Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, C. C.
Right arrow Articles by Romaniuk, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, C. C.
Right arrow Articles by Romaniuk, P. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 28, Issue of July 14, pp. 16988-16994, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Relationship between P-box Amino Acid Sequence and DNA Binding Specificity of the Thyroid Hormone Receptor
THE EFFECTS OF SEQUENCES FLANKING HALF-SITES IN THYROID HORMONE RESPONSE ELEMENTS (*)

Colleen C. Nelson (§) , Stephen C. Hendy , Paul J. Romaniuk (¶)

From the (1)Department of Biochemistry and Microbiology, P. O. Box 3055, University of Victoria, Victoria, British Columbia V8W 3P6, Canada

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The three P-box amino acids in the DNA recognition -helix of steroid/thyroid hormone receptors participate in the discrimination of the central base pairs of the hexameric half-sites of receptor response elements in DNA. Using a series of variant receptors incorporating all 19 possible substitutions for each individual P-box amino acid of the human thyroid hormone receptor (hT3R), we demonstrated that the first P-box position must have a glutamate, and the second P-box position must have either an alanine or a glycine for high affinity binding to everted repeat elements with half-site sequences of AGGNCA. In the present study, the influence of half-site flanking sequence on the compatibility of P-box amino acids in hT3R with DNA binding was investigated. When a 5` sequence of CTG flanked AGGNCA half-sites in an everted repeat, several additional P-box variant receptors were able to bind to the DNA that were not able to bind when the half-sites were flanked with the 5` sequence CAG. Flanking sequence had the most dramatic effects on amino acid substitutions at the first P-box position, with smaller effects observed at the second P-box position and only subtle effects observed at the third P-box position. Expansion of the number of P-box sequences compatible with binding of hT3R to thyroid hormone response elements required the thymidine in the CTG flanking sequence, an everted repeat of the AGGNCA half-sites, and an intermolecular interaction in the C terminus of the receptor.


INTRODUCTION

The thyroid hormone receptor (T3R)()belongs to a large family of nuclear receptors which act as regulatory transcription factors in response to specific ligands(1, 2, 3) . These receptors have profound effects on development, differentiation, and homeostasis, by regulating the expression of a large number of genes in a coordinate and cell specific manner. Receptors within this family bind to DNA containing binding sites consisting of either a single 6-8 base pair sequence or two 6-base pair sequences arranged as inverted repeats, everted repeats, or direct repeats(3) . Both the orientation and spacing of the half-sites in these repeats must allow the necessary protein-protein interactions required for cooperative binding of homodimers or heterodimers of the cognate receptors(4, 5, 6) . A number of receptors will also bind to a single half-site sequence provided specific flanking sequences are present which stabilize protein binding (7-11).

hT3R has the ability to bind to a variety of thyroid hormone response elements (TREs) that differ in the arrangement of half-sites, both in respect to orientation and spacing (Fig. 1) (4-6, 12). The consensus half-site sequence AGGTCA may be sufficient to bind hT3R, but DNA binding affinity is significantly increased by the presence of a TG or TA sequence immediately preceding the half-site (12). Recent evidence suggests that these ``flanking'' nucleotides are directly contacted by the receptor and are sufficient to direct binding of a receptor monomer to form a complex that is competent for transcriptional activation(10, 11) . How these flanking nucleotides are contacted is still uncertain. Some evidence suggests that the 5`-flanking region is contacted in the minor groove by the A-box motif downstream of the DNA binding domain of the receptor (Fig. 1)(12) . Other data suggests that receptor interaction with the flanking nucleotides is dependent upon the presence of the 5-methyl group of the thymidine in the major groove of the DNA(10) . Crystallographic data will mostly likely be required to determine if these bases are contacted in both the major and minor grooves and by which amino acids of the receptor.


Figure 1: A, schematic representation of the DNA binding domain of the hT3R. Shown in the boxed region is the predicted DNA recognition -helix by comparison to the structural analysis of the ER and GR (20, 25). The P-box amino acids within the DNA recognition -helix are circled. The proposed A-box motif is indicated by the shaded boxed (12). B, three classes of response elements bound by hT3R, showing the differences in AGGTCA half-site orientation and spacing between half-sites.



The consensus half-sites recognized by different members of the nuclear receptor superfamily are identical in 4 out of 6 base pairs, differing only at the central 2 base pairs. Binding site discrimination at these 2 base pairs is achieved by a 3-amino acid motif in the DNA recognition -helix of the receptors referred to as the P-box(13, 14, 15) . In the preceding paper (18) we investigated the relationship between the P-box amino acid sequence within the DNA recognition -helix of hT3R and the third and fourth base pairs of the hexameric half-site using an everted repeat with a 5`-flanking sequence of CAG adjacent to each half-site. To determine how a strong flanking sequence might influence the role of P-box sequences in hT3R in determining the DNA sequence specificity of the receptor, we have measured the binding affinity of a panel of 57 P-box variant receptors with TREs having a 5`-flanking sequence of CTG. Our results indicate that there is an expansion of the number of P-box sequences compatible with binding of hT3R to TREs which not only requires the thymidine in the CTG flanking sequence, but also an everted repeat of the half-sites and an intermolecular interaction in the C terminus of the receptor.


EXPERIMENTAL PROCEDURES

Construction and Expression of hT3R Mutants

The construction and expression of full-length hT3R mutants is described in the preceding paper(18) . The C-terminal deletion mutants of hT3R were prepared by transcription of hT3R cDNA templates that were digested with the restriction enzyme PvuII. The receptors resulting from the translation of these mRNAs were truncated at the C terminus by 34 amino acids.

Construction of Mutant TREs

The following everted repeat (EvR) and direct repeat (DR) TREs were synthesized: CAG-EvR(T), AGCTTCTGACCTCTGCAGAGGTCAGA; CAG-Lys, AGCTTCTGACCCCTGCAGAGGTCAGA; CTG-EvR(T), AGCTTCTGACCCCAGCTGAGGTCAGA; CTG-EvR(A), AGCTTCTGTCCCCAGCTGAGGACAGA; CTG-EvR(G), AGCTTCTGCCCCCAGCTGAGGGCAGA; CTG-EvR(C), AGCTTCTGGCCCCAGCTGAGGCCAGA; TC/GG-DR4, AGCTTCAGGTCACAGGAGGTCAGA; CTG-DR4, AGCTTCGCTGAGGTCAGCTGAGGTCAGCTGA. The oligonucleotide sequences shown encode the top strand of the elements. Bold nucleotides indicate differences to the reference sequence CAG-EvR(T). The everted repeat oligonucleotides were annealed to complementary bottom strand oligonucleotides and cloned in the HindIII site of pUC19 and the elements were excised by digestion with HindIII and labeled as described previously (16). Underlined sequences in oligonucleotides encoding direct repeat elements highlight the flanking bases 5` to the consensus AGGTCA half-sites. These oligonucleotides were annealed to a complementary bottom strand nucleotide, and were cloned by blunt end ligation into pUC19 at the BamHI site which had been filled in. The direct repeat elements where then excised from pUC19 by digestion with the restriction enzymes HindIII and EcoRI, and labeled as described previously(16) .

DNA Binding Analysis

The binding of variant hT3Rs to TREs was measured as described in the previous paper(18) . The wild type hT3R protein bound approximately 20-30% of the labeled DNA when the everted repeat element had the wild type AGGTCA half-site sequences flanked by 5`-CAG and approximately 70-80% of the labeled DNA when the everted repeat had the wild type AGGTCA half-site sequences flanked by 5`-CTG(16) . The binding of mutant receptors with less than 1% of the activity of the wild type receptor could be detected under these binding conditions when the time for autoradiography was extended from 16 to 96 h(17) . Where indicated, thyroid hormone (T) was added to a final concentration of 10M while the protein was being equilibrated in binding buffer. Experiments were repeated a minimum of three times using different preparations of protein.


RESULTS

Relationship between the 5`-Flanking Sequence of a TRE and Amino Acid Substitutions in the First P-box Position of hT3R Compatible with DNA Binding

An everted repeat element with AGGTCA half-sites with a 5`-flanking sequence of CAG (denoted here as CAG-EvR(T)) is able to bind to wild type hT3R with an EGG P-box sequence and has a weaker interaction with a variant receptor with the P-box sequence DGG(18) . However, when the 5`-flanking sequence of the everted repeat is changed to CTG (CTG-EvR(T)), other variant hT3R receptors with substitutions in the first P-box amino acid position are able to bind (Fig. 2). On the CTG-EvR(T) element receptors with the P-box sequences DGG and EGG bound with the highest affinity. Variant receptors with the P-box sequences AGG, SGG, and NGG bound with high affinity and appreciable binding was observed for those receptors with the P-box sequences LGG, GGG, YGG, QGG, and HGG.


Figure 2: Gel mobility shift analysis of amino acid substitution mutants in the first P-box position of hT3R, comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions were analyzed by gel mobility shift analysis on DNA elements composed of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid sequence of the receptor protein is indicated by the amino acid one letter code, where the amino acid in bold is the one varied within this set of mutants. Shown are strips of the autoradiographs containing the bound complexes.



On the CTG-EvR(A) element binding was restricted to the wild type hT3R receptor with an EGG P-box sequence, while on the CAG-EvR(A) element barely detectable binding was also observed for the variant receptor with a DGG P-box sequence. On the CTG-EvR(G) element binding was observed for receptors with EGG and DGG P-boxes, as was observed for the CAG-EvR(G) element. On the other hand, a receptor binding pattern similar to CTG-EvR(T) was seen on the CTG-EvR(C) element: receptors with DGG and EGG P-boxes bound strongly, and significant binding was observed for those variant receptors with NGG, AGG, GGG, SGG, YGG, CGG, or HGG P-box sequences. In comparison, the receptors with EGG or DGG P-box sequences were the only ones to bind to the CAG-EvR(C) element.

There are two distinct differences between CTG-EvR(T) and CAG-EvR(T). CTG-EvR(T) has a CTG rather than a CAG sequence flanking the 5` side of both half-sites as noted above. In addition, one of the half-sites of CTG-EvR(T) is a GGGTCA, rather than an AGGTCA half-site, since this element is derived from the TRE of the chicken lysozyme promoter(19) . To test whether the ability of additional variant hT3R proteins to bind to the CTG-EvR(T) element was the result of the difference in the 5`-flanking sequences or the guanine to adenine change in the first half-site, we created the CAG-Lys element that preserves the half-sites of the CTG-EvR(T) element but changes the flanking sequences adjacent to both half-sites to CAG. This construct had a receptor binding pattern identical to that observed for the CAG-EvR(T) element (with two AGGTCA half-sites), indicating that changing 1 base pair in the 5`-flanking sequences results in the ability of additional P-box variants of hT3R to bind to CTG-EvR(T) (data not shown).

The alteration in the flanking sequences 5` to the consensus hexameric half-sites from CAG to CTG increased DNA binding affinity approximately 5-fold. One potential explanation for the apparent increase in the number of variant receptors that bind to CTG-EvR elements compared to the number that bind to the corresponding CAG-EvR elements would be that receptor affinity is increased by interactions between the T or A box motifs downstream of the DNA binding domain of the receptors and the DNA base pairs flanking the half-sites(10, 12) . If this explanation were correct, either increasing the protein concentration used to assay DNA binding or lengthening the autoradiographic exposure time should have detected weak binding by additional receptor variants on the CAG-EvR(T) element. Changing the experimental conditions in either manner did not change the pattern of variant receptor binding on CAG-EvR(T) from that shown in Fig. 2.

Relationship between the 5`-Flanking Sequence of a TRE and Amino Acid Substitutions in the Second P-box Position of hT3R Compatible with DNA Binding

The 5`-flanking sequence of the everted repeat elements also influences which amino acid substitutions in the second P-box position of hT3R are compatible with DNA binding (Fig. 3). The CAG-EvR(T) element binds variant receptors with EAG and EGG P-boxes strongly and has a very weak affinity for the ESG variant. In comparison, the CTG-EvR(T) bound the EAG, EGG, and ESG receptors with equal affinity and had a weak affinity for the variant receptor with an EPG P-box. On the CTG-EvR(A) element there was high affinity binding by receptors with EAG, EPG, EGG, and ESG P-box sequences and a low level of binding by the variant receptor with a ECG P-box. On the CTG-EvR(G) element, the binding pattern of receptors with substitutions in the second P-box position was similar to that observed for the CAG element, which bound EAG and EGG: however, the CTG-EvR(G) element also had a weak affinity for the variant with an ESG P-box. The CTG-EvR(C) element had strong affinity for receptors with EAG and EGG P-box sequences, as was observed for the CAG-EvR(C) element, but in addition also was able to bind the ESG variant with reasonable affinity and the EPG variant with weak affinity. The compatibility of small amino acids in the second P-box position with DNA binding correlates well with the proximity of this amino acid to the DNA backbone in the estrogen receptor-DNA complex(20) . However, the observation that substitution of proline into the recognition -helix is compatible with DNA binding was unexpected, because this amino acid may strain or disrupt the helix. Proline substitution in the second P-box position resulted in the highest affinity binding on everted repeats with AGGACA half-sites (CTG-EvR(A)and CAG-EvR(A)), while this variant bound with much lower affinity to the AGGTCA and AGGCCA half-sites of CTG-EvR(T) and CTG-EvR(C). This result suggests that there may be conformational differences in these half-site sequences that influence the ability of the proline variant to bind to the DNA.


Figure 3: Gel mobility shift analysis of amino acid substitution mutants in the second P-box position of hT3R, comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions were analyzed by gel mobility shift analysis on DNA elements composed of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid sequence of the receptor protein is indicated by the amino acid one letter code, where the amino acid in bold is the one varied within this set of mutants. Shown are strips of the autoradiographs containing the bound complexes.



Relationship between the 5`-Flanking Sequence of a TRE and Amino Acid Substitutions in the Third P-box Position of hT3R Compatible with DNA Binding

Changing the 5`-flanking sequence in the everted repeat elements from CAG to CTG had only modest effects on the binding of hT3R variants with amino acid substitutions at the third P-box position. For the everted repeats with AGGTCA, AGGGCA and AGGCCA half-sites, the switch from CAG to CTG 5`-flanking sequences did not alter the identity of variant receptors that bound to the DNA, but it did strengthen the weaker interactions observed between some variants and the elements with CAG flanking sequences (Fig. 4).


Figure 4: Gel mobility shift analysis of amino acid substitution mutants in the third P-box position of hT3R, comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions were analyzed by gel mobility shift analysis on DNA elements composed of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid sequence of the receptor protein is indicated by the amino acid one letter code, where the amino acid in bold is the one varied within this set of mutants. Shown are strips of the autoradiographs containing the bound complexes. Dimer (D) and monomer (M) complexes of bound hT3R are indicated.



Flanking Sequences on Direct Repeat TREs Do Not Influence the Binding of P-box Variants of hT3R

Altering the 5`-sequence flanking the half-sites of an everted repeat TRE to a TG or TA sequence has been reported to increase the affinity of T3R binding by approximately 5-fold(4) . A 5`-sequence of TG flanking both half-sites of a direct repeat TRE enhances the binding of T3R and is contacted in the minor groove by the A box region located downstream of the second zinc finger motif of the receptor(12) . A single half-site sequence flanked by a 5` TG motif is sufficient for T3R binding and activation, and it has been demonstrated that T3R interacts in the major groove of the DNA with the methyl of the thymine base of this motif(10, 11) . Based upon these observations, we investigated whether the 5`-flanking sequence effect we observed on the binding of variant T3R receptors to everted repeat elements was also present on the direct repeat elements TC/GG-DR4 and CTG-DR4.

When comparing receptor binding to these two DR4 elements, we found that the CTG flanking sequence increased the DNA binding affinity of hT3R homodimers, but did not alter which P-box amino acid sequences were compatible with binding (Fig. 5). The increase in DNA binding affinity is not apparent in this figure because the time of autoradiographic exposure was increased to detect any additional binding resulting from the changes in the 5`-flanking sequences. The patterns of receptor binding to TC/GG-DR4 and CTG-DR4 were virtually identical to the patterns of receptor binding observed with the CAG-EvR(T) everted repeat element (compare Fig. 2-4 with Fig. 5). Thus while a CTG flanking sequence will enhance T3R binding affinity regardless of the orientation of half-sites in the TRE, only the combination of a CTG flanking sequence with half-sites oriented as an everted repeat results in the binding of additional P-box variant receptors. This result suggests that the increase in P-box sequences compatible with DNA binding on CTG-EvR elements may require a protein-protein interaction that is unique to DNA binding on an everted configuration of half-sites.


Figure 5: Comparison of P-box specificity on direct repeat elements with different flanking sequences. DNA-protein interactions were analyzed by gel mobility shift analyses on direct repeat elements of AGGTCA half-sites spaced by four nucleotides, which either had a TC flanking the upstream half-site and a GG flanking the downstream half-site, or CTG flanking both half-sites. The position of the P-box substitution is indicated at the left-hand column by the letter ``X'' within the wild type sequence of EGG, with the identity of X being shown in the top row by the amino acid one letter code. Shown are strips of the autoradiographs containing the bound complexes. Dimer (D) and monomer (M) complexes of bound hT3R are indicated.



Interaction of the C-terminal Domain in Homodimers Influences the Binding of P-box Variant hT3R Receptors to Everted Repeats

Deleting the last 34 amino acids of hT3R alters the affinity of the receptor for everted repeat elements, but has little effect on the affinity of the receptor for inverted or direct repeat elements(4) . This observation suggests that the last 34 amino acids of hT3R are involved in an intermolecular interaction that increases DNA binding affinity and cooperativity when hT3R is bound as a homodimer to everted repeat elements.

This observation prompted us to determine whether deleting the last 34 amino acids of hT3R would influence which P-box variant receptors will bind to CTG-EvR elements. Since the CTG flanking sequence change did not alter the DNA binding specificity of variants with amino acid substitutions at the third P-box position, only the first two P-box sets were tested (Fig. 6). The results clearly demonstrate that truncation of the receptors influences which P-box substitutions are compatible with binding to the CTG-EvR(T) and CTG-EvR(A) elements. The binding patterns of the truncated hT3Rs on CTG-EvR(T) are similar to the binding patterns of full-length hT3Rs on CAG-EvR(T). This result suggests that the 34 amino acids at the C terminus are required for allowing additional P-box sequence variants of hT3R to be compatible with receptor binding to the CTG-EvR(T) element. A similar effect of deleting the last 34 amino acids of the receptor was observed for the binding of variants with substitutions in the second P-box position to the CTG-EvR(A) element.


Figure 6: Influence of amino acid deletion and ligand binding the DNA binding properties of variant hT3Rs. DNA-protein interactions were analyzed by gel mobility shift analyses using everted repeats of AGGTCA or AGGACA half-sites with CTG 5`-flanking sequences. A, DNA binding activity of selected amino acid variants in the first P-box position of hT3R, where the amino acid substitution is shown in bold. Shown are strips of autoradiographs containing the bound complexes. The top strip demonstrates binding of the full-length receptors. The middle strip shows binding of receptors which have been truncated by 34 amino acids at the C terminus. The bottom strip shows binding of full-length receptors in the presence of T. B, the top panel illustrates DNA binding by selected amino acid variants in the second P-box position of hT3R to the everted repeat with AGGTCA half-sites. Shown are strips of autoradiographs containing the bound complexes. The top strip demonstrates binding of the full-length receptors. The middle strip shows binding of receptors which have been truncated by 34 amino acids at the C terminus. The bottom strip shows binding of full-length receptors in the presence of T. The bottom panel illustrates DNA binding by the same hT3R variants to the everted repeat with AGGACA half-sites. Shown are strips of autoradiographs containing the bound complexes. The top strip demonstrates binding of the full-length receptors. The bottom strip shows binding of receptors which have been truncated by 34 amino acids at the C terminus.



Binding of thyroid hormone to T3R results in the loss of cooperative binding of a homodimer to an everted repeat element, but increases the binding affinity of a receptor monomer for the DNA(21, 22, 23, 24) . The results in Fig. 6show that adding T to a binding reaction with full-length hT3R proteins mimics the effects of deleting 34 amino acids from the C terminus of the receptors. Thus the influence that CTG flanking sequences in everted repeat elements have on P-box compatibility with DNA binding is achieved through a cooperative interaction of the C termini of the receptor homodimers, which may be disrupted by amino acid deletion or by the binding of ligand.


DISCUSSION

The crystallographic studies of the DNA binding domains of glucocorticoid and estrogen receptors bound to their cognate DNA elements have elegantly shown the interaction of the P-box amino acids with the central base pairs of the hexameric half-site(20, 25) . The effects of mutating the P-box amino acids of the thyroid hormone receptor on DNA binding and transcriptional activation would suggest that they function in a similar manner to those of the estrogen receptor(16, 17) . In this article we have demonstrated that in the context of the full-length hT3R the compatibility of a variety of P-box amino acid sequences with DNA binding can vary dramatically depending upon both the flanking sequence 5` to the half-sites of a response element and the orientation of the half-sites in the element. Thus the intermolecular interaction of thyroid hormone receptor homodimers on everted repeat elements combined with an interaction between the receptor and the 5`-flanking sequence of the half-site can influence the interaction of the P-box amino acids with the central base pairs of the half-site. Further investigation will be necessary to understand the mechanisms of these effects.

The effect of 5`-flanking sequence on the compatibility of amino acid substitutions P-box with DNA binding was most dramatic at the first P-box position and was partially effective for amino acid substitutions at the second P-box position. This expansion of the number of P-box variants that are capable of binding to DNA was dependent upon four factors: the identity of the 5`-flanking nucleotides; the identity of the fourth base pair of the hexameric half-sites; the everted configuration of the half-sites; and a protein-protein interaction involving the C termini of the homodimer partners. These observations suggest that three bimolecular interactions influence the DNA binding specificity of hT3R: a protein-protein interaction in the ligand binding domain, an interaction between the DNA recognition -helix of the receptor and the base pairs of the hexameric half-site, and presumably another protein-DNA interaction between the base pairs flanking each DNA half-site and another region of hT3R. The complexity and interdependence of these interactions would indicate that this DNA-protein interaction may be allosteric.

Additional DNA contact(s) in the 5`-flanking sequence formed by other regions of the hT3R could alter the DNA and/or receptor conformation to compensate for a weakened interaction between the first P-box amino acid and the central base pairs within the half-site. If such a compensating DNA binding contact exists, our evidence suggests that it requires an intermolecular interaction of the hT3R homodimer partners when they are bound to an everted repeat. This presumptive interaction of the flanking base pairs with the receptor has two effects: it increases the strength of the DNA-receptor interaction and it allows for additional amino acid substitutions at the first and second P-box positions. However, these two effects are separate as demonstrated by the observation that the affinity of receptor binding to direct repeats and single half-sites can be enhanced by the presence of a CTG flanking sequence without allowing for additional amino acid substitutions in the P-box. In contrast, changing the flanking sequence 5` to each half-site in an everted repeat element increases the affinity of receptor binding and allows more P-box variants to bind to the DNA. This second effect appears to be dependent on the presence of the 34 amino acids at the C terminus of the receptor and is disrupted by the conformational changes that occur in the receptor when ligand is bound.

Our data on the effects of P-box substitutions on DNA binding were obtained in the context of hT3R. Extrapolation of these results to the role of P-box amino acids in other receptors is unlikely to be valid. Indeed, the relationship between P-box sequence and DNA binding specificity reflects both the receptor and DNA binding site used for analysis. A comprehensive study of the relationship between P-box sequence and DNA binding specificity in the context of a mutant DNA binding domain of the glucocorticoid receptor (GR-DBD) containing an EGA P-box sequence was recently reported(26) . In that study all possible amino acid substitutions were constructed in the first and second P-box positions of this mutant GR-DBD, and the effects on transcriptional activity from four inverted repeat elements were assayed in yeast. In this unusual context, substitution of the glutamate in the mutant EGA P-box of this GR-DBD with 12 different amino acids (Trp, Tyr, Phe, His, Gln, Asp, Ala, Met, Asn, Ser, Cys, and Pro) resulted in transcriptional activation from an inverted repeat of AGGTCA half-sites spaced by three nucleotides. All of these mutations marginally decreased transcriptional activity from the inverted repeat with AGGTCA half-sites compared to the GR-DBD with the EGA P-box, but increased activity from an element composed of AGAACA half-sites. The remaining seven variant receptors were inactive in this assay. From this observation, it was concluded that the function of the glutamate in the P-box of the estrogen receptor was to prevent the protein from binding to an inappropriate sequence. The differences between these results and those we report in this study illustrate the need for caution in extrapolating from one receptor system to others. The cooperative interactions formed between two GR-DBDs are strong enough to allow one of the monomers to bind out of register with respect to the DNA on an inappropriately spaced element (inverted repeat spaced by four rather than three base pairs)(25) . This strong cooperativity may compensate for the loss of contact by the first P-box amino acid in those GR-DBD variants where glutamate was replaced.

The protein-protein interactions which lead to cooperative binding of the GR to an inverted repeat (25, 27) and T3R to an everted repeat (4) differ substantially. These differences in the protein-protein interactions are likely to have different influences on the compatibility of P-box sequences in the two receptors with DNA binding specificity. Thus it is not surprising that our results differ from those obtained by Zilliacus and co-workers (26) using the mutant GR-DBD system. In addition, our data illustrate that factors beyond the confines of the DNA recognition -helix of the hT3R and the hexameric half-site of the TRE can influence the function of the P-box amino acids in discriminating DNA sequences. Another significant influence might arise from apparently small differences in the ``parent'' P-box sequences of the different receptors. We have previously demonstrated that the P-box operates as a functional entity in the sense that a double mutation like EAA will have a phenotype that is not simply the sum of the phenotypes of the two single mutations EAG and EGA(16) . Therefore one cannot simply assume that substitutions of amino acids for glutamate will have the same phenotype in the EGG P-box of hT3R as they will in the EGA P-box found naturally in the estrogen receptor and also in the mutant GR-DBD used by Zilliacus and co-workers(26) .

While very useful information is obtained from crystallographic studies of the DNA binding domains of the receptor superfamily, the manner in which isolated domains interact with their DNA target sequences may not entirely reflect the way that full-length receptors bind to DNA elements. Our data also emphasize the point that full-length receptors may interact with a DNA sequence motif that significantly extends beyond the canonical 6-base pair half-sites. Sequences flanking repeat elements can have an influence on receptor interaction with the DNA that must be considered. Such effects will need to be investigated in further detail.


FOOTNOTES

*
This work was supported in part by a grant (to P. J. R.) from the National Cancer Institute of Canada with funds from the Canadian Cancer Society. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of a National Cancer Institute of Canada postdoctoral fellowship.

To whom correspondence should be addressed. Tel.: 604-721-7088; Fax: 604-721-6227.

The abbreviations used are: T3R, thyroid hormone receptor; TRE, thyroid hormone response elements; EvR, everted repeat; DR, direct repeat; GR-DBD, glucocorticoid receptor-DNA binding domain.


ACKNOWLEDGEMENTS

We thank R. Evans for providing plasmid peA101, C. Juricic for assistance in the construction of mutant receptor clones, and J. Faris for helpful discussions.


REFERENCES
  1. Evans, R. M. (1988) Science240, 889-895 [Abstract/Free Full Text]
  2. Laudet, V., Hanni, C., Coll, J., Catzeflis, F., and Stehelin, D. (1992) EMBO J.11, 1003-1013 [Medline] [Order article via Infotrieve]
  3. Glass, C. K. (1994) Endocr. Rev.15, 391-407 [Abstract/Free Full Text]
  4. Näär, A. M., Boutin, J. M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell65, 1267-1279 [CrossRef][Medline] [Order article via Infotrieve]
  5. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  6. Williams, G. R., Harney, J. W., Moore, D. D., Larsen, P. R., and Brent, G. A. (1992) Mol. Endocrinol. 6, 1527-1537
  7. Wilson, T. E., Paulsen, R. E., Padgett, K. A., and Milbrandt, J. (1992) Science256, 107-110 [Abstract/Free Full Text]
  8. Harding, H. P., and Lazar, M. A. (1993) Mol. Cell. Biol.13, 3113-3121 [Abstract/Free Full Text]
  9. Ueda, H., Sun, G. C., Murata, T., and Hirose, S. (1992) Mol. Cell. Biol.12, 5667-5672 [Abstract/Free Full Text]
  10. Katz, R. W., and Koenig, R. J. (1993) J. Biol. Chem.268, 19392-19397 [Abstract/Free Full Text]
  11. Schrader, M., Becker-Andre, M., and Carlberg, C. (1994) J. Biol. Chem.269, 6444-6449 [Abstract/Free Full Text]
  12. Kurokawa, R., Yu, V. C., Näär, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes & Dev.7, 1423-1435 [CrossRef]
  13. Danielsen, M., Hinck, L., and Ringold, G. M. (1989) Cell57, 1131-1138 [CrossRef][Medline] [Order article via Infotrieve]
  14. Umesono, K., and Evans, R. M. (1989) Cell57, 1139-1146 [CrossRef][Medline] [Order article via Infotrieve]
  15. Mader, S., Kumar, V., de Verneuil, H., and Chambon, P. (1989) Nature338, 271-274 [CrossRef][Medline] [Order article via Infotrieve]
  16. Nelson, C. C., Hendy, S. C., Faris, J. S., and Romaniuk, P. J. (1994) Mol. Endocrinol.8, 829-840 [Abstract/Free Full Text]
  17. Nelson, C. C., Faris, J. S., Hendy, S. C., and Romaniuk, P. J. (1993) Mol. Endocrinol.7, 1185-1195 [Abstract/Free Full Text]
  18. Nelson, C. C., Hendy, S. C., and Romaniuk, P. J. (1995) J. Biol. Chem.270, 16981-16987 [Abstract/Free Full Text]
  19. Baniahmad, A., Steiner, C., Köhne, A. C., and Renkawitz, R. (1990) Cell61, 505-514 [CrossRef][Medline] [Order article via Infotrieve]
  20. Schwabe, J. W. R., Chapman, L., Finch, J. T., and Rhodes, D. (1993) Cell75, 567-578 [CrossRef][Medline] [Order article via Infotrieve]
  21. Andersson, M. L., Nordstrom, K., Demczuk, S., Harbers, M., and Vennstrom, B. (1992) Nucleic Acids Res.20, 4803-4810 [Abstract/Free Full Text]
  22. Yen, P. M., Sugawara, A., and Chin, W. W. (1992) J. Biol. Chem.267, 23248-23252 [Abstract/Free Full Text]
  23. Miyamoto, T., Suzuki, S., and Degroot, L. J. (1993) Mol. Endocrinol.7, 224-231 [Abstract/Free Full Text]
  24. Ribeiro, R. C., Kushner, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol.6, 1142-1152 [Abstract/Free Full Text]
  25. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991) Nature352, 497-505 [CrossRef][Medline] [Order article via Infotrieve]
  26. Zilliacus, J., Carlstedt-Duke, J., Gustafsson, J. A., and Wright, A. P. H. (1994) Proc. Natl. Acad. Sci. U. S. A.91, 4175-4179 [Abstract/Free Full Text]
  27. Freedman, L. P., and Towers, T. L. (1991) Mol. Endocrinol.5, 1815-1826 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.




Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev, July 1, 2001; 81(3): 1097 - 1142.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Chusacultanachai, K. A. Glenn, A. O. Rodriguez, E. K. Read, J. F. Gardner, B. S. Katzenellenbogen, and D. J. Shapiro
Analysis of Estrogen Response Element Binding by Genetically Selected Steroid Receptor DNA Binding Domain Mutants Exhibiting Altered Specificity and Enhanced Affinity
J. Biol. Chem., August 13, 1999; 274(33): 23591 - 23598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Nelson, S. C. Hendy, J. S. Faris, and P. J. Romaniuk
Retinoid X Receptor Alters the Determination of DNA Binding Specificity by the P-box Amino Acids of the Thyroid Hormone Receptor
J. Biol. Chem., August 9, 1996; 271(32): 19464 - 19474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Judelson and M. L. Privalsky
DNA Recognition by Normal and Oncogenic Thyroid Hormone Receptors
J. Biol. Chem., May 3, 1996; 271(18): 10800 - 10805.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Nelson, S. C. Hendy, and P. J. Romaniuk
Relationship between P-box Amino Acid Sequence and DNA Binding Specificity of the Thyroid Hormone Receptor
J. Biol. Chem., July 14, 1995; 270(28): 16981 - 16987.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ito, J. C. Achermann, and J. L. Jameson
A Naturally Occurring Steroidogenic Factor-1 Mutation Exhibits Differential Binding and Activation of Target Genes
J. Biol. Chem., October 6, 2000; 275(41): 31708 - 31714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, C. C.
Right arrow Articles by Romaniuk, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, C. C.
Right arrow Articles by Romaniuk, P. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement