|
Volume 270,
Number 28,
Issue of July 14, pp. 16988-16994, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Relationship
between P-box Amino Acid Sequence and DNA Binding Specificity of the
Thyroid Hormone Receptor
THE EFFECTS OF SEQUENCES FLANKING HALF-SITES IN THYROID HORMONE
RESPONSE ELEMENTS (*)
Colleen C.
Nelson (§)
,
Stephen C.
Hendy
,
Paul
J.
Romaniuk (¶)
From the
(1)Department of Biochemistry and Microbiology, P. O. Box
3055, University of Victoria, Victoria, British Columbia V8W 3P6,
Canada
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The three P-box amino acids in the DNA recognition -helix
of steroid/thyroid hormone receptors participate in the discrimination
of the central base pairs of the hexameric half-sites of receptor
response elements in DNA. Using a series of variant receptors
incorporating all 19 possible substitutions for each individual P-box
amino acid of the human thyroid hormone receptor (hT3R ), we
demonstrated that the first P-box position must have a glutamate, and
the second P-box position must have either an alanine or a glycine for
high affinity binding to everted repeat elements with half-site
sequences of AGGNCA. In the present study, the influence of half-site
flanking sequence on the compatibility of P-box amino acids in
hT3R with DNA binding was investigated. When a 5` sequence of CTG
flanked AGGNCA half-sites in an everted repeat, several additional
P-box variant receptors were able to bind to the DNA that were not able
to bind when the half-sites were flanked with the 5` sequence CAG.
Flanking sequence had the most dramatic effects on amino acid
substitutions at the first P-box position, with smaller effects
observed at the second P-box position and only subtle effects observed
at the third P-box position. Expansion of the number of P-box sequences
compatible with binding of hT3R to thyroid hormone response
elements required the thymidine in the CTG flanking sequence, an
everted repeat of the AGGNCA half-sites, and an intermolecular
interaction in the C terminus of the receptor.
INTRODUCTION
The thyroid hormone receptor (T3R) ( )belongs to a large family of nuclear receptors which act as
regulatory transcription factors in response to specific
ligands(1, 2, 3) . These receptors have profound
effects on development, differentiation, and homeostasis, by regulating
the expression of a large number of genes in a coordinate and cell
specific manner. Receptors within this family bind to DNA containing
binding sites consisting of either a single 6-8 base pair
sequence or two 6-base pair sequences arranged as inverted repeats,
everted repeats, or direct repeats(3) . Both the orientation and
spacing of the half-sites in these repeats must allow the necessary
protein-protein interactions required for cooperative binding of
homodimers or heterodimers of the cognate
receptors(4, 5, 6) . A number of receptors will
also bind to a single half-site sequence provided specific flanking
sequences are present which stabilize protein binding (7-11).
hT3R has the ability to bind to a variety of thyroid hormone
response elements (TREs) that differ in the arrangement of half-sites,
both in respect to orientation and spacing (Fig. 1) (4-6,
12). The consensus half-site sequence AGGTCA may be sufficient to bind
hT3R , but DNA binding affinity is significantly increased by the
presence of a TG or TA sequence immediately preceding the half-site
(12). Recent evidence suggests that these ``flanking''
nucleotides are directly contacted by the receptor and are sufficient
to direct binding of a receptor monomer to form a complex that is
competent for transcriptional activation(10, 11) . How
these flanking nucleotides are contacted is still uncertain. Some
evidence suggests that the 5`-flanking region is contacted in the minor
groove by the A-box motif downstream of the DNA binding domain of the
receptor (Fig. 1)(12) . Other data suggests that receptor
interaction with the flanking nucleotides is dependent upon the
presence of the 5-methyl group of the thymidine in the major groove of
the DNA(10) . Crystallographic data will mostly likely be
required to determine if these bases are contacted in both the major
and minor grooves and by which amino acids of the receptor.
Figure 1:
A, schematic
representation of the DNA binding domain of the hT3R . Shown in the boxed region is the predicted DNA recognition -helix by
comparison to the structural analysis of the ER and GR (20, 25). The
P-box amino acids within the DNA recognition -helix are circled. The proposed A-box motif is indicated by the shaded boxed (12). B, three classes of response
elements bound by hT3R , showing the differences in AGGTCA
half-site orientation and spacing between
half-sites.
The
consensus half-sites recognized by different members of the nuclear
receptor superfamily are identical in 4 out of 6 base pairs, differing
only at the central 2 base pairs. Binding site discrimination at these
2 base pairs is achieved by a 3-amino acid motif in the DNA recognition
-helix of the receptors referred to as the
P-box(13, 14, 15) . In the preceding paper (18) we investigated the relationship between the P-box amino
acid sequence within the DNA recognition -helix of hT3R and
the third and fourth base pairs of the hexameric half-site using an
everted repeat with a 5`-flanking sequence of CAG adjacent to each
half-site. To determine how a strong flanking sequence might influence
the role of P-box sequences in hT3R in determining the DNA
sequence specificity of the receptor, we have measured the binding
affinity of a panel of 57 P-box variant receptors with TREs having a
5`-flanking sequence of CTG. Our results indicate that there is an
expansion of the number of P-box sequences compatible with binding of
hT3R to TREs which not only requires the thymidine in the CTG
flanking sequence, but also an everted repeat of the half-sites and an
intermolecular interaction in the C terminus of the receptor.
EXPERIMENTAL PROCEDURES
The construction and expression of full-length hT3R
mutants is described in the preceding paper(18) . The C-terminal
deletion mutants of hT3R were prepared by transcription of
hT3R cDNA templates that were digested with the restriction enzyme PvuII. The receptors resulting from the translation of these
mRNAs were truncated at the C terminus by 34 amino acids.
The following everted
repeat (EvR) and direct repeat (DR) TREs were synthesized: CAG-EvR(T),
AGCTTCTGACCTCTGCAGAGGTCAGA; CAG-Lys, AGCTTCTGACCCCTGCAGAGGTCAGA;
CTG-EvR(T), AGCTTCTGACCCCAGCTGAGGTCAGA;
CTG-EvR(A),
AGCTTCTGTCCCCAGCTGAGGACAGA;
CTG-EvR(G),
AGCTTCTGCCCCCAGCTGAGGGCAGA;
CTG-EvR(C),
AGCTTCTGGCCCCAGCTGAGGCCAGA;
TC/GG-DR4, AGCTTCAGGTCACAGGAGGTCAGA; CTG-DR4,
AGCTTCGCTGAGGTCAGCTGAGGTCAGCTGA. The oligonucleotide sequences shown
encode the top strand of the elements. Bold nucleotides indicate
differences to the reference sequence CAG-EvR(T). The everted repeat
oligonucleotides were annealed to complementary bottom strand
oligonucleotides and cloned in the HindIII site of pUC19 and
the elements were excised by digestion with HindIII and
labeled as described previously (16). Underlined sequences in
oligonucleotides encoding direct repeat elements highlight the flanking
bases 5` to the consensus AGGTCA half-sites. These oligonucleotides
were annealed to a complementary bottom strand nucleotide, and were
cloned by blunt end ligation into pUC19 at the BamHI site
which had been filled in. The direct repeat elements where then excised
from pUC19 by digestion with the restriction enzymes HindIII
and EcoRI, and labeled as described previously(16) .
The binding of variant
hT3R s to TREs was measured as described in the previous
paper(18) . The wild type hT3R protein bound approximately
20-30% of the labeled DNA when the everted repeat element had the
wild type AGGTCA half-site sequences flanked by 5`-CAG and
approximately 70-80% of the labeled DNA when the everted repeat
had the wild type AGGTCA half-site sequences flanked by
5`-CTG(16) . The binding of mutant receptors with less than 1%
of the activity of the wild type receptor could be detected under these
binding conditions when the time for autoradiography was extended from
16 to 96 h(17) . Where indicated, thyroid hormone
(T ) was added to a final concentration of 10 M while the protein was being equilibrated in binding
buffer. Experiments were repeated a minimum of three times using
different preparations of protein.
RESULTS
An everted repeat element with
AGGTCA half-sites with a 5`-flanking sequence of CAG (denoted here as
CAG-EvR(T)) is able to bind to wild type hT3R with an EGG
P-box sequence and has a weaker interaction with a variant receptor
with the P-box sequence DGG(18) . However, when the
5`-flanking sequence of the everted repeat is changed to CTG
(CTG-EvR(T)), other variant hT3R receptors with substitutions in
the first P-box amino acid position are able to bind (Fig. 2). On
the CTG-EvR(T) element receptors with the P-box sequences DGG
and EGG bound with the highest affinity. Variant receptors with
the P-box sequences AGG, SGG, and NGG bound with
high affinity and appreciable binding was observed for those receptors
with the P-box sequences LGG, GGG, YGG, QGG, and HGG.
Figure 2:
Gel mobility shift analysis of amino acid
substitution mutants in the first P-box position of hT3R ,
comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions
were analyzed by gel mobility shift analysis on DNA elements composed
of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid
sequence of the receptor protein is indicated by the amino acid one
letter code, where the amino acid in bold is the one varied within this
set of mutants. Shown are strips of the autoradiographs containing the
bound complexes.
On the CTG-EvR(A) element binding was
restricted to the wild type hT3R receptor with an EGG P-box
sequence, while on the CAG-EvR(A) element barely detectable binding was
also observed for the variant receptor with a DGG P-box
sequence. On the CTG-EvR(G) element binding was observed for receptors
with EGG and DGG P-boxes, as was observed for the
CAG-EvR(G) element. On the other hand, a receptor binding pattern
similar to CTG-EvR(T) was seen on the CTG-EvR(C) element: receptors
with DGG and EGG P-boxes bound strongly, and significant
binding was observed for those variant receptors with NGG, AGG, GGG, SGG, YGG, CGG, or HGG P-box sequences. In comparison, the receptors with EGG or DGG P-box sequences were the only ones to bind to
the CAG-EvR(C) element.
There are two distinct differences between
CTG-EvR(T) and CAG-EvR(T). CTG-EvR(T) has a CTG rather than a CAG
sequence flanking the 5` side of both half-sites as noted above. In
addition, one of the half-sites of CTG-EvR(T) is a GGGTCA, rather than
an AGGTCA half-site, since this element is derived from the TRE of the
chicken lysozyme promoter(19) . To test whether the ability of
additional variant hT3R proteins to bind to the CTG-EvR(T) element
was the result of the difference in the 5`-flanking sequences or the
guanine to adenine change in the first half-site, we created the
CAG-Lys element that preserves the half-sites of the CTG-EvR(T) element
but changes the flanking sequences adjacent to both half-sites to CAG.
This construct had a receptor binding pattern identical to that
observed for the CAG-EvR(T) element (with two AGGTCA half-sites),
indicating that changing 1 base pair in the 5`-flanking sequences
results in the ability of additional P-box variants of hT3R to
bind to CTG-EvR(T) (data not shown).
The alteration in the flanking
sequences 5` to the consensus hexameric half-sites from CAG to CTG
increased DNA binding affinity approximately 5-fold. One potential
explanation for the apparent increase in the number of variant
receptors that bind to CTG-EvR elements compared to the number that
bind to the corresponding CAG-EvR elements would be that receptor
affinity is increased by interactions between the T or A box motifs
downstream of the DNA binding domain of the receptors and the DNA base
pairs flanking the half-sites(10, 12) . If this
explanation were correct, either increasing the protein concentration
used to assay DNA binding or lengthening the autoradiographic exposure
time should have detected weak binding by additional receptor variants
on the CAG-EvR(T) element. Changing the experimental conditions in
either manner did not change the pattern of variant receptor binding on
CAG-EvR(T) from that shown in Fig. 2.
The 5`-flanking sequence of the
everted repeat elements also influences which amino acid substitutions
in the second P-box position of hT3R are compatible with DNA
binding (Fig. 3). The CAG-EvR(T) element binds variant receptors
with EAG and EGG P-boxes strongly and has a very weak
affinity for the ESG variant. In comparison, the CTG-EvR(T)
bound the EAG, EGG, and ESG receptors with equal
affinity and had a weak affinity for the variant receptor with an
EPG P-box. On the CTG-EvR(A) element there was high affinity
binding by receptors with EAG, EPG, EGG, and
ESG P-box sequences and a low level of binding by the variant
receptor with a ECG P-box. On the CTG-EvR(G) element, the
binding pattern of receptors with substitutions in the second P-box
position was similar to that observed for the CAG element, which bound
EAG and EGG: however, the CTG-EvR(G) element also had a
weak affinity for the variant with an ESG P-box. The CTG-EvR(C)
element had strong affinity for receptors with EAG and
EGG P-box sequences, as was observed for the CAG-EvR(C) element,
but in addition also was able to bind the ESG variant with
reasonable affinity and the EPG variant with weak affinity. The
compatibility of small amino acids in the second P-box position with
DNA binding correlates well with the proximity of this amino acid to
the DNA backbone in the estrogen receptor-DNA complex(20) .
However, the observation that substitution of proline into the
recognition -helix is compatible with DNA binding was unexpected,
because this amino acid may strain or disrupt the helix. Proline
substitution in the second P-box position resulted in the highest
affinity binding on everted repeats with AGGACA half-sites
(CTG-EvR(A)and CAG-EvR(A)), while this variant bound with much lower
affinity to the AGGTCA and AGGCCA half-sites of CTG-EvR(T) and
CTG-EvR(C). This result suggests that there may be conformational
differences in these half-site sequences that influence the ability of
the proline variant to bind to the DNA.
Figure 3:
Gel mobility shift analysis of amino acid
substitution mutants in the second P-box position of hT3R ,
comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions
were analyzed by gel mobility shift analysis on DNA elements composed
of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid
sequence of the receptor protein is indicated by the amino acid one
letter code, where the amino acid in bold is the one varied within this
set of mutants. Shown are strips of the autoradiographs containing the
bound complexes.
Changing the 5`-flanking sequence in
the everted repeat elements from CAG to CTG had only modest effects on
the binding of hT3R variants with amino acid substitutions at the
third P-box position. For the everted repeats with AGGTCA, AGGGCA and
AGGCCA half-sites, the switch from CAG to CTG 5`-flanking sequences did
not alter the identity of variant receptors that bound to the DNA, but
it did strengthen the weaker interactions observed between some
variants and the elements with CAG flanking sequences (Fig. 4).
Figure 4:
Gel mobility shift analysis of amino acid
substitution mutants in the third P-box position of hT3R ,
comparing a CAG to a CTG 5`-flanking sequence. DNA-protein interactions
were analyzed by gel mobility shift analysis on DNA elements composed
of everted half-sites with either a 5`-flanking sequence of CAG (top rows) or CTG (bottom rows). The P-box amino acid
sequence of the receptor protein is indicated by the amino acid one
letter code, where the amino acid in bold is the one varied within this
set of mutants. Shown are strips of the autoradiographs containing the
bound complexes. Dimer (D) and monomer (M) complexes
of bound hT3R are indicated.
Altering the
5`-sequence flanking the half-sites of an everted repeat TRE to a TG or
TA sequence has been reported to increase the affinity of T3R binding
by approximately 5-fold(4) . A 5`-sequence of TG flanking both
half-sites of a direct repeat TRE enhances the binding of T3R and is
contacted in the minor groove by the A box region located downstream of
the second zinc finger motif of the receptor(12) . A single
half-site sequence flanked by a 5` TG motif is sufficient for T3R
binding and activation, and it has been demonstrated that T3R interacts
in the major groove of the DNA with the methyl of the thymine base of
this motif(10, 11) . Based upon these observations, we
investigated whether the 5`-flanking sequence effect we observed on the
binding of variant T3R receptors to everted repeat elements was
also present on the direct repeat elements TC/GG-DR4 and CTG-DR4.
When comparing receptor binding to these two DR4 elements, we found
that the CTG flanking sequence increased the DNA binding affinity of
hT3R homodimers, but did not alter which P-box amino acid
sequences were compatible with binding (Fig. 5). The increase in
DNA binding affinity is not apparent in this figure because the time of
autoradiographic exposure was increased to detect any additional
binding resulting from the changes in the 5`-flanking sequences. The
patterns of receptor binding to TC/GG-DR4 and CTG-DR4 were virtually
identical to the patterns of receptor binding observed with the
CAG-EvR(T) everted repeat element (compare Fig. 2-4 with Fig. 5). Thus while a CTG flanking sequence will enhance T3R
binding affinity regardless of the orientation of half-sites in the
TRE, only the combination of a CTG flanking sequence with half-sites
oriented as an everted repeat results in the binding of additional
P-box variant receptors. This result suggests that the increase in
P-box sequences compatible with DNA binding on CTG-EvR elements may
require a protein-protein interaction that is unique to DNA binding on
an everted configuration of half-sites.
Figure 5:
Comparison of P-box specificity on direct
repeat elements with different flanking sequences. DNA-protein
interactions were analyzed by gel mobility shift analyses on direct
repeat elements of AGGTCA half-sites spaced by four nucleotides, which
either had a TC flanking the upstream half-site and a GG flanking the
downstream half-site, or CTG flanking both half-sites. The position of
the P-box substitution is indicated at the left-hand column by the
letter ``X'' within the wild type sequence of EGG,
with the identity of X being shown in the top row by
the amino acid one letter code. Shown are strips of the autoradiographs
containing the bound complexes. Dimer (D) and monomer (M) complexes of bound hT3R are
indicated.
Deleting the last 34 amino acids of hT3R alters the
affinity of the receptor for everted repeat elements, but has little
effect on the affinity of the receptor for inverted or direct repeat
elements(4) . This observation suggests that the last 34 amino
acids of hT3R are involved in an intermolecular interaction that
increases DNA binding affinity and cooperativity when hT3R is
bound as a homodimer to everted repeat elements.
This observation
prompted us to determine whether deleting the last 34 amino acids of
hT3R would influence which P-box variant receptors will bind to
CTG-EvR elements. Since the CTG flanking sequence change did not alter
the DNA binding specificity of variants with amino acid substitutions
at the third P-box position, only the first two P-box sets were tested (Fig. 6). The results clearly demonstrate that truncation of the
receptors influences which P-box substitutions are compatible with
binding to the CTG-EvR(T) and CTG-EvR(A) elements. The binding patterns
of the truncated hT3R s on CTG-EvR(T) are similar to the binding
patterns of full-length hT3R s on CAG-EvR(T). This result suggests
that the 34 amino acids at the C terminus are required for allowing
additional P-box sequence variants of hT3R to be compatible with
receptor binding to the CTG-EvR(T) element. A similar effect of
deleting the last 34 amino acids of the receptor was observed for the
binding of variants with substitutions in the second P-box position to
the CTG-EvR(A) element.
Figure 6:
Influence of amino acid deletion and
ligand binding the DNA binding properties of variant hT3R s.
DNA-protein interactions were analyzed by gel mobility shift analyses
using everted repeats of AGGTCA or AGGACA half-sites with CTG
5`-flanking sequences. A, DNA binding activity of selected
amino acid variants in the first P-box position of hT3R , where the
amino acid substitution is shown in bold. Shown are strips of
autoradiographs containing the bound complexes. The top strip demonstrates binding of the full-length receptors. The middle
strip shows binding of receptors which have been truncated by 34
amino acids at the C terminus. The bottom strip shows binding
of full-length receptors in the presence of T . B,
the top panel illustrates DNA binding by selected amino acid
variants in the second P-box position of hT3R to the everted
repeat with AGGTCA half-sites. Shown are strips of autoradiographs
containing the bound complexes. The top strip demonstrates
binding of the full-length receptors. The middle strip shows
binding of receptors which have been truncated by 34 amino acids at the
C terminus. The bottom strip shows binding of full-length
receptors in the presence of T . The bottom panel illustrates DNA binding by the same hT3R variants to the
everted repeat with AGGACA half-sites. Shown are strips of
autoradiographs containing the bound complexes. The top strip demonstrates binding of the full-length receptors. The bottom
strip shows binding of receptors which have been truncated by 34
amino acids at the C terminus.
Binding of thyroid hormone to T3R results in
the loss of cooperative binding of a homodimer to an everted repeat
element, but increases the binding affinity of a receptor monomer for
the DNA(21, 22, 23, 24) . The results in Fig. 6show that adding T to a binding reaction with
full-length hT3R proteins mimics the effects of deleting 34 amino
acids from the C terminus of the receptors. Thus the influence that CTG
flanking sequences in everted repeat elements have on P-box
compatibility with DNA binding is achieved through a cooperative
interaction of the C termini of the receptor homodimers, which may be
disrupted by amino acid deletion or by the binding of ligand.
DISCUSSION
The crystallographic studies of the DNA binding domains of
glucocorticoid and estrogen receptors bound to their cognate DNA
elements have elegantly shown the interaction of the P-box amino acids
with the central base pairs of the hexameric
half-site(20, 25) . The effects of mutating the P-box
amino acids of the thyroid hormone receptor on DNA binding and
transcriptional activation would suggest that they function in a
similar manner to those of the estrogen
receptor(16, 17) . In this article we have demonstrated
that in the context of the full-length hT3R the compatibility of a
variety of P-box amino acid sequences with DNA binding can vary
dramatically depending upon both the flanking sequence 5` to the
half-sites of a response element and the orientation of the half-sites
in the element. Thus the intermolecular interaction of thyroid hormone
receptor homodimers on everted repeat elements combined with an
interaction between the receptor and the 5`-flanking sequence of the
half-site can influence the interaction of the P-box amino acids with
the central base pairs of the half-site. Further investigation will be
necessary to understand the mechanisms of these effects.
The effect
of 5`-flanking sequence on the compatibility of amino acid
substitutions P-box with DNA binding was most dramatic at the first
P-box position and was partially effective for amino acid substitutions
at the second P-box position. This expansion of the number of P-box
variants that are capable of binding to DNA was dependent upon four
factors: the identity of the 5`-flanking nucleotides; the identity of
the fourth base pair of the hexameric half-sites; the everted
configuration of the half-sites; and a protein-protein interaction
involving the C termini of the homodimer partners. These observations
suggest that three bimolecular interactions influence the DNA binding
specificity of hT3R : a protein-protein interaction in the ligand
binding domain, an interaction between the DNA recognition -helix
of the receptor and the base pairs of the hexameric half-site, and
presumably another protein-DNA interaction between the base pairs
flanking each DNA half-site and another region of hT3R . The
complexity and interdependence of these interactions would indicate
that this DNA-protein interaction may be allosteric.
Additional DNA
contact(s) in the 5`-flanking sequence formed by other regions of the
hT3R could alter the DNA and/or receptor conformation to
compensate for a weakened interaction between the first P-box amino
acid and the central base pairs within the half-site. If such a
compensating DNA binding contact exists, our evidence suggests that it
requires an intermolecular interaction of the hT3R homodimer
partners when they are bound to an everted repeat. This presumptive
interaction of the flanking base pairs with the receptor has two
effects: it increases the strength of the DNA-receptor interaction and
it allows for additional amino acid substitutions at the first and
second P-box positions. However, these two effects are separate as
demonstrated by the observation that the affinity of receptor binding
to direct repeats and single half-sites can be enhanced by the presence
of a CTG flanking sequence without allowing for additional amino acid
substitutions in the P-box. In contrast, changing the flanking sequence
5` to each half-site in an everted repeat element increases the
affinity of receptor binding and allows more P-box variants to bind to
the DNA. This second effect appears to be dependent on the presence of
the 34 amino acids at the C terminus of the receptor and is disrupted
by the conformational changes that occur in the receptor when ligand is
bound.
Our data on the effects of P-box substitutions on DNA binding
were obtained in the context of hT3R . Extrapolation of these
results to the role of P-box amino acids in other receptors is unlikely
to be valid. Indeed, the relationship between P-box sequence and DNA
binding specificity reflects both the receptor and DNA binding site
used for analysis. A comprehensive study of the relationship between
P-box sequence and DNA binding specificity in the context of a mutant
DNA binding domain of the glucocorticoid receptor (GR-DBD) containing
an EGA P-box sequence was recently reported(26) . In that study
all possible amino acid substitutions were constructed in the first and
second P-box positions of this mutant GR-DBD, and the effects on
transcriptional activity from four inverted repeat elements were
assayed in yeast. In this unusual context, substitution of the
glutamate in the mutant EGA P-box of this GR-DBD with 12
different amino acids (Trp, Tyr, Phe, His, Gln, Asp, Ala, Met, Asn,
Ser, Cys, and Pro) resulted in transcriptional activation from an
inverted repeat of AGGTCA half-sites spaced by three nucleotides. All
of these mutations marginally decreased transcriptional activity from
the inverted repeat with AGGTCA half-sites compared to the GR-DBD with
the EGA P-box, but increased activity from an element composed of
AGAACA half-sites. The remaining seven variant receptors were inactive
in this assay. From this observation, it was concluded that the
function of the glutamate in the P-box of the estrogen receptor was to
prevent the protein from binding to an inappropriate sequence. The
differences between these results and those we report in this study
illustrate the need for caution in extrapolating from one receptor
system to others. The cooperative interactions formed between two
GR-DBDs are strong enough to allow one of the monomers to bind out of
register with respect to the DNA on an inappropriately spaced element
(inverted repeat spaced by four rather than three base
pairs)(25) . This strong cooperativity may compensate for the
loss of contact by the first P-box amino acid in those GR-DBD variants
where glutamate was replaced.
The protein-protein interactions which
lead to cooperative binding of the GR to an inverted repeat (25, 27) and T3R to an everted repeat (4) differ
substantially. These differences in the protein-protein interactions
are likely to have different influences on the compatibility of P-box
sequences in the two receptors with DNA binding specificity. Thus it is
not surprising that our results differ from those obtained by Zilliacus
and co-workers (26) using the mutant GR-DBD system. In addition,
our data illustrate that factors beyond the confines of the DNA
recognition -helix of the hT3R and the hexameric half-site of
the TRE can influence the function of the P-box amino acids in
discriminating DNA sequences. Another significant influence might arise
from apparently small differences in the ``parent'' P-box
sequences of the different receptors. We have previously demonstrated
that the P-box operates as a functional entity in the sense that a
double mutation like EAA will have a phenotype that is not
simply the sum of the phenotypes of the two single mutations EAG
and EGA(16) . Therefore one cannot simply assume that
substitutions of amino acids for glutamate will have the same phenotype
in the EGG P-box of hT3R as they will in the EGA P-box found
naturally in the estrogen receptor and also in the mutant GR-DBD used
by Zilliacus and co-workers(26) .
While very useful
information is obtained from crystallographic studies of the DNA
binding domains of the receptor superfamily, the manner in which
isolated domains interact with their DNA target sequences may not
entirely reflect the way that full-length receptors bind to DNA
elements. Our data also emphasize the point that full-length receptors
may interact with a DNA sequence motif that significantly extends
beyond the canonical 6-base pair half-sites. Sequences flanking repeat
elements can have an influence on receptor interaction with the DNA
that must be considered. Such effects will need to be investigated in
further detail.
FOOTNOTES
- *
- This work was supported in
part by a grant (to P. J. R.) from the National Cancer Institute of
Canada with funds from the Canadian Cancer Society. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- Recipient of a National Cancer Institute of
Canada postdoctoral fellowship.
- ¶
- To whom
correspondence should be addressed. Tel.: 604-721-7088; Fax:
604-721-6227.
- The abbreviations used are: T3R,
thyroid hormone receptor; TRE, thyroid hormone response elements; EvR,
everted repeat; DR, direct repeat; GR-DBD, glucocorticoid receptor-DNA
binding domain.
ACKNOWLEDGEMENTS
We thank R. Evans for providing plasmid peA101, C.
Juricic for assistance in the construction of mutant receptor clones,
and J. Faris for helpful discussions.
REFERENCES
- Evans, R. M. (1988) Science240, 889-895
[Abstract/Free Full Text]
- Laudet, V., Hanni, C., Coll, J., Catzeflis, F., and Stehelin, D. (1992) EMBO J.11, 1003-1013
[Medline]
[Order article via Infotrieve]
- Glass, C. K. (1994) Endocr. Rev.15, 391-407
[Abstract/Free Full Text]
- Näär, A. M., Boutin, J. M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell65, 1267-1279
[CrossRef][Medline]
[Order article via Infotrieve]
- Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell65, 1255-1266
[CrossRef][Medline]
[Order article via Infotrieve]
- Williams, G. R., Harney, J. W., Moore, D. D., Larsen, P. R., and Brent, G. A. (1992) Mol. Endocrinol. 6, 1527-1537
- Wilson, T. E., Paulsen, R. E., Padgett, K. A., and Milbrandt, J. (1992) Science256, 107-110
[Abstract/Free Full Text]
- Harding, H. P., and Lazar, M. A. (1993) Mol. Cell. Biol.13, 3113-3121
[Abstract/Free Full Text]
- Ueda, H., Sun, G. C., Murata, T., and Hirose, S. (1992) Mol. Cell. Biol.12, 5667-5672
[Abstract/Free Full Text]
- Katz, R. W., and Koenig, R. J. (1993) J. Biol. Chem.268, 19392-19397
[Abstract/Free Full Text]
- Schrader, M., Becker-Andre, M., and Carlberg, C. (1994) J. Biol. Chem.269, 6444-6449
[Abstract/Free Full Text]
- Kurokawa, R., Yu, V. C., Näär, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes & Dev.7, 1423-1435
[CrossRef]
- Danielsen, M., Hinck, L., and Ringold, G. M. (1989) Cell57, 1131-1138
[CrossRef][Medline]
[Order article via Infotrieve]
- Umesono, K., and Evans, R. M. (1989) Cell57, 1139-1146
[CrossRef][Medline]
[Order article via Infotrieve]
- Mader, S., Kumar, V., de Verneuil, H., and Chambon, P. (1989) Nature338, 271-274
[CrossRef][Medline]
[Order article via Infotrieve]
- Nelson, C. C., Hendy, S. C., Faris, J. S., and Romaniuk, P. J. (1994) Mol. Endocrinol.8, 829-840
[Abstract/Free Full Text]
- Nelson, C. C., Faris, J. S., Hendy, S. C., and Romaniuk, P. J. (1993) Mol. Endocrinol.7, 1185-1195
[Abstract/Free Full Text]
- Nelson, C. C., Hendy, S. C., and Romaniuk, P. J. (1995) J. Biol. Chem.270, 16981-16987
[Abstract/Free Full Text]
- Baniahmad, A., Steiner, C., Köhne, A. C., and Renkawitz, R. (1990) Cell61, 505-514
[CrossRef][Medline]
[Order article via Infotrieve]
- Schwabe, J. W. R., Chapman, L., Finch, J. T., and Rhodes, D. (1993) Cell75, 567-578
[CrossRef][Medline]
[Order article via Infotrieve]
- Andersson, M. L., Nordstrom, K., Demczuk, S., Harbers, M., and Vennstrom, B. (1992) Nucleic Acids Res.20, 4803-4810
[Abstract/Free Full Text]
- Yen, P. M., Sugawara, A., and Chin, W. W. (1992) J. Biol. Chem.267, 23248-23252
[Abstract/Free Full Text]
- Miyamoto, T., Suzuki, S., and Degroot, L. J. (1993) Mol. Endocrinol.7, 224-231
[Abstract/Free Full Text]
- Ribeiro, R. C., Kushner, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol.6, 1142-1152
[Abstract/Free Full Text]
- Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991) Nature352, 497-505
[CrossRef][Medline]
[Order article via Infotrieve]
- Zilliacus, J., Carlstedt-Duke, J., Gustafsson, J. A., and Wright, A. P. H. (1994) Proc. Natl. Acad. Sci. U. S. A.91, 4175-4179
[Abstract/Free Full Text]
- Freedman, L. P., and Towers, T. L. (1991) Mol. Endocrinol.5, 1815-1826
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P. M. Yen
Physiological and Molecular Basis of Thyroid Hormone Action
Physiol Rev,
July 1, 2001;
81(3):
1097 - 1142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chusacultanachai, K. A. Glenn, A. O. Rodriguez, E. K. Read, J. F. Gardner, B. S. Katzenellenbogen, and D. J. Shapiro
Analysis of Estrogen Response Element Binding by Genetically Selected Steroid Receptor DNA Binding Domain Mutants Exhibiting Altered Specificity and Enhanced Affinity
J. Biol. Chem.,
August 13, 1999;
274(33):
23591 - 23598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Nelson, S. C. Hendy, J. S. Faris, and P. J. Romaniuk
Retinoid X Receptor Alters the Determination of DNA Binding Specificity by the P-box Amino Acids of the Thyroid Hormone Receptor
J. Biol. Chem.,
August 9, 1996;
271(32):
19464 - 19474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Judelson and M. L. Privalsky
DNA Recognition by Normal and Oncogenic Thyroid Hormone Receptors
J. Biol. Chem.,
May 3, 1996;
271(18):
10800 - 10805.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Nelson, S. C. Hendy, and P. J. Romaniuk
Relationship between P-box Amino Acid Sequence and DNA Binding Specificity of the Thyroid Hormone Receptor
J. Biol. Chem.,
July 14, 1995;
270(28):
16981 - 16987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ito, J. C. Achermann, and J. L. Jameson
A Naturally Occurring Steroidogenic Factor-1 Mutation Exhibits Differential Binding and Activation of Target Genes
J. Biol. Chem.,
October 6, 2000;
275(41):
31708 - 31714.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|