidase subunit levels (Van Itallie, 1990).

In addition, an early mitochondrial T uptake after [I]T administration has been reported in electron microscopy studies (Sterling et al., 1984b). In agreement with this observation, evidence of at least one high affinity T-binding site was provided by [I]T binding studies in the mitochondria (Sterling and Milch, 1975; Goglia et al., 1981; Hashizume and Ichikawa, 1982), suggesting that a T mitochondrial receptor (K = 10M; molecular mass = 28 kDa) is located in the organelle's inner membrane (Sterling et al., 1978).

However, the involvement of a direct pathway in the mitochondrial action of T is still debated. Therefore, the characterization of the mitochondrial T receptor could be an important tool to verify the existence of such a pathway. The ADP/ATP translocator has been proposed as a putative T mitochondrial receptor (Sterling, 1986). Unfortunately, in agreement with Rasmussen et al.(1989), we were unable to observe any T binding activity of this protein, neither in mitochondria nor by testing the purified protein (kindly provided by Dr. Brandolin, Grenoble, France).

Nuclear T receptors are encoded by two different loci leading to the synthesis of three T-binding proteins (c-Erb A 1, 2, and 1) sharing homology in the DNA-binding and ligand-binding domains. In addition to the full-length 46-kDa c-Erb A 1 protein, Bigler and Eisenman(1988) have reported the occurrence of several smaller size cellular c-Erb A proteins in chicken erythroid cells, some of which display an extranuclear location. On the basis of these observations, we searched for the presence of protein(s) related to c-Erb A in mitochondria, and we report here the existence in the mitochondrial matrix of a 43-kDa protein related to c-Erb A 1 with thyroid-responsive element (TRE) and T binding activities.


EXPERIMENTAL PROCEDURES

Mitochondria Preparations

Male Wistar rats (body weight, 200 g) were injected with Triton WR 1339 (75 mg of Triton/100 g of body weight in order to reduce lysosome density) 4 days before euthanasia. Animals were sacrificed after a 16-h period of food deprivation to reduce cellular stocks of lipids and glycogen. Liver mitochondria were prepared by differential centrifugations and purified using a sucrose gradient (1.02/1.68 M) according to Fleischer and Kervina(1974) and Szczesna-Kaczmarek(1990). Mitoplast, inner membrane, outer membrane, and matrix fractions were obtained using digitonin and Lubrol, as described previously by Greenawalt(1974). Lysosome, microsome, plasma membrane, and nuclei fractions were obtained according to Fleischer and Kervina(1974).

The purity of mitochondrial preparations was tested by measuring the specific activities of acid phosphatase (lysosomes; De Duve(1967)), glucose-6-phosphatase (microsomes; Morré(1971)), and 5`-nucleotidase (plasma membranes; Morré(1971)). Monoamine oxidase (outer membrane; Ragan et al.(1987)), malate dehydrogenase (matrix; Ragan et al.(1987)), and succinate dehydrogenase (inner membrane; Morré(1971)) were also measured to test the submitochondrial fractions (data not shown).

Nuclear contaminations were assessed by Western blots of specific nuclear proteins (lamin A, CREB, and c-Erb A ). Lamin A was detected using an antibody kindly provided by Höger et al. (1991) and revealed using a second antibody linked to alkaline phosphatase. c-Erb A was detected using RHTII antiserum and revealed by I-protein A. CREB was detected using anti-rat CREB (rabbit polyclonal antiserum, UBI, Lake Placid, NY) and revealed using the ECL kit (Amersham Corp.).

Electron micrograph was performed on purified rat liver mitochondria. The pellet was fixed by 1% glutaraldehyde/1% paraformaldehyde in phosphate buffer, washed in PBS, postfixed in OsO, and embedded in Epon.

Photoaffinity Labeling of T-binding Proteins and Western Blots

T-binding proteins were detected using a [I]T photoaffinity label derivative (T-PAL), which covalently binds to these proteins after ultraviolet irradiation. [I]T-PAL was synthetized and protein labeling was performed according to Horowitz and Samuels(1988). The 100-µg protein samples were electrophoresed in a SDS-10% polyacrylamide gel (Laemmli, 1970) and autoradiographed. T-PAL labeling was performed without and with a previous incubation of mitochondrial proteins with a 1000-fold molar excess of cold T-PAL in order to assess labeling specificity.

Western blots of mitochondrial proteins were performed using two different rabbit antisera (IRS 21 and RHTII). IRS 21 is directed against a bacterially expressed protein containing 99 amino acid residues of MS2 polymerase fused to the 96 amino acid residues of the hormone-binding domain of the human c-Erb A 1 nuclear T receptor (Goldberg et al., 1988). RHTII antiserum is raised against the following amino acid sequence: Glu-Cys-Pro-Thr-Glu-Leu-Phe-Pro-Pro-Leu-Phe-Leu-Glu-Val-Phe-Glu (399-414 of c-Erb A 1 xenopus receptor, 392-407 of c-Erb A 1 chicken receptor, 391-406 of c-Erb A 1 rat receptor, and 440-455 of c-Erb A rat receptor).

Immunoprecipitation and Gel Mobility Shift Assays

Immunoprecipitation of [I]T-PAL-binding proteins was performed with IRS 21 antiserum (Sambrook et al., 1989).

Prior to gel mobility shift assays, purified mitochondria were lysed at 4 °C for 60 min with two volumes of solution A (10 mM Hepes, pH 7.9, 0.4 M KCl, 1.5 mM MgCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 25% glycerol, 0.5% Nonidet P40). After centrifugation of the lysate (130,000 g for 60 min), the supernatant was dialyzed in solution B (20 mM Hepes, pH 7.9, 1 mM MgCl, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 20% glycerol) with 50 mM KCl and was loaded onto a heparin-agarose column equilibrated in solution B/50 mM KCl. The column was washed with solution B/50 mM KCl and eluted with solution B/300 mM KCl. Fractions containing proteins were pooled and concentrated by precipitation with ammonium sulfate. After centrifugation, the pellet was suspended and then dialyzed in solution B/50 mM KCl.

Gel mobility shift assays were performed according to Graupner et al.(1989) using a P-labeled palindromic TRE as a probe (GATCCTCAGGTCATGACCTGAA). Specificity of DNA binding was tested by competition with 200 ng of cold palindromic TRE or with a similar amount of a mutated carbonic anhydrase II TRE unable to bind nuclear T receptors (Pal-I: GATCCGAGTGGTGATTCAACTGCTA). A natural TRE (Pal-2) identified on the upstream sequence (-669/-650) of the anhydrase carbonic II gene (Disela et al., 1991) was also tested.

Similar experiments were performed using a synthetic oligonucleotide (TAGCCGTCAAGGCATGAAGGTCAGCAC) corresponding to a direct repeat sequence (DR2) (Bogazzi et al., 1994) observed in the rat D-loop (15923-15949) according to the complete nucleotide sequence of the Rattus norvegicus mitochondrial genome (Gadaleta et al., 1989).

Electron Microscopy

Electron microscopy was performed on Wistar rat liver preparations (cryoultramicrotomy and immunolabeling). Specimens were fixed with 4% paraformaldehyde/0.1% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, for 1 h at 4 °C. The fixed specimens were infused with 2.3 M sucrose, rapidly frozen. Ultrathin frozen sections (80 nm) were prepared and transferred onto Formvar films on electron microscope grids. They were washed with 0.1 M phosphate buffer, pH 7.4, containing 0.65 M NaCl, 0.05% Tween 20, and 0.5% ovalbumin and then incubated with RHTII antiserum (diluted 1/1000 in PBS) for 45 min. After the washes, the sections were incubated for 45 min with goat anti-rabbit antiserum diluted 1/25 in 20 mM Tris buffer, pH 7.6, containing 0.65 M NaCl, 0.05% Tween 20, and 0.5% ovalbumin. Ultrathin sections were then osmicated, dehydrated, stained with 1% aqueous uranyl acetate, and examined in a Zeiss EM902 electron microscope.

Cytoimmunofluorescence Study

Simian CV1 cells (ATCC CCL 70) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Cells were carefully washed in PBS and fixed for 10 min in freshly prepared 3% (w/v) paraformaldehyde with 0.05% Tween 20. The cells were again washed in PBS and incubated in methanol for 10 min at -20 °C. Cells were then incubated in 50 mM glycine for 5 min and washed in PBS. Fixed cells were blocked for 20 min in normal goat serum and incubated in a mixture of rabbit RHTII antiserum (final dilution 1/100) and monoclonal antibody against mitochondria (anti-mitok, Chemicon International, Inc.; final dilution, 1/30) in PBS plus 0.5% bovine serum albumin for 1 h. After washing for 3 5 min in PBS with 0.1% Tween 20, cells were incubated with a rhodamine-conjugated goat anti-mouse antibody and a fluorescein-conjugated goat anti-rabbit antibody. After a final 3 5 min wash in PBS with 0.1% Tween 20, culture dishes were mounted and photographed using a standard Zeiss Axiophot immunofluorescence microscope.

Expression of a Truncated c-Erb A 1 Receptor

CV1 cells stably expressing truncated Erb A protein were obtained by transfecting plasmid pF1met1 (kindly provided by Bigler and Eisenman; Bigler et al.(1992)). One day prior to transfection, the cells were plated at 5 10 cells/10-cm dish. DNA was transfected into those cells by the Ca(PO) coprecipitation method with pSV-neo as a selectable marker. Individual clones were grown in the presence of G418 (800 µg/ml).

Assessment of Mitochondrial Activity

Mitochondrial activity was observed in living cells by measurement of rhodamine 123 uptake (Johnson et al., 1980) as a marker of mitochondrial membrane potential (Chen, 1988) and of cytochrome oxidase activity (Wharton and Tzagaloff, 1967).


RESULTS

Assessment of the Purity of Mitochondrial Preparations

Electron microscopy examination did not demonstrate the occurrence of extramitochondrial components in our preparations (Fig. 1A). Measurements of specific activities of acid phosphatase, glucose-6-phosphatase, and 5`-nucleotidase demonstrate that contaminations by lysosome, microsome, and membrane proteins were always minimal (5.2, 9.8, and 4.3%, respectively; Fig. 1B).


Figure 1: Assessment of the purity of mitochondrial preparations. A, electron micrograph of purified rat liver mitochondria. All the recognizable organelles are mitochondria showing different degrees of density of the matrix and of dilatation of the cristae (18,000). B, specific activities of acid phosphatase (lysosomes), glucose-6-phosphatase (microsomes), and 5`-nucleotidase (plasma membranes) in mitochondrial (Mito) preparations. Data are presented as the means of 10 different experiments. C, Western blot of nuclei and mitochondrial preparations using an antibody raised against a specific nuclear protein, lamin A. Lane 1, 100 µg of mitochondrial protein; lane 2, 200 µg of mitochondrial protein; lane 3, 10 µg of nuclear protein. D, Western blot of nuclei and mitochondrial preparations using RHTII antiserum. Lane 1, 50 µg of nuclear protein; lane 2, 50 µg of mitochondrial protein. E, Western blot of nuclei and mitochondrial preparations using an antiserum raised against rat CREB. Lane 1, 400 µg of mitochondrial protein; lane 2, 200 µg of mitochondrial protein; lane 3, 5 µg of nuclear protein; lane 4, 10 µg of nuclear protein; lane 5, 20 µg of nuclear protein; lane 6, 50 µg of nuclear protein; lane 7, 100 µg of nuclear protein. In each case, mitochondrial and nuclei preparations were obtained from the same fresh sample of rat liver.



Moreover, a nucleus-specific protein, lamin A, was not detected by Western blot in 100 and 200 µg of mitochondrial proteins, whereas it was clearly apparent in 10 µg of nuclear proteins (Fig. 1C). Similarly, the nuclear cAMP-dependent transcription factor CREB was easily detected in 10 µg of nuclear proteins and was on the brink of detection in 5 µg of nuclear proteins; however, it was not detected in 400 and 200 µg of mitochondrial proteins (Fig. 1D). In addition, although RHTII antiserum recognizes the c-Erb A 1 and forms of T nuclear receptors, in our mitochondrial preparations, we were unable to detect c-Erb A , the major isoform in liver nuclei (Fig. 1E).

Detection of TBinding and Proteins Related to c-Erb A 1 in Rat Liver Mitochondria

We searched for T-binding proteins in purified mitochondrial preparations from rat liver. In all samples, three proteins were identified by [I]T-PAL labeling (Fig. 2A) with apparent molecular mass in SDS-polyacrylamide gel electrophoresis of approximately 43, 41, and 28 kDa. In agreement with the data of Rasmussen et al.(1989), a T-PAL signal could not be detected in the 30-kDa range, indicating that the ADP/ATP translocator is unlikely to bind T significantly. Furthermore, a purified preparation of the ADP/ATP translocator could not be labeled after incubation in the presence of [I]T-PAL (data not shown). Labeling of the 43-, 41-, and 28-kDa proteins is specific, because it is competed with a 1000-fold excess of unlabeled T-PAL (Fig. 2A).


Figure 2: Detection of T binding and c-Erb A 1 proteins in rat liver mitochondria. A, photoaffinity labeling (T-PAL) of 100 µg mitochondrial proteins. T-PAL labeling was performed without (lane 1) and with (lane 2) a previous incubation of mitochondrial proteins with a 1000-fold molar excess of cold T-PAL in order to assess labeling specificity. B, Western blot of mitochondrial proteins using IRS 21 antibody (100 µg of protein/well). C, intramitochondrial localization of c-Erb A 1-related protein shown on Western blot using IRS 21 antiserum. M, purified mitochondria, Mp, mitoplast fraction, Mi, inner membranes; Ma, matrix fraction. D, Western blot of mitoplast (Mp), matrix (Ma), and inner membrane (Mi) proteins using RHTII antiserum (100 µg of protein/well). E, immunoprecipitation of a [I]T-PAL-labeled protein by IRS 21 antiserum. Lane1, IRS 21 alone; lane 2, IRS 21 previously incubated with a large excess of MS2-Erb A protein. F, the 43-kDa protein is specifically detected by IRS 21 antiserum in purified mitochondria (100 µg of protein/well). Lane 1, IRS 21 antiserum; lane 2, MS2/c-Erb A peptide preabsorbed IRS 21 antiserum; lane 3, MS2 antiserum. G, RHTII antiserum also specifically detects a 43-kDa protein in purified mitochondria (100 µg of protein/well). Lane 1, RHTII antiserum; lane 2, preimmune RHTII serum. H, specific mitochondrial localization of the 43-kDa c-Erb A-related protein. Western blots using IRS 21 antiserum were performed on 50-µg protein samples. Lane 1, mitochondria; lane 2, lysosomes; lane 3, plasma membranes; lane 4, microsomes; lane 5, nuclei.



Similarly sized proteins (43, 41, and 28 kDa) were observed by immunoblotting analysis of mitochondrial extracts using IRS 21, a specific anti-Erb A antibody (Fig. 2B). IRS 21 is directed against a bacterially expressed MS2 polymerase/c-Erb A fusion protein. Blockade of c-Erb A IRS 21 antibody with its nominal antigen or the use of an antibody directed against the MS2-encoded domain of the fusion protein indicated that antibody binding to the 41-kDa protein was not specific (Fig. 2F). In addition, Western blot performed with RHTII antiserum only specifically detected a 43-kDa protein in mitochondrial preparations (Fig. 2G).

Following mitochondrial subfractionation, we showed that 43 and-28-kDa proteins were detected by T-PAL labeling (data not shown) and Western blots (IRS 21, Fig. 2C) in the mitoplast fraction. Whereas the 28-kDa protein was for the most part localized in the inner membrane, the 43-kDa protein showed a major localization in the matrix, although lower relative amounts could be detected in the inner membrane fraction. Interestingly, Western blots performed with RHTII antiserum also detected a 43-kDa protein in the mitochondrial matrix (Fig. 2D). As verified by Western blots (IRS 21), no signal corresponding to the 43-kDa protein appeared on lysosome, microsome, membrane, and nuclear preparations (Fig. 2H), demonstrating a specific mitochondrial localization.

Using IRS 21 antibody and T-PAL-labeled mitochondrial preparations, we were able to immunoprecipitate a 43-kDa [I]T-PAL-labeled protein. This did not significantly occur when the antibody was preincubated with an excess of the MS2/Erb A protein (Fig. 2E). Therefore, the 43-kDa T-binding protein was identified to be immunologically related to the 43-kDa protein detected by Western blot. In agreement with this set of data, using RHTII antibody in electron microscopy studies, we have directly observed a specific liver mitochondrial labeling, which does not appear when using the preimmune serum or the c-Erb A preabsorbed antiserum (Fig. 3).


Figure 3: Observation of a protein related to c-Erb A in rat liver mitochondria by electron microscopy (42,000). M, mitochondria; RER, rough endoplasmic reticulum. A, preimmune RHTII serum. B, c-Erb A peptide preabsorbed RHTII antiserum. C, RHTII antiserum.



The Mitochondrial 43-kDa Protein Related to c-Erb A 1 Specifically Binds to a T-responsive Element and a DR2 Sequence Located in the Mitochondrial D-loop

In order to further extend similarities between the mitochondrial 43-kDa protein and the c-Erb A 1 nuclear receptor, we analyzed the DNA binding properties of the mitochondrial protein. The 43-kDa [I]T-PAL-labeled mitochondrial protein bound to DNA cellulose and to heparin-agarose columns (data not shown). Gel mobility shift assays performed with mitochondrial preparations partially purified on heparin-agarose showed that a protein or a protein complex binds to a palindromic TRE (Fig. 4, A and B) and a natural TRE identified on the chicken carbonic anhydrase II gene (data not shown). An excess of cold TRE was found to compete binding to the probe, whereas a similar molar excess of a mutated TRE unable to bind T receptors did not, thus demonstrating specificity of the binding (Fig. 4A). Moreover, in contrast to nonspecific antisera (raised against MS2 and rat ADP/ATP translocator), IRS 21 and RHTII antisera suppressed the signal observed for mitochondrial extracts (Fig. 4B). Because RHTII antiserum only detects the 43-kDa protein in heparin-agarose purified mitochondrial extracts, these results demonstrate that the 43-kDa protein also shares strong homology in the DNA-binding domain with the nuclear T receptors.


Figure 4: A mitochondrial protein partly purified on heparin-agarose specifically binds to a palindromic TRE. A, gel mobility shift assays (2 µg of mitochondrial protein). Lane 1, labeled alone; lane 2, labeled TRE and mitochondrial extract; lane 3, competition with 200 ng of a cold mutated TRE (Pal-1); lane 4, competition with 200 ng of cold TRE (TREp). B, specific recognition by c-Erb A antisera of the mitochondrial TRE-binding protein. Lanes 1 and 6, mitochondrial extracts. Mitochondrial extracts were preincubated with RHTII (lane 2), IRS 21 (lane 3), MS2 antiserum (lane 4), or rat ADP/ATP translocator (lane 5) antiserum.



Interestingly, a similar retardation band was observed after interaction of heparin-agarose-purified mitochondrial extracts with a DR2 sequence located in the D-loop of the rat mitochondrial genome (Fig. 5). This result clearly indicated that the 43-kDa protein binds to a specific sequence residing in the D-loop area, which contains the promotors and is not transcribed.


Figure 5: The mitochondrial protein related to c-Erb A binds to a specific DR2 sequence located on the D-loop of mitochondrial genome. Gel mobility shift assays (2 µg of mitochondrial protein) are shown. Lanes 1-5, DR2 probe. Mitochondrial extracts were preincubated with IRS21 (lane 1) or RHTII (lane 2) antisera. Lane 3, competition with 200 ng of cold DR2; lane 4, competition with 200 ng of cold mutated TRE (Pal-1); lane 6, mitochondrial extract and labeled palindromic TRE (TREpal).



The 43-kDa Protein Related to c-Erb A 1 Is a Possible TMitochondrial Receptor

Because Sterling et al.(1977) reported the absence of mitochondrial T receptors in adult rat brain, we performed photoaffinity labeling and Western blots of rat brain mitochondrial proteins. As shown in Fig. 6A, the 43-kDa protein was not detected in these preparations.


Figure 6: The mitochondrial amounts of the 43-kDa protein related to c-Erb A 1 display cell specificity. A, adult rat brain mitochondria (100 µg of protein/well). Lane 1, T-PAL labeling; lane 2, Western blot using RHTII antiserum. B, relative amounts of the 43-kDa c-Erb A 1 protein in mitochondrial extracts (30 µg of protein) of white adipose tissue (lane 1), brown adipose tissue (lane 2), or liver (lane 3).



We have compared the amounts of the 43-kDa protein in mitochondria obtained from three tissues showing great differences in mitochondrial mass: brown adipose tissue, liver, and white adipose tissue in decreasing order. This study was performed using purified mitochondria from 12-day-old rabbits, in which brown and white adipose tissues are easily collected simultaneously. We showed that the relative mitochondrial amounts of the 43-kDa protein are higher in brown adipose tissue than in liver and are higher in liver than in white adipose tissue (Fig. 6B). Therefore, a clear relationship exists between the mitochondrial mass and the amount of the 43-kDa protein in the mitochondrion, thus suggesting an important mitochondrial function for this protein.

Because the 43-kDa protein shared strong homology in the DNA and T-binding domains with the nuclear T receptors, the lower molecular weight of the mitochondrial protein could be explained by deletion of the hinge region or of the N-terminal domain of c-Erb A 1 receptor. However, Lin et al.(1992) have reported that deletion of the hinge region abolished T binding activity of the protein. Therefore, using the pF1met1 plasmid, we overexpressed in CV1 cells a truncated c-Erb A 1 protein lacking the N-terminal domain (A/B domains) of the nuclear receptor. Interestingly, we observed a strong increase in mitochondrial staining by RHTII antibody when compared with control cells (transfected with the empty vector, pEMSV; Fig. 7). This result strongly suggested that the overexpressed protein displayed a major mitochondrial location.


Figure 7: An overexpressed truncated c-Erb A 1 protein displays a mitochondrial location in CV1 cells. Cytoimmunofluorescence studies (400) are shown. A, staining of control CV1 cells by RHTII antibody. B, staining of CV1 cells overexpressing the c-Erb A truncated protein by RHTII antibody. C, same field as in B labeled with a monoclonal antibody against mitochondria (anti-mitok).



Lastly, overexpression of the truncated protein induced a strong stimulation of rhodamine 123 uptake (Fig. 8A) and cytochrome oxidase activity (Fig. 8B). All these data clearly indicated that a mitochondrial truncated c-Erb A 1 protein strongly affects the organelle function.


Figure 8: An overexpressed truncated c-Erb A 1 protein stimulates mitochondrial activity. A, living cells stained with rhodamine 123. a, control CV1; b, pF1met1-transfected CV1 cells. B, cytochrome oxidase activity in control (open bar) and truncated c-Erb A expressing CV1 cells (hatched bar)




DISCUSSION

Our data recording mitochondrial T-binding proteins confirm the results of the Sterling group, who reported the presence of a 28-kDa T-binding protein in the mitochondrial inner membrane. In addition, we show that a 43-kDa T-binding protein is present in the mitochondrial matrix. This binding site was not observed by the Sterling group, probably because purification steps leading to the concept of a 28-kDa mitochondrial receptor were performed using inner membrane preparations after discarding matrix proteins (Sterling et al., 1984a). Furthermore, we report here that at least one mitochondrial T-binding protein is related to c-Erb A-encoded nuclear receptors.

Among these T-binding proteins, we also observed a 41-kDa protein obviously not related to c-Erb A nuclear receptors. We observed by T-PAL binding (data not shown) that it was also detected in microsome, plasma membrane, and lysosome preparations, thus ruling out a specific mitochondrial localization. Our results concerning the 28-kDa T-binding protein are not fully conclusive; the recognition specificity by IRS 21 remains unclear, and we were unable to immunoprecipitate this protein by IRS 21 and to detect it by RHTII antiserum. However, these negative data could be explained by the very low amounts of the 28-kDa protein recorded into mitochondria. By contrast, the mitochondrial 43-kDa protein is clearly related to the c-Erb A 1 nuclear receptor. Antisera raised against two different amino acid sequences of the T-binding domain of c-Erb A specifically detect this protein in the matrix. Moreover, a 43-kDa T-binding protein is specifically immunoprecipitated by IRS 21 antiserum. Lastly, gel retardation experiments demonstrate that this mitochondrial protein binds to TREs DNA sequences. This set of data strongly suggests that this protein shares homology in the DNA binding and T-binding domains with c-Erb A nuclear receptors.

The identification of a protein related to c-Erb A 1 in the mitochondrion is not the consequence of contamination of our preparations by nuclei or components of other cell compartments because (a) Contaminations by lysosome, microsome, and membrane proteins were always minimal, as verified by measurements of specific markers. (b) Nucleus-specific proteins lamin A and CREB were not detected in our mitochondrial preparations. (c) RHTII antibody recognizes c-Erb A 1 and forms; although the form is at least four times more abundant than the 1 form in rat liver nuclei (Schwartz et al., 1992; Rodd et al., 1992), we were unable to detect c-Erb A in our mitochondrial preparations. If the localization of a c-Erb A protein into the mitochondrion was the result of nuclear contaminations, a major form would be detected. (d) As verified by Western blot, the signal corresponding to the 43-kDa protein appeared only in mitochondrial preparations. (e) Treatment of mitochondria with trypsin did not affect the 43-kDa signal in Western blot experiments (data not shown). (f) In situ electron microscopy studies bring direct evidence of the presence of a protein related to c-Erb A in the mitochondrion. Indeed, the 43-kDa protein related to c-Erb A 1 displays a specific mitochondrial localization.

Interestingly, we observed that the T-binding 43-kDa protein related to c-Erb A 1 was not detectable in adult rat brain mitochondria, in agreement with the previously reported lack of T receptors in these mitochondria (Sterling et al., 1977). In addition, the positive relation recorded between the amounts of this protein into the organelle and the mitochondrial mass of three characteristic tissues strongly suggests a possible involvement of the 43-kDa protein in the regulation of mitochondriogenesis, a T-regulated process (Gustafsson et al., 1965; Kadenbach, 1966; Jakovilcic et al., 1978).

All these data strongly suggest that the 43-kDa protein is a putative T mitochondrial receptor. This hypothesis is well supported by the additional observation that overexpression of a truncated c-Erb A 1 protein displaying a mitochondrial localization induced a strong stimulation of the organelle activity assessed by rhodamine 123 uptake and cytochrome oxidase activity, a well known target of T influence at the mitochondrial level.

The origin and function of this protein is finally questioned. Taking into account the sequence of the mitochondrial genome in several species, the 43-kDa protein related to c-Erb A 1 is clearly encoded by a nuclear gene and is translocated into the mitochondrion.

To date, five different c-erb A mRNAs have been identified in rats, encoding c-Erb A 1, 2, 1, 2, and 3 (v II) proteins. Despite intensive studies, no additional mRNAs have been identified that could lead to the specific synthesis of a 43-kDa c-Erb A 1 protein. Using polymerase chain reaction in rat liver mRNAs preparations, we were also unable to detect c-erb A 1 mRNAs other than that encoding the 46-kDa protein (data not shown). Nevertheless, the possibility of such a mRNA could not be excluded.

Another possibility is raised by the observation of Sap et al.(1986) that in vitro translation of a chicken c-erb A 1 mRNA gives rise to two major proteins with molecular mass of 46 kDa (as expected) and approximately 40 kDa. The same was observed by these workers after transfection of the c-erb A 1 cDNA in chicken embryo fibroblasts. Therefore, the c-erb A 1 mRNA can encode two proteins. Additional support is supplied by the identification of several c-Erb A 1 proteins in cells (Bigler and Eisenman, 1988), and the observation that some of them have an extranuclear localization. In addition, Bigler et al.(1992) reported that the smaller receptor forms are generated by alternative translational initiations at internal AUGs in full-length erb A 1 mRNA. Therefore, we suggest that the mitochondrial 43 kDa T-binding protein could be the product of the mRNA c-erb A 1 using an internal AUG. In agreement with this hypothesis, we observed that overexpression of a truncated c-Erb A 1 protein corresponding to the product obtained by utilization of the first internal AUG lead to the synthesis of a mitochondrial protein inducing a stimulation of mitochondrial activity.

Interestingly, the 43-kDa T-binding protein is localized in the mitochondrial matrix and thus is in physical contact with mitochondrial DNA. Several studies reported that T stimulates mitochondrial gene transcription (De Leo et al., 1976; Martino et al., 1986; Mutvei et al., 1989b). We have shown that this 43-kDa protein is strongly related to the c-Erb A 1 nuclear receptor, a well known T-dependent transcription factor. This protein displayed a sequence-specific DNA binding activity and particularly is able to bind to a specific sequence of the mitochondrial D-loop. Therefore, it could be proposed that the 43-kDa T-binding protein could be the first hormone-dependent transcription factor identified in the mitochondrion.

In conclusion, our work suggests the presence of a T mitochondrial receptor, which has the truncated form of the T nuclear receptor c-Erb A 1 in the mitochondrial matrix, which could act as a T-dependent transcription factor. This hypothesis could explain the specific action of thyroid hormone on the mitochondria, particularly the stimulation of mitochondrial gene transcription induced by T.


FOOTNOTES

*
This work was supported in part by a grant from l'Association Franaise contre les Myopathies. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Tel.: 33-67612219; Fax: 33-67545694.

The abbreviations used are: T, triiodothyronine; T-PAL, T-photoaffinity labeling; TRE, thyroid-responsive element; PBS, phosphate-buffered saline; CREB, cAMP-responsive element-binding protein; DR2, direct repeat 2.


ACKNOWLEDGEMENTS

We acknowledge Dr. Bigler and Dr. Eisenman for the gift of the pF1met1 plasmid and Dr. Brandolin and Dr. Vignais (Grenoble, France) for the gift of purified ADP/ATP translocator and ADP/ATP translocator antibody and for critical reading of the manuscript.


REFERENCES
  1. Bigler, J., and Eisenman, R. N. (1988) Mol. Cell. Biol.8, 4155-4161 [Abstract/Free Full Text]
  2. Bigler, J., Hokanson, W., and Eisenman, R. N. (1992) Mol. Cell. Biol.12, 2406-2417 [Abstract/Free Full Text]
  3. Bogazzi, F., Hudson, L. D., and Nikodem, V. M. (1994) J. Biol. Chem.269, 11683-11686 [Abstract/Free Full Text]
  4. Chen, L. B. (1988) Annu. Rev. Cell Biol.4, 155-181 [CrossRef]
  5. De Duve, C. (1967) Methods Enzymol.10, 7-18
  6. De Leo, T., Di Meo, S., Barletta, A., Martino, G., and Goglia, F. (1976) Pfluegers Arch. Eur. J. Physiol.366, 73-77 [CrossRef][Medline] [Order article via Infotrieve]
  7. Disela, C., Glineur, C., Bugge, T., Sap, J., Stengl, G., Dodgson, J., Stunnenberg, H., Beug, H., and Zenke, M. (1991) Genes & Dev.5, 2033-2047
  8. Fleischer, S., and Kervina, M. (1974) Methods Enzymol.31, 6-41 [Medline] [Order article via Infotrieve]
  9. Gadaleta, G., Pepe, G., De Candia, G., Quagliariello, C., Sbis, E., and Saccone, C. (1989) J. Mol. Evol.28, 497-516 [Medline] [Order article via Infotrieve]
  10. Goglia, F., Torresani, J., Bugli, P., Barletta, A., and Liverini, G. (1981) Pfluegers Arch. Eur. J. Physiol.390, 120-124 [CrossRef][Medline] [Order article via Infotrieve]
  11. Goldberg, Y., Glineur, C., Gesquiere, J. C., Riconart, A., Sap, J., Vennström, B., and Ghysdael, J. (1988) EMBO J.7, 2425-2433 [Medline] [Order article via Infotrieve]
  12. Graupner, G., Wills, K. N., Tzukerman, M., Zhang, X., and Pfahl, M. (1989) Nature340, 653-656 [CrossRef][Medline] [Order article via Infotrieve]
  13. Greenawalt, J. W. (1974) Methods Enzymol.31, 310-323 [Medline] [Order article via Infotrieve]
  14. Gustafsson, R., Tata, J. R., Lindberg, J., and Ernster, L. (1965) J. Cell Biol.26, 555-578 [Abstract/Free Full Text]
  15. Hafner, P. R., Brown, G. C., and Brand, M. D. (1990) Biochem. J.265, 731-734 [Medline] [Order article via Infotrieve]
  16. Hashizume, K., and Ichikawa, K. (1982) Biochem. Biophys. Res. Commun.106, 920-926 [CrossRef][Medline] [Order article via Infotrieve]
  17. Höger, T. I., Grund, C., Franke, W. W., and Krohne, G. (1991) Europ. J. Cell Biol.54, 150-156 [Medline] [Order article via Infotrieve]
  18. Horowitz, Z. D., and Samuels, H. H. (1988) Affinity Labeling and Cloning of Steroid and Thyroid Hormone Receptors (Gronemeyer, H., ed) pp 79-83, Ellis Horwood Ltd, Chichester, UK
  19. Jakovilcic, S., Swift, H. H., Gross, N. J., and Rabinowitz, R. (1978) J. Cell Biol.77, 887-901 [Abstract/Free Full Text]
  20. Johnson, L. V., Walsh, M. L., and Chen, L. B. (1980) Proc. Natl. Acad. Sci. U. S. A.77, 990-994 [Abstract/Free Full Text]
  21. Kadenbach, B. (1966) Regulation of Metabolic Processes in Mitochondria (Targer, J. M., Papa, S., Quagliariello, E., and Slater, E. C., eds) pp 508-517, Elsevier Science Publishers B.V., Amsterdam
  22. Laemmli, U. K. (1970) Nature227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  23. Lin, K. H., Ashizawa, K., and Cheng, S. (1992) Proc. Natl. Acad. Sci. U. S. A.89, 7737-7741 [Abstract/Free Full Text]
  24. Martino, G., Covello, C., De Giovanni, R., Filipelli, R., and Pitrelli, G. (1986) Mol. Biol. Rep.11, 205-211 [CrossRef][Medline] [Order article via Infotrieve]
  25. Morré, D. J. (1971) Methods Enzymol.22, 130-145
  26. Mutvei, A., Husman, B., Andersson, G., and Nelson, B. D. (1989a) Acta Endocrinol.121, 223-228
  27. Mutvei, A., Kuzela, S., and Nelson, B. D. (1989b) Eur. J. Biochem.180, 235-240 [Medline] [Order article via Infotrieve]
  28. Ragan, C. I., Wilson, M. T., Darley-Usmar, V. M., and Lowe, P. M. (1987) Mitochondria: A Practical Approach (Darley-Usmar, V. M., Rickwood, D., and Wilson, M. T., eds) pp 79-112, IRL Press, Oxford
  29. Rasmussen, U. B., Köhrle, J., Rokos, H., and Hesch, R. D. (1989) FEBS Lett.255, 385-390 [CrossRef][Medline] [Order article via Infotrieve]
  30. Rodd, C., Schwartz, H. L., Strait, K. A., and Oppenheimer, J. H. (1992) Endocrinology131, 2559-2564 [Abstract]
  31. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Coning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  32. Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H., and Vennström, B. (1986) Nature324, 635-640 [CrossRef][Medline] [Order article via Infotrieve]
  33. Schwartz, H. L., Strait, K. A., Ling, N. C., and Oppenheimer, J. H. (1992) J. Biol. Chem.267, 11794-11799 [Abstract/Free Full Text]
  34. Soboll, S., Horst, C., Hummerich, H., Schumacher, J. P., and Seitz, H. J. (1992) Biochem. J.281, 171-173
  35. Sterling, K. (1986) Endocrinology119, 292-295 [Abstract]
  36. Sterling, K., and Milch, P. O. (1975) Proc. Natl. Acad. Sci U. S. A.72, 3225-3229 [Abstract/Free Full Text]
  37. Sterling, K., Milch, P. O., Brenner, M. A., and Lazarus, J. H. (1977) Science197, 996-999 [Abstract/Free Full Text]
  38. Sterling, K., Lazarus, J. H., Milch, P. O., Sakurada, T., and Brenner, M. A. (1978) Science201, 1126-1129 [Abstract/Free Full Text]
  39. Sterling, K., Brenner, M. A., and Sakurada, T. (1980) Science210, 340-343 [Abstract/Free Full Text]
  40. Sterling, K., Campbell, G. A., and Brenner, M. A. (1984a) Acta Endocrinol.105, 391-397
  41. Sterling, K., Campbell, G. A., Taliadouros, G. S., and Nunez, E. A. (1984b) Cell Tissue Res.236, 321-325 [CrossRef][Medline] [Order article via Infotrieve]
  42. Szczesna-Kaczmarek, A. (1990) Intl. J. Biochem.22, 617-620 [CrossRef][Medline] [Order article via Infotrieve]
  43. Van Itallie, C. M. (1990) Endocrinology127, 55-62 [Abstract]
  44. Wharton, D. C., and Tzagaloff, A. (1967) Methods Enzymol.10, 245-250

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
R. C. Scarpulla
Transcriptional Paradigms in Mammalian Mitochondrial Biogenesis and Function
Physiol Rev, April 1, 2008; 88(2): 611 - 638.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. M. Facucho-Oliveira, J. Alderson, E. C. Spikings, S. Egginton, and J. C. St. John
Mitochondrial DNA replication during differentiation of murine embryonic stem cells
J. Cell Sci., November 15, 2007; 120(22): 4025 - 4034.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Busson, L. Daury, P. Seyer, S. Grandemange, L. Pessemesse, F. Casas, C. Wrutniak-Cabello, and G. Cabello
Avian MyoD and c-Jun Coordinately Induce Transcriptional Activity of the 3,5,3'-Triiodothyronine Nuclear Receptor c-ErbA{alpha}1 in Proliferating Myoblasts
Endocrinology, July 1, 2006; 147(7): 3408 - 3418.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. M. Yen
Thyroid hormones and 3,5-diiodothyropropionic Acid: new keys for new locks.
Endocrinology, April 1, 2006; 147(4): 1598 - 1601.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Casas, M. Busson, S. Grandemange, P. Seyer, A. Carazo, L. Pessemesse, C. Wrutniak-Cabello, and G. Cabello
Characterization of a Novel Thyroid Hormone Receptor {alpha} Variant Involved in the Regulation of Myoblast Differentiation
Mol. Endocrinol., April 1, 2006; 20(4): 749 - 763.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Grandemange, P. Seyer, A. Carazo, P. Becuwe, L. Pessemesse, M. Busson, C. Marsac, P. Roger, F. Casas, G. Cabello, et al.
Stimulation of Mitochondrial Activity by p43 Overexpression Induces Human Dermal Fibroblast Transformation
Cancer Res., May 15, 2005; 65(10): 4282 - 4291.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison
Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors
Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
N. Saelim, L. M. John, J. Wu, J. S. Park, Y. Bai, P. Camacho, and J. D. Lechleiter
Nontranscriptional modulation of intracellular Ca2+ signaling by ligand stimulated thyroid hormone receptor
J. Cell Biol., December 6, 2004; 167(5): 915 - 924.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Maniura-Weber, S. Goffart, H. L. Garstka, J. Montoya, and R. J. Wiesner
Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells
Nucleic Acids Res., November 16, 2004; 32(20): 6015 - 6027.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Q. Chen, M. Delannoy, C. Cooke, and J. D. Yager
Mitochondrial localization of ER{alpha} and ER{beta} in human MCF7 cells
Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E1011 - E1022.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. L. Garstka, W. E. Schmitt, J. Schultz, B. Sogl, B. Silakowski, A. Perez-Martos, J. Montoya, and R. J. Wiesner
Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA
Nucleic Acids Res., September 1, 2003; 31(17): 5039 - 5047.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. M. LOSEL, E. FALKENSTEIN, M. FEURING, A. SCHULTZ, H.-C. TILLMANN, K. ROSSOL-HASEROTH, and M. WEHLING
Nongenomic Steroid Action: Controversies, Questions, and Answers
Physiol Rev, July 1, 2003; 83(3): 965 - 1016.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. CASAS, L. DAURY, S. GRANDEMANGE, M. BUSSON, P. SEYER, R. HATIER, A. CARAZO, G. CABELLO, and C. WRUTNIAK-CABELLO
Endocrine regulation of mitochondrial activity: involvement of truncated RXR{alpha} and c-Erb A{alpha}1 proteins
FASEB J, March 1, 2003; 17(3): 426 - 436.
[Abstract] [Full Text] [PDF]


Home page