JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, B.
Right arrow Articles by Leibold, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, B.
Right arrow Articles by Leibold, E. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 28, Issue of July 14, pp. 16529-16535, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Characterization and Expression of Iron Regulatory Protein 2 (IRP2)
PRESENCE OF MULTIPLE IRP2 TRANSCRIPTS REGULATED BY INTRACELLULAR IRON LEVELS (*)

Bing Guo , Fritz M. Brown , John D. Phillips , Yang Yu , Elizabeth A. Leibold (§)

From the (1)Department of Medicine and the Eccles Program in Human Molecular Biology and Genetics, University of Utah, Salt Lake City, Utah 84112

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Iron regulatory proteins (IRP1 and IRP2) are RNA-binding proteins that bind to stem-loop structures, termed iron-responsive elements (IREs), present in either the 5`- or 3`-untranslated regions of specific mRNAs. The binding of IRPs to 5`-IREs inhibits translation of mRNA, whereas the binding of IRPs to 3`-IREs stabilizes mRNA. To study the structure and regulation of IRP2, we isolated cDNAs for rat and human IRP2. The derived amino acid sequence of rat IPR2 is 93% identical with that of human IRP2 and is present in lower eukaryotes, indicating that IRP2 is highly conserved. IRP1 and IRP2 share 61% overall amino acid identity. IRP2 is ubiquitously expressed in rat tissues, the highest amounts present in skeletal muscle and heart. IRP2 is encoded by multiple mRNAs of 6.4, 4.0, and 3.7 kilobases. The 3`-untranslated region of rat IRP2 contains multiple polyadenylation signals, two of which could account for the 4.0-kb and 3.7-kb mRNAs. The 3.7-kb mRNA is increased in iron-depleted cells and occurs with a reciprocal decrease in the 6.4-kb transcript. These data suggest that the 3.7-kb mRNA is produced by alternative poly(A) site utilization in iron-depleted cells.


INTRODUCTION

Iron-regulatory proteins (IRP1 and IRP2)()are cytosolic RNA-binding proteins that regulate the post-transcriptional expression of mRNAs encoding proteins involved in iron homeostasis and utilization(1, 2, 3) . IRP1 was previously known as the iron-responsive element binding protein, iron-regulatory factor, and the ferritin repressor protein. IRPs bind to stem-loop structures, known as iron-responsive elements (IREs), located in the 5`-untranslated regions (UTRs) of mRNAs encoding ferritin(4, 5) , mitochondrial aconitase(6) , and erythroid aminolevulinic acid synthase(7, 8) . Five IREs are also located in the 3`-UTR of the mRNA encoding the transferrin receptor(9, 10) . Binding of IRP to IREs in the 5`-UTR of ferritin (11, 12, 13) and erythroid aminolevulinic acid synthase mRNAs (13, 14) results in inhibition of translation, whereas binding of IRP to IREs in the 3`-UTR of the transferrin receptor mRNA results in stabilization of the mRNA(10, 15) . Intracellular iron levels modulate the affinity of the IRP for the IRE: IRPs bind with high affinity to IREs in iron-depleted cells and with low affinity in iron-repleted cells.

IRP1 and IRP2 have been purified and cloned from mammalian cells (16-20). IRP1 has a molecular mass of 98,000 Da and exhibits homology with the 4Fe-4S enzyme mitochondrial aconitase(21) . Like mitochondrial aconitase, IRP1 contains an 4Fe-4S cluster and is an active aconitase (22, 23). IRP1 isolated from iron-repleted cells contains an 4Fe-4S cluster and is an active aconitase, but binds IREs with low affinity (24). In contrast, IRP1 isolated from iron-depleted cells lacks an 4Fe-4S cluster and aconitase activity, but binds IREs with high affinity. Thus, IRP1 functions as either an RNA-binding protein or cytosolic aconitase, depending on levels of intracellular iron. The function of aconitase activity in IRP1 is unclear; however, recent data indicated that aconitase activity is not required for the iron-dependent regulation of IRE binding(25) .

IRP2 was identified by RNA-band shift analysis in extracts from rat tissue and cultured cells (4) and in regenerating rat liver(26) . IRP2 has been purified from rat liver and has a molecular mass estimated as 104,000 Da(27) . The partial amino acid sequences of a peptide derived from rat liver IRP2 was similar to the deduced sequence of an IRP2-like cDNA isolated from a human T cell library(16, 20) . Mouse tissues and cells have been shown by RNA-band shift analysis to contain a second IRP termed IRF(28) . UV-cross-linking experiments indicated that mouse IRF has a molecular mass of 105,000 Da which is similar to the mass of rat IRP2, suggesting that these proteins are homologous.

Although RNA binding activities of IRP1 and IRP2 decrease in iron-treated cells, the mechanisms that regulate their RNA binding activities differ. The decrease in IRP1 RNA binding activity is due to the switch to an 4Fe-4S form and occurs without changes in IRP1 levels (18, 29). In contrast, IRP2 RNA binding activity decreases via reduction in IRP2 levels(27, 30) . Furthermore, unlike IRP1, IRP2 lacks aconitase activity(27) .

The presence of two IRPs in cells that are regulated by iron by different mechanisms raises questions of the function and necessity of two IRPs. To begin to answer these questions, we report the isolation and sequence of cDNAs for rat liver and human fetal brain IRP2. We also provide an analysis of the expression of IRP2 in rat tissues and demonstrate that IRP2 is also present in lower eukaryotes, indicating that IRP2 is highly conserved. Finally, we demonstrate the presence of multiple IRP2 mRNA transcripts in rat, mouse, and human cells that may be regulated by alternative polyadenylation in iron-depleted cells.


MATERIALS AND METHODS

Cell Culture

Rat hepatoma cells (FTO2B), mouse fibroblasts (NIH 3T3), and human primary transformed embryonal kidney cells (293) and HeLa cells were grown at 37 °C in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum.

cDNA Library Screening and DNA Sequencing

cDNA clones corresponding to the rat and human IRP2s were isolated from rat liver and human fetal brain libraries, respectively. For the isolation of the rat IRP2 cDNA, two rat liver libraries were screened. A Stratagene rat liver library was sequentially screened with two random-primed (31) P-labeled DNA fragments generated by reverse transcriptase-PCR that corresponded to the 225-bp 73-amino-acid insertion (probe 1) and to the last 500 bp of the coding region (probe 3) of the human T cell 10.1 cDNA (16) (see Reverse Transcriptase-PCR below). Approximately 2 10 recombinants were screened, and 3 recombinants were isolated and sequenced using Sequenase (United States Biochemical Corp.). Sequence analysis of the longest clone, pSL800, showed that it contained a putative initiation codon followed by an 876-bp open reading frame and 6 bp of the 5`-UTR sequence. No recombinants were isolated that correspond to the COOH-end or the 3`-UTR of IRP2. To obtain IRP2 cDNAs containing the 3` sequence, a rat liver cDNA library provided by Dr. Jonathan Gitlin (Washington University School of Medicine) was screened with probe 3. Approximately 2 10 plaques were screened, and 4 recombinants of varying lengths were isolated and partially sequenced. The longest cDNA, pUZB2-1, contained 1017 bp of coding region and 2850 bp of 3`-UTR. Since cDNAs corresponding to nucleotides 877 to 1875 were not found in either of the two libraries, reverse transcriptase-PCR using oligonucleotide primers from the 3` end of pSL800 and the 5` end of pUZB2-1 was used to amplify the corresponding region from rat liver mRNA (see Reverse Transcriptase-PCR). The reverse transcriptase-PCR product was cloned into PCR-Script SK(+) (Stratagene) and sequenced.

A human IRP2 cDNA was isolated from a human fetal brain library (Stratagene) using probes 1 and 3. Approximately 6.0 10 recombinants were screened, and 8 recombinants were isolated. Two cDNAs were mapped, and their coding regions were sequenced. pSLFB4a was 3.0 kb in length. It included nucleotides 175 to 2889 based on the rat sequence and 386 bp of the 3`-UTR sequence. pSLFB15c was 3.0 kb in length and included 2859 bp of coding sequence.

Reverse Transcriptase-PCR

To isolate cDNA clones for the rat and human IRP2, IRP2 probes were generated by amplifying IRP2 sequences from rat liver mRNA with primers from the human 10.1 sequence (16). These PCR probes were then used to screen the rat liver and human fetal brain cDNA libraries. We have previously shown that the amino acid sequence of a peptide derived from rat IRP2 is similar to sequences in the human 10.1 cDNA, suggesting that these are homologous proteins(27) . Primers corresponding to sequences in the human 10.1 sequence (16) were generated and used for reverse transcriptase-PCR. The sequences of these primers and their corresponding locations in the rat IRP2 sequence are: probe 1, nucleotides 418 to 435, ATACAGAATGCACCAAAT, and nucleotides 631-648, GTGCCTGAACCTGAAACA, and probe 3, nucleotides 2389-2408, GGCACTTTTGC-AAATATCAA, and nucleotides 2872-2892, GTGGCACGAAAATTCTCATAG. RNA was prepared from FT02B rat hepatoma cells using TRIzol (Life Technologies, Inc.) as recommended. First strand cDNA synthesis was carried out with 1 µg of total RNA in a reaction volume of 20 µl with either oligo(dT) or random hexamers by using SuperScript reverse transcriptase (Life Technologies, Inc.) as recommended by the manufacturer. The PCR reaction contained 20 mM Tris-HCl, pH 8.4, 2 mM MgCl, 0.1 mM dNTP, 50 pmol of each primer, 1/100 of cDNA synthesized, and 5 units of Taq DNA polymerase. 30 cycles were carried out at an annealing temperature of 56 °C. The PCR products were separated in a 2% agarose gel, and the appropriate size gel fragments were excised and eluted from the gel and used as probes. Reverse transcriptase-PCR product corresponding to 877-1875 was synthesized using primers corresponding to nucleotides 855-869, TATAACCATGGTGAATGGATT, and 1953-1973, TACTGACTCTACAGGCAAGAA. The PCR product was cloned into pCR-Script SK(+) plasmid (Stratagene) and sequenced.

Immunoblotting and RNA-Band Shift Assays

Tissues from Sprague-Dawley male rats were isolated and were pulverized in liquid nitrogen. After the powder was added to SDS buffer (1% SDS, 50 mM Tris-HCl, pH 6.8) and boiled for 10 min, 0.25% bromphenol blue and 2% -mercaptoethanol were added. The concentration of protein in the extracts was determined by the bicinchoninic acid protein assay (Pierce).

Protein extracts were prepared from the following tissues and organisms: skeletal muscle of zebra fish (a gift from Dr. D. Grunwald), skeletal muscle of Xenopus laevis (a gift from Dr. B. Bass), and whole Drosophila melanogaster third instar larvae (a gift from Dr. A. Letsou) all at the University of Utah. All tissues and larvae were quick-frozen in liquid nitrogen and processed as described for the rat tissues. Equal amounts of protein were electrophoretically separated on an 8% SDS-polyacrylamide gel, and the protein was transferred onto nitrocellulose membranes. IRP1 and IRP2 were detected by incubation of the membranes with chicken polyclonal antibodies directed against the coding region of rat IRP1 or rabbit polyclonal antibodies directed against the 73-amino-acid insertion of rat IRP2 (27). After the primary antibody incubations, the membranes were incubated with horseradish peroxidase-conjugated goat anti-chicken or goat anti-rabbit antibodies, using the Enhanced Chemiluminescent (ECL) Western blotting detection system (Amersham). Four separate immunoblotting experiments were performed and one representative blot is shown.

RNA-band shift assays and electrophoresis of the RNAprotein complexes were performed as described previously(4) . In some experiments, rabbit anti-IRP2 antisera or rabbit preimmune serum was preincubated for 10 min with extracts prior to the addition of P-labeled IRE. RNA-band shift assays were performed four times and one representative experiment is shown.

Northern Blots

Total RNA was isolated from the tissues of male Sprague-Dawley rats using guanidium thiocyanate (32) or from 293 cells, HeLa cells, mouse 3T3 cells, and rat FTO2B cells using TRIzol (Life Technologies, Inc.). Total RNA (10 µg) was electrophoresed on 1% formaldehyde-agarose gels in MOPS buffer (pH 7.0). The RNA was transferred to a nylon membrane and hybridized with random-primed P-labeled rat IRP2 DNA probes corresponding to the 73-amino-acid insertion (225 bp), to the entire coding region (2889 bp), and to two 3`-UTR fragments (214 bp) and (2200 bp) located downstream from the alternative polyadenylation consensus signals. Hybridization was carried out using Rapid-hyb buffer (Amersham) for 1 h at 65 °C according to the manufacturer, and the membranes were washed at 2 SSC (20 SSC = 3 M NaCl, 0.3 M sodium acetate) at 25 °C for 15 min followed by a wash at 1 SSC at 65 °C for 10 min. Northern blotting experiments were performed at least 3-5 times and one representative blot from each experiment is shown.


RESULTS

Isolation of Rat and Human IRP2 cDNAs

To study the expression and regulation of IRP2, we cloned and sequenced IRP2 cDNAs from rat liver and human fetal brain libraries (see ``Materials and Methods''). The rat IRP2 cDNA was 5.7 kb in length and contained an open reading frame of 2889 bp and 5`- and 3`-UTRs of 6 bp and 2.9 kb, respectively. The human IRP2 contained an open reading frame of 2714 bp and a 3`-UTR of 386 bp. Comparison of the predicted amino acid sequences of the rat IRP2 cDNA with those of a human T cell IRP2 cDNA or the human fetal brain cDNA showed that they share 93% identity and 97% similarity. Human and rat IRP2 sequences are contiguous along their lengths except for a deletion and an insertion of glycine residues at position 32 and between positions 426-427 in the human fetal brain IRP2 cDNA (data not shown). Since the amino-terminal sequences of the human and rat IRP2s have not been determined, their translation initiation codons have been tentatively assigned. We believe that the ATG assignment in the rat and human cDNAs may represent full-length or close to full-length coding regions since rat IRP2 expressed in yeast migrates on SDS-polyacrylamide gels with mobility similar to that of the endogenous rat liver IRP2 (data not shown).

Rat liver IRP1 and IRP2 are conserved proteins sharing 61% amino acid identity and 79% amino acid similarity. A notable difference between IRP1 and IRP2 is the insertion into IRP2 of a 73-amino-acid domain located 139 amino acids downstream from the putative translational initiation codon (Fig. 1). This sequence is rich in cysteines, serines, and prolines and also contains a site located between amino acids Ser and Gln that is susceptible to proteolysis during purification(27) . Cleavage at this site results in the appearance of an 83,000-Da fragment. Finally, a serine located at residue 130 in IRP1, which has been shown to cross-link to IRE RNA(33) , is also conserved in IRP2, suggesting that RNA binding sites may be conserved between these proteins.


Figure 1: Comparison of the amino acid sequences of rat liver IRP1 and IRP2 with those of pig mitochondrial aconitase. The deduced amino acid sequences of rat IRP1 (26) and IRP2 and of porcine mitochondrial aconitase (42) are compared and are displayed with gaps allowing optimized alignment. Identical residues are indicated by the horizontal lines. The 73-amino-acid insertion in IRP2 is boxed. The black bars above and below the sequences indicate active-site residues in mitochondrial aconitase (43), and the asterisks above and below Arg and Ser indicate aconitase active-site residues that are changed in IRP2.



Like IRP1, IRP2 shares about 26% amino acid identity and 51% amino acid similarity with mitochondrial aconitase (Fig. 1). IRP1 contains a 4Fe-4S cluster similar to the cluster in mitochondrial aconitase (34) and is an active aconitase(24) . All 18 active-site residues in mitochondrial aconitase, including the 3 cysteines that are ligands for the 4Fe-4S cluster, are conserved in IRP1(21) . Inspection of IRP2 sequences from rat liver and human fetal brain shows that, although they contain these 3 cysteines and 16 of the 18 active-site residues, 2 residues essential for enzymatic activity, Arg and Ser in mitochondrial aconitase, are substituted with Lys and Asn in rat IRP2. Thus, not surprisingly, IRP2 does not exhibit aconitase activity(27) . Whether IRP2 contains a 4Fe-4S cluster similar to those of mitochondrial aconitase and IRP1 is not known.

Expression of Multiple IRP2 mRNAs in Rat Hepatoma Cells and Rat Tissues

Rat hepatoma FTO2B cells contained three mRNAs that hybridized with the IRP2 cDNA: two major mRNAs of 6.4 kb and 3.7 kb and one minor mRNA of 4.0 kb (Fig. 2B, lanes a and b). The sizes of the three mRNAs are sufficient to encode an IRP2 whose relative molecular mass is 104,000 Da(27) . The rat liver IRP2 cDNA is estimated to be at least 5.7 kb, and, therefore, we believe that it corresponds to the 6.4-kb mRNA. These mRNAs encode IRP2, and not IRP1, since a probe corresponding to the 73 amino acid insertion in IRP2 hybridized to all three mRNAs (Fig. 2B, lane b). Also, probes representing various regions of the IRP2 coding region hybridized to all three mRNAs, indicating that the 4.0-kb and 3.7-kb mRNAs did not contain major coding region deletions (data not shown). Finally, Southern blotting analysis suggested that IRP2 is encoded by a single gene (data not shown). These data suggested that the differences in length of the IRP2 mRNAs might be due to the lack of either 5`- or 3`-UTR sequences.


Figure 2: The presence of multiple IRP2 mRNAs in rat hepatoma cells. A, a map of the rat liver IRP2 cDNA is shown including the coding region (black box), the 73-amino-acid insertion (white box), and the 3`-UTR (single black line). The dotted lines indicate that the cDNA is not complete and is missing sequences at the 5`- and 3`-UTR. The initiation codon (ATG) and the termination codon (TAG) are indicated. The KpnI (K) and EcoRI (E) sites are indicated. The fragments used as probes and their sizes are located beneath the map and are labeled a, b, c, and d. Large and small arrows indicated strong and weak poly(A) consensus signals, respectively. B, total RNA was prepared from rat FTO2B cells and fractionated on a 1% formaldehyde-agarose gel. The RNA was hybridized with P-labeled IRP2 probes corresponding to the coding region (a), to the 225-bp 73-amino acid insertion (b), to a 214-bp 3`-UTR fragment (c), or to a 2200-bp 3`-UTR fragment (d). The sizes of the IRP2 mRNAs and a nonspecific mRNA (ns) are indicated. RNA molecular weight standards are from Life Technologies, Inc. C, total RNA was prepared from rat tissues and hybridized to a P-labeled IRP2 cDNA as described in B.



We isolated an IRP2 cDNA that contained 2.9 kb of 3`-UTR sequence and sequenced the first 800 bp after the termination codon. Inspection of this sequence revealed the presence of two alternative poly(A) signal sequences (Fig. 3). One sequence, AATAAA, is located at nucleotide 3169 and is a perfect match with the consensus sequence (35). This sequence is also present in the human T cell IRP2 cDNA (Fig. 3). Two GU- or U-rich elements that are commonly found downstream of the AAUAAA element (36) are present at nucleotides 3227 and 3261 in the rat sequence and at nucleotides 3215 and 3251 in the human sequence (Fig. 3). A minor poly(A) signal sequence, GATAAA, is located at nucleotide 3512 in the rat sequence. Thus, the possibility existed that the 4.0-kb and 3.7-kb mRNAs might have been generated by polyadenylation at these upstream sites.


Figure 3: Comparison of the sequences of the 3`-untranslated regions of rat and human IRP2. The rat sequence (2890-3759) is located on the top line, and the human sequence (16) (2842-3402) is located beneath. The numbering begins with the first nucleotide in the rat and human sequences, and the figure shows the sequences starting at the termination codon (TAG). The two alternative polyadenylation consensus signals are boxed, and the two KpnI sites in the rat sequence are underlined.



If the 4.0-kb and 3.7-kb mRNAs are generated by alternative polyadenylation site utilization, these mRNAs should not contain 3`-UTR sequences downstream from the poly(A) signal sequences. Two 3`-UTR probes were prepared that corresponded to a KpnI fragment of 214 bp and a KpnI/EcoRI fragment of 2200 bp (Fig. 2A). The conserved poly(A) consensus sequence is located 5` to the 214-bp KpnI and the 2200-bp KpnI/EcoRI fragments, and the minor poly(A) consensus sequence is located 5` to the 2200-bp fragment (Fig. 2A). The 214-bp probes hybridized to the 6.4-kb and 4.0-kb mRNA, but not to the 3.7-kb mRNA (Fig. 2B, lanes c). The 214-bp probe also hybridized to an unknown mRNA of about 2.5 kb. This mRNA did not hybridize to IRP2 coding region probes a and b, indicating that it does not encode IRP2. The 2200-bp probe did not hybridize to either the 4.0-kb or the 3.7-kb mRNAs (Fig. 2B, lane d). These data indicated that the 3.7-kb and the 4.0-kb mRNAs lacked 3`-UTR sequences downstream from the AAUAAA sequence and the GATAAA sequences, respectively, suggesting that these sites might be utilized for polyadenylation.

To determine if the three mRNAs are present in rat tissues, total RNA isolated from brain, intestinal mucosa, heart, kidney, liver, and lung from rats was hybridized to a P-labeled IRP2 coding region probe (Fig. 2C). The three mRNAs are present in all tissues examined; however, the amounts of the 3.7-kb and 4.0-kb mRNAs varied among the different tissues. Intestinal mucosa, kidney, liver, and lung contain higher amounts of the 3.7-kb mRNA, whereas brain and heart contain lower amounts of this transcript.

The 3.7-kb mRNA Is Present in Human and Mouse Cells and Is Regulated in Iron-depleted Cells

Since the AAUAAA element is present in the human IRP2 3`-UTR sequence, this suggests that human cells, and perhaps other rodents, may contain multiple IRP2 mRNAs. Hybridization of a P-labeled IRP2 cDNA to total RNA from human 293 and HeLa cells and mouse 3T3 cells demonstrated that the three mRNAs were present in these cells (Fig. 4A). The presence of multiple IRP2 mRNAs in rat, mouse, and human cells and the conservation of rat and human 3`-UTR sequences, particularly the poly(A) signal sequence, suggests that the 3`-UTR may be important in regulation of these mRNAs.


Figure 4: The 3.7-kb mRNA is regulated in iron-depleted cells. A, total RNA was prepared from mouse 3T3 cells, human HeLa and 293 cells, and rat FTO2B cells and hybridized to a P-labeled IRP2 cDNA as described in Fig. 2. Note the larger size of human IRP2 mRNA corresponding to the rat 6.4-kb mRNA. Arrows indicate the three IRP2 mRNAs. B, rat FTO2B and mouse 3T3 cells were treated in the presence or absence of ferric ammonium citrate (50 µg/ml) or desferrioxamine (200 µM) for 16 h. Total RNA was prepared and hybridized with a P-labeled IRP2 probe as described in Fig. 2.



To determine if changes in intracellular iron levels affect amounts of these mRNAs, mouse 3T3 cells and rat FTO2B cells were treated in the presence or absence of ferric ammonium citrate, or desferrioxamine, an intracellular iron chelator, for 16 h (Fig. 4B). Total RNA was prepared from these cells and hybridized to a P-labeled IRP2 cDNA. The 3.7-kb mRNA increased 2-fold and 5-fold in desferrioxamine-treated FTO2B and 3T3 cells, respectively, compared to untreated cells (Fig. 4B). Densitometric scanning of the autoradiograms showed that the amount of the 3.7-kb mRNA increased with a reciprocal and an equal decrease in the amount of the 6.4-kb mRNA, suggesting that total IRP2 mRNA levels remain constant. In iron-treated FTO2B and 3T3 cells, the amount of the 6.4-kb mRNA did not change, whereas the amount of the 3.7-kb mRNA decreased slightly in FTO2B cells and was barely detectable in 3T3 cells. The 4.0-kb mRNA was unaffected by iron or desferrioxamine treatment, in both FTO2B and 3T3 cells; however, the levels of this mRNA were too low to accurately quantitate. Based on these data, we propose that the 3.7-kb mRNA is produced by alternative poly(A) site utilization in iron-depleted cells.

Expression of IRP2 in Rat Tissues

The question arises of the biological relevance of two IRPs in cells. One possibility is that the distributions of IRP1 and IRP2 may differ among tissues. To address this question, the levels of IRP1 and IRP2 in rat tissues were compared by Western blotting. Extracts from rat tissues were analyzed by electrophoresis on SDS-polyacrylamide gels and subjected to immunoblot analysis using anti-IRP1 antisera or anti-IRP2 antisera. Fig. 5shows that IRP1 and IRP2 are ubiquitously expressed in all tissues examined, but at different levels. Whereas IRP1 levels are highest in kidney and liver, IRP2 levels are highest in heart and muscle (Fig. 5). Other immunoreactive bands were observed on the IRP2 immunoblot. Previous data indicated that IRP2 is susceptible to proteolysis during purification, resulting in the appearance of an 83,000-Da protein and smaller degradation products. In contrast to IRP2, IRP1 is relatively stable. To minimize IRP2 degradation, tissues were pulverized in liquid nitrogen and immediately thereafter were boiled in SDS-sample buffer, followed by electrophoresis on SDS-polyacrylamide gels. Even with this rapid purification protocol, degradation of IRP2 is observed in some of the tissue extracts examined.


Figure 5: Differential expression of IRP1 and IRP2 in rat tissues. Rat tissues were pulverized in liquid nitrogen, and the powder was immediately boiled in SDS-loading buffer for 10 min. Equal amounts of protein (100 µg) from each tissue extract were analyzed by an 8% SDS-polyacrylamide gel and subjected to immunoblot analysis with anti-IRP1 or anti-IRP2. Brain (Br), bone marrow (BM), gut mucosa (G), heart (H), kidney (K), liver (Li), lung (Lu), muscle (M), spleen (S), and testis (T) are shown. Prestained molecular weight markers are from Amersham.



IRP2 Is Conserved in Other Species

RNA binding activity of IRP1 has been demonstrated not only in mammals, but in fish, flies, and frogs(37) . To determine if IRP2 is present in other species, protein extracts were prepared from the yeast S. cerevisiae, zebra fish muscle, Drosophila larvae, Xenopus muscle, rat FTO2B cells, mouse 3T3 cells, and human 293 cells, and the proteins were subjected to immunoblot analysis using anti-IRP2 antisera generated against the 73-amino-acid insertion. Fig. 6shows that IRP2 is present in all organisms examined, although the size of the protein varies. The apparent molecular mass of IRP2 from Drosophila is larger than that of rat, whereas IRP2 from human cells has a smaller apparent molecular mass. While yeast extracts contain a protein of about 75 kDa that reacts with the IRP2 antibody, we believe this band to be nonspecific since it also reacts with anti-IRP1 antisera (data not shown). Because the levels of IRP2 vary significantly in different tissues, it is difficult to assign significance to the levels of IRP2 in different organisms.


Figure 6: IRP2 is conserved in many diverse organisms. Cytoplasmic extracts were prepared from yeast, fly larvae, zebra fish muscle, frog muscle, mouse 3T3 cells, rat FTO2B cells, and human 293 cells. Equal amounts of protein (100 µg) were boiled in SDS-loading buffer for 10 min, and the samples were immediately analyzed by 8% SDS-PAGE and immunoblot analysis with anti-IRP2 antisera. Molecular weight standards are from Amersham.



A distinct IRP2IRE complex has not been observed in extracts from human cells and tissues. To determine if the lack of a distinct human IRP2IRE complex is due to the comigration of IRP1IRE and IRP2IRE complexes on gels, cytosolic extracts were prepared from human 293 and HeLa cells, and, as controls, mouse 3T3 and rat FTO2B cells and the extracts were incubated with P-labeled IRE in the presence or absence of anti-IRP2 antisera. The RNAprotein complexes were analyzed by native polyacrylamide gels. Mouse and rat extracts contain distinctive IRP1IRE and IRP2IRE complexes (Fig. 7, lanes 1 and 2 and 5 and 6). In contrast, human cells contain only one complex (Fig. 7, lanes 3 and 4 and 7 and 8). Addition of anti-IRP2 antisera to extracts resulted in slower migrating ``supershifted'' complexes corresponding to the IRP2IRE complexes in mouse, rat, and human cells (Fig. 7, lanes 9-12). Rabbit preimmune antisera used at the same amounts as anti-IRP2 antisera has no effect on IRPIRE complexes (Fig. 7, lanes 5-8). These data indicate that human IRP1IRE and IRP2IRP2 complexes comigrate on native polyacrylamide gels.


Figure 7: Analysis of IRP2IRE complexes in extracts from mouse, human, and rat cells. Cytoplasmic extracts from mouse 3T3 cells, rat FTO2B cells, and human 293 cells were prepared, and equal amounts of protein (10 µg) were incubated with a P-labeled IRE in the presence (lanes 9-12) or the absence (lanes 1-4) of anti-IRP2 antisera, or as a control, rabbit preimmune (PI) antisera (lanes 5-8). IRP2IRE complexes were resolved on a 5% nondenaturing polyacrylamide gel. The supershifted IRP2 (*) and free RNA are indicated.




DISCUSSION

The studies reported here describe the characterization of cDNAs for rat and human IRP2 and the presence of multiple IRP2 mRNAs regulated in iron-depleted mammalian cells. Our data indicate that, although rat IRP1 and IRP2 are 61% identical in the overall amino acid sequence, IRP2 lacks two aconitase active-site residues and contains a 73-amino-acid insertion near its amino terminus that is rich in proline, serine, and cysteine. Thus, it is not surprising that IRP2 lacks aconitase activity(27) . Whether IRP2 contains an 4Fe-4S cluster similar to the 4Fe-4S cluster in IRP1 and mitochondrial aconitase is unknown. Modeling of the 73-amino-acid insertion onto the structure of mitochondrial aconitase suggests that it is located at the beginning of a helical region and could be located on the surface of the protein. The location of the 73-amino-acid insertion on the surface of the protein is consistent with our data indicating that the 73-amino-acid insertion contains a site that is susceptible to proteolysis during purification(27) . The 73-amino-acid insertion does not appear to be directly involved in RNA binding since antibodies directed against this region do not prevent IRE binding. RNA binding activity of IRP2 is regulated by iron by a decrease in levels of IRP2 which occurs via an increase in the rate of IRP2 degradation(27, 30) . Since the 73-amino-acid insertion is unique to IRP2, it is tempting to speculate that the structural determinants responsible for iron-mediated IRP2 degradation may reside in this region.

IRP2 is encoded by two major mRNAs of 6.4 kb and 3.7 kb and a minor mRNA of 4.0 kb. The 4.0-kb mRNA is present at lower levels than that of the 3.7-kb mRNA, suggesting that polyadenylation at the weaker GATAAA poly(A) consensus sequence is not efficient. The significance of the 3.7-kb mRNA that is regulated in iron-depleted cells is not clear. We believe, however, that the 3.7-kb mRNA serves a functional role in IRP2 expression for the following reasons. First, the upstream poly(A) site implicated in mRNA processing is present not only in the 3`-UTR of rat mRNA, but also in the human mRNA. Second, the 3.7-kb mRNA is found in rodent and human cells, suggesting that the upstream poly(A) site is used for RNA processing in these cells. Third, the increase in levels of the 3.7-kb mRNA in iron-depleted cells occurs with a reciprocal decrease in the levels of the 6.4-kb mRNA. Since total IRP2 mRNA levels remain constant in iron-depleted cells, this suggests that the production of the 3.7-kb mRNA may be due to alternative utilization of the upstream poly(A) site. We cannot, however, eliminate the possibility that the 3.7-kb mRNA is stabilized and the 6.4-kb mRNA is destabilized in iron-depleted cells.

Since our data suggest that the coding potential of IRP2 is not altered in the 3.7-kb and 4.0-kb mRNAs, the question arises of the functional significance of these mRNAs. One possibility is that the 3.7-kb mRNA is translated with higher efficiency than that of the 6.4- kb mRNA. Our previous data indicated that IRP2 levels are increased in iron-depleted cells and destabilized in iron-repleted cells(27) . Thus, it is possible that the increased IRP2 levels in iron-depleted cells are due to increased processing and translation of the 3.7-kb mRNA, in addition to increased IRP2 stability. The regulation of alternative poly(A) site selection is used by viruses (38, 39) and by eukaryotic cells (40) to regulate gene expression. Recent studies have shown that levels of specific poly(A) site processing factors can stimulate or depress utilization of a specific poly(A) site(38, 39, 40) .

IRP2, like that of IRP1, is present not only in mammals, but also in fish, flies, and frogs, suggesting that the regulation of iron homeostasis may be similar in these lower eukaryotes. Our data indicate that human IRP1IRE and IRP2IRE complexes comigrate on nondenaturing polyacrylamide gels, in contrast to rodent IRP1IRE and IRP2IRE complexes which migrate as distinct complexes. The reason for the altered mobilities of human and rodent IRP1 and IRP2 complexes is unknown, but may be due to subtle charge differences in mammalian IRPs.

What may be the biological relevance of two IRPs in cells, each being regulated by iron but by different mechanisms? Although we do not know the specific function of IRP2 in cells, three possibilities can be postulated. First, IRP2 has been shown to recognize a specific subset of in vitro-synthesized IRE RNAs, suggesting a role of IRP2 in the regulation of specific IRE-containing mRNAs(28) . Second, IRP2, although ubiquitously expressed, is present at higher levels in skeletal muscle and heart than IRP1, suggesting a role of IRP2 in the regulation of muscle-specific IRE-containing mRNAs. Third, IRP2 RNA binding activity is increased in regenerating rat liver (26) and is decreased in livers from rats subjected to oxidative stress(41) . Thus, it is also possible that IRP2 is regulated by biological mediators other than iron.


FOOTNOTES

*
This research was supported by National Institutes of Health Grant GM45201 (to E. A. L.) and by National Cancer Institute Grant CA4201 (to the Protein DNA Core Facility of the Utah Cancer Center at the University of Utah). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) U20181 (rat liver iron-regulatory protein 2) and U20180 (human fetal brain iron-regulatory protein 2).

§
To whom correspondence and reprint requests should be addressed: University of Utah, Bldg. 533, Rm. 4220, HMBG, Salt Lake City, UT 84112. Tel.: 801-585-5002; Fax: 801-585-3501.

The abbreviations used are: IRP, iron regulatory protein; IRE, iron-responsive element; kb, kilobase(s); bp, base pair(s); UTR, untranslated region; PCR, polymerase chain reaction; MOPS, 4-morpholinepropanesulfonic acid.


ACKNOWLEDGEMENTS

We thank Alex Knisely and members of the laboratory for critical reading of the manuscript and for helpful discussions.


REFERENCES
  1. Leibold, E. A., and Guo, B. (1992) Annu. Rev. Nutr.12, 345-368 [CrossRef][Medline] [Order article via Infotrieve]
  2. Klausner, R. D., Rouault, T. A., and Harford, J. B. (1993) Cell72, 19-28 [CrossRef][Medline] [Order article via Infotrieve]
  3. Theil, E. C. (1993) Biofactors4, 87-93 [Medline] [Order article via Infotrieve]
  4. Leibold, E. A., and Munro, H. N. (1988) Proc. Natl. Acad. Sci. U. S. A.85, 2171-2175 [Abstract/Free Full Text]
  5. Rouault, T. A., Hentze, M. W., Caughman, S. W., Harford, J. B., and Klausner, R. D. (1988) Science241, 1207-1210 [Abstract/Free Full Text]
  6. Zheng, L., Kennedy, M. C., Blondin, G. A., Beinert, H., and Zalkin, H. (1992) Arch. Biochem. Biophys.299, 356-360 [CrossRef][Medline] [Order article via Infotrieve]
  7. Dandekar, T., Stripecke, R., Gray, N. K., Goossen, B., Constable, A., Johansson, H. E., and Hentze, M. W. (1991) EMBO10, 1903-1909 [Medline] [Order article via Infotrieve]
  8. Cox, L. A., and Adrian, G. S. (1993) Biochemistry32, 4738-4745 [CrossRef][Medline] [Order article via Infotrieve]
  9. Mullner, E. W., Neupert, B., and Kuhn, L. C. (1989) Cell58, 373-382 [CrossRef][Medline] [Order article via Infotrieve]
  10. Casey, J. L., Koeller, D. M., Ramin, V. C., Klausner, R. D., and Harford, J. B. (1989) EMBO J.8, 3693-3699 [Medline] [Order article via Infotrieve]
  11. Goossen, B., Caughman, S. W., Harford, J. B., Klausner, R. D., and Hentze, M. W. (1990) EMBO J.9, 4127-4133 [Medline] [Order article via Infotrieve]
  12. Walden, W. E., Patino, M. M., and Gaffield, L. (1989) J. Biol. Chem.264, 13765-13769 [Abstract/Free Full Text]
  13. Gray, N. K., and Hentze, M. W. (1994) EMBO J.13, 3882-3891 [Medline] [Order article via Infotrieve]
  14. Bhasker, C. R., Burgiel, G., Neupert, B., Emery-Goodman, A., Kuhn, L. C., and May, B. K. (1993) J. Biol. Chem.268, 12699-12705 [Abstract/Free Full Text]
  15. Binder, R., Horowitz, J. A., Basilion, J. P., Koeller, D. M., Klausner, R. D., and Harford, J. B. (1994) EMBO J.13, 1969-1980 [Medline] [Order article via Infotrieve]
  16. Rouault, T. A., Tang, C. K., Kaptain, S., Burgess, W. H., Haile, D. J., Samaniego, F., McBride, O. W., Harford, J. B., and Klausner, R. D. (1990) Proc. Natl. Acad. Sci. U. S. A.87, 7958-7962 [Abstract/Free Full Text]
  17. Neupert, B., Thompson, N. A., Meyer, C., and Kuhn, L. C. (1990) Nucleic Acids Res.18, 51-55 [Abstract/Free Full Text]
  18. Yu, Y., Radisky, E., and Leibold, E. A. (1992) J. Biol. Chem.267, 19005-19010 [Abstract/Free Full Text]
  19. Patino, M. M., and Walden, W. E. (1992) J. Biol. Chem.267, 19011-19016 [Abstract/Free Full Text]
  20. Rouault, T. A., Haile, D. J., Downey, W. E., Philpott, C. C., Tang, C., Samaniego, F., Chin, J., Paul, I., Orloff, D., Harford, J. B., and Klausner, R. D. (1992) BioMetals5, 131-140 [CrossRef][Medline] [Order article via Infotrieve]
  21. Rouault, T. A., Stout, C. D., Kaptain, S., Harford, J. B., and Klausner, R. D. (1991) Cell64, 881-883 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kaptain, S., Downey, W. E., Tang, C., Philpott, C., Haile, D., Orloff, D. G., Harford, J. B., Rouault, T. A., and Klausner, R. D. (1991) Proc. Natl. Acad. Sci. U. S. A.88, 10109-10113 [Abstract/Free Full Text]
  23. Haile, D. J., Rouault, T. A., Tang, C. K., Chin, J., Harford, J. B., and Klausner, R. D. (1992) Proc. Natl. Acad. Sci. U. S. A.89, 7536-7540 [Abstract/Free Full Text]
  24. Haile, D. J., Rouault, T. A., Harford, J. B., Kennedy, M. C., Blondin, G. A., Beinert, H., and Klausner, R. D. (1992) Proc. Natl. Acad. Sci. U. S. A.89, 11735-11739 [Abstract/Free Full Text]
  25. Philpott, C. C., Klausner, R. D., and Rouault, T. A. (1994) Proc. Natl. Acad. Sci. U. S. A.91, 7321-7325 [Abstract/Free Full Text]
  26. Cairo, G., and Pietrangelo, A. (1994) J. Biol. Chem.269, 6405-6409 [Abstract/Free Full Text]
  27. Guo, B., Yu, Y., and Leibold, E. A. (1994) J. Biol. Chem.269, 24252-24260 [Abstract/Free Full Text]
  28. Henderson, B. R., Seiser, C., and Kuhn, L. C. (1994) J. Biol. Chem.268, 27327-27334 [Abstract/Free Full Text]
  29. Tang, C. K., Chin, J., Harford, J. B., Klausner, R. D., and Rouault, T. A. (1992) J. Biol. Chem.267, 24466-24470 [Abstract/Free Full Text]
  30. Samaniego, F., Chin, J., Iwai, K., Rouault, T. A., and Klausner, R. D. (1994) J. Biol. Chem.269, 30904-30910 [Abstract/Free Full Text]
  31. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem.132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  32. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  33. Basilion, J. P., Rouault, T. A., Massinople, C. M., Klausner, R. D., and Burgess, W. H. (1994) Proc. Natl. Acad. Sci. U. S. A.91, 574-578 [Abstract/Free Full Text]
  34. Kennedy, M. C., Mende-Mueller, L., Blondin, G. A., and Beinert, H. (1992) Proc. Natl. Acad. Sci. U. S. A.89, 11730-11734 [Abstract/Free Full Text]
  35. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature263, 211-214 [CrossRef][Medline] [Order article via Infotrieve]
  36. Wickens, M. (1990) Trends Biochem. Sci.15, 277-281 [CrossRef][Medline] [Order article via Infotrieve]
  37. Rothenberger, S., Mullner, E. W., and Kuhn, L. C. (1990) Nucleic Acids Res.18, 1175-1179 [Abstract/Free Full Text]
  38. McLauchlan, J., Simpson, S., and Clements, J. B. (1989) Cell59, 1093-1105 [CrossRef][Medline] [Order article via Infotrieve]
  39. Mann, K. P., Weiss, E. A., and Nevins, J. R. (1993) Mol. Cell. Biol.13, 2411-2419 [Abstract/Free Full Text]
  40. Peterson, M. L. (1994) Mol. Cell. Biol.14, 7891-7898 [Abstract/Free Full Text]
  41. Cairo, G., Tacchini, L., Pogliaghi, G., Anzon, E., Tomasi, A., and Bernelli-Zazzera, A. (1994) J. Biol. Chem.270, 700-703 [Abstract/Free Full Text]
  42. Zheng, L., Andrews, P. C., Hermodson, M. A., Dixon, J. E., and Zalkin, H. (1990) J. Biol. Chem.265, 2814-2821 [Abstract/Free Full Text]
  43. Robbins, A. H., and Stout, C. D. (1989) Proteins Struct. Funct. Genet.5, 289-312 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. Song and F. S. Lee
A Role for IOP1 in Mammalian Cytosolic Iron-Sulfur Protein Biogenesis
J. Biol. Chem., April 4, 2008; 283(14): 9231 - 9238.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Wang, X. Di, R. B. D'Agostino Jr., S. V. Torti, and F. M. Torti
Excess Capacity of the Iron Regulatory Protein System
J. Biol. Chem., August 24, 2007; 282(34): 24650 - 24659.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Biederbick, O. Stehling, R. Rosser, B. Niggemeyer, Y. Nakai, H.-P. Elsasser, and R. Lill
Role of Human Mitochondrial Nfs1 in Cytosolic Iron-Sulfur Protein Biogenesis and Iron Regulation
Mol. Cell. Biol., August 1, 2006; 26(15): 5675 - 5687.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Alberghini, S. Recalcati, L. Tacchini, P. Santambrogio, A. Campanella, and G. Cairo
Loss of the von Hippel Lindau Tumor Suppressor Disrupts Iron Homeostasis in Renal Carcinoma Cells
J. Biol. Chem., August 26, 2005; 280(34): 30120 - 30128.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
X. Xu, H. L. Persson, and D. R. Richardson
Molecular Pharmacology of the Interaction of Anthracyclines with Iron
Mol. Pharmacol., August 1, 2005; 68(2): 261 - 271.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. J. Mayo, P. Kohlhepp, D. Zhang, and J. J. Winzerling
Effects of sham air and cigarette smoke on A549 lung cells: implications for iron-mediated oxidative damage
Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L866 - L876.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. D. Schneider and E. A. Leibold
Effects of iron regulatory protein regulation on iron homeostasis during hypoxia
Blood, November 1, 2003; 102(9): 3404 - 3411.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
R.L. Upton, Y. Chen, S. Mumby, J.M.C. Gutteridge, P.B. Anning, A.G. Nicholson, T.W. Evans, and G.J. Quinlan
Variable tissue expression of transferrin receptors: relevance to acute respiratory distress syndrome
Eur. Respir. J., August 1, 2003; 22(2): 335 - 341.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Erlitzki, J. C. Long, and E. C. Theil
Multiple, Conserved Iron-responsive Elements in the 3'-Untranslated Region of Transferrin Receptor mRNA Enhance Binding of Iron Regulatory Protein 2
J. Biol. Chem., November 1, 2002; 277(45): 42579 - 42587.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. C. Kwok and D. R. Richardson
Unexpected Anthracycline-Mediated Alterations in Iron-Regulatory Protein-RNA-Binding Activity: The Iron and Copper Complexes of Anthracyclines Decrease RNA-Binding Activity
Mol. Pharmacol., October 1, 2002; 62(4): 888 - 900.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Rutherford, S. Jaron, E. Ray, P. O. Brown, and D. R. Winge
A second iron-regulatory system in yeast independent of Aft1p
PNAS, December 4, 2001; 98(25): 14322 - 14327.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K.-Y. Yeh, M. Yeh, and J. Glass
Glucocorticoids and dietary iron regulate postnatal intestinal heavy and light ferritin expression in rats
Am J Physiol Gastrointest Liver Physiol, February 1, 2000; 278(2): G217 - G226.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kim and P. Ponka
Control of Transferrin Receptor Expression via Nitric Oxide-mediated Modulation of Iron-regulatory Protein 2
J. Biol. Chem., November 12, 1999; 274(46): 33035 - 33042.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Qi, I. Hamza, and M. R. O'Brian
Heme is an effector molecule for iron-dependent degradation of the bacterial iron response regulator (Irr) protein
PNAS, November 9, 1999; 96(23): 13056 - 13061.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Pourzand, R. D. Watkin, J. E. Brown, and R. M. Tyrrell
Ultraviolet A radiation induces immediate release of iron in human primary skin fibroblasts: The role of ferritin
PNAS, June 8, 1999; 96(12): 6751 - 6756.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Gegout, J. Schlegl, B. Schlager, M. W. Hentze, J. Reinbolt, B. Ehresmann, C. Ehresmann, and P. Romby
Ligand-induced Structural Alterations in Human Iron Regulatory Protein-1 Revealed by Protein Footprinting
J. Biol. Chem., May 21, 1999; 274(21): 15052 - 15058.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. S. Hanson, L. M. Foot, and E. A. Leibold
Hypoxia Post-translationally Activates Iron-regulatory Protein 2
J. Biol. Chem., February 19, 1999; 274(8): 5047 - 5052.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Toth, L. Yuan, J. T. Rogers, H. Boyce, and K. R. Bridges
Hypoxia Alters Iron-regulatory Protein-1 Binding Capacity and Modulates Cellular Iron Homeostasis in Human Hepatoma and Erythroleukemia Cells
J. Biol. Chem., February 12, 1999; 274(7): 4467 - 4473.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
K. Wu, A. Polack, and R. Dalla-Favera
Coordinated Regulation of Iron-Controlling Genes, H-Ferritin and IRP2, by c-MYC
Science, January 29, 1999; 283(5402): 676 - 679.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
L. Oliveira, C. Bouton, and J.-C. Drapier
Thioredoxin Activation of Iron Regulatory Proteins. REDOX REGULATION OF RNA BINDING AFTER EXPOSURE TO NITRIC OXIDE
J. Biol. Chem., January 1, 1999; 274(1): 516 - 521.
[Abstract] [Full Text] [PDF]