Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhalerao, J.
Right arrow Articles by Merregaert, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhalerao, J.
Right arrow Articles by Merregaert, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 27, Issue of July 07, pp. 16385-16394, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular Cloning, Characterization, and Genetic Mapping of the cDNA Coding for a Novel Secretory Protein of Mouse
DEMONSTRATION OF ALTERNATIVE SPLICING IN SKIN AND CARTILAGE (*)

Jayant Bhalerao (§) , Przemko Tylzanowski , Jane D. Filie (1), Christine A. Kozak (1), Joseph Merregaert (¶)

From the (1)Department of Biochemistry, Laboratory of Molecular Biotechnology, University of Antwerp, Universiteitsplein-1, 2610 Wilrijk, Belgium and NIAID, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A novel 85-kDa protein secreted by the mouse stro-mal osteogenic cell line MN7 was identified using two-dimensional polyacrylamide gel electrophoresis (Mathieu, E., Meheus, L., Raymackers, J., and Merregaert, J.(1994) J. Bone Miner. Res. 9, 903-913). Degenerate primers were used to isolate the cDNA coding for this protein. The full-length cDNA clone is 1.9 kilobases (kb) and codes for a protein of 559 amino acid residues. The DNA and deduced amino acid sequences have no counterparts in public data bases, but a structural similarity involving typical cysteine doublets can be observed to serum albumin family proteins and to Endo16 (a calcium-binding protein of sea urchin). Northern blot analysis revealed the presence of a 1.9-kb transcript in various tissues, and a shorter transcript of 1.5 kb, derived by alternative splicing in tail, front paw and skin of embryonic mice. The gene for the p85 protein, termed Ecm1 (for extracellular matrix protein 1), is a single-copy gene, which was localized to the region on mouse chromosome 3 known to contain at least one locus associated with developmental disorders of the skin, soft coat (soc). Alternative splicing may serve as a mechanism for generating functional diversity in the Ecm1 gene.


INTRODUCTION

The process of embryonic bone formation involves the creation of an extracellular matrix that mineralizes during the course of tissue maturation. This matrix is subject to constant remodeling during the lifetime of an individual, through the combined actions of osteoblasts and osteoclasts. A careful balance of matrix formation and resorption must be maintained because perturbations can result in various bone disorders (reviewed in Ref. 1).

The extracellular matrix of bone consists of two phases, an organic phase and a mineral one. The organic phase consists primarily of the collagen type I fibrils that are associated with a number of noncollagenous matrix proteins. Interest in the noncollagenous proteins of the bone was greatly stimulated when Urist first demonstrated that demineralized bone extracts could induce ectopic bone formation(2) . Non-collagenous proteins of bone are now believed to be involved in mineralization as well as the local regulation of bone cell function (3, 4). In the past few years, a number of noncollagenous proteins of bone have been isolated and characterized; among these are osteocalcin, osteopontin, osteonectin, and bone sialoprotein(4, 5) .

In order to study the properties of bone-forming cells, our laboratory has established a clonal osteogenic cell line (MN7) from bone marrow stroma of the adult mouse(6) . These cells, under appropriate conditions, undergo typical osteoblastic differentiation in vitro and are able to form a mineralized extracellular matrix(7, 8) .

To characterize the proteins secreted by MN7 cells during in vitro proliferation and differentiation, two-dimensional polyacrylamide gel electrophoretic (2D SDS-PAGE)() patterns of proteins present in MN7 culture supernatants at different time points were compared to those of non-osteogenic stromal cell cultures(9) . Fifteen different protein spots were found to be specific for MN7. Five of these polypeptides were isolated and partially microsequenced. Four of them were identified as osteopontin, collagen 2 (I), cathepsin L, and tissue inhibitor of metalloproteinases-2, all of which are known to be involved in bone formation or resorption processes(10, 11) . Three partial peptide sequences of the fifth protein did not have any counterparts in public data banks(9) . This protein migrated as a train of spots with an average mass of 85 kDa and pI 5. 7, and was designated ``p85.''

In the present study we report the isolation of the p85 cDNA clone. The full-length cDNA contains an ORF of 1677 bp encoding a protein of 559 amino acids. Computer analysis of the deduced primary amino acid sequence revealed a hydrophobic signal peptide characteristic of a secreted protein. Motif analyses did not identify features typical for known protein families. The message of 1.9 kb is expressed in various tissues such as liver, heart, lungs, etc., whereas a splice variant was present in embryonic cartilage and skin. The corresponding gene for p85 (called Ecm1 for extracellular matrix protein 1), maps on chromosome (Chr) 3 of mouse in a region containing several loci involved in skin developmental disorders.


MATERIALS AND METHODS

Cell Culture

All cell culture materials were purchased from Life Technologies, Inc. (Ghent, Belgium). RNA for making the cDNA library was isolated from MN7 cells that were grown as described before(9) . Briefly, cells were grown in BGJ-B medium (Biggers-Gwatkin-Jones Bone medium, Fitton-Jackson modification) supplemented with 10% fetal calf serum and 2 mML-glutamine. After reaching confluence, the cells were grown in serum-free medium (BGJ-B with ITS (insulin-transferrin-selenium premix, purchased from Sigma)) for 48 h before harvesting. MC3T3-E cells(12) , were grown in -MEM (-minimal essential medium) containing 10% fetal calf serum and 2 mML-glutamine. BALB/c 3T3 cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. MC615 chondrocytes (13) were grown in Dulbecco's modified Eagle's medium/F-12 medium containing 10% fetal calf serum and 2 mML-glutamine.

For time course expression, MN7 cells were grown under conditions optimized for inducing mineralization(8) . Briefly, the cells were seeded at a density of 5 10 cells/cm in 24-well culture plates, in -MEM supplemented with 10% fetal calf serum, 2 mML-glutamine, 10 mM sodium -glycerophosphate, and 50 µg/ml L-ascorbic acid. The cultures were refreshed every 2 days and harvested by trypsinization at different time points. The cells were cultured in the presence of serum throughout the experiment.

RNA Studies

Isolation of RNA

Isolation from Cells in Culture

This was performed as described in Ref. 14. Briefly, cells were lysed in Nonidet P-40, cell lysates extracted with phenol and chloroform, and then precipitated with isopropanol at -20 °C overnight. The RNA was pelleted, washed in 70% ethanol, and then dissolved in diethyl pyrocarbonate-treated water.

Isolation from Tissues

This was performed as described in Ref. 14. Tissues were dissected out of embryonic BALB/c mice (16 days post-coitum) and immediately frozen in liquid nitrogen. The frozen tissues were homogenized in 4 M guanidine thiocyanate and then centrifuged over a cesium chloride cushion at 32,000 rpm for 24 h at 21 °C in a SW41 rotor (Beckman). The pellet containing the RNA was washed in 70% ethanol and dissolved in diethyl pyrocarbonate-treated water.

Poly(A)Enrichment

Poly(A) containing RNA was isolated from total RNA using magnetic oligo(dT) beads (Dynabeads) according to the manufacturer's protocol.

Northern Blotting

Standard blotting and hybridization procedures were used(14) . 10-µg quantities of total RNAs were electrophoresed in formaldehyde gels, blotted onto Hybond N membranes (Amersham Corp.), UV cross-linked, and then hybridized (Amersham hybridization protocols). Quantitive comparisons of RNAs present on the blots were made using the murine glyceraldehyde-3-phosphate dehydrogenase probe(15) .

Southern Blotting

Mouse genomic DNA was digested with different enzymes and separated on 0.8% agarose gels. The DNAs were blotted onto Hybond N membranes, UV cross-linked, and hybridized.

Construction and Screening of the MN7 cDNA Library

A directional cDNA library in the pSPORT vector was made using MN7 poly(A)-enriched RNA and the Superscript cDNA cloning system of Life Technologies, Inc. The library contained approximately 2 10 independent clones, with an average insert size of 1.7 kb.

The library was screened by colony hybridization using selected (see ``Results''), end-labeled oligonucleotides as a probe. Labeling of the oligonucleotides was performed as described (14) using T polynucleotide kinase (New England Biolabs) and [-P]dATP (Amersham). Hybridizations were done at room temperature according to standard procedures. The hybridization was followed by washes at increasing stringency. Positive clones were subjected to secondary and tertiary screening.

Design of Oligonucleotide Primers

Microsequencing of the p85 protein was done on spots isolated from dried two-dimensional gels as described earlier(9) . One N-terminal and two internal peptide sequences were obtained. Among these, a 6-amino acid N-terminal sequence, DQREMT, had minimum codon degeneracy and was used to design degenerate oligonucleotide primers with the help of the PGEN computer program (16). The oligonucleotides were synthesized commercially (British Bio-technology Products Ltd.) as 17-mers, in three sets of 16 degeneracies each. The sequences of the oligonucleotides were: 1) 5`-CTRGTYGCRCTYTACTG-3`, 2) 5`-CTRGTYGCYCTYTACTG-3`, and 3) 5`-CTRGTYTCYCTYTACTG-3`, where (R = A or G and Y = C or T).

DNA Sequencing

The cDNA clone of p85 was sequenced by the dideoxynucleotide chain termination method (17) using [S]dATP (Amersham Corp.) and Sequenase (a modified T7 DNA polymerase; Amersham). Vector-specific as well as insert-specific primers were used.

For computer analysis of the sequence data, various software packages were used in the course of this study. They are mentioned under ``Results'' where appropriate.

Identification of the 5` End by PCR-RACE

The 5` sequence of the message was obtained using the 5`-RACE (Rapid Amplification of cDNA Ends) amplification system of Life Technologies, Inc. The three gene-specific primers used are listed below. NotI and SalI linkers designed for cloning are indicated in parentheses; numbers indicate positions on the cDNA (see Fig. 1): GSP1(antisense, 313-289), 5`-CAGAGTGGTCAACTCGGAGTCTCCG-3`; GSP2 (antisense, 222-198), 5`-{TCGCGAACTAGTGCGGCCGC}CGTCATCTCTCGCTGGTCTGAAGC-3`; GSP3 (antisense, 178-154), 5`-{TCGCGAACTAGTGCGGCCGC}CAGCAGAAGCAAGAGCCAAGCAGGC-3`.


Figure 1: Nucleotide and deduced amino acid sequence of the p85 cDNA. Residues are numbered at sides of figure. Nucleotides from positions 1 to 18 were obtained by 5`-RACE. The putative signal peptide (amino acid positions 1-19) is marked by boldunderline. The putative cleavage site for the signal peptide after residue 19 is marked by &cjs0435;. The single N-terminal and the two internal peptide sequences obtained by microsequencing of the protein spot are marked by thinunderline. Cysteine residues are circled. The three potential N-glycosylation sites are marked with asterisks (*). Potential phosphorylation sites are indicated as follows: &cjs3485; for protein kinase C, &cjs3486; for casein kinase II, &cjs3487; for tyrosine kinase, and &cjs3488; for cAMP- and cGMP-dependent protein kinases. The termination codon and polyadenylation signal are marked in bold. The differentially spliced exon is shaded.



Briefly, first strand cDNA was produced by reverse transcription using GSP1 as the first primer. This was followed by tailing at the 5` end using dCTP and terminal transferase. The tailed cDNA product was amplified using an anchor primer (supplied with the kit) and GSP2. The amplified product was then cloned in the NotI and SalI sites of pSPORT and sequenced. Sequences obtained were verified on several independent PCR clones. The 5` sequence obtained was independently confirmed by repeating PCR-RACE using the primer GSP3.

Cloning of the Splice Variant by Reverse Transcription PCR

Reverse transcription PCR was used to clone the differentially spliced p85 transcript. 1 µg of total RNA from mouse embryonic front paw and tail were reverse transcribed using the preamplification kit of Life Technologies, Inc. This was followed by two rounds of PCR amplification using cDNA-specific primers. The primers used are listed below. NotI and SalI linkers designed for cloning are indicated in parentheses. Numbers indicate positions on the cDNA (Fig. 1): N1 (upper, 29-53), 5`-CAGGCTTGCAGCAAGTGGCCCAACC-3`; N2 (upper, 61-86), 5`-{TCGCGAGTCGAC}GTCTAGATCTGCCTGTGACAACCAGC-3`;C1 (lower, 1870-1847), 5`-GTAATGAGTGTTCGAGGAGGGTGG-3`; C2 (lower, 1806-1784), 5`-{TCGCGAGCGGCCGC}GGTGACTCATTCTTCCTTGGACC-3`.

PCR conditions used during the experiment were denaturation at: 95 °C for 5 min; 36 cycles of 95 °C, 3 s; 55 °C, 30 s; 72 °C, 2.30 min; and a final extension of 10 min at 72 °C. Products of the first amplification (using N1 and C1 primers) were purified by phenol extraction and then subjected to a second amplification using N2 and C1 primers. The PCR products were analyzed on agarose gels, purified, and subsequently cloned in the NotI and SalI sites of pSPORT. The region involved in differential splicing was identified on the basis of restriction mapping and sequence analysis of several independent clones originating from separate reactions.

Genomic Mapping

A 462-bp EcoRI- PstI fragment of the p85 cDNA clone was used as a hybridization probe on Southern blots to type DNAs from two genetic crosses: (NFS/N or C58/J Mus m. musculus) M. m. musculus(18) and (NFS/N Mus spretus) M. spretus or C58/J(19) . DNAs from these crosses have been typed for over 700 markers including the Chr 3 markers Gba (glucocerebrosidase), Fcgr1 (Fc receptor), Cd1a (cluster designation 1a), Amy1 (amylase 1), Ngfb (nerve growth factor ) and Egf (epidermal growth factor). Probes for these markers and RFLPs used to type these crosses for Gba, Fcgr1, Cd1a, and Ngfb have been described previously(20) . Amy1 was typed following HindIII digestion in the M. spretus cross using a 530-bp probe kindly provided by Dr. M. Meisler (U. Mich.)(21) . Egf was typed following BamHI digestion in the spretus cross and HindIII digestion in the musculus cross using a 1200-bp fragment of the pre-pro-epidermal growth factor cDNA obtained from Dr. G. Bell (University of Chicago)(22) .


RESULTS

Isolation of the p85 cDNA Clone and Its Sequence

The p85 polypeptide isolated from 2D SDS-PAGE gels was microsequenced as described(9) . An N-terminal and two internal peptide sequences were obtained (see Fig. 1). Three sets of degenerate oligonucleotide probes were made against the N-terminal sequence DQREMT (see ``Materials and Methods''). These oligonucleotides were tested by hybridization to MN7 poly(A) RNA on three separate Northern blots. Although all three sets hybridized specifically to a single message of 1.9 kb, set number 2 hybridized at highest stringency and was used to screen the MN7 cDNA library.

Screening of approximately 750,000 clones yielded a single positive clone with an insert size of 1.9 kb. This clone was sequenced at the 5` end to confirm the presence of the N-terminal peptide sequence DQREMT. Subsequently, the insert was cut into five separate fragments using EcoRI and PstI and subcloned into the pSPORT vector. Sequencing of the subclones was performed on both strands using T7 and SP6 primers of pSPORT. In cases where these primers could not be used (compressions or too long insert), specifically designed primers were employed. The complete sequence of the p85 cDNA is shown in Fig. 1.

In order to identify the 5`-end of the message, a 5`-RACE reaction was carried out and 18 additional nucleotides were obtained. The complete cDNA sequence contains an ORF of 1677 bp, which extends between positions 121-1797 and codes for a protein of 559 amino acids. All three peptide sequences obtained by microsequencing are present in the deduced protein sequence (see Fig. 1). The first AUG, at position 121, is in a favorable codon context for an eukaryotic translation start site (A at -3 and G at +4; Ref. 23). It is preceded by three in-frame stop codons, while the ORFs in the two alternative reading frames are not more than 100 bp long. The coding region is terminated by a single UGA codon and is followed by a 3`-untranslated region of 95 bp, which includes an AAUAAA polyadenylation signal(24) , and a poly(A) tail.

The protein sequence contains a putative signal peptide at the N terminus, which is the only hydrophobic portion of the protein (see Fig. 2b). The cleavage site for the signal peptide is most probably between Ala-Ala after residue 19. This is based on N-terminal protein sequencing data, where the first residue is alanine (at position 20), and the application of von Heijne's(-3, -1) rule(25) . The cleaved extracellular protein would therefore contain 540 amino acids with a calculated mass of 61 kDa and a pI of 6.26. On 2D SDS-PAGE gels, the p85 protein migrates as a diffuse spot with an average mass of 85 kDa and a pI of 5.7(9) . The differences in apparent and predicted values are most probably the result of post-translational modifications. Indeed, the analysis of the sequence reveals the presence of three potential N-glycosylation sites and several possible phosphorylation sites (see Fig. 1). N-Linked glycosylations can contribute significantly to the molecular weight of proteins(26) , and phosphorylations have been shown to affect the mobility of proteins on SDS gels(27) . However, the protein does not contain potential sites for glycosaminoglycan addition, indicating that it is unlikely to be a proteoglycan(28) . Considering the differences in apparent and predicted molecular weights, the total carbohydrate content of the molecule could be up to 28%.


Figure 2: a, internal sequence homology of p85. The deduced amino acid sequence was analyzed by computer for self-homology; gaps are permitted. Similar residues are in uppercase, and identical residues are shaded. Cysteine doublets are shadeddark. Numbers indicate the positions of the amino acid residues starting at the N terminus. b, hydropathicity plot of coding region (Kyte and Doolittle algorithm included in the GCG software package). Apart from the hydrophobic signal peptide (visible as a single peak at amino acid positions 1-19), the protein is essentially hydrophilic in nature. c, schematic representation of the different regions in the p85 protein. The molecule has been drawn to scale. Each box represents one of the four identifiable regions. The residue positions that mark the ends of each region are indicated. Single cysteine residues are indicated as single-headed arrows, and cysteine-doublets are shown as double-headed arrows. The alternatively spliced domain is shadedgray.



Analysis of the amino acid composition reveals that protein is rich in Arg, Pro, and Leu residues (). The basic and acidic amino acid contents are balanced (14.6. and 13.4% of the mass, respectively) and the distribution of charged residues is fairly uniform over the sequence (data not shown). The protein is not rich in Ser or Thr, which is generally observed for phosphoproteins, and it does not contain a high number of aspartic acid or glutamic acid which are common to some bone glycoproteins(10) . The protein is rich in cysteines (a total of 29 residues or 4.8% mass), that are unevenly distributed in the sequence. There is one residue in the signal peptide, followed by a cysteine-free region of 150 residues, while the remaining 28 residues are distributed over the rest of the molecule in a typical pattern characteristic of the serum albumin family of proteins (see ``Arrangement of Cysteines in the p85 Proteins''). There are 63 prolines and 34 glycines in the protein, which suggests rigidity in the unfolded polypeptide chain, since prolines permit less rotational freedom(29) .

Computer Analysis of the DNA and Deduced Protein Sequences

Analysis of the deduced protein sequence of p85 using the WinDot (30) and Clustal V (31) programs revealed the presence of a tandemly duplicated domain within the protein; region 170-298 is homologous to region 302-424 (Fig. 2a). These two domains immediately follow the N-terminal cysteine-free domain of 150 amino acids. The first repeat contains 10 cysteines and the second 9. There is a remarkable conservation of the cysteines, including the positions of two cysteine doublets, within these domains.

Similarity searches (performed using BLASTP (32) at the National Center for Biotechnology Information (NCBI), FASTA at Los Alamos National Laboratory(33) , and D-FLASH(34) ) indicated that although the p85 sequence was not closely related to any other known protein, a limited similarity to a recently characterized calcium-binding protein of sea urchin called Endo16 (35) could be observed. Following alignment, three regions in the p85 sequence (235-264, 265-289, and 400-418) showed 33%, 48%, and 47% similarity to regions 273-301, 412-436, and 664-682 of Endo16, respectively. Coinciding with this, we find that residues 253-290 of p85 are similar (55%) to residues 654-690 of calpain, a calcium-activated neutral protease(36) . This region in calpain, contains a calcium-binding loop of an EF hand structure (residues 663-674 of calpain) and both p85 and calpain contain 6 acidic residues in this region. Regions 264-278 and 361-376 of p85 are also similar (66% and 62%) to serum albumin family repeats(37) . The similarities to Endo16 and serum albumin family of proteins, involves characteristic cysteine doublets that typify these proteins and is discussed under ``Arrangement of Cysteines in the p85 Proteins.''

Domain and motif searches using the mail servers SBASE(38, 39) , and PRODOM (40) primarily yielded similarities of the first 19 residues of p85 to signal peptides of various secreted proteins. Apart from this, typical signatures for domains or motifs of other known proteins were not identifiable. Cell attachment motifs such as RGD and LDV were absent(41) . Alignments of protein sequences on the basis of similarities in amino acid compositions (using the ExPASy server; Ref. 42) did not identify any homologues to p85.

The deduced protein sequence of the p85 was analyzed using the Kyte and Doolittle algorithm (hydrophobicity) as well as the Chou and Fasman algorithm (secondary structure), which are included in the University of Wisconsin Genetics Computer Group software package GCG. Predictions indicate that the protein is highly hydrophilic with no intervening transmembrane domains (Fig. 2b). The molecule is predicted to contain 39.75% helices, 24.38% sheets, and 35.87% coils.

Structurally, the p85 molecule can be divided into four regions. These are, a 19-residue signal peptide, followed by a cysteine-free domain of 150 residues, two tandem repeats of 129 and 123 residues, and a C-terminal region of 135 residues. This is schematically represented in Fig. 2c.

Northern Blot Studies

To study the tissue specificity of p85 gene (Ecm1) transcription, we performed Northern blot analysis on RNAs isolated from tissues of embryonic mice and different cell lines. In addition, the steady state levels of the p85 message in MN7 cultures at different time points were examined.

Expression in Embryonic Tissues

Weak expression of a 1.9-kb p85 gene transcript was detected in liver, heart, and lungs (Fig. 3a). Calvaria, which are essentially membranous bones produced directly by osteoblasts without a cartilage intermediate, showed almost negligible expression. On the other hand, skin- and cartilage-containing tissues, such as tail and front paw, showed a very strong expression of p85. Moreover, these tissues uniquely contained a smaller message of 1.5 kb in addition to the longer transcript of 1.9 kb. In skin, only the smaller transcript was present. No p85 gene message was detected in brain.


Figure 3: Northern blot analysis. Each lane contains 10 µg of total RNA. The blots were first probed with the full-length p85 cDNA and then with mouse glyceraldehyde-3-phosphate dehydrogenase. a, embryonic tissues. Highest steady state levels of the p85 transcript were detected in front paw, tail, and MN7. The single shorter transcript present in skin was clearly visible after a longer exposure of 5 days (right). b, cell lines. RNAs were isolated from cells in culture when they reached 95% confluence. High steady state levels of the longer p85 transcript were present in MN7, MC3T3-E, and moderate levels in MC615. In contrast, the p85 transcript was barely detectable in BALB/c 3T3 fibroblasts. c, time course expression. 5 µg of total RNAs isolated from cells at different time points were loaded on the gels. High steady state levels of p85 were present before and during the onset of confluence; thereafter the levels declined.



Expression in Cell Lines

We examined whether bone and cartilage derived cell lines other than MN7, expressed p85. Strong expression was detected in MC3T3-E, which is a mouse calvarial preosteoblastic cell line(12) . Expression was also seen in MC615, a mouse chondroblastic cell line(13) . Interestingly, all the above cell lines expressed only the longer transcript. Negligible expression of p85 was detected in BALB/c 3T3 fibroblasts (Fig. 3b).

Time Course Expression in MN7

Since MN7 cells are able to proliferate and differentiate in vitro forming a mineralized matrix(7, 8) , we studied the steady state levels of the p85 gene transcript at different periods of culture in an attempt to identify to which stage of MN7 culture (proliferation or maturation), its expression could be correlated. It was seen that the level of p85 mRNA peaked during confluence and then declined (Fig. 3c). This indicates that maximum expression occurred during the proliferative phase of MN7. However, the expression of the p85 gene is not completely repressed in post-confluent cultures and experiments in which MN7 cells were cultured for longer periods in serum-free media, revealed that p85 mRNA could still be detected in 30-day post-confluent cultures (results not shown).

Characterization of the Splice Variant

To explain the observation that RNAs from tail, front paw, and skin contained a shorter p85 transcript of 1.5 kb (Fig. 3a), we looked for multiple copies of the p85 gene by genomic Southern blot analysis. Mouse genomic DNA digested with different enzymes always showed the presence of a single band when hybridized to a 5` cDNA probe (Fig. 4). Genomic DNA digested with BamHI and probed with the full-length cDNA gave only two bands of 4.4 and 1.0 kb, corresponding to the 5` and 3` ends of the gene, respectively (Fig. 4). Since BamHI does not cut in the cDNA, these restriction sites ought to be located within intron sequences. We also isolated different genomic clones of the p85 gene, and all of them share the same restriction enzyme pattern. Furthermore, genomic mapping identifies a single locus on Chr 3 corresponding to the p85 gene (see ``Genetic Mapping''). These data support the conclusion that the p85 gene exists as a single-copy gene in mouse.


Figure 4: Genomic Southern blot. Mouse genomic DNA was isolated from BALB/c 3T3 cells. Each lane contains 10 µg of DNA digested with different restriction enzymes (E, EcoRI; B, BamHI; H, HindIII). The blot on the left was probed with a 5` cDNA probe (470-bp PstI fragment p85 cDNA). This probe consistently hybridizes to single bands. The blot on the right represents BamHI-digested DNA probed with the full-length p85 cDNA. The two bands of 4..4 and 1.0 kb are because of sites situated within introns.



Post-transcriptional processing of the mRNA seemed a more likely explanation for the two transcripts. The 1.9-kb message contains a single polyadenylation signal, indicating that differential polyadenylation was unlikely. It was also observed, by 5`-RACE, that the two transcripts share a common 5`-untranslated region. Therefore, to look for alternatively spliced internal exons, we performed reverse transcription-PCR using primers located at the 5` and 3` ends of the cDNA (see ``Materials and Methods'') and observed a specific band corresponding to the expected size of the smaller transcript. Subsequent cloning and sequence analysis revealed that a region of 375 bp between nucleotides 886 to 1260 was missing in this transcript. Comparison of this sequence to the genomic sequence() revealed that the deleted region corresponds to a single internal exon. This is a phase 0 exon (it has complete codon triplets at both ends; Ref. 43) and is bounded by canonical donor and acceptor splice sites(44) . This exon is deleted through a normal cassette mechanism, and the splicing event does not change the reading frame of the protein but produces a smaller protein lacking 125 amino acids. The absence of this exon in the smaller transcript has been confirmed using an exon-specific probe (a 250-bp PstI fragment present within the spliced exon) on Northern blots containing tail and front paw RNAs. This probe hybridizes only to the longer transcript (data not shown). Thus tissue-specific alternative splicing is associated with the expression of the p85 gene.

Arrangement of Cysteines in the p85 Proteins

The p85 protein contains 29 cysteines, one located in the signal peptide and the remaining 28 after the 150 residue-containing N-terminal cysteine-free domain. Of the 29 cysteines, there are 6 pairs of cysteine doublets and 17 single cysteines. The arrangement of the cysteines is very similar to the pattern in serum albumin family proteins(45, 46) , and the spacing of the single cysteines is strikingly similar to that of the Endo16 protein (35) (Fig. 5). The six pairs of cysteine doublets, at positions 239-240, 277-278, 367-368, 402-403, 468-469, and 505-506 of p85, are arranged in a highly specific manner in which two general rules can be identified. 1) All of the six doublets are followed by a single cysteine within 7-10 amino acid residues (this is typical for the serum albumin family proteins(35, 46) ; 2) the distance between the single cysteine that follows the doublet and its next successive neighbor is 12 residues in every alternate case. The distance between the single preceding cysteine and its following doublet is also 12 in every alternate case (Fig. 5). Notably, these characteristic spacings are also preserved in the splice variant of p85.


Figure 5: The regular distribution of single cysteines and cysteine doublets in the p85 protein and its putative smaller isoform. The cysteine doublets have been aligned below each other, and the distances in terms of amino acid residues of preceding and following single cysteines are indicated. The figures below the doublets represent their positions on the protein sequence. The alternating 12-residue distances are boxed.



Genetic Mapping

The gene encoding p85 was also localized on the mouse linkage map in an effort to determine if this gene may be implicated in any known developmental diseases. Southern blot hybridization with a 462-bp fragment of p85 cDNA identified ApaI fragments of 6.0 kb in parental M. m. musculus and 5.8 in NFS/N and C58/J. Digestion with BamHI identified fragments of 5.2 and 4.5 kb in M. spretus and NFS/N, respectively. Inheritance of the polymorphic fragments in the progeny of the two genetic crosses was compared with inheritance of over 700 markers previously mapped to all 19 autosomes and the X chromosome. As shown in Fig. 6, the gene encoding p85, Ecm1, was linked to markers on Chr 3 just distal to Gba. The closest linkage was observed with Fcgr1. In the M. m. musculus cross, no recombination was observed between Ecm1 and Fcgr1 in the 71 mice typed for both markers, indicating that these genes are within 4.1 centimorgans (see Fig. 6).


Figure 6: An abbreviated map of Chr 3 showing the location of the p85 gene, Ecm1. The map to the left represents the composite map of this chromosome showing the locations of the marker loci typed in our crosses and the locations of relevant mutations (47). Centimorgan distances of these loci from the centromere are given to the immediate left of the map. Human map locations for homologs of the underlined mouse genes are given to the far left. The two maps to the right were generated from the two separate crosses typed in this study. Recombination fractions are given to the right of both maps for each adjacent locus pair. Numbers in parentheses represent the percent recombination and standard error calculated according to Green (48). No double recombinants were observed in this interval in either cross. The Mouse Genome Data Base (MGD) accession numbers are MGD-CREX-299 for M. m. musculus and MGD-CREX-300 for M. spretus.




DISCUSSION

p85 was originally identified as a novel secreted protein of the mouse stromal osteogenic cell line, MN7. This protein has been further characterized by cDNA cloning, sequencing, Northern analysis and genomic mapping. The complete cDNA clone is 1.9 kb and contains an open reading frame of 1677 bp that codes for a protein of 559 amino acids.

The deduced protein sequence contains a hydrophobic signal peptide corresponding to the first 19 residues. The detection of p85 in the culture supernatants of MN7, as well as the establishment of the N-terminal sequence of this protein as Ala-Ser-Glu . . . , confirms the function of this signal sequence in the processing of the p85 protein.

The deduced protein also contains three potential N-glycosylation sites and several potential phosphorylation sites. These post-translational modifications may explain the diffuse nature of the p85 spot on 2D SDS-PAGE gels (9) and the differences in apparent and predicted values of mass and pI. The acidic and basic amino acid contents of the protein are almost balanced (13.4 and 14.6% mass), and the distribution of charged residues is fairly uniform throughout the sequence (data not shown). The sequence does not contain acidic regions, common cell attachment motifs, or leucine repeats that are observed in other non-collagenous bone matrix proteins such as osteocalcin, osteopontin, osteonectin, and bone sialoprotein(49) . Data base searches also indicate neither p85 nor closely related genes have previously been described.

Study of the tissue distribution by Northern blot analysis reveals that the p85 transcript is present in various tissues such as liver, heart, and lungs, but expression is not detected in brain and is negligible in the calvaria and the BALB/c 3T3 cell line. Uniquely, in skin and cartilage-containing-tissues, a smaller transcript derived via alternative splicing is observed. This suggests the presence of a smaller protein isoform in these tissues.

Based on the distribution of cysteines and repeats in the protein sequence, four different regions can be identified: an N-terminal cysteine-free domain rich in prolines and glutamines, two tandem repeats, and a C-terminal region. The p85 molecule, therefore, appears to have a large multidomain structure.

The cysteine-containing portion of the molecule contains six cysteine doublets that all have the typical CC-(X)-C arrangement, which is characteristic of the serum albumin family of proteins(46) . Such an arrangement was predicted to generate characteristic ``double loop'' domains in the serum albumin family proteins (45) as confirmed by x-ray analysis(46, 50, 51) . These double loop structures are involved in important ligand-binding functions of the albumin proteins (reviewed in Ref. 52).

The cysteine pattern in p85 is also very similar to that of Endo16 with respect to the 12-residue distances that separate the successive single cysteines in every alternate case(35) .

The similarities in the structures of these proteins may be reflected in their functions as well. It seems very likely that the cysteine-containing portion of p85 would form double loop structures similar to the albumin proteins. Modeling the p85 sequence to the albumin pattern, it would appear that each tandem repeat in the p85 molecule would comprise one double loop domain and the third double loop domain would be in the C-terminal region. The typical double loop domain structure of the albumins confers on them the ability to bind and carry various molecules in the blood, wherein the different loops bind to distinct ligands(52) . We can at this point only speculate that this cysteine arrangement in p85 has a similar role in its biological functions.

It has been demonstrated that molecules of the extracellular matrix bind to various ligands important for growth and differentiation and present them to the cells (reviewed in Refs. 53-55). Since p85 is probably secreted into the extracellular matrix of bone by osteoblastic cells, the cysteine-containing region of this protein may be involved in binding to important ligands (possibly including growth factors) and then presenting them to cell surface receptors or other interactive molecules.

The functional analogy may be further supported by the globular, hydrophilic nature of the p85 molecule, which is similar to the soluble nature of the albumins. The ligand binding ability of the albumins is also attributed to the high proportion of acidic and basic residues in these proteins. The acidic and basic amino acid contents of the p85 sequence are 13.4 and 14.6%, respectively. In comparison, the basic amino acid content of p85 is slightly higher than the values for albumin (16.6% acidic and 12.9% basic) (56) and Endo16 (17.8% acidic and 14% basic)(35) . The basic amino acid content in p85 may reflect different ligand binding affinities.

The selective presence of the smaller Ecm1 transcript in skin and cartilage may signal a diversification in function. Interestingly, the splicing event does not disrupt the pattern in C-CC-C distances. It does lead to the loss of the first double loop domain, and creates a rearranged double loop domain instead. The effects of this alteration are not known. We observe that the region that is spliced out contains a sequence similar to the calcium-binding loop of calpain(36) . It is tempting to speculate that the larger isoform has the ability to bind calcium and thus would be appropriately placed in bone. The predicted smaller isoform, on the other hand, may have a structural modification for an altered function in skin and cartilage. Analysis of the amino acid compositions of the two isoforms reveals that the smaller protein is more acidic (predicted pI is 5.55) as compared to the larger molecule (predicted pI is 6.26). We also observe that the alternatively deleted domain contains one of the three possible N-glycosylation sites and three of the 14 possible phosphorylation sites, indicative of possible post-translational differences.

Thus, alternative splicing may serve as a mechanism for generating functional diversity in the Ecm1 gene. The larger Ecm1 transcript is expressed in several tissues at varying levels, but the levels are comparatively higher in MN7 cells. This larger transcript is detected in subconfluent cultures of MN7, indicating that the Ecm1 gene is an early-expressed gene. Furthermore, the steady state levels of the transcript decline after MN7 cells have passed the proliferative phase, which suggest that the larger isoform of p85 may be necessary for promoting cell proliferation and/or inducing the early matrix formation events in bone(7, 57) .

The presence of the smaller transcript in skin and cartilage is especially interesting in light of the chromosomal location of the gene in mouse. The Ecm1 gene maps to Chr 3, just distal to Gba in a region containing at least three known mutations affecting skin: ft (flaky tail), soc (soft coat), and ma (matted) (the phenotypes of these mutations are summarized in Ref. 58). This suggests that Ecm1 may represent a candidate for any of these mutations. In particular, mice with soc have abnormalities in the epidermis, hair bulb, whiskers, and display a clumping of the hairs of the coat(58) , all of which is consistent with the known expression pattern of Ecm1. Correlation of soc and Ecm1 would provide important information in the elucidation of the in vivo function of p85.

The localization of Ecm1 is also interesting from another standpoint. The Ecm1 region shares linkage homology to human chromosome 1q21(59) , a region that contains a cluster of three families of genes involved in epidermal differentiation(60) . One family includes includes the proteins loricrin (LOR), involucrin (IVL), and a small proline-rich protein (SPRR1). These proteins are closely associated in the formation of the cornified cell envelope in the uppermost layers of the epidermis(61, 62, 63, 64) . Each of these genes contains a region of short tandem peptide repeats that have been partially conserved during evolution(65, 66) . A recent report demonstrated that the mouse homolog of LOR maps to mouse Chr 3 in apparent close proximity to Ecm1(67) .

The second group includes several members of the S100 family of small calcium-binding proteins: calcyclin (CACY), calpactin I light chain (CAL1L), calgranulins A and B, and possibly others(68, 69, 70, 71) . These proteins contain two calcium-binding domains with the EF-hand motif, are highly homologous at the amino acid sequence level, and have a similar gene organization.

The third family localized to human 1q21 includes profilaggrin (FLG) (72) and trichohyalin (THH)(73) . These genes appear to be ``fused'' genes containing at the 5` end two EF-hand calcium binding motifs like those of the S100 family, and tandem peptide repeats that are characteristic of the cornified cell envelope family(74, 75) . The mouse Flg locus has recently been mapped to Chr 3(67) .

The close physical linkage of these genes and the striking similarity in their organizations have been suggested to be the result of a common evolution(66, 60) . It has been suggested that some of these genes may share common regulatory regions and may function in concert during the final steps of epidermal differentiation(76) . The questions of whether Ecm1 is evolutionarily related to these genes and whether the p85 protein is involved in epidermal differentiation are intriguing and require further investigation.

Finally, the question whether p85, which shares close structural similarity with Endo16 (a protein that performs important functions during the development and differentiation of sea urchin embryos)(35) , could be a mammalian analogue needs further investigation, especially for its potential implications in ontogenic and phylogenic studies.

  
Table: Amino acid composition of the p85 coding region



FOOTNOTES

*
This work was supported in part by the ``Vlaams Actieprogramma Biotechnologie'' (ETC-009). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) L33416.

§
Recipient of financial support from Innogenetics N.V. (Ghent, Belgium).

To whom correspondence and reprint requests should be addressed. Tel.: 32-3-820-2311; Fax: 32-3-820-2248; E-mail: merrega@uia.ua.ac.be.

The abbreviations used are: 2D SDS-PAGE, two-dimensional SDS-polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; kb, kilobase(s); bp, base pair(s); RACE, rapid amplification of cDNA ends; ORF, open reading frame; Chr, chromosome.

P. Smits, personal communication.


ACKNOWLEDGEMENTS

We thank Dr. A. Van de Voorde and Dr. W. Deleersnijder for helpful discussions and encouragement during the course of this study.


REFERENCES
  1. Burr, D. B., and Martin, R. B. (1989) Am. J. Anat.186, 186-216 [CrossRef][Medline] [Order article via Infotrieve]
  2. Urist, M. R. (1965) Science150, 893-899 [Abstract/Free Full Text]
  3. Heinegard, D., and Oldberg, A. (1993) in Connective Tissue and Its Heritable Disorders (Royce, P. M., and Steinmann, B., eds) pp. 189-209, Wiley-Liss, New York
  4. von der Mark, K., and Goodman, S. (1993) in Connective Tissue and Its Heritable Disorders (Royce, P. M., and Steinmann, B., eds) pp. 211-236, Wiley-Liss, New York
  5. Heinegard, D., and Oldberg, A. (1989) FASEB J.3, 2042-2051 [Abstract]
  6. Mathieu, E., Schoeters, G., Vander Plaetse, F., and Merregaert, J. (1992) Calcif. Tissue Int.50, 362-371 [CrossRef][Medline] [Order article via Infotrieve]
  7. Mathieu, E., and Merregaert, J. (1994) J. Bone Miner. Res.9, 183-192 [Medline] [Order article via Infotrieve]
  8. Mathieu, E. (1993) Establishment and Cellular Biochemical Characterization of the Osteogenic Stromal Cell Line MN. Ph.D. thesis, University of Antwerp, Belgium
  9. Mathieu, E., Meheus, L., Raymackers, J., and Merregaert, J. (1994) J. Bone Miner. Res.9, 903-913 [Medline] [Order article via Infotrieve]
  10. Dickson, I. R. (1993) in Connective Tissue and Its Heritable Disorders (Royce, P. M., and Steinmann, B., eds) pp. 249-285, Wiley-Liss, New York
  11. Murphy, G., and Reynolds, J. J. (1993) in Connective Tissue and Its Heritable Disorders (Royce, P. M., and Steinmann, B., eds) pp. 287-316, Wiley-Liss, New York
  12. Sudo, H., Kodama, H. A., Amagai, Y., Yamamoto, S., and Kasai, S. (1983) J. Cell Biol.96, 191-198 [Abstract/Free Full Text]
  13. Mallein-Gerin, F., and Olsen, B. R. (1993) Proc. Natl. Acad. Sci. U. S. A.90, 3289-3293 [Abstract/Free Full Text]
  14. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  15. Sabath, D. E., Broome, H. E., and Prystowsky, M. B. (1990) Gene (Amst.) 91, 185-191 [CrossRef][Medline] [Order article via Infotrieve]
  16. Nash, J. H. E. (1993) Comput. Appl. Biosci.9, 469-471 [Abstract/Free Full Text]
  17. Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H., and Roe, B. A. (1980) J. Mol. Biol.143, 161-178 [CrossRef][Medline] [Order article via Infotrieve]
  18. Kozak, C. A., Peyser, M., Krall, M., Mariano, T. M., Kumar, C. S., Pestka, S., and Mock, B. A. (1990) Genomics8, 519-524 [CrossRef][Medline] [Order article via Infotrieve]
  19. Adamson, M. C., Silver, J., and Kozak, C. A. (1991) Virology183, 778 [CrossRef][Medline] [Order article via Infotrieve]
  20. Osman, N., Kozak, C. A., Mckenzie, I. F. C., and Hogarth, P. M. (1992) J. Immunol.148, 1570-1575 [Abstract]
  21. Darlington, G. J., Tsai, C. C., Samuelson, L. C., Gumucio, D. L., and Meisler, M. H. (1986) Mol. Cell. Biol.6, 969-975 [Abstract/Free Full Text]
  22. Zabel, B. U., Eddy, R. L., Lalley, P. A., Scott, J., and Bell, G. I. (1985) Proc. Natl. Acad. Sci. U. S. A.82, 469-473 [Abstract/Free Full Text]
  23. Kozak, M. (1989) J. Cell Biol.108, 229-241 [Abstract/Free Full Text]
  24. Wahle, E., and Keller, W. (1992) Annu. Rev. Biochem.61, 419-440 [Medline] [Order article via Infotrieve]
  25. von Heijne, G. (1986) Nucleic Acids Res.14, 4683-4690 [Abstract/Free Full Text]
  26. Jokinen, M., Ulmanen, I., Andersson, L. D., Kaariainen, L., and Gahmberg, C. G. (1981) Eur. J. Biochem.114, 393-397 [Medline] [Order article via Infotrieve]
  27. Gates, R. E., and King, L. E., Jr. (1982) Biochem. Biophys. Res. Commun.105, 57-66 [CrossRef][Medline] [Order article via Infotrieve]
  28. Kjellen, L., and Lindahl, U. (1991) Annu. Rev. Biochem.60, 443-475 [CrossRef][Medline] [Order article via Infotrieve]
  29. Branden, C., and Tooze, J. (1991) Introduction to Protein Structure, p. 259, Garland Publishing Inc., New York
  30. Nakisa, R. C. (1993) DotPlot, a program for graphical comparison of nucleic acid and protein sequences for Microsoft Windows. Published electronically on the Internet and available by anonymous ftp from ftp.bio.indiana.edu.
  31. Higgins, D. G., Bleasby, A. J., and Fuch, R. (1992) Comput. Appl. Biosci.8, 189-191 [Abstract/Free Full Text]
  32. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol.215, 403-410 [CrossRef][Medline] [Order article via Infotrieve]
  33. Pearson, W. R., and Lipman, O. J. (1988) Proc. Natl. Acad. Sci. U. S. A.85, 2444-2448 [Abstract/Free Full Text]
  34. Rigoutsos, I., and Califano, A. (1994) IEEE Comput. Sci. Eng.1, 60-75
  35. Soltysik-Espanola, M., Klinzing, D. C., Pfarr, K., Burke, R. D., and Ernst, S. G. (1994) Dev. Biol.165, 73-85 [CrossRef][Medline] [Order article via Infotrieve]
  36. Aoki, K., Imajoh, S., Ohno, S., Emori, Y., Koike, M., Kosaki, G and Suzuki, K. (1986) FEBS Lett.205, 313-317 [CrossRef][Medline] [Order article via Infotrieve]
  37. Dugaiczyk, A., Law, S. W., and Dennison, O. E. (1982) Proc. Natl. Acad. Sci.U. S. A.79, 71-75 [Abstract/Free Full Text]
  38. Pongor, S., Skerl, V., Cserzo, M., and Hatsagi, Z., Simon, G., and Bevilacqua, V. (1992) Nucleic Acids Res.21, 3111-3115 [Abstract/Free Full Text]
  39. Hegyi, H., and Pongor, S (1993) Comput. Appl. Biosci.9, 371-372 [Free Full Text]
  40. Sonnhammer, E. L. L., and Kahn, D. (1994) Protein Sci.3, 482-492 [Medline] [Order article via Infotrieve]
  41. Yamada, Y., and Kleinman, H. K. (1992) Curr. Opin. Cell Biol.4, 819-823 [CrossRef][Medline] [Order article via Infotrieve]
  42. Appel, R. D, Sanchez, J.-C., Bairoch, A., Golaz, O., Miu, M., Vargas, R., and Hochstrasser, D. (1993) Electrophoresis14, 1232-1238 [CrossRef][Medline] [Order article via Infotrieve]
  43. Sharp, P. A. (1981) Cell23, 643-646 [CrossRef][Medline] [Order article via Infotrieve]
  44. Mount, S. M. (1982) Nucleic Acids Res.10, 459-472 [Abstract/Free Full Text]
  45. Brown, J. R. (1976) Fed. Proc. Fed. Am. Soc. Exp. Biol.35, 2141-2144
  46. Yang, F., Brune, J., Naylor, S., Cupples, R., Naberhaus, K., and Bowman, B. (1985) Proc. Natl. Acad. Sci. U. S. A.82, 7994-7998 [Abstract/Free Full Text]
  47. Seldin, M. F., Prins, J.-B., Rodrigues, N., Todd, J. A., and Meisler, M. H. (1993) Mammal. Genome4, S47-S57
  48. Green, E. L. (1981) Genetics and Probability in Animal Breeding Experiments, p. 77, Oxford University Press, New York
  49. Ayad, S., Boot-Handford, R. P., Humphries, M. J., Kadler, K. E., and Shuttleworth, C. A. (eds) (1994) The Extracellular Matrix Factsbook, Academic Press Ltd., London
  50. Carter, A. D., He, X. M., Munson, S., Twigg, P., Gernert, K., Broom, M., and Miller, T. (1989) Science244, 1195-1198 [Abstract/Free Full Text]
  51. Vogelaar, N., Lindberg, U., and Schutt, C. (1991) J. Mol. Biol.220, 545-547 [CrossRef][Medline] [Order article via Infotrieve]
  52. Kragh-Hansen, U. (1990) Danish Med. Bull.37, 57-84
  53. Schubert, D. (1992) Trends Cell Biol.2, 63-66 [CrossRef][Medline] [Order article via Infotrieve]
  54. Adams, J. C., and Watt, F. M. (1993) Development117, 1183-1198 [Medline] [Order article via Infotrieve]
  55. Juliano, R. L., and Haskill, S. (1993) J. Cell Biol.120, 577-585 [Free Full Text]
  56. Peters, T. (1975) in The Plasma Proteins (Putman, F., ed) pp. 133-181, Academic Press, New York
  57. Stein, G. S., Lian, J. B., and Owen, T. A. (1990) FASEB J.4, 3112-3122
  58. Green, M. C. (1989) in Genetic Variants and Strains of the Laboratory Mouse (Lyon, M. F., and Searle, A. G., eds) pp. 12-403, Oxford University Press, Oxford
  59. O'Brien, S. J., and Graves, M. J. A. (1991) Cytogenet. Cell Genet.58, 1124-1151 [CrossRef]
  60. Volz, A., Korge, B. P., Compton, J. G., Ziegler, A., Steinert, P. M., and Mischke, D. (1993) Genomics18, 92-99 [CrossRef][Medline] [Order article via Infotrieve]
  61. Yoneda, K., Hohl, D., McBride, O. W., Wang, M., Cehrs, K. U., Idler, W., and Steinert, P. M. (1992) J. Biol. Chem.267, 18060-18066 [Abstract/Free Full Text]
  62. Simon, M., Phillips, M., Green, H., Stroh, H., Glatt, K., Bruns, G., and Latt, S. A. (1989) Am. J. Hum. Genet.45, 910-916 [Medline] [Order article via Infotrieve]
  63. Kartasova, T., and van de Putte, P. (1988) Mol. Cell. Biol.8, 2195-2203 [Abstract/Free Full Text]
  64. An, G., Huang, T. H., Tesfaigzi, J., Garcia-Jeras, J., Ledbetter, D. H., Carlson, D. H., and Wu, R. (1992) Am. J. Respir. Cell. Mol. Biol.7, 104-111
  65. Steinert, P. M., Mack, J. W., Korge, B. P., Gan, S. Q., Haynes, S. R., and Steven, A. C. (1991) Int. J. Biol. Macromol.13, 130-139 [CrossRef][Medline] [Order article via Infotrieve]
  66. Backendorf, C., and Hohl, D. (1992) Nature Genet.2, 91 [CrossRef][Medline] [Order article via Infotrieve]
  67. Rothnagel, J. A., Longley, M. A., Bundman, D. S., Naylor, S. L., Lalley, P. A., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., and Roop, D. R. (1994) Genomics23, 450-456 [CrossRef][Medline] [Order article via Infotrieve]
  68. Ferrari, S., Calabretta, B., DeRiel, J., Battini, R., Ghezzo, F., Lauret, E., Griffin, C., Emanuel, B., Gurrieri, F., and Baserga, R. (1987) J. Biol. Chem.262, 8325-8332 [Abstract/Free Full Text]
  69. Dooley, T. P., Weiland, K. L., and Simon, M. (1992) Genomics13, 866-868 [CrossRef][Medline] [Order article via Infotrieve]
  70. Harder, T., Kube, E., and Gerke, V. (1992) Gene (Amst.) 113, 269-274 [CrossRef][Medline] [Order article via Infotrieve]
  71. Dorin, J. R., Emslie, E., and Heyningen, V. (1990) Genomics8, 420-426 [CrossRef][Medline] [Order article via Infotrieve]
  72. McKinley-Grant, L. J., Idler, W. W., Bernstein, I. A., Parry, D. A. D., Cannizzaro, L., Croce, M., Huebner, K., Lessin, S. R., and Steinert, P. M. (1989) Proc. Natl. Acad. Sci. U. S. A.86, 4868-4852 [Abstract/Free Full Text]
  73. Lee, S. C., Wang, M., McBride, O. W., O'Keefe, E. J., Kim, I. G., and Steinert, P. M. (1993) J. Invest. Dermatol.100, 65-69 [CrossRef][Medline] [Order article via Infotrieve]
  74. Markova, N. G., Marekov, L. N., Chipev, C. C., Gan, S. Q., Idler, W. W., and Steinert, P. M. (1993) Mol. Cell. Biol.13, 613-625 [Abstract/Free Full Text]
  75. Presland, R. B., Haydock, P. V., Fleckman, P., Nirunsuksiri, W., and Dale, B. A. (1992) J. Biol. Chem.267, 23772-23781 [Abstract/Free Full Text]
  76. Rosenthal, D. S., Griffiths, C. E. M., Yuspa, S. H., Roop, D. R., and Voorhees, J. J. (1992) J. Invest. Dermatol.98, 343-350 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. ProteomicsHome page
R. Uematsu, J.-i. Furukawa, H. Nakagawa, Y. Shinohara, K. Deguchi, K. Monde, and S.-I. Nishimura
High Throughput Quantitative Glycomics and Glycoform-focused Proteomics of Murine Dermis and Epidermis
Mol. Cell. Proteomics, December 1, 2005; 4(12): 1977 - 1989.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Mongiat, J. Fu, R. Oldershaw, R. Greenhalgh, A. M. Gown, and R. V. Iozzo
Perlecan Protein Core Interacts with Extracellular Matrix Protein 1 (ECM1), a Glycoprotein Involved in Bone Formation and Angiogenesis
J. Biol. Chem., May 2, 2003; 278(19): 17491 - 17499.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. Hamada, W. H. I. McLean, M. Ramsay, G. H. S. Ashton, A. Nanda, T. Jenkins, I. Edelstein, A. P. South, O. Bleck, V. Wessagowit, et al.
Lipoid proteinosis maps to 1q21 and is caused by mutations in the extracellular matrix protein 1 gene (ECM1)
Hum. Mol. Genet., April 1, 2002; 11(7): 833 - 840.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z. HAN, J. NI, P. SMITS, C. B. UNDERHILL, B. XIE, Y. CHEN, N. LIU, P. TYLZANOWSKI, D. PARMELEE, P. FENG, et al.
Extracellular matrix protein 1 (ECM1) has angiogenic properties and is expressed by breast tumor cells
FASEB J, April 1, 2001; 15(6): 988 - 994.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. T. Hartsough, S. E. Clare, M. Mair, A. G. Elkahloun, D. Sgroi, C. K. Osborne, G. Clark, and P. S. Steeg
Elevation of Breast Carcinoma Nm23-H1 Metastasis Suppressor Gene Expression and Reduced Motility by DNA Methylation Inhibition
Cancer Res., March 1, 2001; 61(5): 2320 - 2327.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhalerao, J.
Right arrow Articles by Merregaert, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhalerao, J.
Right arrow Articles by Merregaert, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement