|
Volume 270,
Number 29,
Issue of July 21, pp. 17381-17385, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Naturally Occurring Point
Mutation Confers Broad Range Tolerance to Herbicides That Target
Acetolactate Synthase (*)
(Received for publication, April 12, 1995; and in revised form, May 31, 1995)
Paul
Bernasconi (§)
,
Alison R.
Woodworth
,
Barbara
A.
Rosen
,
Mani V.
Subramanian
,
Daniel
L.
Siehl
From the From Sandoz Agro Inc., Research Division, Palo Alto, California
94304-1104
ABSTRACT
INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Acetolactate synthase (ALS) inhibitors are among the most
commonly used herbicides. They fall into four distinct families of
compounds: sulfonylureas, imidazolinones, triazolopyrimidine
sulfonanilides, and pyrimidinyl oxybenzoates. We have investigated the
molecular basis of imidazolinone tolerance of two field isolates of
cocklebur (Xanthium sp.) from Mississippi and Missouri. In
both cases, tolerance was conferred by a form of ALS that was less
sensitive to inhibitors than the wild type. The insensitivity pattern
of the Mississippi isolate was similar to that of a commercial mutant
of corn generated in the laboratory: ICI 8532 IT. Sequencing revealed
that the same residue (Ala Thr) was mutated in both
Mississippi cocklebur and ICI 8532 IT corn. ALS from the Missouri
isolate was highly insensitive to all the ALS herbicide families,
similar in this respect to another commercial corn mutant: Pioneer 3180
IR corn. Sequencing of ALS from both plants revealed a common mutation
that changed Trp to Leu. The sensitive cocklebur ALS
cDNA, fused with a glutathione S-transferase, was functionally
expressed in Escherichia coli. The recombinant protein had
enzymatic properties similar to those of the plant enzyme. All the
possible point mutations affecting Trp were investigated
by site-directed mutagenesis. Only the Trp Leu mutation yielded
an active enzyme. This mutation conferred a dramatically reduced
sensitivity toward representatives of all four chemical families,
demonstrating its role in herbicide tolerance. This study indicates
that mutations conferring herbicide tolerance, obtained in an
artificial environment, also occur in nature, where the selection
pressure is much lower. Thus, this study validates the use of
laboratory models to predict mutations that may develop in natural
populations.
INTRODUCTION
Acetolactate synthase (ALS ; ( )EC
4.1.3.18; acetohydroxyacid synthase) catalyzes the condensation of two
molecules of pyruvate or one molecule of pyruvate and one of
2-ketobutyrate to form 2-acetolactate or 2-aceto-2-hydroxybutyrate,
respectively(1) . This is the first enzyme in the biosynthetic
pathway leading to the production of valine, leucine, and isoleucine in
plants and microorganisms. Sequence comparisons have revealed
substantial homologies between the mature forms of ALS of bacteria
(large subunit), yeast, and higher plants (for a review, see (2) ). The eukaryotic ALS proform contains a transit peptide at
the N terminus that directs the enzyme to the chloroplast in higher
plants(3, 4) .
There are many structurally diverse
families of potent inhibitors of ALS (for a review, see (5) ).
A number of compounds representing three distinct chemical families, i.e. sulfonylureas (SU) (6) , imidazolinones
(IM)(7) , and triazolopyrimidine sulfonanilides
(TP)(8) , are produced commercially as herbicides, and there
are many others in development such as pyrimidinyl
oxybenzoates(9) . The popularity of ALS-inhibiting herbicides
can be attributed to (i) their efficacy at low use rates against a
broad spectrum of weeds, (ii) multi-crop selectivity, (iii) lack of
mammalian toxicity, and (iv) favorable environmental
profile(10) . However, constant and extensive use of
ALS-inhibiting herbicides has resulted in selection of tolerant weeds
worldwide(10) . Development of tolerance to SU, since its first
appearance in 1987, has been particularly dramatic(11) . In
addition, isolation of tolerant lines in tissue culture for different
families of ALS-inhibiting herbicides has been reported by a number of
laboratories (9, 12) . Since the structurally diverse
ALS inhibitors are competitive with one another with respect to binding
to the enzyme(13, 14) , tolerance toward a particular
herbicide has resulted in varying degrees of cross-tolerance to the
other chemicals(9, 12, 15) .
The
alteration of ALS by one or more point mutations is the only reported
mechanism of tolerance(10) . The lesion causing tolerance to SU
has been localized to a single point mutation affecting proline 197 in
ALS in Arabidopsis thaliana(16) and position 196 in
tobacco(17) . The same residue has also been implicated in SU
tolerance in the fields(18) . Only one IM-specific tolerance
has been confirmed in the field so far(19, 20) , but
the mutation involved has not been identified. Two IM-specific
mutations have been obtained in the laboratory: first, a Ser Asp change in the ALS gene of A. thaliana(21) and second, an Ala Thr mutation
in corn(22) . The latter mutant was developed into a commercial
product: ICI 8532 IT corn. Finally, in yeast, 10 distinct loci in the
ALS gene have been shown to confer SU tolerance(23) , but the
specificity of tolerance for each locus with respect to other families
of ALS inhibitors has not been defined.
We have cloned and sequenced
the mutated ALS gene from two field isolates of cocklebur, a common
broadleaf weed that has developed tolerance to
IM(19, 20) . The first isolate (MS-XANST), from a
field in Mississippi, showed specific tolerance to IM. The second
isolate, (MO-XANST) from Missouri, showed high level and broad based
tolerance to all classes of ALS inhibitors. The mutation conferring
broad based tolerance was further studied by site-directed mutagenesis,
implicating it in the dramatically high level and broad based tolerance
to all ALS-inhibiting herbicides.
MATERIALS AND METHODS
Plant MaterialSeeds of wild-type cocklebur
(S-XANST) were from Azlin Seeds Service (Leland, MS). Seeds of the
Mississippi isolate (MS-XANST) were provided by the Sandoz Agro, Inc.
field station in Mississippi. Seeds of the Missouri isolate (MO-XANST)
were collected from a field near Caruthersville, MO in the fall of 1993
and were kindly provided by Professor Andy Kendig (University of
Missouri). These seeds were grown in a greenhouse, and mature leaves
were harvested. See (15) for details on Pioneer 3180 IR corn
and ICI 8532 IT corn.
ChemicalsThe following chemicals were used as
representatives of each ALS inhibitor family: chlorsulfuron (SU),
imazethapyr (IM), flumetsulam (TP), and pyrimidinyl oxybenzoate (POB).
SU, IM, and TP were obtained from Chem Service, Inc. (West Chester,
PA). POB (9) was synthesized by Sandoz Agro, Inc. chemists.
Partial Purification of the Plant Enzyme and ALS
AssayPartially purified ALS active fractions were prepared from
young green leaves as described by Schmitzer et
al.(20) . The ALS assay was performed as described by
Siehl et al.(15) .
RNA, cDNA, and Genomic DNA PreparationProtocols
from Ausubel et al.(24) were used. About 20 g of
frozen leaves were ground to a fine powder in a coffee grinder cooled
with dry ice. Total RNA was prepared using the guanidium isothiocyanate
method(24) . mRNA was prepared by oligo(dT) chromatography
(Life Technologies, Inc.) from 1.5 mg of total RNA. mRNA was used for
both cDNA synthesis and Northern blot analysis(24) . Genomic
DNA was prepared from 20 g of leaves using established protocols
involving CsCl gradient centrifugation(24) .
Library ConstructionS-XANST cDNA was used for the
preparation of a [lamdba]gt10 library according to the vector
manufacturer's instructions (Promega, Madison, WI).
Cloning of S-XANST ALSTwo degenerate PCR primers
(Keystone Labs Inc., Menlo Park, CA) were designed in regions of the
ALS gene conserved through evolution between plants, bacteria, and
yeast. Their sequences were ATG(CT)T(ACTG)GG(ACTG)ATGCA(CT)GG and
ACAT(CT)TG(AG)TG(CT)TG(ACTG)CC(ACTG)AC. The corresponding 398-base pair
fragment from wild-type ALS was amplified (Ampli-Taq kit,
Perkin-Elmer) from 10 ng of S-XANST cDNA and cloned into pBluescript
SK(+) (Stratagene, La Jolla, CA).
The library was screened by
plaque hybridization with a probe obtained by random labeling (Promega)
of the cloned PCR fragment. Both strands of the largest positive insert
were sequenced with a combination of subcloning and custom primers
(Keystone Labs Inc.).
Cloning of MS-XANST and MO-XANST ALSPCR primers
were derived from the S-XANST ALS sequence. PCR amplification was
performed on 10 ng of MS-XANST or MO-XANST cDNA. The amplified
fragments were cloned into pCR-Script SK(+) (Stratagene), and at
least two independent clones were sequenced for each region.
Cloning of Pioneer 3180 IR Corn ALSPioneer 3180
IR corn kernels (Pioneer Hi-Bred) were germinated in soil and grown for
1 month in a greenhouse. Mature leaves were harvested and used for
the preparation of cDNA as described above. PCR primers were designed
based on the published sequence of wild-type ALS(25) . The
amplified fragments were cloned and sequenced as described above.
Expression of S-XANST ALSThe fusion protein
vector pGEX-2T (Pharmacia Biotech Inc.) was used. PCR amplification was
used to introduce BamHI sites at the beginning (primer
sequence: CACACATGGATCCATGGCGGCCATCCC) and the end (primer sequence:
CATTGAGGATCCATATTTCATTCTGCC) of the complete open reading frame coding
for the enzyme. The obtained fragment was cloned in both orientations
in the expression vector, and the construct was used to transform Escherichia coli MC1061 cells. Expression was typically
performed in 50-ml cultures. The cells were grown at 37 °C with
shaking at 300 rpm. Protein expression was induced when the culture
reached an A of 0.5 by the addition of 1
mM isopropyl-1-thio- -D-galactopyranoside. The
culture was allowed to grow until late exponential phase and harvested.
The fusion protein was prepared by chromatography on GSH-Sepharose
(Pharmacia Biotech Inc.)(26) . The extraction buffer was
composed of 50 mM EPPS, pH 7.5, 10 mM
MgCl , 5 mM dithiothreitol, 10% ethylene glycol, 10
µM FAD, 1 mM pyruvate, 1 µg/ml leupeptin, 2
µg/ml aprotinin, and 1 µg/ml pepstatin.
Site-directed MutagenesisSite-directed
mutagenesis of the expressed S-XANST ALS was performed directly on the
plasmid derived from pGEX-2T containing the ALS cDNA. A unique site
elimination mutagenesis kit (Pharmacia Biotech Inc.) was used with the PstI/SacII primers for selection and custom
mutagenesis primers (Keystone Labs Inc.). The Trp codon (TGG) was
mutated to TCG (Ser), AGG (Arg), TGT (Cys), GGG (Gly), and TTG (Leu).
The plasmids containing the mutated cDNA were expressed under the same
conditions as described above, except that the bacteria were grown at
30 °C at 125 rpm and were induced with 0.5 mM
isopropyl-1-thio- -D-galactopyranoside. The extraction and
elution buffers were the same as described above, but with 10 mM pyruvate.
ALS Assay of the Recombinant ProteinThe assay was
performed as described in (15) , except that 0.25-1
µg of purified fusion protein was used, and the incubation time was
reduced to 30 min. Protein was determined using the Bio-Rad Bradford
reagent.
RESULTS
Enzymatic Activity of S-XANST, MS-XANST, and MO-XANST
ALSPartially purified fractions of each cocklebur biotype were
used for the determination of enzymatic activity. The K for pyruvate for each biotype was found
to be in the range of 3.2-6.6 mM. The reaction was
linear in the presence of 50 mM pyruvate for at least 90 min.
The plant enzyme was inactivated upon prolonged incubation at room
temperature and upon freezing.
Inhibition Properties of Plant ALSInhibition of
the plant enzymes by representatives of the four chemical families was
studied. The IC values for the inhibition by SU, IM, TP,
and POB were determined, and the results are summarized in the Table 1. The results clearly indicate that a modified enzyme was
responsible for IM tolerance in MS-XANST and for the broad based
tolerance in MO-XANST.
Sequence of S-XANST ALSBefore establishing the
mutations present in MS-XANST and MO-XANST, it was necessary to obtain
the sequence of ALS from the wild-type cocklebur (S-XANST). Using the
two degenerate primers, a 398-base pair fragment was amplified from
S-XANST cDNA. Northern blot analysis of leaf mRNA, probed with the
amplified fragment, revealed the presence of a major transcript of 3.5
kilobases (>90% of the signal) with minor mRNA bands at 5 and 6
kilobases. Screening of 100,000 phages from the cDNA library yielded
four positive clones. The longest cDNA insert was 2146 base pairs and
encoded a 648-residue protein. The resulting protein sequence, together
with other sequences relevant to this work, is shown in the Fig. 1. The N-terminal 77-residue chloroplast transit peptide
shared no homology with any other peptide with similar function. The
571-residue mature protein was 89, 78, and 46% homologous to the
corresponding ALS of tobacco, corn, and yeast, respectively. PCR
analysis of the genomic DNA revealed that the ALS gene(s) was devoid of
introns, i.e. the amplified fragments from genomic DNA did not
differ in size from the fragments obtained from the cDNA.
Figure 1:
Primary sequence alignment of
S-XANST and wild-type corn ALS isozyme ZMAHAS108 (CORN) (25) . Blackboxes identify residues
conserved between the two enzymes. The numbers on the right
indicate amino acid positions. The mutations in MS-XANST (boxedT) and MO-XANST ALS are indicated on top of the alignment (MO/MS-XANST). ICI 8532 IT corn (boxedT;
from (22) ) and Pioneer 3180 IR corn ALS mutations are
indicated at the bottom of the alignment (IR/IT-CORN). The asterisk indicates the proline residue involved in the
SU-specific mutations(16, 17) , and the numbersign indicates the residue involved in the IM-specific
mutation(21) .
Sequence of MS-XANST ALSThe sequence of the
mature form of MS-XANST ALS was established in three overlapping
fragments of the ALS cDNA. The fragments encompassed nucleotides
298-748, 530-1860, and 1419-2056. Nine point mutations were
detected, with two of them translating into an amino acid change:
Ala Thr and Phe Leu (Fig. 1).
Sequence of MO-XANST ALSThe sequence of ALS from
MO-XANST was obtained by similar means, except that the first
overlapping fragment was from nucleotides 102 to 1123, thus giving the
complete proform of ALS. Eight nucleotide changes were detected, five
of which caused a mutation in the sequence of the protein. The amino
acid changes were Lys Glu, Phe
Leu, Gln His, Asn Ser, and
Trp Leu (Fig. 1).
Sequence of Pioneer 3180 IR Corn ALSThe sequence
of mature ALS from 3180 IR corn was obtained by PCR amplification of
two overlapping fragments: nucleotides 904-1552 and 1138-2578 of
the published sequence ZMAHAS108(25) . Two mutations in the
protein sequence were detected: Trp was mutated to Leu,
and Glu was changed to Val (Fig. 1).
Expression of S-XANST ALSS-XANST was expressed in E. coli as a protein fused to glutathione S-transferase. Upon expression, a 97-kDa product was detected
by SDS-polyacrylamide gel electrophoresis in GSH-Sepharose-purified
fractions. Two other proteins of 65 and 32 kDa were also present in
these fractions. Further separation by gel filtration showed that ALS
activity copurified with the 97-kDa protein. None of these products
were detected in purified extracts from bacteria expressing a construct
in which the ALS cDNA was inserted backwards. In a similar fashion, no
correct product was detected upon expression of a construct composed of
the glutathione S-transferase and the mature form of ALS
(Ala -Tyr ). In the latter case,
inclusion bodies were clearly observable in the bacteria, whereas they
could not be detected in bacteria expressing the fused ALS proform.
Only the construct comprising the ALS proform was used for the rest of
the work. A typical experiment yielded 3 mg of purified fusion
protein/liter of culture with a specific activity of 250 µmol/h/mg.
The K for pyruvate was 6 mM. The
stability of the recombinant enzyme was much greater than that of plant
ALS since it was not inactivated by prolonged incubation at room
temperature or repeated freezing and thawing. Its sensitivity toward
inhibitors was similar to that of the S-XANST enzyme (Table 2).
Mutagenesis of S-XANSTWe investigated the effect
of a point mutation of the Trp codon by site-directed mutagenesis. Out
of the nine possibilities, two of them gave a stop codon (TGA and TAG)
and were not pursued since a truncated enzyme would likely be inactive.
The other point mutations encode for cysteine, glycine, leucine,
arginine, and serine. The Cys mutation gave an unstable protein, and no
enzyme of the correct molecular mass could be detected by
SDS-polyacrylamide gel electrophoresis. The other four mutations gave a
fusion protein with the correct molecular mass, but only the leucine
mutation yielded an active ALS. Active enzyme was obtained only when a
lower level of induction (0.5 mM
isopropyl-1-thio- -D-galactopyranoside instead of 1
mM) and a lower aeration and temperature (200 rpm at 30 °C
instead of 300 rpm at 37 °C) were used. A yield of 0.4 mg/liter was
obtained with a specific activity of 50 µmol/h/mg. This protein had
a K of 2 mM for pyruvate. The
enzyme with the Trp Leu mutation was assayed for sensitivity
toward the different chemical classes and was comparable to the
MO-XANST enzyme (Table 2).
DISCUSSION
Enzymatic Properties and Inhibitor Sensitivity of the
Native Plant EnzymesSince only partially purified fractions
from S-XANST, MS-XANST, and MO-XANST were used, we did not determine
the composition of ALS isozymes in our preparation. But, based on
literature reports (2) and as further confirmed our by
Northern blot analysis, we assumed that the observed activity was
mostly due to one major isozyme. As is the case for most broadleaf
plants, S-XANST ALS was susceptible to representatives of all families
of ALS inhibitors used in this study. The MS-XANST enzyme was
particularly less sensitive to imazethapyr, with a modest
desensitization to the others (Table 1). The pattern of tolerance
to ALS inhibitors in MS-XANST was comparable to that observed with the
hybrid corn ICI 8532 IT (Table 1)(15) . In contrast,
MO-XANST was highly tolerant to all ALS inhibitors tested, like the
commercial hybrid Pioneer 3180 IR corn (Table 1). None of the
mutant lines showed any significant change with respect to sensitivity
to leucine (data not shown).
Sequence of S-XANST ALSNorthern blot analysis
showed a major transcript for ALS and that ALS activity is mostly due
to one isozyme. The demonstration, by PCR, that the cocklebur ALS gene
is intronless further validates the same observation made by other
researchers working with corn(25) . Although the S-XANST ALS
primary sequence did not differ substantially from other plant ALS
sequences, there was a noteworthy variation: the serine implicated in
imidazolinone tolerance in Arabidopsis (Ser ) (21) was replaced by Ala in cocklebur (Ala ).
Sequence of MS-XANST ALSTwo mutations affecting
the primary structure of ALS were found. The mutation Ala Thr is identical to the mutation described for ICI 8532
IT(22) . This finding makes the correlation between sensitivity
toward inhibitors and gene mutation of the natural isolate (MS-XANST)
and the laboratory isolate (ICI 8532 IT) quite striking. These two
mutations were obtained using different selective pressures, and one
could have believed that the mutation obtained using a high selection
pressure and chemical mutagenesis in the laboratory could only occur at
an extremely low frequency in the field. The Phe
Leu mutation was probably a natural variation with no consequences for
inhibitor tolerance since a Leu residue in that position is present in
ALS from several other plants.
Sequence of MO-XANST ALSOf the five mutations
found in MO-XANST, Lys Glu and Phe Leu can be quickly dismissed for consideration for a role
in tolerance. The first one occurs in the chloroplast transit peptide
that is cleaved from the mature protein. The second one is the same
variation found in MS-XANST. At this point, there was no indication of
the involvement of the other three mutations in tolerance. Two of them,
Gln His and Asn Ser, affect
residues that are not conserved in yeast and may not play any role in
tolerance. The most interesting mutation was the Trp Leu mutation. Such a change has been shown to increase SU
tolerance in tobacco already harboring the Pro mutation characteristic
of SU tolerance(17) . The Trp mutation has never
been described alone in plants, and the proline residue
(Pro ) is unchanged in MS-XANST and MO-XANST. Work done in
yeast indicated that the mutation of this Trp residue confers an
increased tolerance to SU(23) .
Sequence of Pioneer 3180 IR Corn ALSThe pattern
of cross-tolerance in MO-XANST was similar to that in the commercial
hybrid Pioneer 3180 IR corn(22) . There is no report in the
literature about the nature of the mutation in 3180 IR corn; hence, a
comparison of the mutations in MO-XANST and 3180 IR corn ALS was
undertaken to pinpoint the mutation responsible for the broad based
tolerance to ALS inhibitors. Of the two mutations detected in 3180 IR
corn, Glu was probably not involved in tolerance since
this residue is not conserved among the different ALS enzymes. The
Trp Leu mutation corresponded to the Trp mutation
in MO-XANST (Trp ), making it a very likely candidate for
the mutation responsible for the high degree of tolerance. Two
questions needed to be answered: first, whether the Trp mutation alone
was sufficient to confer tolerance, and second, whether the Trp residue
could be mutated to amino acids other than Leu and still confer
tolerance. Indeed, in the case of SU tolerance, all six possible single
point mutations in the first or second base of the Pro codon have been
shown to occur and confer SU tolerance(18) .
Expression of S-XANST ALSTwo reports describe the
functional expression of plant ALS in bacteria. Smith et al.(4) and Singh et al.(27) reported the
functional expression of a plant ALS in a bacteria deficient in its own
ALS. Our expression system differed in several ways. First, since ALS
is fused to glutathione S-transferase, it could be purified in
one simple chromatography step on GSH-Sepharose, and second, the need
for an ALS-deficient bacteria was avoided. Also, the construct provided
an easy template on which to perform site-directed mutagenesis. Active
protein was recovered only when the complete proform of S-XANST ALS was
fused to the glutathione S-transferase. This finding is well
in accordance with that of Smith et al.(4) . ALS
activity was associated with the 97-kDa protein, contradicting the
results of Singh et al.(27) . In their expression
system, cleavage of the chloroplast transit peptide was needed to
obtain an active enzyme.
The specific activity of the recombinant
protein compared favorably with the best specific activity obtained for
plant ALS, i.e. 190 µmol/h/mg for ALS purified from
barley(28) . The specific activities of the other recombinant
plant proteins were 4 and 2.6 µmol/h/mg (4) and 5
µmol/h/mg(27) ; but the degree of purification has not been
reported, and it is assumed that these values were for only partially
purified enzymes. The K for pyruvate for
the expressed fusion protein was in accordance with the K generally reported for plant ALS (28) and the other recombinant ALS
enzymes(4, 27) . A striking feature is the stability
of the expressed ALS compared with the enzyme from various plant
sources. It is conceivable that the presence of the chloroplast transit
peptide may be a major contributing factor since, without this peptide,
proper expression could not be achieved. Inhibitor sensitivity was
identical to that for the plant enzyme with a major difference. The
feedback inhibition by valine and leucine was lost in the recombinant
enzyme, a finding consistent with the results of Singh et
al.(27) .
Mutagenesis of S-XANST ALSOnly the point
mutations affecting Trp were investigated since the most
dramatic tolerance toward ALS inhibitors was observed in a mutation
affecting this residue. In our bacterial expression system, only the
Trp Leu mutation yielded an active protein. This mutation may
negatively impact the stability of the protein since milder expression
conditions were needed to obtain it in an active form. The increase in
the IC values for the different ALS inhibitors for this
recombinant protein correlated well with the values for the MO-XANST
and Pioneer 3180 IR corn enzymes.
Our study demonstrates that a
single point mutation in the ALS gene, Trp Leu,
can confer to a weed a broad based and high level of tolerance to all
the chemical families of inhibitors. Occurrence of this mutation will
impact negatively on the widely used commercial products that are ALS
inhibitors. Moreover, we also demonstrate that, given the time,
mutations obtained using extreme selective pressures in the laboratory
have occurred in nature and are now being selected from wild-type
populations during herbicide application.
FOOTNOTES
- *
- The costs of publication of this article
were defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been
submitted to the GenBank®/EMBL Data Bank with accession
number(s) U16279 [GenBank® Link]and
U16280[GenBank® Link].
- §
- To
whom correspondence should be addressed: Sandoz Agro Inc., Research
Div., 975 California Ave., Palo Alto, CA 94304-1104. Tel.:
415-354-3552; Fax: 415-493-1073.
- The
abbreviations used are: ALS, acetolactate synthase; SU, sulfonylurea;
IM, imidazolinone; TP, triazolopyrimidine sulfonanilide; MS-XANST,
cocklebur, Mississippi ecotype; MO-XANST, cocklebur, Missouri ecotype;
S-XANST, wild-type cocklebur (Xanthium sp.); IR,
imidazolinone-resistant; IT, imidazolinone-tolerant; POB, pyrimidinyl
oxybenzoate; PCR, polymerase chain reaction; EPPS, N-2-hydroxyethylpiperazine-N`-3-propanesulfonic acid.
ACKNOWLEDGEMENTS
We are indebted to Professor Andy Kendig for providing
the seeds for MO-XANST. We thank Dr. Robert Lamoreaux and Randy Ratliff
for providing the MS-XANST seeds. We acknowledge the excellent
greenhouse work of Tom DeHoog.
REFERENCES
- Bryan, J. K. (1990) The Biochemistry of Plants (Conn, E. E., and Stumpf, P. K., eds) pp. 161-165, Academic Press, Inc., New York
- Mazur, B. J., Chui, C.-F., and Smith, J. K.(1987)Plant Physiol. 85, 1110-1117
[Abstract/Free Full Text]
- Miflin, B. J. (1974)Plant Physiol. 54, 550-555
[Abstract/Free Full Text]
- Smith, J. K., Schloss, J. V., and Mazur, B. J.(1989)Proc. Natl. Acad. Sci. U. S. A. 86, 4179-4183
[Abstract/Free Full Text]
- Babczinski, P., and Zelinski, T.(1991)Pestic. Sci. 31, 305-323
[CrossRef]
- Sauers, R. F., and Levitt, G.(1984)ACS Symp. Ser. 255, 21-28
- Los, M.(1984) ACS Symp. Ser. 255, 29-44
- Kleschick, W. A., Costales, M. J., Dunbar, J. E., Meikle, R. W., Monte, W. T., Pearson, N. R., Snider, S. W., and Vinogradoff, A. P.(1992) Pestic. Sci. 29, 341-355
- Subramanian, M. V., Hung, H. Y., Dias, J. M., Miner, V. W., Butler, J. H., and Jachetta, J. J. (1990)Plant Physiol. 94, 239-244
[Abstract/Free Full Text]
- Saari, L. L., Coterman, J. C., and Thill, D. C. (1994) Herbicide Resistance in Plants: Biology and Biochemistry (Powles, S., and Holtum, J., eds) pp. 83-139, Lewis Publishers, Inc., Boca Raton, FL
- Mallory-Smith, C. A., Thill, D. C., and Dial, M. J.(1990)Weed Technol. 4, 163-168
- Saxena, P. K., and King, J.(1988)Plant Physiol. 86, 863-867
[Abstract/Free Full Text]
- Subramanian, M. V., Gallant, V. L., Dias, J. M., and Mireles, L. M.(1991) Plant Physiol. 96, 310-313
[Abstract/Free Full Text]
- Schloss, J. V., Ciskanik, L. M., and Van Dyk, D.(1988)Nature 331, 360-362
[CrossRef]
- Siehl, D. L., Bengston, A. S., Brockman, J. P., Butler, J. H., Kraatz, G. W., Lamoreaux, R. J., and Subramanian, M. V. (1995) Crop Sci., in press
- Haughn, G. W., Smith, J., Mazur, B., and Somerville, C.(1988)Mol. & Gen. Genet. 211, 266-271
- Lee, K. Y., Townsend, J., Tepperman, J., Black, M., Chui, C.-F., Mazur, B., Dunsmuir, P., and Bedbrook, J.(1988)EMBO J. 7, 1241-1248
[Medline]
[Order article via Infotrieve]
- Guttieri, M. J., Eberlein, C. V., Mallory-Smith, C. A., Thill, D. C., and Hoffman, D. L. (1992)Weed Sci. 40, 670-677
- Kendig, J. A., and De Felice, M. S. (1994) Weed Science Society of America, Abstr. 34
- Schmitzer, P. R., Eilers, R. J., and Czeke, C.(1993)Plant Physiol. 103, 281-283
[Abstract]
- Sathasivan, K., Haughn, G. W., and Murai, N.(1991)Plant Physiol. 97, 1044-1050
[Abstract/Free Full Text]
- Greaves, J. A., Rufener, G. K., Chang, M. T., and Koehler, P. H. (1993) Proceedings of the 48th Annual Corn and Sorghum Industry Research Conference, pp. 104-118
- Mazur, B. J., and Carl Falco, S.(1989)Annu. Rev. Plant Physiol. Plant Mol. Biol. 40, 441-470
[CrossRef]
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith J. A., and Struhl, K. (eds) (1993) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York
- Fang, L. Y., Gross, P. R., Chen, C. H., and Lillis, M.(1992)Plant Mol. Biol. 18, 1185-1187
[CrossRef][Medline]
[Order article via Infotrieve]
- Bernasconi, P., Walters, E. W., Woodworth, A. R., Siehl, D. L., Stone, T. E., and Subramanian, M. V.(1994)Plant Physiol. 106, 353-358
[Abstract]
- Singh, B., Szamoni, I., Hand, L. M., and Misra, R.(1992)Plant Physiol. 99, 812-816
[Abstract/Free Full Text]
- Durner, J., Gailus, V., and Böger, P.(1991)Plant Physiol. 95, 1144-1149
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Manabe, N. Tinker, A. Colville, and B. Miki
CSR1, the Sole Target of Imidazolinone Herbicide in Arabidopsis thaliana
Plant Cell Physiol.,
September 1, 2007;
48(9):
1340 - 1358.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-J. Chen, F. Delmotte, S. R. Cervera, L. Douence, C. Greif, and M.-F. Corio-Costet
At Least Two Origins of Fungicide Resistance in Grapevine Downy Mildew Populations
Appl. Envir. Microbiol.,
August 15, 2007;
73(16):
5162 - 5172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. McCourt, S. S. Pang, J. King-Scott, L. W. Guddat, and R. G. Duggleby
Herbicide-binding sites revealed in the structure of plant acetohydroxyacid synthase
PNAS,
January 17, 2006;
103(3):
569 - 573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Pozniak, I. T. Birk, L. S. O'Donoughue, C. Menard, P. J. Hucl, and B. K. Singh
Physiological and Molecular Characterization of Mutation-Derived Imidazolinone Resistance in Spring Wheat
Crop Sci.,
July 1, 2004;
44(4):
1434 - 1443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-S. Yoon and D. A. Baum
Transgenic study of parallelism in plant morphological evolution
PNAS,
April 27, 2004;
101(17):
6524 - 6529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Pozniak and P. J. Hucl
Genetic Analysis of Imidazolinone Resistance in Mutation-Derived Lines of Common Wheat
Crop Sci.,
January 1, 2004;
44(1):
23 - 30.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kochevenko and L. Willmitzer
Chimeric RNA/DNA Oligonucleotide-Based Site-Specific Modification of the Tobacco Acetolactate Syntase Gene
Plant Physiology,
May 1, 2003;
132(1):
174 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Jander, S. R. Baerson, J. A. Hudak, K. A. Gonzalez, K. J. Gruys, and R. L. Last
Ethylmethanesulfonate Saturation Mutagenesis in Arabidopsis to Determine Frequency of Herbicide Resistance
Plant Physiology,
January 1, 2003;
131(1):
139 - 146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Sun, I. Ghosh, H. Paulus, and M.-Q. Xu
Protein trans-Splicing To Produce Herbicide-Resistant Acetolactate Synthase
Appl. Envir. Microbiol.,
March 1, 2001;
67(3):
1025 - 1029.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|