Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernasconi, P.
Right arrow Articles by Siehl, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernasconi, P.
Right arrow Articles by Siehl, D. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 29, Issue of July 21, pp. 17381-17385, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Naturally Occurring Point Mutation Confers Broad Range Tolerance to Herbicides That Target Acetolactate Synthase (*)

(Received for publication, April 12, 1995; and in revised form, May 31, 1995)

Paul Bernasconi (§) , Alison R. Woodworth , Barbara A. Rosen , Mani V. Subramanian , Daniel L. Siehl

From the From Sandoz Agro Inc., Research Division, Palo Alto, California 94304-1104

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Acetolactate synthase (ALS) inhibitors are among the most commonly used herbicides. They fall into four distinct families of compounds: sulfonylureas, imidazolinones, triazolopyrimidine sulfonanilides, and pyrimidinyl oxybenzoates. We have investigated the molecular basis of imidazolinone tolerance of two field isolates of cocklebur (Xanthium sp.) from Mississippi and Missouri. In both cases, tolerance was conferred by a form of ALS that was less sensitive to inhibitors than the wild type. The insensitivity pattern of the Mississippi isolate was similar to that of a commercial mutant of corn generated in the laboratory: ICI 8532 IT. Sequencing revealed that the same residue (Ala Thr) was mutated in both Mississippi cocklebur and ICI 8532 IT corn. ALS from the Missouri isolate was highly insensitive to all the ALS herbicide families, similar in this respect to another commercial corn mutant: Pioneer 3180 IR corn. Sequencing of ALS from both plants revealed a common mutation that changed Trp to Leu. The sensitive cocklebur ALS cDNA, fused with a glutathione S-transferase, was functionally expressed in Escherichia coli. The recombinant protein had enzymatic properties similar to those of the plant enzyme. All the possible point mutations affecting Trp were investigated by site-directed mutagenesis. Only the Trp Leu mutation yielded an active enzyme. This mutation conferred a dramatically reduced sensitivity toward representatives of all four chemical families, demonstrating its role in herbicide tolerance. This study indicates that mutations conferring herbicide tolerance, obtained in an artificial environment, also occur in nature, where the selection pressure is much lower. Thus, this study validates the use of laboratory models to predict mutations that may develop in natural populations.


INTRODUCTION

Acetolactate synthase (ALS; ()EC 4.1.3.18; acetohydroxyacid synthase) catalyzes the condensation of two molecules of pyruvate or one molecule of pyruvate and one of 2-ketobutyrate to form 2-acetolactate or 2-aceto-2-hydroxybutyrate, respectively(1) . This is the first enzyme in the biosynthetic pathway leading to the production of valine, leucine, and isoleucine in plants and microorganisms. Sequence comparisons have revealed substantial homologies between the mature forms of ALS of bacteria (large subunit), yeast, and higher plants (for a review, see (2) ). The eukaryotic ALS proform contains a transit peptide at the N terminus that directs the enzyme to the chloroplast in higher plants(3, 4) .

There are many structurally diverse families of potent inhibitors of ALS (for a review, see (5) ). A number of compounds representing three distinct chemical families, i.e. sulfonylureas (SU) (6) , imidazolinones (IM)(7) , and triazolopyrimidine sulfonanilides (TP)(8) , are produced commercially as herbicides, and there are many others in development such as pyrimidinyl oxybenzoates(9) . The popularity of ALS-inhibiting herbicides can be attributed to (i) their efficacy at low use rates against a broad spectrum of weeds, (ii) multi-crop selectivity, (iii) lack of mammalian toxicity, and (iv) favorable environmental profile(10) . However, constant and extensive use of ALS-inhibiting herbicides has resulted in selection of tolerant weeds worldwide(10) . Development of tolerance to SU, since its first appearance in 1987, has been particularly dramatic(11) . In addition, isolation of tolerant lines in tissue culture for different families of ALS-inhibiting herbicides has been reported by a number of laboratories (9, 12) . Since the structurally diverse ALS inhibitors are competitive with one another with respect to binding to the enzyme(13, 14) , tolerance toward a particular herbicide has resulted in varying degrees of cross-tolerance to the other chemicals(9, 12, 15) .

The alteration of ALS by one or more point mutations is the only reported mechanism of tolerance(10) . The lesion causing tolerance to SU has been localized to a single point mutation affecting proline 197 in ALS in Arabidopsis thaliana(16) and position 196 in tobacco(17) . The same residue has also been implicated in SU tolerance in the fields(18) . Only one IM-specific tolerance has been confirmed in the field so far(19, 20) , but the mutation involved has not been identified. Two IM-specific mutations have been obtained in the laboratory: first, a Ser Asp change in the ALS gene of A. thaliana(21) and second, an Ala Thr mutation in corn(22) . The latter mutant was developed into a commercial product: ICI 8532 IT corn. Finally, in yeast, 10 distinct loci in the ALS gene have been shown to confer SU tolerance(23) , but the specificity of tolerance for each locus with respect to other families of ALS inhibitors has not been defined.

We have cloned and sequenced the mutated ALS gene from two field isolates of cocklebur, a common broadleaf weed that has developed tolerance to IM(19, 20) . The first isolate (MS-XANST), from a field in Mississippi, showed specific tolerance to IM. The second isolate, (MO-XANST) from Missouri, showed high level and broad based tolerance to all classes of ALS inhibitors. The mutation conferring broad based tolerance was further studied by site-directed mutagenesis, implicating it in the dramatically high level and broad based tolerance to all ALS-inhibiting herbicides.


MATERIALS AND METHODS

Plant Material

Seeds of wild-type cocklebur (S-XANST) were from Azlin Seeds Service (Leland, MS). Seeds of the Mississippi isolate (MS-XANST) were provided by the Sandoz Agro, Inc. field station in Mississippi. Seeds of the Missouri isolate (MO-XANST) were collected from a field near Caruthersville, MO in the fall of 1993 and were kindly provided by Professor Andy Kendig (University of Missouri). These seeds were grown in a greenhouse, and mature leaves were harvested. See (15) for details on Pioneer 3180 IR corn and ICI 8532 IT corn.

Chemicals

The following chemicals were used as representatives of each ALS inhibitor family: chlorsulfuron (SU), imazethapyr (IM), flumetsulam (TP), and pyrimidinyl oxybenzoate (POB). SU, IM, and TP were obtained from Chem Service, Inc. (West Chester, PA). POB (9) was synthesized by Sandoz Agro, Inc. chemists.

Partial Purification of the Plant Enzyme and ALS Assay

Partially purified ALS active fractions were prepared from young green leaves as described by Schmitzer et al.(20) . The ALS assay was performed as described by Siehl et al.(15) .

RNA, cDNA, and Genomic DNA Preparation

Protocols from Ausubel et al.(24) were used. About 20 g of frozen leaves were ground to a fine powder in a coffee grinder cooled with dry ice. Total RNA was prepared using the guanidium isothiocyanate method(24) . mRNA was prepared by oligo(dT) chromatography (Life Technologies, Inc.) from 1.5 mg of total RNA. mRNA was used for both cDNA synthesis and Northern blot analysis(24) . Genomic DNA was prepared from 20 g of leaves using established protocols involving CsCl gradient centrifugation(24) .

Library Construction

S-XANST cDNA was used for the preparation of a [lamdba]gt10 library according to the vector manufacturer's instructions (Promega, Madison, WI).

Cloning of S-XANST ALS

Two degenerate PCR primers (Keystone Labs Inc., Menlo Park, CA) were designed in regions of the ALS gene conserved through evolution between plants, bacteria, and yeast. Their sequences were ATG(CT)T(ACTG)GG(ACTG)ATGCA(CT)GG and ACAT(CT)TG(AG)TG(CT)TG(ACTG)CC(ACTG)AC. The corresponding 398-base pair fragment from wild-type ALS was amplified (Ampli-Taq kit, Perkin-Elmer) from 10 ng of S-XANST cDNA and cloned into pBluescript SK(+) (Stratagene, La Jolla, CA).

The library was screened by plaque hybridization with a probe obtained by random labeling (Promega) of the cloned PCR fragment. Both strands of the largest positive insert were sequenced with a combination of subcloning and custom primers (Keystone Labs Inc.).

Cloning of MS-XANST and MO-XANST ALS

PCR primers were derived from the S-XANST ALS sequence. PCR amplification was performed on 10 ng of MS-XANST or MO-XANST cDNA. The amplified fragments were cloned into pCR-Script SK(+) (Stratagene), and at least two independent clones were sequenced for each region.

Cloning of Pioneer 3180 IR Corn ALS

Pioneer 3180 IR corn kernels (Pioneer Hi-Bred) were germinated in soil and grown for 1 month in a greenhouse. Mature leaves were harvested and used for the preparation of cDNA as described above. PCR primers were designed based on the published sequence of wild-type ALS(25) . The amplified fragments were cloned and sequenced as described above.

Expression of S-XANST ALS

The fusion protein vector pGEX-2T (Pharmacia Biotech Inc.) was used. PCR amplification was used to introduce BamHI sites at the beginning (primer sequence: CACACATGGATCCATGGCGGCCATCCC) and the end (primer sequence: CATTGAGGATCCATATTTCATTCTGCC) of the complete open reading frame coding for the enzyme. The obtained fragment was cloned in both orientations in the expression vector, and the construct was used to transform Escherichia coli MC1061 cells. Expression was typically performed in 50-ml cultures. The cells were grown at 37 °C with shaking at 300 rpm. Protein expression was induced when the culture reached an A of 0.5 by the addition of 1 mM isopropyl-1-thio--D-galactopyranoside. The culture was allowed to grow until late exponential phase and harvested. The fusion protein was prepared by chromatography on GSH-Sepharose (Pharmacia Biotech Inc.)(26) . The extraction buffer was composed of 50 mM EPPS, pH 7.5, 10 mM MgCl, 5 mM dithiothreitol, 10% ethylene glycol, 10 µM FAD, 1 mM pyruvate, 1 µg/ml leupeptin, 2 µg/ml aprotinin, and 1 µg/ml pepstatin.

Site-directed Mutagenesis

Site-directed mutagenesis of the expressed S-XANST ALS was performed directly on the plasmid derived from pGEX-2T containing the ALS cDNA. A unique site elimination mutagenesis kit (Pharmacia Biotech Inc.) was used with the PstI/SacII primers for selection and custom mutagenesis primers (Keystone Labs Inc.). The Trp codon (TGG) was mutated to TCG (Ser), AGG (Arg), TGT (Cys), GGG (Gly), and TTG (Leu). The plasmids containing the mutated cDNA were expressed under the same conditions as described above, except that the bacteria were grown at 30 °C at 125 rpm and were induced with 0.5 mM isopropyl-1-thio--D-galactopyranoside. The extraction and elution buffers were the same as described above, but with 10 mM pyruvate.

ALS Assay of the Recombinant Protein

The assay was performed as described in (15) , except that 0.25-1 µg of purified fusion protein was used, and the incubation time was reduced to 30 min. Protein was determined using the Bio-Rad Bradford reagent.


RESULTS

Enzymatic Activity of S-XANST, MS-XANST, and MO-XANST ALS

Partially purified fractions of each cocklebur biotype were used for the determination of enzymatic activity. The K for pyruvate for each biotype was found to be in the range of 3.2-6.6 mM. The reaction was linear in the presence of 50 mM pyruvate for at least 90 min. The plant enzyme was inactivated upon prolonged incubation at room temperature and upon freezing.

Inhibition Properties of Plant ALS

Inhibition of the plant enzymes by representatives of the four chemical families was studied. The IC values for the inhibition by SU, IM, TP, and POB were determined, and the results are summarized in the Table 1. The results clearly indicate that a modified enzyme was responsible for IM tolerance in MS-XANST and for the broad based tolerance in MO-XANST.



Sequence of S-XANST ALS

Before establishing the mutations present in MS-XANST and MO-XANST, it was necessary to obtain the sequence of ALS from the wild-type cocklebur (S-XANST). Using the two degenerate primers, a 398-base pair fragment was amplified from S-XANST cDNA. Northern blot analysis of leaf mRNA, probed with the amplified fragment, revealed the presence of a major transcript of 3.5 kilobases (>90% of the signal) with minor mRNA bands at 5 and 6 kilobases. Screening of 100,000 phages from the cDNA library yielded four positive clones. The longest cDNA insert was 2146 base pairs and encoded a 648-residue protein. The resulting protein sequence, together with other sequences relevant to this work, is shown in the Fig. 1. The N-terminal 77-residue chloroplast transit peptide shared no homology with any other peptide with similar function. The 571-residue mature protein was 89, 78, and 46% homologous to the corresponding ALS of tobacco, corn, and yeast, respectively. PCR analysis of the genomic DNA revealed that the ALS gene(s) was devoid of introns, i.e. the amplified fragments from genomic DNA did not differ in size from the fragments obtained from the cDNA.


Figure 1: Primary sequence alignment of S-XANST and wild-type corn ALS isozyme ZMAHAS108 (CORN) (25) . Blackboxes identify residues conserved between the two enzymes. The numbers on the right indicate amino acid positions. The mutations in MS-XANST (boxedT) and MO-XANST ALS are indicated on top of the alignment (MO/MS-XANST). ICI 8532 IT corn (boxedT; from (22) ) and Pioneer 3180 IR corn ALS mutations are indicated at the bottom of the alignment (IR/IT-CORN). The asterisk indicates the proline residue involved in the SU-specific mutations(16, 17) , and the numbersign indicates the residue involved in the IM-specific mutation(21) .



Sequence of MS-XANST ALS

The sequence of the mature form of MS-XANST ALS was established in three overlapping fragments of the ALS cDNA. The fragments encompassed nucleotides 298-748, 530-1860, and 1419-2056. Nine point mutations were detected, with two of them translating into an amino acid change: Ala Thr and Phe Leu (Fig. 1).

Sequence of MO-XANST ALS

The sequence of ALS from MO-XANST was obtained by similar means, except that the first overlapping fragment was from nucleotides 102 to 1123, thus giving the complete proform of ALS. Eight nucleotide changes were detected, five of which caused a mutation in the sequence of the protein. The amino acid changes were Lys Glu, Phe Leu, Gln His, Asn Ser, and Trp Leu (Fig. 1).

Sequence of Pioneer 3180 IR Corn ALS

The sequence of mature ALS from 3180 IR corn was obtained by PCR amplification of two overlapping fragments: nucleotides 904-1552 and 1138-2578 of the published sequence ZMAHAS108(25) . Two mutations in the protein sequence were detected: Trp was mutated to Leu, and Glu was changed to Val (Fig. 1).

Expression of S-XANST ALS

S-XANST was expressed in E. coli as a protein fused to glutathione S-transferase. Upon expression, a 97-kDa product was detected by SDS-polyacrylamide gel electrophoresis in GSH-Sepharose-purified fractions. Two other proteins of 65 and 32 kDa were also present in these fractions. Further separation by gel filtration showed that ALS activity copurified with the 97-kDa protein. None of these products were detected in purified extracts from bacteria expressing a construct in which the ALS cDNA was inserted backwards. In a similar fashion, no correct product was detected upon expression of a construct composed of the glutathione S-transferase and the mature form of ALS (Ala-Tyr). In the latter case, inclusion bodies were clearly observable in the bacteria, whereas they could not be detected in bacteria expressing the fused ALS proform. Only the construct comprising the ALS proform was used for the rest of the work. A typical experiment yielded 3 mg of purified fusion protein/liter of culture with a specific activity of 250 µmol/h/mg. The K for pyruvate was 6 mM. The stability of the recombinant enzyme was much greater than that of plant ALS since it was not inactivated by prolonged incubation at room temperature or repeated freezing and thawing. Its sensitivity toward inhibitors was similar to that of the S-XANST enzyme (Table 2).



Mutagenesis of S-XANST

We investigated the effect of a point mutation of the Trp codon by site-directed mutagenesis. Out of the nine possibilities, two of them gave a stop codon (TGA and TAG) and were not pursued since a truncated enzyme would likely be inactive. The other point mutations encode for cysteine, glycine, leucine, arginine, and serine. The Cys mutation gave an unstable protein, and no enzyme of the correct molecular mass could be detected by SDS-polyacrylamide gel electrophoresis. The other four mutations gave a fusion protein with the correct molecular mass, but only the leucine mutation yielded an active ALS. Active enzyme was obtained only when a lower level of induction (0.5 mM isopropyl-1-thio--D-galactopyranoside instead of 1 mM) and a lower aeration and temperature (200 rpm at 30 °C instead of 300 rpm at 37 °C) were used. A yield of 0.4 mg/liter was obtained with a specific activity of 50 µmol/h/mg. This protein had a K of 2 mM for pyruvate. The enzyme with the Trp Leu mutation was assayed for sensitivity toward the different chemical classes and was comparable to the MO-XANST enzyme (Table 2).


DISCUSSION

Enzymatic Properties and Inhibitor Sensitivity of the Native Plant Enzymes

Since only partially purified fractions from S-XANST, MS-XANST, and MO-XANST were used, we did not determine the composition of ALS isozymes in our preparation. But, based on literature reports (2) and as further confirmed our by Northern blot analysis, we assumed that the observed activity was mostly due to one major isozyme. As is the case for most broadleaf plants, S-XANST ALS was susceptible to representatives of all families of ALS inhibitors used in this study. The MS-XANST enzyme was particularly less sensitive to imazethapyr, with a modest desensitization to the others (Table 1). The pattern of tolerance to ALS inhibitors in MS-XANST was comparable to that observed with the hybrid corn ICI 8532 IT (Table 1)(15) . In contrast, MO-XANST was highly tolerant to all ALS inhibitors tested, like the commercial hybrid Pioneer 3180 IR corn (Table 1). None of the mutant lines showed any significant change with respect to sensitivity to leucine (data not shown).

Sequence of S-XANST ALS

Northern blot analysis showed a major transcript for ALS and that ALS activity is mostly due to one isozyme. The demonstration, by PCR, that the cocklebur ALS gene is intronless further validates the same observation made by other researchers working with corn(25) . Although the S-XANST ALS primary sequence did not differ substantially from other plant ALS sequences, there was a noteworthy variation: the serine implicated in imidazolinone tolerance in Arabidopsis (Ser) (21) was replaced by Ala in cocklebur (Ala).

Sequence of MS-XANST ALS

Two mutations affecting the primary structure of ALS were found. The mutation Ala Thr is identical to the mutation described for ICI 8532 IT(22) . This finding makes the correlation between sensitivity toward inhibitors and gene mutation of the natural isolate (MS-XANST) and the laboratory isolate (ICI 8532 IT) quite striking. These two mutations were obtained using different selective pressures, and one could have believed that the mutation obtained using a high selection pressure and chemical mutagenesis in the laboratory could only occur at an extremely low frequency in the field. The Phe Leu mutation was probably a natural variation with no consequences for inhibitor tolerance since a Leu residue in that position is present in ALS from several other plants.

Sequence of MO-XANST ALS

Of the five mutations found in MO-XANST, Lys Glu and Phe Leu can be quickly dismissed for consideration for a role in tolerance. The first one occurs in the chloroplast transit peptide that is cleaved from the mature protein. The second one is the same variation found in MS-XANST. At this point, there was no indication of the involvement of the other three mutations in tolerance. Two of them, Gln His and Asn Ser, affect residues that are not conserved in yeast and may not play any role in tolerance. The most interesting mutation was the Trp Leu mutation. Such a change has been shown to increase SU tolerance in tobacco already harboring the Pro mutation characteristic of SU tolerance(17) . The Trp mutation has never been described alone in plants, and the proline residue (Pro) is unchanged in MS-XANST and MO-XANST. Work done in yeast indicated that the mutation of this Trp residue confers an increased tolerance to SU(23) .

Sequence of Pioneer 3180 IR Corn ALS

The pattern of cross-tolerance in MO-XANST was similar to that in the commercial hybrid Pioneer 3180 IR corn(22) . There is no report in the literature about the nature of the mutation in 3180 IR corn; hence, a comparison of the mutations in MO-XANST and 3180 IR corn ALS was undertaken to pinpoint the mutation responsible for the broad based tolerance to ALS inhibitors. Of the two mutations detected in 3180 IR corn, Glu was probably not involved in tolerance since this residue is not conserved among the different ALS enzymes. The Trp Leu mutation corresponded to the Trp mutation in MO-XANST (Trp), making it a very likely candidate for the mutation responsible for the high degree of tolerance. Two questions needed to be answered: first, whether the Trp mutation alone was sufficient to confer tolerance, and second, whether the Trp residue could be mutated to amino acids other than Leu and still confer tolerance. Indeed, in the case of SU tolerance, all six possible single point mutations in the first or second base of the Pro codon have been shown to occur and confer SU tolerance(18) .

Expression of S-XANST ALS

Two reports describe the functional expression of plant ALS in bacteria. Smith et al.(4) and Singh et al.(27) reported the functional expression of a plant ALS in a bacteria deficient in its own ALS. Our expression system differed in several ways. First, since ALS is fused to glutathione S-transferase, it could be purified in one simple chromatography step on GSH-Sepharose, and second, the need for an ALS-deficient bacteria was avoided. Also, the construct provided an easy template on which to perform site-directed mutagenesis. Active protein was recovered only when the complete proform of S-XANST ALS was fused to the glutathione S-transferase. This finding is well in accordance with that of Smith et al.(4) . ALS activity was associated with the 97-kDa protein, contradicting the results of Singh et al.(27) . In their expression system, cleavage of the chloroplast transit peptide was needed to obtain an active enzyme.

The specific activity of the recombinant protein compared favorably with the best specific activity obtained for plant ALS, i.e. 190 µmol/h/mg for ALS purified from barley(28) . The specific activities of the other recombinant plant proteins were 4 and 2.6 µmol/h/mg (4) and 5 µmol/h/mg(27) ; but the degree of purification has not been reported, and it is assumed that these values were for only partially purified enzymes. The K for pyruvate for the expressed fusion protein was in accordance with the K generally reported for plant ALS (28) and the other recombinant ALS enzymes(4, 27) . A striking feature is the stability of the expressed ALS compared with the enzyme from various plant sources. It is conceivable that the presence of the chloroplast transit peptide may be a major contributing factor since, without this peptide, proper expression could not be achieved. Inhibitor sensitivity was identical to that for the plant enzyme with a major difference. The feedback inhibition by valine and leucine was lost in the recombinant enzyme, a finding consistent with the results of Singh et al.(27) .

Mutagenesis of S-XANST ALS

Only the point mutations affecting Trp were investigated since the most dramatic tolerance toward ALS inhibitors was observed in a mutation affecting this residue. In our bacterial expression system, only the Trp Leu mutation yielded an active protein. This mutation may negatively impact the stability of the protein since milder expression conditions were needed to obtain it in an active form. The increase in the IC values for the different ALS inhibitors for this recombinant protein correlated well with the values for the MO-XANST and Pioneer 3180 IR corn enzymes.

Our study demonstrates that a single point mutation in the ALS gene, Trp Leu, can confer to a weed a broad based and high level of tolerance to all the chemical families of inhibitors. Occurrence of this mutation will impact negatively on the widely used commercial products that are ALS inhibitors. Moreover, we also demonstrate that, given the time, mutations obtained using extreme selective pressures in the laboratory have occurred in nature and are now being selected from wild-type populations during herbicide application.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank®/EMBL Data Bank with accession number(s) U16279 [GenBank® Link]and U16280[GenBank® Link].

§
To whom correspondence should be addressed: Sandoz Agro Inc., Research Div., 975 California Ave., Palo Alto, CA 94304-1104. Tel.: 415-354-3552; Fax: 415-493-1073.

The abbreviations used are: ALS, acetolactate synthase; SU, sulfonylurea; IM, imidazolinone; TP, triazolopyrimidine sulfonanilide; MS-XANST, cocklebur, Mississippi ecotype; MO-XANST, cocklebur, Missouri ecotype; S-XANST, wild-type cocklebur (Xanthium sp.); IR, imidazolinone-resistant; IT, imidazolinone-tolerant; POB, pyrimidinyl oxybenzoate; PCR, polymerase chain reaction; EPPS, N-2-hydroxyethylpiperazine-N`-3-propanesulfonic acid.


ACKNOWLEDGEMENTS

We are indebted to Professor Andy Kendig for providing the seeds for MO-XANST. We thank Dr. Robert Lamoreaux and Randy Ratliff for providing the MS-XANST seeds. We acknowledge the excellent greenhouse work of Tom DeHoog.


REFERENCES
  1. Bryan, J. K. (1990) The Biochemistry of Plants (Conn, E. E., and Stumpf, P. K., eds) pp. 161-165, Academic Press, Inc., New York
  2. Mazur, B. J., Chui, C.-F., and Smith, J. K.(1987)Plant Physiol. 85, 1110-1117 [Abstract/Free Full Text]
  3. Miflin, B. J. (1974)Plant Physiol. 54, 550-555 [Abstract/Free Full Text]
  4. Smith, J. K., Schloss, J. V., and Mazur, B. J.(1989)Proc. Natl. Acad. Sci. U. S. A. 86, 4179-4183 [Abstract/Free Full Text]
  5. Babczinski, P., and Zelinski, T.(1991)Pestic. Sci. 31, 305-323 [CrossRef]
  6. Sauers, R. F., and Levitt, G.(1984)ACS Symp. Ser. 255, 21-28
  7. Los, M.(1984) ACS Symp. Ser. 255, 29-44
  8. Kleschick, W. A., Costales, M. J., Dunbar, J. E., Meikle, R. W., Monte, W. T., Pearson, N. R., Snider, S. W., and Vinogradoff, A. P.(1992) Pestic. Sci. 29, 341-355
  9. Subramanian, M. V., Hung, H. Y., Dias, J. M., Miner, V. W., Butler, J. H., and Jachetta, J. J. (1990)Plant Physiol. 94, 239-244 [Abstract/Free Full Text]
  10. Saari, L. L., Coterman, J. C., and Thill, D. C. (1994) Herbicide Resistance in Plants: Biology and Biochemistry (Powles, S., and Holtum, J., eds) pp. 83-139, Lewis Publishers, Inc., Boca Raton, FL
  11. Mallory-Smith, C. A., Thill, D. C., and Dial, M. J.(1990)Weed Technol. 4, 163-168
  12. Saxena, P. K., and King, J.(1988)Plant Physiol. 86, 863-867 [Abstract/Free Full Text]
  13. Subramanian, M. V., Gallant, V. L., Dias, J. M., and Mireles, L. M.(1991) Plant Physiol. 96, 310-313 [Abstract/Free Full Text]
  14. Schloss, J. V., Ciskanik, L. M., and Van Dyk, D.(1988)Nature 331, 360-362 [CrossRef]
  15. Siehl, D. L., Bengston, A. S., Brockman, J. P., Butler, J. H., Kraatz, G. W., Lamoreaux, R. J., and Subramanian, M. V. (1995) Crop Sci., in press
  16. Haughn, G. W., Smith, J., Mazur, B., and Somerville, C.(1988)Mol. & Gen. Genet. 211, 266-271
  17. Lee, K. Y., Townsend, J., Tepperman, J., Black, M., Chui, C.-F., Mazur, B., Dunsmuir, P., and Bedbrook, J.(1988)EMBO J. 7, 1241-1248 [Medline] [Order article via Infotrieve]
  18. Guttieri, M. J., Eberlein, C. V., Mallory-Smith, C. A., Thill, D. C., and Hoffman, D. L. (1992)Weed Sci. 40, 670-677
  19. Kendig, J. A., and De Felice, M. S. (1994) Weed Science Society of America, Abstr. 34
  20. Schmitzer, P. R., Eilers, R. J., and Czeke, C.(1993)Plant Physiol. 103, 281-283 [Abstract]
  21. Sathasivan, K., Haughn, G. W., and Murai, N.(1991)Plant Physiol. 97, 1044-1050 [Abstract/Free Full Text]
  22. Greaves, J. A., Rufener, G. K., Chang, M. T., and Koehler, P. H. (1993) Proceedings of the 48th Annual Corn and Sorghum Industry Research Conference, pp. 104-118
  23. Mazur, B. J., and Carl Falco, S.(1989)Annu. Rev. Plant Physiol. Plant Mol. Biol. 40, 441-470 [CrossRef]
  24. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith J. A., and Struhl, K. (eds) (1993) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York
  25. Fang, L. Y., Gross, P. R., Chen, C. H., and Lillis, M.(1992)Plant Mol. Biol. 18, 1185-1187 [CrossRef][Medline] [Order article via Infotrieve]
  26. Bernasconi, P., Walters, E. W., Woodworth, A. R., Siehl, D. L., Stone, T. E., and Subramanian, M. V.(1994)Plant Physiol. 106, 353-358 [Abstract]
  27. Singh, B., Szamoni, I., Hand, L. M., and Misra, R.(1992)Plant Physiol. 99, 812-816 [Abstract/Free Full Text]
  28. Durner, J., Gailus, V., and Böger, P.(1991)Plant Physiol. 95, 1144-1149 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Plant Cell PhysiolHome page
Y. Manabe, N. Tinker, A. Colville, and B. Miki
CSR1, the Sole Target of Imidazolinone Herbicide in Arabidopsis thaliana
Plant Cell Physiol., September 1, 2007; 48(9): 1340 - 1358.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
W.-J. Chen, F. Delmotte, S. R. Cervera, L. Douence, C. Greif, and M.-F. Corio-Costet
At Least Two Origins of Fungicide Resistance in Grapevine Downy Mildew Populations
Appl. Envir. Microbiol., August 15, 2007; 73(16): 5162 - 5172.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. A. McCourt, S. S. Pang, J. King-Scott, L. W. Guddat, and R. G. Duggleby
Herbicide-binding sites revealed in the structure of plant acetohydroxyacid synthase
PNAS, January 17, 2006; 103(3): 569 - 573.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
C. J. Pozniak, I. T. Birk, L. S. O'Donoughue, C. Menard, P. J. Hucl, and B. K. Singh
Physiological and Molecular Characterization of Mutation-Derived Imidazolinone Resistance in Spring Wheat
Crop Sci., July 1, 2004; 44(4): 1434 - 1443.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-S. Yoon and D. A. Baum
Transgenic study of parallelism in plant morphological evolution
PNAS, April 27, 2004; 101(17): 6524 - 6529.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
C. J. Pozniak and P. J. Hucl
Genetic Analysis of Imidazolinone Resistance in Mutation-Derived Lines of Common Wheat
Crop Sci., January 1, 2004; 44(1): 23 - 30.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Kochevenko and L. Willmitzer
Chimeric RNA/DNA Oligonucleotide-Based Site-Specific Modification of the Tobacco Acetolactate Syntase Gene
Plant Physiology, May 1, 2003; 132(1): 174 - 184.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
G. Jander, S. R. Baerson, J. A. Hudak, K. A. Gonzalez, K. J. Gruys, and R. L. Last
Ethylmethanesulfonate Saturation Mutagenesis in Arabidopsis to Determine Frequency of Herbicide Resistance
Plant Physiology, January 1, 2003; 131(1): 139 - 146.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
L. Sun, I. Ghosh, H. Paulus, and M.-Q. Xu
Protein trans-Splicing To Produce Herbicide-Resistant Acetolactate Synthase
Appl. Envir. Microbiol., March 1, 2001; 67(3): 1025 - 1029.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernasconi, P.
Right arrow Articles by Siehl, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernasconi, P.
Right arrow Articles by Siehl, D. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement