![]()
|
|
||||||||
From the
Iron regulatory proteins (IRP1 and IRP2) are RNA-binding
proteins that bind to stem-loop structures, termed iron-responsive
elements (IREs), present in either the 5`- or 3`-untranslated regions
of specific mRNAs. The binding of IRPs to 5`-IREs inhibits translation
of mRNA, whereas the binding of IRPs to 3`-IREs stabilizes mRNA. To
study the structure and regulation of IRP2, we isolated cDNAs for rat
and human IRP2. The derived amino acid sequence of rat IPR2 is 93%
identical with that of human IRP2 and is present in lower eukaryotes,
indicating that IRP2 is highly conserved. IRP1 and IRP2 share 61%
overall amino acid identity. IRP2 is ubiquitously expressed in rat
tissues, the highest amounts present in skeletal muscle and heart. IRP2
is encoded by multiple mRNAs of 6.4, 4.0, and 3.7 kilobases. The
3`-untranslated region of rat IRP2 contains multiple polyadenylation
signals, two of which could account for the 4.0-kb and 3.7-kb mRNAs.
The 3.7-kb mRNA is increased in iron-depleted cells and occurs with a
reciprocal decrease in the 6.4-kb transcript. These data suggest that
the 3.7-kb mRNA is produced by alternative poly(A) site utilization in
iron-depleted cells.
Iron-regulatory proteins (IRP1 and IRP2)
IRP1 and IRP2 have been purified and cloned from mammalian cells
(16-20). IRP1 has a molecular mass of 98,000 Da and exhibits
homology with the 4Fe-4S enzyme mitochondrial aconitase(21) .
Like mitochondrial aconitase, IRP1 contains an 4Fe-4S cluster and is an
active aconitase (22, 23). IRP1 isolated from iron-repleted cells
contains an 4Fe-4S cluster and is an active aconitase, but binds IREs
with low affinity (24). In contrast, IRP1 isolated from iron-depleted
cells lacks an 4Fe-4S cluster and aconitase activity, but binds IREs
with high affinity. Thus, IRP1 functions as either an RNA-binding
protein or cytosolic aconitase, depending on levels of intracellular
iron. The function of aconitase activity in IRP1 is unclear; however,
recent data indicated that aconitase activity is not required for the
iron-dependent regulation of IRE binding(25) .
IRP2 was
identified by RNA-band shift analysis in extracts from rat tissue and
cultured cells (4) and in regenerating rat liver(26) .
IRP2 has been purified from rat liver and has a molecular mass
estimated as 104,000 Da(27) . The partial amino acid sequences
of a peptide derived from rat liver IRP2 was similar to the deduced
sequence of an IRP2-like cDNA isolated from a human T cell
library(16, 20) . Mouse tissues and cells have been
shown by RNA-band shift analysis to contain a second IRP termed
IRF
Although RNA binding activities of IRP1 and IRP2
decrease in iron-treated cells, the mechanisms that regulate their RNA
binding activities differ. The decrease in IRP1 RNA binding activity is
due to the switch to an 4Fe-4S form and occurs without changes in IRP1
levels (18, 29). In contrast, IRP2 RNA binding activity decreases via
reduction in IRP2 levels(27, 30) . Furthermore, unlike
IRP1, IRP2 lacks aconitase activity(27) .
The presence of two
IRPs in cells that are regulated by iron by different mechanisms raises
questions of the function and necessity of two IRPs. To begin to answer
these questions, we report the isolation and sequence of cDNAs for rat
liver and human fetal brain IRP2. We also provide an analysis of the
expression of IRP2 in rat tissues and demonstrate that IRP2 is also
present in lower eukaryotes, indicating that IRP2 is highly conserved.
Finally, we demonstrate the presence of multiple IRP2 mRNA transcripts
in rat, mouse, and human cells that may be regulated by alternative
polyadenylation in iron-depleted cells.
A human IRP2 cDNA was isolated from a human fetal brain
library (Stratagene) using probes 1 and 3. Approximately 6.0
Protein extracts were prepared from the
following tissues and organisms: skeletal muscle of zebra fish (a gift
from Dr. D. Grunwald), skeletal muscle of Xenopus laevis (a
gift from Dr. B. Bass), and whole Drosophila melanogaster third instar larvae (a gift from Dr. A. Letsou) all at the
University of Utah. All tissues and larvae were quick-frozen in liquid
nitrogen and processed as described for the rat tissues. Equal amounts
of protein were electrophoretically separated on an 8%
SDS-polyacrylamide gel, and the protein was transferred onto
nitrocellulose membranes. IRP1 and IRP2 were detected by incubation of
the membranes with chicken polyclonal antibodies directed against the
coding region of rat IRP1 or rabbit polyclonal antibodies directed
against the 73-amino-acid insertion of rat IRP2 (27). After the primary
antibody incubations, the membranes were incubated with horseradish
peroxidase-conjugated goat anti-chicken or goat anti-rabbit antibodies,
using the Enhanced Chemiluminescent (ECL) Western blotting detection
system (Amersham). Four separate immunoblotting experiments were
performed and one representative blot is shown.
RNA-band shift
assays and electrophoresis of the RNA
Rat liver IRP1 and IRP2 are conserved proteins sharing 61%
amino acid identity and 79% amino acid similarity. A notable difference
between IRP1 and IRP2 is the insertion into IRP2 of a 73-amino-acid
domain located 139 amino acids downstream from the putative
translational initiation codon (Fig. 1). This sequence is rich in
cysteines, serines, and prolines and also contains a site located
between amino acids Ser
To determine if the
three mRNAs are present in rat tissues, total RNA isolated from brain,
intestinal mucosa, heart, kidney, liver, and lung from rats was
hybridized to a
The studies reported here describe the characterization of
cDNAs for rat and human IRP2 and the presence of multiple IRP2 mRNAs
regulated in iron-depleted mammalian cells. Our data indicate that,
although rat IRP1 and IRP2 are 61% identical in the overall amino acid
sequence, IRP2 lacks two aconitase active-site residues and contains a
73-amino-acid insertion near its amino terminus that is rich in
proline, serine, and cysteine. Thus, it is not surprising that IRP2
lacks aconitase activity(27) . Whether IRP2 contains an 4Fe-4S
cluster similar to the 4Fe-4S cluster in IRP1 and mitochondrial
aconitase is unknown. Modeling of the 73-amino-acid insertion onto the
structure of mitochondrial aconitase suggests that it is located at the
beginning of a helical region and could be located on the surface of
the protein. The location of the 73-amino-acid insertion on the surface
of the protein is consistent with our data indicating that the
73-amino-acid insertion contains a site that is susceptible to
proteolysis during purification(27) . The 73-amino-acid
insertion does not appear to be directly involved in RNA binding since
antibodies directed against this region do not prevent IRE binding. RNA
binding activity of IRP2 is regulated by iron by a decrease in levels
of IRP2 which occurs via an increase in the rate of IRP2
degradation(27, 30) . Since the 73-amino-acid insertion
is unique to IRP2, it is tempting to speculate that the structural
determinants responsible for iron-mediated IRP2 degradation may reside
in this region.
IRP2 is encoded by two major mRNAs of 6.4 kb and 3.7
kb and a minor mRNA of 4.0 kb. The 4.0-kb mRNA is present at lower
levels than that of the 3.7-kb mRNA, suggesting that polyadenylation at
the weaker GATAAA poly(A) consensus sequence is not efficient. The
significance of the 3.7-kb mRNA that is regulated in iron-depleted
cells is not clear. We believe, however, that the 3.7-kb mRNA serves a
functional role in IRP2 expression for the following reasons. First,
the upstream poly(A) site implicated in mRNA processing is present not
only in the 3`-UTR of rat mRNA, but also in the human mRNA. Second, the
3.7-kb mRNA is found in rodent and human cells, suggesting that the
upstream poly(A) site is used for RNA processing in these cells. Third,
the increase in levels of the 3.7-kb mRNA in iron-depleted cells occurs
with a reciprocal decrease in the levels of the 6.4-kb mRNA. Since
total IRP2 mRNA levels remain constant in iron-depleted cells, this
suggests that the production of the 3.7-kb mRNA may be due to
alternative utilization of the upstream poly(A) site. We cannot,
however, eliminate the possibility that the 3.7-kb mRNA is stabilized
and the 6.4-kb mRNA is destabilized in iron-depleted cells.
Since
our data suggest that the coding potential of IRP2 is not altered in
the 3.7-kb and 4.0-kb mRNAs, the question arises of the functional
significance of these mRNAs. One possibility is that the 3.7-kb mRNA is
translated with higher efficiency than that of the 6.4- kb mRNA. Our
previous data indicated that IRP2 levels are increased in iron-depleted
cells and destabilized in iron-repleted cells(27) . Thus, it is
possible that the increased IRP2 levels in iron-depleted cells are due
to increased processing and translation of the 3.7-kb mRNA, in addition
to increased IRP2 stability. The regulation of alternative poly(A) site
selection is used by viruses (38, 39) and by eukaryotic
cells (40) to regulate gene expression. Recent studies have
shown that levels of specific poly(A) site processing factors can
stimulate or depress utilization of a specific poly(A)
site(38, 39, 40) .
IRP2, like that of IRP1,
is present not only in mammals, but also in fish, flies, and frogs,
suggesting that the regulation of iron homeostasis may be similar in
these lower eukaryotes. Our data indicate that human IRP1
What may be the
biological relevance of two IRPs in cells, each being regulated by iron
but by different mechanisms? Although we do not know the specific
function of IRP2 in cells, three possibilities can be postulated.
First, IRP2 has been shown to recognize a specific subset of in
vitro-synthesized IRE RNAs, suggesting a role of IRP2 in the
regulation of specific IRE-containing mRNAs(28) . Second, IRP2,
although ubiquitously expressed, is present at higher levels in
skeletal muscle and heart than IRP1, suggesting a role of IRP2 in the
regulation of muscle-specific IRE-containing mRNAs. Third, IRP2 RNA
binding activity is increased in regenerating rat liver (26) and
is decreased in livers from rats subjected to oxidative
stress(41) . Thus, it is also possible that IRP2 is regulated by
biological mediators other than iron.
The
nucleotide sequence(s) reported in this paper has been submitted to the
GenBank
We thank Alex Knisely and members of the laboratory
for critical reading of the manuscript and for helpful discussions.
Volume 270,
Number 28,
Issue of July 14, pp. 16529-16535, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
PRESENCE OF MULTIPLE IRP2 TRANSCRIPTS REGULATED BY INTRACELLULAR
IRON LEVELS (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(
)are cytosolic RNA-binding proteins that regulate the
post-transcriptional expression of mRNAs encoding proteins involved in
iron homeostasis and utilization(1, 2, 3) . IRP1
was previously known as the iron-responsive element binding protein,
iron-regulatory factor, and the ferritin repressor protein. IRPs bind
to stem-loop structures, known as iron-responsive elements (IREs),
located in the 5`-untranslated regions (UTRs) of mRNAs encoding
ferritin(4, 5) , mitochondrial aconitase(6) , and
erythroid aminolevulinic acid synthase(7, 8) . Five IREs
are also located in the 3`-UTR of the mRNA encoding the transferrin
receptor(9, 10) . Binding of IRP to IREs in the 5`-UTR
of ferritin (11, 12, 13) and erythroid
aminolevulinic acid synthase mRNAs (13, 14) results in
inhibition of translation, whereas binding of IRP to IREs in the 3`-UTR
of the transferrin receptor mRNA results in stabilization of the
mRNA(10, 15) . Intracellular iron levels modulate the
affinity of the IRP for the IRE: IRPs bind with high affinity to IREs
in iron-depleted cells and with low affinity in iron-repleted cells.
(28) . UV-cross-linking experiments indicated
that mouse IRF
has a molecular mass of 105,000 Da which is
similar to the mass of rat IRP2, suggesting that these proteins are
homologous.
Cell Culture
Rat hepatoma cells (FTO2B), mouse
fibroblasts (NIH 3T3), and human primary transformed embryonal kidney
cells (293) and HeLa cells were grown at 37 °C in
Dulbecco's modified Eagle's medium supplemented with 10%
heat-inactivated fetal bovine serum.
cDNA Library Screening and DNA Sequencing
cDNA
clones corresponding to the rat and human IRP2s were isolated from rat
liver and human fetal brain libraries, respectively. For the isolation
of the rat IRP2 cDNA, two rat liver libraries were screened. A
Stratagene rat liver library was sequentially screened with two
random-primed (31) P-labeled DNA fragments
generated by reverse transcriptase-PCR that corresponded to the 225-bp
73-amino-acid insertion (probe 1) and to the last 500 bp of the coding
region (probe 3) of the human T cell 10.1 cDNA (16) (see Reverse Transcriptase-PCR below). Approximately 2
10
recombinants were screened, and 3 recombinants were
isolated and sequenced using Sequenase (United States Biochemical
Corp.). Sequence analysis of the longest clone, pSL800, showed that it
contained a putative initiation codon followed by an 876-bp open
reading frame and 6 bp of the 5`-UTR sequence. No recombinants were
isolated that correspond to the COOH-end or the 3`-UTR of IRP2. To
obtain IRP2 cDNAs containing the 3` sequence, a rat liver cDNA library
provided by Dr. Jonathan Gitlin (Washington University School of
Medicine) was screened with probe 3. Approximately 2 10
plaques were screened, and 4 recombinants of varying lengths were
isolated and partially sequenced. The longest cDNA, pUZB2-1, contained
1017 bp of coding region and 2850 bp of 3`-UTR. Since cDNAs
corresponding to nucleotides 877 to 1875 were not found in either of
the two libraries, reverse transcriptase-PCR using oligonucleotide
primers from the 3` end of pSL800 and the 5` end of pUZB2-1 was
used to amplify the corresponding region from rat liver mRNA (see Reverse Transcriptase-PCR). The reverse transcriptase-PCR
product was cloned into PCR-Script SK(+) (Stratagene) and
sequenced.
10
recombinants were screened, and 8 recombinants were
isolated. Two cDNAs were mapped, and their coding regions were
sequenced. pSLFB4a was 3.0 kb in length. It included nucleotides 175 to
2889 based on the rat sequence and 386 bp of the 3`-UTR sequence.
pSLFB15c was 3.0 kb in length and included 2859 bp of coding sequence.
Reverse Transcriptase-PCR
To isolate cDNA clones
for the rat and human IRP2, IRP2 probes were generated by amplifying
IRP2 sequences from rat liver mRNA with primers from the human 10.1
sequence (16). These PCR probes were then used to screen the rat liver
and human fetal brain cDNA libraries. We have previously shown that the
amino acid sequence of a peptide derived from rat IRP2 is similar to
sequences in the human 10.1 cDNA, suggesting that these are homologous
proteins(27) . Primers corresponding to sequences in the human
10.1 sequence (16) were generated and used for reverse
transcriptase-PCR. The sequences of these primers and their
corresponding locations in the rat IRP2 sequence are: probe 1,
nucleotides 418 to 435, ATACAGAATGCACCAAAT, and nucleotides
631-648, GTGCCTGAACCTGAAACA, and probe 3, nucleotides
2389-2408, GGCACTTTTGC-AAATATCAA, and nucleotides
2872-2892, GTGGCACGAAAATTCTCATAG. RNA was prepared from FT02B rat
hepatoma cells using TRIzol (Life Technologies, Inc.) as recommended.
First strand cDNA synthesis was carried out with 1 µg of total RNA
in a reaction volume of 20 µl with either oligo(dT) or random hexamers by using SuperScript reverse transcriptase
(Life Technologies, Inc.) as recommended by the manufacturer. The PCR
reaction contained 20 mM Tris-HCl, pH 8.4, 2 mM MgCl
, 0.1 mM dNTP, 50 pmol of each primer,
1/100 of cDNA synthesized, and 5 units of Taq DNA polymerase.
30 cycles were carried out at an annealing temperature of 56 °C.
The PCR products were separated in a 2% agarose gel, and the
appropriate size gel fragments were excised and eluted from the gel and
used as probes. Reverse transcriptase-PCR product corresponding to
877-1875 was synthesized using primers corresponding to nucleotides
855-869, TATAACCATGGTGAATGGATT, and 1953-1973,
TACTGACTCTACAGGCAAGAA. The PCR product was cloned into pCR-Script
SK(+) plasmid (Stratagene) and sequenced.
Immunoblotting and RNA-Band Shift Assays
Tissues
from Sprague-Dawley male rats were isolated and were pulverized in
liquid nitrogen. After the powder was added to SDS buffer (1% SDS, 50
mM Tris-HCl, pH 6.8) and boiled for 10 min, 0.25% bromphenol
blue and 2%
-mercaptoethanol were added. The concentration of
protein in the extracts was determined by the bicinchoninic acid
protein assay (Pierce).
protein complexes were
performed as described previously(4) . In some experiments,
rabbit anti-IRP2 antisera or rabbit preimmune serum was preincubated
for 10 min with extracts prior to the addition of
P-labeled IRE. RNA-band shift assays were performed four
times and one representative experiment is shown.
Northern Blots
Total RNA was isolated from the
tissues of male Sprague-Dawley rats using guanidium thiocyanate (32) or from 293 cells, HeLa cells, mouse 3T3 cells, and rat
FTO2B cells using TRIzol (Life Technologies, Inc.). Total RNA (10
µg) was electrophoresed on 1% formaldehyde-agarose gels in MOPS
buffer (pH 7.0). The RNA was transferred to a nylon membrane and
hybridized with random-primed P-labeled rat IRP2 DNA
probes corresponding to the 73-amino-acid insertion (225 bp), to the
entire coding region (2889 bp), and to two 3`-UTR fragments (214 bp)
and (2200 bp) located downstream from the alternative polyadenylation
consensus signals. Hybridization was carried out using Rapid-hyb buffer
(Amersham) for 1 h at 65 °C according to the manufacturer, and the
membranes were washed at 2
SSC (20
SSC = 3 M NaCl
, 0.3 M sodium acetate) at 25
°C for 15 min followed by a wash at 1 SSC at 65 °C for
10 min. Northern blotting experiments were performed at least 3-5
times and one representative blot from each experiment is shown.
Isolation of Rat and Human IRP2 cDNAs
To study
the expression and regulation of IRP2, we cloned and sequenced IRP2
cDNAs from rat liver and human fetal brain libraries (see
``Materials and Methods''). The rat IRP2 cDNA was 5.7 kb in
length and contained an open reading frame of 2889 bp and 5`- and
3`-UTRs of 6 bp and 2.9 kb, respectively. The human IRP2 contained an
open reading frame of 2714 bp and a 3`-UTR of 386 bp. Comparison of the
predicted amino acid sequences of the rat IRP2 cDNA with those of a
human T cell IRP2 cDNA or the human fetal brain cDNA showed that they
share 93% identity and 97% similarity. Human and rat IRP2 sequences are
contiguous along their lengths except for a deletion and an insertion
of glycine residues at position 32 and between positions 426-427 in the
human fetal brain IRP2 cDNA (data not shown). Since the amino-terminal
sequences of the human and rat IRP2s have not been determined, their
translation initiation codons have been tentatively assigned. We
believe that the ATG assignment in the rat and human cDNAs may
represent full-length or close to full-length coding regions since rat
IRP2 expressed in yeast migrates on SDS-polyacrylamide gels with
mobility similar to that of the endogenous rat liver IRP2 (data not
shown).
and Gln
that is
susceptible to proteolysis during purification(27) . Cleavage at
this site results in the appearance of an 83,000-Da fragment. Finally,
a serine located at residue 130 in IRP1, which has been shown to
cross-link to IRE RNA(33) , is also conserved in IRP2,
suggesting that RNA binding sites may be conserved between these
proteins.
Figure 1:
Comparison of the amino acid sequences
of rat liver IRP1 and IRP2 with those of pig mitochondrial aconitase.
The deduced amino acid sequences of rat IRP1 (26) and IRP2 and of
porcine mitochondrial aconitase (42) are compared and are displayed
with gaps allowing optimized alignment. Identical residues are
indicated by the horizontal lines. The 73-amino-acid insertion
in IRP2 is boxed. The black bars above and below the
sequences indicate active-site residues in mitochondrial aconitase
(43), and the asterisks above and below Arg and
Ser
indicate aconitase active-site residues that are
changed in IRP2.
Like IRP1, IRP2 shares about 26% amino acid identity and
51% amino acid similarity with mitochondrial aconitase (Fig. 1).
IRP1 contains a 4Fe-4S cluster similar to the cluster in mitochondrial
aconitase (34) and is an active aconitase(24) . All 18
active-site residues in mitochondrial aconitase, including the 3
cysteines that are ligands for the 4Fe-4S cluster, are conserved in
IRP1(21) . Inspection of IRP2 sequences from rat liver and human
fetal brain shows that, although they contain these 3 cysteines and 16
of the 18 active-site residues, 2 residues essential for enzymatic
activity, Arg and Ser
in mitochondrial
aconitase, are substituted with Lys
and Asn
in rat IRP2. Thus, not surprisingly, IRP2 does not exhibit
aconitase activity(27) . Whether IRP2 contains a 4Fe-4S cluster
similar to those of mitochondrial aconitase and IRP1 is not known.
Expression of Multiple IRP2 mRNAs in Rat Hepatoma Cells
and Rat Tissues
Rat hepatoma FTO2B cells contained three mRNAs
that hybridized with the IRP2 cDNA: two major mRNAs of 6.4 kb and 3.7
kb and one minor mRNA of 4.0 kb (Fig. 2B, lanes a and b). The sizes of the three mRNAs are sufficient to
encode an IRP2 whose relative molecular mass is 104,000 Da(27) .
The rat liver IRP2 cDNA is estimated to be at least 5.7 kb, and,
therefore, we believe that it corresponds to the 6.4-kb mRNA. These
mRNAs encode IRP2, and not IRP1, since a probe corresponding to the 73
amino acid insertion in IRP2 hybridized to all three mRNAs (Fig. 2B, lane b). Also, probes representing
various regions of the IRP2 coding region hybridized to all three
mRNAs, indicating that the 4.0-kb and 3.7-kb mRNAs did not contain
major coding region deletions (data not shown). Finally, Southern
blotting analysis suggested that IRP2 is encoded by a single gene (data
not shown). These data suggested that the differences in length of the
IRP2 mRNAs might be due to the lack of either 5`- or 3`-UTR sequences.
Figure 2:
The presence of multiple IRP2 mRNAs in rat
hepatoma cells. A, a map of the rat liver IRP2 cDNA is shown
including the coding region (black box), the 73-amino-acid
insertion (white box), and the 3`-UTR (single black
line). The dotted lines indicate that the cDNA is not
complete and is missing sequences at the 5`- and 3`-UTR. The initiation
codon (ATG) and the termination codon (TAG) are indicated. The KpnI (K) and EcoRI (E) sites are
indicated. The fragments used as probes and their sizes are located
beneath the map and are labeled a, b, c, and d. Large and small arrows indicated strong
and weak poly(A) consensus signals, respectively. B, total RNA
was prepared from rat FTO2B cells and fractionated on a 1%
formaldehyde-agarose gel. The RNA was hybridized with P-labeled IRP2 probes corresponding to the coding region (a), to the 225-bp 73-amino acid insertion (b), to a
214-bp 3`-UTR fragment (c), or to a 2200-bp 3`-UTR fragment (d). The sizes of the IRP2 mRNAs and a nonspecific mRNA (ns) are indicated. RNA molecular weight standards are from
Life Technologies, Inc. C, total RNA was prepared from rat
tissues and hybridized to a
P-labeled IRP2 cDNA as
described in B.
We isolated an IRP2 cDNA that contained 2.9 kb of 3`-UTR sequence
and sequenced the first 800 bp after the termination codon. Inspection
of this sequence revealed the presence of two alternative poly(A)
signal sequences (Fig. 3). One sequence, AATAAA, is located at
nucleotide 3169 and is a perfect match with the consensus sequence
(35). This sequence is also present in the human T cell IRP2 cDNA (Fig. 3). Two GU- or U-rich elements that are commonly found
downstream of the AAUAAA element (36) are present at nucleotides
3227 and 3261 in the rat sequence and at nucleotides 3215 and 3251 in
the human sequence (Fig. 3). A minor poly(A) signal sequence,
GATAAA, is located at nucleotide 3512 in the rat sequence. Thus, the
possibility existed that the 4.0-kb and 3.7-kb mRNAs might have been
generated by polyadenylation at these upstream sites.
Figure 3:
Comparison of the sequences of the
3`-untranslated regions of rat and human IRP2. The rat sequence
(2890-3759) is located on the top line, and the human
sequence (16) (2842-3402) is located beneath. The numbering
begins with the first nucleotide in the rat and human sequences, and
the figure shows the sequences starting at the termination codon (TAG).
The two alternative polyadenylation consensus signals are boxed, and the two KpnI sites in the rat sequence are underlined.
If the 4.0-kb
and 3.7-kb mRNAs are generated by alternative polyadenylation site
utilization, these mRNAs should not contain 3`-UTR sequences downstream
from the poly(A) signal sequences. Two 3`-UTR probes were prepared that
corresponded to a KpnI fragment of 214 bp and a KpnI/EcoRI fragment of 2200 bp (Fig. 2A). The conserved poly(A) consensus sequence is
located 5` to the 214-bp KpnI and the 2200-bp KpnI/EcoRI fragments, and the minor poly(A) consensus
sequence is located 5` to the 2200-bp fragment (Fig. 2A). The 214-bp probes hybridized to the 6.4-kb
and 4.0-kb mRNA, but not to the 3.7-kb mRNA (Fig. 2B, lanes c). The 214-bp probe also hybridized to an unknown mRNA
of about 2.5 kb. This mRNA did not hybridize to IRP2 coding region
probes a and b, indicating that it does not encode IRP2. The 2200-bp
probe did not hybridize to either the 4.0-kb or the 3.7-kb mRNAs (Fig.
2B, lane d). These data indicated that the 3.7-kb and
the 4.0-kb mRNAs lacked 3`-UTR sequences downstream from the AAUAAA
sequence and the GATAAA sequences, respectively, suggesting that these
sites might be utilized for polyadenylation.
P-labeled IRP2 coding region probe (Fig. 2C). The three mRNAs are present in all tissues
examined; however, the amounts of the 3.7-kb and 4.0-kb mRNAs varied
among the different tissues. Intestinal mucosa, kidney, liver, and lung
contain higher amounts of the 3.7-kb mRNA, whereas brain and heart
contain lower amounts of this transcript.
The 3.7-kb mRNA Is Present in Human and Mouse Cells and
Is Regulated in Iron-depleted Cells
Since the AAUAAA element is
present in the human IRP2 3`-UTR sequence, this suggests that human
cells, and perhaps other rodents, may contain multiple IRP2 mRNAs.
Hybridization of a P-labeled IRP2 cDNA to total RNA from
human 293 and HeLa cells and mouse 3T3 cells demonstrated that the
three mRNAs were present in these cells (Fig. 4A). The
presence of multiple IRP2 mRNAs in rat, mouse, and human cells and the
conservation of rat and human 3`-UTR sequences, particularly the
poly(A) signal sequence, suggests that the 3`-UTR may be important in
regulation of these mRNAs.
Figure 4:
The 3.7-kb mRNA is regulated in
iron-depleted cells. A, total RNA was prepared from mouse 3T3
cells, human HeLa and 293 cells, and rat FTO2B cells and hybridized to
a P-labeled IRP2 cDNA as described in Fig. 2. Note the
larger size of human IRP2 mRNA corresponding to the rat 6.4-kb mRNA. Arrows indicate the three IRP2 mRNAs. B, rat FTO2B
and mouse 3T3 cells were treated in the presence or absence of ferric
ammonium citrate (50 µg/ml) or desferrioxamine (200
µM) for 16 h. Total RNA was prepared and hybridized with a
P-labeled IRP2 probe as described in Fig.
2.
To determine if changes in intracellular
iron levels affect amounts of these mRNAs, mouse 3T3 cells and rat
FTO2B cells were treated in the presence or absence of ferric ammonium
citrate, or desferrioxamine, an intracellular iron chelator, for 16 h (Fig. 4B). Total RNA was prepared from these cells and
hybridized to a P-labeled IRP2 cDNA. The 3.7-kb mRNA
increased 2-fold and 5-fold in desferrioxamine-treated FTO2B and 3T3
cells, respectively, compared to untreated cells (Fig. 4B). Densitometric scanning of the autoradiograms
showed that the amount of the 3.7-kb mRNA increased with a reciprocal
and an equal decrease in the amount of the 6.4-kb mRNA, suggesting that
total IRP2 mRNA levels remain constant. In iron-treated FTO2B and 3T3
cells, the amount of the 6.4-kb mRNA did not change, whereas the amount
of the 3.7-kb mRNA decreased slightly in FTO2B cells and was barely
detectable in 3T3 cells. The 4.0-kb mRNA was unaffected by iron or
desferrioxamine treatment, in both FTO2B and 3T3 cells; however, the
levels of this mRNA were too low to accurately quantitate. Based on
these data, we propose that the 3.7-kb mRNA is produced by alternative
poly(A) site utilization in iron-depleted cells.
Expression of IRP2 in Rat Tissues
The question
arises of the biological relevance of two IRPs in cells. One
possibility is that the distributions of IRP1 and IRP2 may differ among
tissues. To address this question, the levels of IRP1 and IRP2 in rat
tissues were compared by Western blotting. Extracts from rat tissues
were analyzed by electrophoresis on SDS-polyacrylamide gels and
subjected to immunoblot analysis using anti-IRP1 antisera or anti-IRP2
antisera. Fig. 5shows that IRP1 and IRP2 are ubiquitously
expressed in all tissues examined, but at different levels. Whereas
IRP1 levels are highest in kidney and liver, IRP2 levels are highest in
heart and muscle (Fig. 5). Other immunoreactive bands were
observed on the IRP2 immunoblot. Previous data indicated that IRP2 is
susceptible to proteolysis during purification, resulting in the
appearance of an 83,000-Da protein and smaller degradation products. In
contrast to IRP2, IRP1 is relatively stable. To minimize IRP2
degradation, tissues were pulverized in liquid nitrogen and immediately
thereafter were boiled in SDS-sample buffer, followed by
electrophoresis on SDS-polyacrylamide gels. Even with this rapid
purification protocol, degradation of IRP2 is observed in some of the
tissue extracts examined.
Figure 5:
Differential expression of IRP1 and IRP2
in rat tissues. Rat tissues were pulverized in liquid nitrogen, and the
powder was immediately boiled in SDS-loading buffer for 10 min. Equal
amounts of protein (100 µg) from each tissue extract were analyzed
by an 8% SDS-polyacrylamide gel and subjected to immunoblot analysis
with anti-IRP1 or anti-IRP2. Brain (Br), bone marrow (BM), gut mucosa (G), heart (H), kidney (K), liver (Li), lung (Lu), muscle (M), spleen (S), and testis (T) are shown.
Prestained molecular weight markers are from
Amersham.
IRP2 Is Conserved in Other Species
RNA binding
activity of IRP1 has been demonstrated not only in mammals, but in
fish, flies, and frogs(37) . To determine if IRP2 is present in
other species, protein extracts were prepared from the yeast S.
cerevisiae, zebra fish muscle, Drosophila larvae, Xenopus muscle, rat FTO2B cells, mouse 3T3 cells, and human
293 cells, and the proteins were subjected to immunoblot analysis using
anti-IRP2 antisera generated against the 73-amino-acid insertion. Fig. 6shows that IRP2 is present in all organisms examined,
although the size of the protein varies. The apparent molecular mass of
IRP2 from Drosophila is larger than that of rat, whereas IRP2
from human cells has a smaller apparent molecular mass. While yeast
extracts contain a protein of about 75 kDa that reacts with the IRP2
antibody, we believe this band to be nonspecific since it also reacts
with anti-IRP1 antisera (data not shown). Because the levels of IRP2
vary significantly in different tissues, it is difficult to assign
significance to the levels of IRP2 in different organisms.
Figure 6:
IRP2
is conserved in many diverse organisms. Cytoplasmic extracts were
prepared from yeast, fly larvae, zebra fish muscle, frog muscle, mouse
3T3 cells, rat FTO2B cells, and human 293 cells. Equal amounts of
protein (100 µg) were boiled in SDS-loading buffer for 10 min, and
the samples were immediately analyzed by 8% SDS-PAGE and immunoblot
analysis with anti-IRP2 antisera. Molecular weight standards are from
Amersham.
A
distinct IRP2IRE complex has not been observed in extracts from
human cells and tissues. To determine if the lack of a distinct human
IRP2
IRE complex is due to the comigration of IRP1
IRE and
IRP2
IRE complexes on gels, cytosolic extracts were prepared from
human 293 and HeLa cells, and, as controls, mouse 3T3 and rat FTO2B
cells and the extracts were incubated with
P-labeled IRE
in the presence or absence of anti-IRP2 antisera. The RNA
protein
complexes were analyzed by native polyacrylamide gels. Mouse and rat
extracts contain distinctive IRP1
IRE and IRP2
IRE complexes (Fig. 7, lanes 1 and 2 and 5 and 6). In contrast, human cells contain only one complex (Fig. 7, lanes 3 and 4 and 7 and 8). Addition of anti-IRP2 antisera to extracts resulted in
slower migrating ``supershifted'' complexes corresponding to
the IRP2
IRE complexes in mouse, rat, and human cells (Fig. 7, lanes 9-12). Rabbit preimmune antisera
used at the same amounts as anti-IRP2 antisera has no effect on
IRP
IRE complexes (Fig. 7, lanes 5-8). These
data indicate that human IRP1
IRE and IRP2
IRP2 complexes
comigrate on native polyacrylamide gels.
Figure 7:
Analysis of IRP2IRE complexes in
extracts from mouse, human, and rat cells. Cytoplasmic extracts from
mouse 3T3 cells, rat FTO2B cells, and human 293 cells were prepared,
and equal amounts of protein (10 µg) were incubated with a
P-labeled IRE in the presence (lanes 9-12)
or the absence (lanes 1-4) of anti-IRP2 antisera, or as
a control, rabbit preimmune (PI) antisera (lanes
5-8). IRP2
IRE complexes were resolved on a 5%
nondenaturing polyacrylamide gel. The supershifted IRP2 (*) and free
RNA are indicated.
IRE and
IRP2
IRE complexes comigrate on nondenaturing polyacrylamide gels,
in contrast to rodent IRP1
IRE and IRP2
IRE complexes which
migrate as distinct complexes. The reason for the altered mobilities of
human and rodent IRP1 and IRP2 complexes is unknown, but may be due to
subtle charge differences in mammalian IRPs.
/EMBL Data Bank with accession number(s) U20181 (rat liver iron-regulatory protein 2) and
U20180 (human fetal brain iron-regulatory
protein 2).
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
D. Song and F. S. Lee A Role for IOP1 in Mammalian Cytosolic Iron-Sulfur Protein Biogenesis J. Biol. Chem., April 4, 2008; 283(14): 9231 - 9238. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, X. Di, R. B. D'Agostino Jr., S. V. Torti, and F. M. Torti Excess Capacity of the Iron Regulatory Protein System J. Biol. Chem., August 24, 2007; 282(34): 24650 - 24659. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Biederbick, O. Stehling, R. Rosser, B. Niggemeyer, Y. Nakai, H.-P. Elsasser, and R. Lill Role of Human Mitochondrial Nfs1 in Cytosolic Iron-Sulfur Protein Biogenesis and Iron Regulation Mol. Cell. Biol., August 1, 2006; 26(15): 5675 - 5687. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alberghini, S. Recalcati, L. Tacchini, P. Santambrogio, A. Campanella, and G. Cairo Loss of the von Hippel Lindau Tumor Suppressor Disrupts Iron Homeostasis in Renal Carcinoma Cells J. Biol. Chem., August 26, 2005; 280(34): 30120 - 30128. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, H. L. Persson, and D. R. Richardson Molecular Pharmacology of the Interaction of Anthracyclines with Iron Mol. Pharmacol., August 1, 2005; 68(2): 261 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Mayo, P. Kohlhepp, D. Zhang, and J. J. Winzerling Effects of sham air and cigarette smoke on A549 lung cells: implications for iron-mediated oxidative damage Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L866 - L876. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Schneider and E. A. Leibold Effects of iron regulatory protein regulation on iron homeostasis during hypoxia Blood, November 1, 2003; 102(9): 3404 - 3411. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.L. Upton, Y. Chen, S. Mumby, J.M.C. Gutteridge, P.B. Anning, A.G. Nicholson, T.W. Evans, and G.J. Quinlan Variable tissue expression of transferrin receptors: relevance to acute respiratory distress syndrome Eur. Respir. J., August 1, 2003; 22(2): 335 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Erlitzki, J. C. Long, and E. C. Theil Multiple, Conserved Iron-responsive Elements in the 3'-Untranslated Region of Transferrin Receptor mRNA Enhance Binding of Iron Regulatory Protein 2 J. Biol. Chem., November 1, 2002; 277(45): 42579 - 42587. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Kwok and D. R. Richardson Unexpected Anthracycline-Mediated Alterations in Iron-Regulatory Protein-RNA-Binding Activity: The Iron and Copper Complexes of Anthracyclines Decrease RNA-Binding Activity Mol. Pharmacol., October 1, 2002; 62(4): 888 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Rutherford, S. Jaron, E. Ray, P. O. Brown, and D. R. Winge A second iron-regulatory system in yeast independent of Aft1p PNAS, December 4, 2001; 98(25): 14322 - 14327. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Yeh, M. Yeh, and J. Glass Glucocorticoids and dietary iron regulate postnatal intestinal heavy and light ferritin expression in rats Am J Physiol Gastrointest Liver Physiol, February 1, 2000; 278(2): G217 - G226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim and P. Ponka Control of Transferrin Receptor Expression via Nitric Oxide-mediated Modulation of Iron-regulatory Protein 2 J. Biol. Chem., November 12, 1999; 274(46): 33035 - 33042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qi, I. Hamza, and M. R. O'Brian Heme is an effector molecule for iron-dependent degradation of the bacterial iron response regulator (Irr) protein PNAS, November 9, 1999; 96(23): 13056 - 13061. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Pourzand, R. D. Watkin, J. E. Brown, and R. M. Tyrrell Ultraviolet A radiation induces immediate release of iron in human primary skin fibroblasts: The role of ferritin PNAS, June 8, 1999; 96(12): 6751 - 6756. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gegout, J. Schlegl, B. Schlager, M. W. Hentze, J. Reinbolt, B. Ehresmann, C. Ehresmann, and P. Romby Ligand-induced Structural Alterations in Human Iron Regulatory Protein-1 Revealed by Protein Footprinting J. Biol. Chem., May 21, 1999; 274(21): 15052 - 15058. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Hanson, L. M. Foot, and E. A. Leibold Hypoxia Post-translationally Activates Iron-regulatory Protein 2 J. Biol. Chem., February 19, 1999; 274(8): 5047 - 5052. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Toth, L. Yuan, J. T. Rogers, H. Boyce, and K. R. Bridges Hypoxia Alters Iron-regulatory Protein-1 Binding Capacity and Modulates Cellular Iron Homeostasis in Human Hepatoma and Erythroleukemia Cells J. Biol. Chem., February 12, 1999; 274(7): 4467 - 4473. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wu, A. Polack, and R. Dalla-Favera Coordinated Regulation of Iron-Controlling Genes, H-Ferritin and IRP2, by c-MYC Science, January 29, 1999; 283(5402): 676 - 679. [Abstract] [Full Text] |
||||
![]() |
L. Oliveira, C. Bouton, and J.-C. Drapier Thioredoxin Activation of Iron Regulatory Proteins. REDOX REGULATION OF RNA BINDING AFTER EXPOSURE TO NITRIC OXIDE J. Biol. Chem., January 1, 1999; 274(1): 516 - 521. [Abstract] [Full Text] [PDF] |
||||