JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, J.-L.
Right arrow Articles by Murphy, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, J.-L.
Right arrow Articles by Murphy, P. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 29, Issue of July 21, pp. 17494-17501, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Cloning and Differential Tissue-specific Expression of Three Mouse Chemokine Receptor-like Genes, Including the Gene for a Functional Macrophage Inflammatory Protein-1 Receptor (*)

(Received for publication, January 27, 1995; and in revised form, April 10, 1995)

Ji-Liang Gao (§) , Philip M. Murphy

From the Laboratory of Host Defenses, NIAID, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Macrophage inflammatory protein-1 (MIP-1) and RANTES, members of the chemokine family of leukocyte chemoattractants, bind to a common seven-transmembrane-domain human receptor. We have now cloned three related mouse genes: one for a selective MIP-1 receptor (MIP-1R) and two for orphan receptors provisionally designated MIP-1 receptor-like 1 and 2 (MIP-1RL1 and 2). Their deduced sequences are 80, 62, and 63% identical to the human MIP-1/RANTES receptor, respectively. K562 cells stably transfected with MIP-1R specifically bound I-human MIP-1 and I-human RANTES with high affinity. The rank order of chemokine competition for I-human MIP-1 binding was human MIP-1 > mouse MIP-1 RANTES MIP-1 > MCP-1. However, human RANTES was 100-fold less potent as a calcium-mobilizing agonist for MIP-1R than either human or mouse MIP-1, which matched the selectivity of mouse leukocytes for calcium mobilization by MIP-1 and RANTES. No other or chemokines tested were agonists for MIP-1R. RNA for all three genes was detected in mouse leukocytes, but unique patterns of expression were identified in solid organs: MIP-1R, heart, spleen, and lung; MIP-1RL1, skeletal muscle; and MIP-1RL2, spleen and liver. These data identify potentially important new targets for chemokine action in the mouse.


INTRODUCTION

Chemokines are structurally related 70-90-amino acid polypeptides whose most widely shared property is the ability to function as chemoattractants and activating factors for mammalian leukocytes (reviewed in (1) ). Chemokines form two subfamilies, and , based on the presence or absence of a single amino acid between the first two of four conserved cysteine residues. Most chemokines attract and activate neutrophils, whereas all known chemokines target monocytes but have little if any affect on neutrophils. The chemokines macrophage inflammatory protein-1 (MIP-1),()MIP-1, RANTES, and monocyte chemoattractant protein-1 (MCP-1) also attract basophils, eosinophils, and lymphocytes with variable selectivity(1, 2, 3, 4, 5, 6) . In addition, MIP-1 has been shown to suppress hematopoietic stem cell proliferation (7, 8, 9, 10) .

Seventeen distinct human chemokines (10 and 7 ) have been identified so far (reviewed in (1) and (11) ). One way to sort out the biological roles of each member of this complex system is by gene knockout technology in the mouse. However, the mouse chemokine system may differ fundamentally from the human system. For example, the human chemokine interleukin-8 (IL-8) has no known counterpart in the mouse. Furthermore, only one mouse gene for an IL-8 receptor homologue has been found, whereas two closely related genes for functional human neutrophil IL-8 receptors have been cloned(12, 13, 14, 15, 16, 17, 18) . Mice lacking the IL-8 receptor homologue, created by gene knockout technology, exhibit expansion of neutrophils and B lymphocytes in the blood, bone marrow and lymphoid organs, and mobilize neutrophils poorly to sites of chemical irritation, suggesting a role for this receptor in both leukocyte differentiation and chemotaxis(14) . The encoded receptor does not bind human IL-8, but instead binds the related chemokines mouse KC and human MGSA (melanoma growth-stimulatory activity)(18) .

In contrast, cDNAs have been cloned for both human and mouse forms of the chemokines MIP-1, MIP-1, RANTES, and MCP-1 (see (11) for alignment of the amino acid sequences and for primary references). cDNAs for three human leukocyte chemokine-selective receptors have been cloned, one that is selective for MIP-1 and RANTES and two others that are selective for MCP-1(19, 20, 21) . They are members of the rhodopsin-like superfamily of heptahelical, G protein-coupled receptors and exhibit 50% amino acid identity to each other and 30% identity to the IL-8 receptors(22, 23) . Analysis of human leukocytes with panels of chemokines, by competitive binding and functional assays, has suggested that genes for additional receptor subtypes for MIP-1, RANTES, and MCP-1 may exist, but none has been reported yet (2, 5, 24, 25, 26) .

Several groups have identified specific mouse leukocyte binding sites for MIP-1 and MCP-1(27, 28, 29) . Here we report the cloning, RNA expression, ligand selectivity, and signal transduction properties of the first mouse chemokine receptor gene, the MIP-1 receptor gene. In addition we have isolated two highly related genes for putative receptors whose ligands remain unknown.


EXPERIMENTAL PROCEDURES

Materials

Restriction enzymes, T4 polynucleotide kinase, and T4 DNA ligase were obtained from New England Biolabs. [P]dCTP was from Amersham Corp. A random primer labeling kit was from Boehringer Mannheim. Polymerase chain reaction (PCR) reagents were from Perkin-Elmer Cetus. I-Labeled recombinant human MIP-1, MIP-1, RANTES, and MCP-1 (specific activity 2200 Ci/mmol) were purchased from DuPont NEN. Unlabeled recombinant human chemokines were purchased from Peprotech (Rocky Hill, NJ), except for mouse MIP-1 and MIP-1 and human MIP-1, which were from R& Systems (Minneapolis, MN), and human I-309, Mig, and platelet factor 4, and mouse TCA3, which were generous gifts from M. Krangel, J. Farber, G. LaRosa, and M. Dorf, respectively. In control experiments, all chemokines used except platelet factor 4, I-309, MCP-2, and TCA3 were shown to potently induce transient elevations of [Ca] using purified human leukocytes (not shown).

Mouse Genomic DNA Library Screening

Approximately 10 million plaques of a 129/SvJ mouse genomic DNA library constructed in the vector FIX (Stratagene, La Jolla, CA) were hybridized with a full-length human MIP-1/RANTES receptor cDNA labeled with [P]dCTP using previously described methods(19) . Plaques that corresponded to duplicate hybridization signals after washing the membranes at 55 °C in 5 SSC for 30 min were purified, and the genomic inserts were mapped with restriction enzymes. Appropriate restriction fragments of the genomic inserts of clones M2, M3, and M7 that hybridized to the probe were isolated by agarose gel electrophoresis and subcloned into pBluescript SK II (Stratagene). The DNA sequences were determined on both strands.

Design of Expression Plasmids

The ORFs were amplified from the corresponding subcloned genomic fragments by PCR using the sense oligonucleotides 5`-GCTCTAGACTGACCAGTTCCTCAGCAAAGGATGGAGAT for M2, 5`-GCTCTAGACTGTCCTGTAGAAGAGTTTACAATGGAGAT for M3, and 5`-GCTCTAGACATGGTTAATTGTTTCTTTGTTTATTTGT for M7; and the antisense oligonucleotides 5`-CGG GATCCCGTTGACACCTACGGTCTGAATCAGAAGCCA for M2, 5`-CGGAATTCAGGCCTTTGTTCTGTCCAGGGTCTGAATTA for M3, and 5`-CGAATTCCTTTCAGTCCATGGATAAGTGCAATTTTCTC for M7. To facilitate subcloning, all of the sense oligonucleotides contained added XbaI sites, and the antisense oligonucleotides contained added EcoRI sites in the case of M2 and M7, and BamHI in the case of M3 (underlined nucleotides). In addition to the ORF, the PCR products contained 20-60 base pairs of 5`- and 3`-flanking sequence. The amplification reaction was performed using 100 ng of plasmid DNA as a template. The PCR conditions were 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s, with a final extension at 72 °C for 10 min. The PCR products were then digested with appropriate restriction enzymes, purified by agarose gel electrophoresis using the QIAEX system (Qiagen, Chatsworth, CA), and subcloned into pBluescript. Expression plasmids were then constructed by transfer from Bluescript of XbaI/XhoI fragments containing the three cloned ORFs into the NheI and XhoI sites of the hygromycin-selectable, stable episomal vector pCEP4 (Invitrogen, San Diego, CA). The fidelity of the cloned expression plasmids was verified by DNA sequencing. Construction of an expression plasmid in pCEP4 for the human MIP-1/RANTES receptor has been described previously(30) .

Creation of Stably Transfected Cell Lines

Non-adherent K562 human erythroleukemia cells were grown in RPMI 1640-glutamine (Biofluids, Inc., Walkersville, MD) containing 10% fetal bovine serum (complete medium). K562 cells (10) in log phase were electroporated in the presence of 20 µg of plasmid DNA. Electroporation conditions were: 300 µl volume, 250 V, 960 microfarads, with a 0.4-cm gap electroporation cuvette. 48 h later, cells were seeded at 10 cells/ml in complete medium with 250 µg/ml hygromycin B and selected for 5 days. Subsequently, cells were maintained in complete medium with 150 µg/ml hygromycin B. Expression of specific RNA was established by Northern blot hybridization for each cell line. Neither RNA for the human MIP-1/RANTES receptor nor specific binding of MIP-1, MIP-1, MCP-1, or RANTES at 4 °C were detectable in untransfected K562 cells.

Ligand Binding Analysis

10 cells were incubated in duplicate with 0.1 nMI-labeled recombinant human chemokines and varying concentrations of unlabeled recombinant chemokines. Binding reactions were in a total volume of 200 µl of RPMI 1640 with 1 mg/ml bovine serum albumin and 25 mM HEPES, pH 7.4. After incubation for 2 h at 4 °C, the cells were pelleted through a 10% sucrose/PBS cushion and emissions were counted. The data were curve-fitted with the computer program LIGAND (31) to determine the dissociation constant and number of binding sites.

Isolation of Mouse Leukocytes

Total leukocytes were isolated by dextran sedimentation from citrated peripheral blood obtained by cardiac puncture of BALB/c mice. Residual erythrocytes were lysed in hypotonic saline. The cells were isolated within 2 h after harvest. They were maintained in phosphate-buffered saline at room temperature and were studied immediately after purification.

Intracellular [Ca] Measurements

Cells (10/ml) were incubated in Hank's buffered saline solution with Ca and Mg supplemented with 10 mM HEPES, pH 7.4 (HBSS+), containing 2.5 µM FURA-2 AM (Molecular Probes, Eugene, OR) for 30 min at 37 °C in the dark. The cells were subsequently washed twice with HBSS+ and resuspended at 2 10 cells/ml. Two ml of the cell suspension were placed in a continuously stirred cuvette at 37 °C in a fluorimeter (Photon Technology Inc., South Brunswick, NJ). Fluorescence was monitored at = 340 nm, = 380 nm, and = 510 nm, and the data presented as the relative ratio of fluorescence emitted upon sequential excitation at 340 and 380 nm. Data were collected every 200 ms.

RNA Analysis

Total leukocytes from the peripheral blood of BALB/c mice were lysed in guanidinium isothiocyanate. Total RNA was purified by extraction with phenol and chloroform, followed by precipitation in ethanol. RNA was fractionated by size on a denaturing agarose gel and transferred to a nylon membrane as described previously (19) . A Northern blot containing 5 µg/lane of poly(A) RNA from a panel of organs from a BALB/c mouse was purchased from Clontech (Palo Alto, CA). Northern blots were hybridized to P-labeled full-length ORF probes, labeled to a similar specific activity with a random primer labeling kit (Boehringer Mannheim).

Sequence Analysis

DNA and protein sequences were compiled and analyzed using the software package from the University of Wisconsin Genetics Computer Group (32) on a Cray supercomputer maintained by the National Cancer Institute Advanced Scientific Computing Laboratory, Frederick Cancer Research Facility, Frederick, MD.


RESULTS

Cloning of the Mouse MIP-1 Receptor Gene and Two Related Genes

We previously isolated the cDNA and gene for the human MIP-1/RANTES receptor and reported that, like many other members of the seven-transmembrane-domain receptor superfamily, the ORF resides on a single exon(19) . Therefore, to find its mouse orthologue, we screened an 129/SvJ mouse genomic DNA library at low stringency with a full-length human receptor cDNA probe. Unexpectedly, 14 clones were isolated that could be assigned to three distinct groups based on common restriction enzyme cleavage patterns and hybridizing fragments. Clones M2, M3, and M7 were selected for further study, and 3.3-kb XbaI, 6.0-kb XbaI, and 4.2-kb SacI fragments, respectively, were subcloned and sequenced. Each ORF was similar in length and sequence to the human MIP-1/RANTES receptor and appeared to lack introns.

Based on sequence relationships and the functional analysis described below, we have adopted the following provisional nomenclature: M3, MIP-1 receptor (MIP-1R); M2, MIP-1 receptor-like 1 (MIP-1RL1); and M7, MIP-1 receptor-like 2 (MIP-1RL2). The deduced sequences of MIP-1R and the human MIP-1/RANTES receptor are both 355 amino acids in length. MIP-1RL1 and MIP-1RL2 sequences are 1 and 4 residues longer, respectively. None of the mouse sequences has predicted sites for N-linked glycosylation, whereas the human receptor has one in the N-terminal domain (Fig. 1). The deduced protein sequence of MIP-1R is slightly less divergent from that of the human MIP-1/RANTES receptor (80% identity) than its DNA sequence (76% identity). In contrast, the sequences of MIP-1RL1 and MIP-1RL2 are less similar at the protein level (62 and 63% identity, respectively) than at the DNA level (72 and 71% identity, respectively) to the human MIP-1/RANTES receptor, reflecting a relative increase in the content of non-synonymous substitutions.


Figure 1: Sequence alignment of the human MIP-1/RANTES receptor (huMIP-1/RANTES R) with the mouse MIP-1 receptor (MIP-1R) and two related putative receptors (MIP-1RL1 and MIP-1RL2). Shadedletters indicate residues at each aligned position that are identical to the human MIP-1/RANTES receptor specificity. Dots indicate gaps that were inserted to optimize the alignment. The locations of predicted membrane-spanning segments I-VII are noted. Arabicnumbers correspond to the sequence of human MIP-1/RANTES receptor and are left justified.



Signal Transduction and Ligand Selectivity of the Mouse MIP-1 Receptor

To determine whether their products are chemokine receptors, MIP-1R, MIP-1RL1, and MIP-1RL2 ORFs were stably expressed in K562 cells, and ligand-stimulated calcium mobilization was measured. This response, characteristic of known leukocyte chemokine receptors, appears to be a consequence of signal transduction through a phospholipase C-coupled G protein and can be used to monitor receptor activation in real time. Neither untransfected K562 cells nor MIP-1RL1 and MIP-1RL2 transfectants responded to mouse MIP-1, mouse MIP-1, or mouse TCA3, or to any of the following human chemokines: MIP-1, MIP-1, RANTES, MCP-1, MCP-2, MCP-3, I-309, Mig, IP-10, IL-8, GRO, GRO, NAP-2, platelet factor 4, and ENA-78, all tested at 100 nM (Fig. 2A and data not shown). In contrast, human MIP-1 and mouse MIP-1 both induced transient elevations of [Ca] in MIP-1R transfectants with an EC = 10 and 6 nM, respectively (Fig. 2, A and B). RANTES was a much less potent agonist than MIP-1, having a threshold for calcium mobilization > 100 nM. None of the other chemokines listed above, including mouse MIP-1, were agonists for calcium mobilization by MIP-1R.


Figure 2: Agonist selectivity of the mouse MIP-1 receptor and its homologues. A, kinetics. [Ca] was monitored by ratio fluorescence of FURA-2-loaded K562 cells stably transfected with plasmids containing ORFs for the mouse MIP-1 receptor (muMIP-1R) and two related putative receptors (muMIP-1RL1 and muMIP-1RL2). Each column of tracings corresponds to the ORF indicated at the top. Cells were stimulated at the time indicated by the arrows with the chemokine indicated at the left of each row of tracings, at the concentration indicated to the right of the corresponding arrow. The tracings shown are from a single experiment representative of at least three separate experiments for each ORF. B, concentration dependence. The magnitude of the peak of the calcium transient elicited by the indicated concentration of human (solidcircles) or mouse (opensquares) MIP-1 from K562 cells stably expressing MIP-1R is shown. Each data point represents the peak of one tracing. The data are from a single experiment representative of two separate experiments.



After activation, most G protein-coupled receptors have altered sensitivity to repeated stimulation with the activating agonist and other agonists. This phenomenon, known as desensitization, has been described previously for the human MIP-1/RANTES receptor and a viral chemokine receptor encoded by ORF US28 of human cytomegalovirus(20, 30) . When MIP-1R transfectants were sequentially stimulated, 100 nM MIP-1 markedly attenuated responsiveness of the cells to repeat stimulation with the same concentration. In contrast, 100 nM RANTES, MIP-1, or MCP-1 had no effect on the response to subsequent stimulation with 100 nM MIP-1 (Fig. 3). This further demonstrated the high selectivity of MIP-1R for MIP-1.


Figure 3: Desensitization of calcium transients activated by the mouse MIP-1 receptor. Ratio fluorescence was monitored from FURA-2-loaded K562 cells stably transfected with MIP-1R before and during sequential addition of test substances at the times indicated by the arrows. The concentration and identity of each stimulus are indicated to the right of each arrow. The tracings are from a single experiment representative of two separate experiments. hu, human.



To compare the functional properties of MIP-1R to native receptors, leukocytes were isolated from the peripheral blood of BALB/c mice. As for the MIP-1R transfectants, human MIP-1 potently induced a calcium flux response in mouse leukocytes (EC = 0.1 nM) whereas human RANTES was much less potent (100 nM < threshold < 500 nM) (Fig. 4). The desensitization patterns for MIP-1R and mouse leukocytes were also concordant (Fig. 4A). After stimulation with MIP-1, mouse leukocytes were refractory to repeat stimulation, but could still respond to the unrelated agonist N-formyl-methionyl-leucyl-phenylalanine (fMLP). In contrast, pretreatment with 100 nM RANTES had no effect on the response to 100 nM MIP-1. While the kinetics of the calcium transient induced by human MIP-1 were similar for both MIP-1R-transfected K562 cells and mouse leukocytes, it is important to note that the EC values were considerably different: 10 nMversus 0.1 nM, respectively. Additional work will be needed to determine the molecular basis for this difference.


Figure 4: Calcium mobilization responses to chemoattractants by leukocytes from normal mouse peripheral blood. A, kinetics and desensitization. [Ca] was monitored by ratio fluorescence of FURA-2-loaded total leukocytes from peripheral blood of BALB/c mice. Cells were stimulated at the time indicated by the arrows with the substance indicated adjacent to each arrow. Human MIP-1 and RANTES were used. B, concentration dependence. The magnitude of the peak of the calcium transient elicited by the indicated concentration of human MIP-1 from mouse leukocytes is shown. Each data point represents the peak of one tracing, with the exception of the 100 nM data point, which is the average of 5 tracings, all from the same experiment.



Promiscuous Chemokine Binding to the Mouse MIP-1 Receptor

To directly test the ability of MIP-1R, MIP-1RL1, and MIP-1RL2 to interact with chemokines, radioligand binding was performed. Neither untransfected K562 cells nor MIP-1RL1 and MIP-1RL2 transfectants specifically bound radiolabeled MIP-1, MIP-1, MCP-1, or RANTES at 4 °C (Fig. 5A and data not shown). MIP-1R transfectants were able to specifically bind I-human MIP-1 and I-human RANTES ( Fig. 5and 6). Scatchard transformation of computer-fitted competition binding curves with I-human MIP-1 as the radioligand revealed a single class of binding sites, with apparent K values of 20 and 10 nM for human MIP-1 and mouse MIP-1, respectively (Fig. 5, B and C). When unlabeled human MIP-1 from a different supplier (R& Systems, Minneapolis, MN) was used, an apparent K of 0.41 nM was obtained (Fig. 6A). Peprotech is the source of the human MIP-1 protein that was iodinated and the competing unlabeled human MIP-1 used in Fig. 5B.


Figure 5: Specific binding of MIP-1 to K562 cells stably transfected with mammalian chemokine receptor-like genes. A, untransfected cells (K562) or cells stably transfected with the indicated human or mouse genes were incubated in duplicate with 0.1 nMI- human MIP-1 in the presence or absence of 500 nM human MIP-1 at 4 °C. Nonspecific binding was less than 10% of total binding. Data are representative of >five separate experiments. B and C, concentration-dependent competition for I-human MIP-1 binding to MIP-1R-transfected K562 cells. Cells were incubated with 0.1 nMI-human MIP-1 and different concentrations of unlabeled human (B) and mouse (C) MIP-1. Scatchard plots and dissociation constants are shown in the upper right and lower left of each panel, respectively.




Figure 6: Promiscuous binding of chemokines to the mouse MIP-1 receptor. K562 cells stably transfected with MIP-1R were incubated with 0.1 nMI-human MIP-1 (A) or 0.15 nMI-human RANTES (B), and total binding was measured in the presence of increasing concentrations of the unlabeled chemokines identified in the inset at the bottomleft of each panel. mu, mouse; hu, human. RANTES, MCP-1, and IL-8 were human forms. Average total binding was 4000 cpm (A) and 11,500 cpm (B). The average number of binding sites per cell estimated using LIGAND (31) for I-human MIP-1 and unlabeled human MIP-1 data was 173,000. The results shown are from a single experiment representative of at least two independent experiments with both radioligands and all unlabeled chemokines. Total binding of I-human MCP-1 did not exceed background levels determined in similarly selected control cells. In parallel experiments with K562 cells stably transfected with MIP-1RL1 and MIP-1RL2 encoding plasmids, total binding did not exceed background levels with any of the four radiolabeled chemokines.



Binding of I-human MIP-1 and I-human RANTES by MIP-1R could be competed by all unlabeled chemokines tested, but not by the chemokine IL-8 (Fig. 6). The rank order and extent of competition differed depending on the identity of the radioligand. For I-human MIP-1, the rank order was human MIP-1 (R&) > mouse MIP-1 RANTES MIP-1 > MCP-1; for I-human RANTES, the rank order was human MIP-1 RANTES > MIP-1 > MCP-1. The extent of competition by unlabeled MIP-1 and MCP-1 was consistently greater for the I-MIP-1-labeled site than the I-RANTES-labeled site, whereas the extent of competition by MIP-1 was the same for both sites. The extent of competition by unlabeled RANTES was consistently less than unlabeled MIP-1 for both the I-MIP-1- and I-RANTES-labeled sites. More severe problems with homologous RANTES competition binding assays have been reported previously for the human MIP-1/RANTES receptor expressed in human embryonic kidney 293 cells(20) . Because of these problems, accurate calculation of the K for RANTES binding was not possible.

The weaker interaction of MCP-1 with MIP-1R suggested by the heterologous competition binding experiments was supported by the lack of direct binding of I-MCP-1 to the MIP-1R transfected cells (not shown). Low levels of I-MIP-1 bound specifically to the MIP-1R transfectants (not shown).

Graham et al.(28) have reported that K562 cells specifically bind MIP-1 at 37 °C and that binding can be competed by several chemokines, but not by chemokines. They did not report binding studies conducted at 4 °C. We could detect specific I-MIP-1, RANTES, and MCP-1 binding to untransfected K562 cells at 37 °C, but the levels were very low compared to I-MIP-1 binding to MIP-1R and human MIP-1/RANTES receptor transfectants at 4 and 37 °C (data not shown). Moreover, untransfected K562 cells reproducibly lacked specific binding sites for radiolabeled MIP-1, RANTES, and MCP-1 at 4 °C (n > 5), and reproducibly failed to exhibit a calcium flux by 16 different chemokines at 37 °C (n > 10). Finally, we were unable to detect RNA for the human MIP-1/RANTES receptor in untransfected K562 cells by Northern blot analysis. We have also shown that human embryonic kidney 293 cell lines, transiently or stably transfected with MIP-1R or the human MIP-1/RANTES receptor, exhibit calcium flux responses to chemokines that are concordant with the corresponding K562 stable transfectants.() Taken together, the data strongly indicate that the specific binding and calcium flux responses in the MIP-1R transfected cells are mediated by the cloned mouse gene product. The relationship of chemokine binding to K562 cells measured at 37 °C to the cloned chemokine receptors remains unknown.

Tissue-specific Expression of MIP-1R, MIP-1RL1, and MIP-1RL2 RNA

To determine the tissue distribution of MIP-1R, MIP-1RL1, and MIP-1RL2 RNA, the corresponding radiolabeled complete ORF DNAs were used to probe identical Northern blots of total RNA from mouse leukocytes (Fig. 7A) and of poly(A) RNA from mouse solid organs (Fig. 7B) under high stringency conditions. The probes do not cross-hybridize under these conditions and do not cross-hybridize to other mouse genes (not shown). Although all three genes were expressed in mouse leukocytes, each had a unique expression pattern in solid organs.


Figure 7: Distribution of RNA for the mouse MIP-1 receptor and two related putative receptors in mouse leukocytes and solid organs. A, mouse leukocytes. Each lane contains 10 µg of total mouse peripheral blood-derived leukocyte RNA. B, solid organs. Each lane contains 5 µg of poly(A) RNA from the organs of a BALB/c mouse. For both A and B, the exact same leukocyte or solid organ Northern blot was hybridized to the full-length ORF probe indicated at the bottom of each lane or set of lanes. The final wash was at 68 °C in 0.1 SSC for 1 h. The blot was exposed to Kodak XAR-2 film in a Quanta III cassette at -80 °C for 96 h for all six hybridizations. RNA size markers are indicated at the left of each panel. The results were identical when separately prepared leukocyte and solid organ blots were tested with all three probes. sk., skeletal.



For MIP-1R, at least three different specific mRNA bands were consistently identified in mouse leukocyte RNA. The major band was 2.4 kb, whereas the two minor bands were 3.7 and 6 kb. The major band, but not the minor bands, was also detected in heart, spleen, and lung samples. It is important to note that the major band is quite broad and could represent a collection of mRNA species that differ slightly in length. For MIP-1RL1, two different weak bands were identified in mouse leukocyte RNA that were 2.6 and 6 kb. The same probe identified a single 3.7-kb band in skeletal muscle RNA; no other solid organs were positive. For MIP-1RL2, three different mRNA bands were detected in mouse leukocyte RNA. The two major bands were 2.6 and 3.5 kb, whereas the minor band was 1.2 kb. All three of these bands were also detected in spleen and liver samples with the same probe, but not in other solid organs even after prolonged exposures of the blot.


DISCUSSION

In the present work, we have delineated the amino acid sequence, RNA distribution, high affinity ligands, agonists, and signal transduction properties of the first mouse chemokine receptor, MIP-1R. In addition, we have characterized two highly related genes for putative chemokine receptors whose ligands and human orthologues remain unknown. All three genes have been mapped to mouse chromosome 9, in a region of conserved synteny with the gene for the human MIP-1/RANTES receptor.() All of the leukocyte chemokine receptors cloned so far bind either or chemokines, but not to chemokines from both classes, and couple to calcium-mobilizing signal transduction processes(12, 13, 15, 16, 18, 19, 20, 21, 22) . The chemokines MIP-1 and RANTES bind to MIP-1R with the highest affinity. Mouse and human forms of MIP-1 were strong agonists, whereas human RANTES was a very weak agonist for MIP-1R.

We named the mouse receptor MIP-1R to convey the high potency of MIP-1 relative to human RANTES and the other chemokines tested. The human MIP-1/RANTES receptor is also more selective for MIP-1 than for RANTES, whether calcium mobilization is measured in Xenopus oocytes microinjected with receptor cRNA or in transfected 293 and K562 cells, but the EC values differ only by 2-fold, much less than for MIP-1R(19, 20, 30) . Since human and mouse RANTES are 85% identical in amino acid sequence(33) , it is likely that mouse RANTES can also activate MIP-1R, perhaps with greater potency than human RANTES. Purified recombinant mouse RANTES has not been tested yet in functional assays, although supernatants from 293 cells expressing mouse RANTES have been shown to possess some chemoattractant activity for human monocytes in vitro(33) . Interestingly, mouse RANTES contains two fewer positively charged residues than human RANTES, while MIP-1R contains six fewer negatively charged residues than the human MIP-1/RANTES receptor in the regions predicted to be available for ligand binding. These changes might confer differences in activity for RANTES across species.

Clearly, the contact points between chemokine and receptor necessary for high affinity binding and high potency calcium mobilizing activity must overlap, but cannot be identical. This explains how MIP-1 and RANTES could effectively cross-compete for binding to MIP-1R, while being strong and weak agonists, respectively. Another example of this is the promiscuous chemokine receptor encoded by ORF US28 of human cytomegalovirus, which we have recently characterized(30) . While MIP-1, RANTES, MIP-1, and MCP-1 are equally effective at competing with I-human MIP-1 for binding to the US28 product expressed in transfected K562 cells, RANTES is a much more potent agonist than the other three chemokines, when calcium mobilization is measured. The sequence and functional properties of the human, mouse, and viral chemokine receptors may be useful for targeting residues that are critical for restricting the selectivity of these receptors to chemokines.

The specificity of RANTES binding to MIP-1R could be shown by competition with either unlabeled RANTES or MIP-1, whereas for the human MIP-1/RANTES receptor, addition of unlabeled RANTES has been reported to cause an unexplained increase in the cell-associated counts (20) . In our experiments there were also inconsistencies with the RANTES binding assay in that the extent of competition at 10,000-fold molar excess unlabeled RANTES was consistently lower than that observed with unlabeled MIP-1 (Fig. 6B). Additional binding interactions of MIP-1R with MIP-1 and MCP-1 were evident from heterologous competition binding experiments, and could be shown directly for MIP-1. However, we were unable to identify any functional significance in the form of agonist or antagonist activities for these interactions by measuring calcium flux responses. In this case, both human and mouse forms of MIP-1 were tested. It remains possible that MIP-1 and MCP-1 can bind weakly to the receptor and activate a different signal transduction pathway not yet examined.

The similar rank order of potency of MIP-1 and RANTES for calcium mobilization by mouse blood-derived leukocytes and by MIP-1R in transfected K562 cells, and the detection of MIP-1R RNA in leukocytes, together suggest that MIP-1R mediates the mouse leukocyte calcium response to these ligands. Further analysis of leukocyte subsets and functions will be necessary to establish the general functional importance of this receptor.

Oh et al.(27) have identified small numbers of high affinity binding sites for mouse MIP-1 on mouse T lymphocytes and the mouse macrophage cell lines CTLL-R8 and RAW 264.7, but the relationship of other chemokines to these binding sites is unclear. We were unable to detect MIP-1R transcripts in RAW 264.7 total cellular RNA by Northern blot hybridization, nor did these cells respond to MIP-1 when calcium mobilization was measured (data not shown). Graham et al.(28) have reported specific binding sites for MIP-1 on the FDCPmix mouse hematopoietic stem cell line that may be shared with several other but not chemokines. Treatment with MIP-1 has small and variable effects on the cell proliferation. Whether MIP-1R is responsible for these properties of FDCPmix cells is presently unknown.

Although we were unable to demonstrate it, the properties shared by MIP-1RL1 and MIP-1RL2 with MIP-1R (similar sequence and expression in leukocytes) strongly suggest that their putative ligands are chemokines. If so, the correct ligand(s) could have been missed in the panel that we tested if: 1) the putative receptor proteins failed to fold properly or failed to traffic to the plasma membrane of stably transfected cells, 2) the putative receptors did not efficiently couple to calcium-mobilizing signal transduction processes in K562 cells, 3) the actual ligand is one of our panel that was not used in direct radioligand binding to transfected cells, or 4) the putative receptors bind only the mouse form of a human ligand that we tested. Alternatively, these putative receptors could bind novel chemokines, or less likely a non-chemokine ligand. The N-terminal region of MIP-1RL1 before transmembrane domain I, which is predicted to be extracellular and accessible to bind ligand, has a net charge of -1 and contains the sequence Leu-Cys, whereas other chemokine receptors, including the human MIP-1/RANTES receptor, MIP-1R and MIP-1RL2, are much more acidic in this region and have the sequence Pro-Cys. The predicted second extracellular loop of MIP-1RL2 between transmembrane domains IV and V is highly acidic, whereas the corresponding sequences for the MIP-1/RANTES receptor, MIP-1R, and MIP-1RL1 are all highly basic. It is unlikely that these striking differences are functionally unimportant.

The distribution of transcripts for MIP-1R, MIP-1RL1, and MIP-1RL2 in solid organs suggests that the targets for chemokine action may be broader than has been heretofore appreciated. The expression pattern of MIP-1RL1 is particularly provocative since its RNA is found uniquely in skeletal muscle among the solid organs, and only in trace amounts in leukocytes. The differential RNA expression patterns shown in Fig. 7imply specialized tissue-specific functions for the encoded proteins. The present data do not resolve the cell type(s) accounting for the positive RNA hybridization signals. Nevertheless, since the three genes are all expressed in blood leukocytes but have unique expression patterns in solid organs, it is highly unlikely that the signals in solid organs arise from leukocytes traversing the local vascular space. Since RNA for the human MIP-1/RANTES receptor is found in neutrophils, monocytes, eosinophils, and T lymphocytes of human peripheral blood, and in human tonsillar B lymphocytes(19, 34) ,() we expect that the hybridization signals for MIP-1R found in total mouse leukocyte RNA are the sum of signals arising from RNA in the corresponding mouse leukocyte subtypes.

The multiple size classes of mRNA observed for MIP-1R, MIP-1RL1, and MIP-1RL2 were all found using probes that contain only the complete ORF DNA. Since the ORFs lack introns and are unlikely to be spliced, the multiple bands that are observed could arise either from differences in the 5`- and/or 3`-untranslated regions or from cross-hybridization to the products of distinct genes. The different band sizes revealed by the three ORF probes on the same blots indicate that the putative cross-hybridizing genes cannot be MIP-1R, MIP-1RL1, or MIP-1RL2. Furthermore, high stringency Southern hybridization of the three probes to restriction endonuclease cleaved total mouse genomic DNA failed to identify any other cross-hybridizing genes. The most likely molecular basis for the multiple RNA bands observed, therefore, is alternative splicing of exons in the untranslated regions and/or differential usage of alternative polyadenylation signals in the 3`-untranslated region. In fact, the human IL-8 receptor genes and the human MIP-1/RANTES receptor gene all give rise to multiple distinct mRNAs in these ways (35) . The genomic organization for MIP-1R, MIP-1RL1, and MIP-1RL2 is probably similar. It will be necessary to rigorously define the sequence composition of their untranslated regions to prove this.

MIP-1R provides a new resource for studying the biochemical mechanism by which MIP-1 regulates leukocyte motility and activation in the mouse. Future studies will also address whether this receptor mediates the effects of MIP-1 on hematopoiesis. Since MIP-1R is structurally and functionally similar to the human MIP-1/RANTES receptor, both receptors are likely to play a similar role in vivo. Finally, the discovery of MIP-1RL1 and MIP-1RL2 and their different tissue-specific expression patterns suggests new targets for the actions of chemokines in the mouse.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank®/EMBL Data Bank with accession number(s) U28404[GenBank® Link], U28405[GenBank® Link], and U28406[GenBank® Link].

§
To whom correspondence should be addressed: Laboratory of Host Defenses, Bldg. 10, Rm. 11N113, NIH, Bethesda, MD 20892. Tel.: 301-496-2877; Fax: 301-402-0789.

The abbreviations used are: MIP, macrophage inflammatory protein; kb, kilobase(s) or kilobase pair(s); RANTES, regulated on activation, normal T-expressed and secreted; MCP-1, monocyte chemoattractant protein-1; fMLP, N-formyl-methionyl-leucyl-phenylalanine; G protein, heterotrimeric guanine nucleotide-binding regulatory protein; IL-8, interleukin-8; PCR, polymerase chain reaction; ORF, open reading frame.

J.-L. Gao and P. M. Murphy, unpublished observations.

C. Kozak, J.-L. Gao, and P. M. Murphy, submitted for publication.

M. Tomita-Yamaguchi and U. Siebenlist, unpublished data.


ACKNOWLEDGEMENTS

We thank H. L. Tiffany for excellent technical assistance.

Note Added in Proof-A human eosinophil chemokine receptor selective for MIP-1, RANTES, and MIP-1 has been cloned. Its deduced sequence is most similar to mouse MIP-1RL2(36) .


REFERENCES
  1. Baggiolini, M., Dewald, B., and Moser, B.(1994)Adv. Immunol. 55, 97-179 [Medline] [Order article via Infotrieve]
  2. Baggiolini, M., and Dahinden, C. A.(1994)Immunol. Today 15, 127-133 [CrossRef][Medline] [Order article via Infotrieve]
  3. Carr, M. W., Roth, S. J., Luther, E., Rose, S. S., and Springer, T. A.(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3652-3656 [Abstract/Free Full Text]
  4. Schall, T. J., Bacon, K., Camp, R. D., Kaspari, J. W., and Goeddel, D. V.(1993) J. Exp. Med. 177, 1821-1826 [Abstract/Free Full Text]
  5. Taub, D. D., Conlon, K., Lloyd, A. R., Oppenheim, J. J., and Kelvin, D. J.(1993) Science 260, 355-358 [Abstract/Free Full Text]
  6. Tanaka, Y., Adams, D. H., Hubscher, S., Hirano, H., Siebenlist, U., and Shaw, S.(1993) Nature 361, 79-82 [CrossRef][Medline] [Order article via Infotrieve]
  7. Graham, G. J., Wright, E. G., Hewick, R., Wolpe, S. D., Wilkie, N. M., Donaldson, D., Lorimore, S., and Pragnell, I. B.(1990)Nature 344, 442-444 [CrossRef][Medline] [Order article via Infotrieve]
  8. Maze, R., Sherry, B., Kwon, B. S., Cerami, A., and Broxmeyer, H. E.(1992) J. Immunol. 149, 1004-1009 [Abstract]
  9. Dunlop, D. J., Wright, E. G., Lorimore, S., Graham, G. J., Holyoake, T., Kerr, D. J., Wolpe, S. D., and Pragnell, I. B.(1992)Blood 79, 2221-2225 [Abstract/Free Full Text]
  10. Cooper, S., Mantel, C., and Broxmeyer, H. E.(1994)Exp. Hematol. 22, 186-193 [Medline] [Order article via Infotrieve]
  11. Michiel, D.(1993) Bio/Technology11,739 [CrossRef][Medline] [Order article via Infotrieve]
  12. Cerretti, D. P., Nelson, N., Kozlosky, C. J., Morrissey, P. J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Dosik, J. K., and Mock, B. A.(1993) Genomics 18, 410-413 [CrossRef][Medline] [Order article via Infotrieve]
  13. Suzuki, H., Prado, G. N., Wilkinson, N., and Navarro, J.(1994)J. Biol. Chem. 269, 18263-18266 [Abstract/Free Full Text]
  14. Cacalano, G., Lee, J., Kikly, K., Ryan, A. M., Pitts-Meek, S., Hultgren, B., Wood, W. I., and Moore, M. W.(1994)Science 265, 682-684 [Abstract/Free Full Text]
  15. Holmes, W. E., Lee, J., Kuang, W.-J., Rice, G. C., and Wood, W. I.(1991) Science 253, 1278-1280 [Abstract/Free Full Text]
  16. Murphy, P. M., and Tiffany, H. L.(1991)Science 253, 1280-1283 [Abstract/Free Full Text]
  17. Ahuja, S. K., Oczelik, T., Milatovitch, A., Francke, U., and Murphy, P. M.(1992) Nature Genet. 2, 31-36 [CrossRef][Medline] [Order article via Infotrieve]
  18. Bozic, C. R., Gerard, N. P., von Uexkull-Guldenband, C., Kolakowski, L. F., Jr., Conklyn, M. J., Breslow, R., Showell, H. J., and Gerard, C.(1994)J. Biol. Chem. 269, 29355-29358 [Abstract/Free Full Text]
  19. Gao, J.-L., Kuhns, D. B., Tiffany, H. L., McDermott, D., Li, X., Francke, U., and Murphy, P. M.(1993)J. Exp. Med. 177, 1421-1427 [Abstract/Free Full Text]
  20. Neote, K., DiGregorio, D., Mak, J. Y., Horuk, R., and Schall, T. J.(1993) Cell 72, 415-425 [CrossRef][Medline] [Order article via Infotrieve]
  21. Charo, I. F., Myers, S. J., Herman, A., Franci, C., Connolly, A. J., and Coughlin, S. R. (1994)Proc. Natl. Acad. Sci. U. S. A. 91, 2752-2756 [Abstract/Free Full Text]
  22. Probst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C.(1992) DNA Cell Biol. 11, 1-20 [Medline] [Order article via Infotrieve]
  23. Murphy, P. M. (1994)Annu. Rev. Immunol. 12, 593-633 [CrossRef][Medline] [Order article via Infotrieve]
  24. Wang, J.-M., Sherry, B., Fivash, M. J., Kelvin, D. J., and Oppenheim, J. J.(1993) J. Immunol. 150, 3022-3029 [Abstract]
  25. Wang, J.-M., McVicar, D. W., Oppenheim, J. J., and Kelvin, D. J.(1993)J. Exp. Med. 177, 699-705 [Abstract/Free Full Text]
  26. Van Riper, G., Siciliano, S., Fischer, P. A., Meurer, R., Springer, M. S., and Rosen, H.(1993)J. Exp. Med. 177, 851-856 [Abstract/Free Full Text]
  27. Oh, K. O., Zhou, Z., Kim, K. K., Samanta, H., Fraser, M., Kim, Y.-J., Broxmeyer, H. E., and Kwon, B. S.(1991)J. Immunol. 147, 2978-2983 [Abstract]
  28. Graham, G. J., Zhou, L., Weatherbee, J. A., Tsang, M. L., Napolitano, M., Leonard, W. J., and Pragnell, I. B.(1993)Cell Growth & Diff. 4, 137-146
  29. Heinrich, J. N., Ryseck, R. P., MacDonald-Bravo, H., and Bravo, R.(1993)Mol. Cell. Biol. 13, 2020-2030 [Abstract/Free Full Text]
  30. Gao, J.-L., and Murphy, P. M.(1994)J. Biol. Chem. 269, 28539-28542 [Abstract/Free Full Text]
  31. Munson, P. J., and Rodbard, D.(1980)Anal. Biochem. 107, 220-239 [CrossRef][Medline] [Order article via Infotrieve]
  32. Devereux, J., Haeberli, P., and Smithies, O.(1984)Nucleic Acids Res. 12, 389-395
  33. Schall, T. J., Simpson, N. J., and Mak, J. Y.(1992)Eur. J. Immunol. 22, 1477-1481 [Medline] [Order article via Infotrieve]
  34. Combadiere, C., Ahuja, S. K., and Murphy, P. M. (1995) DNA Cell Biol., in press
  35. Ahuja, S. K., Shetty, A., Tiffany, H. L., and Murphy, P. M.(1994) J. Biol. Chem. 269, 26381-26389 [Abstract/Free Full Text]
  36. Combadiere, C., Ahuja, S. K., and Murphy, P. M.(1995)J. Biol. Chem. 270, 16491-16494 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
T. WERNER, S. FESSELE, H. MAIER, and P. J. NELSON
Computer modeling of promoter organization as a tool to study transcriptional coregulation
FASEB J, July 1, 2003; 17(10): 1228 - 1237.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Onuffer, M. A. McCarrick, L. Dunning, M. Liang, M. Rosser, G.-P. Wei, H. Ng, and R. Horuk
Structure Function Differences in Nonpeptide CCR1 Antagonists for Human and Mouse CCR1
J. Immunol., February 15, 2003; 170(4): 1910 - 1916.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Menten, A. Saccani, C. Dillen, A. Wuyts, S. Struyf, P. Proost, A. Mantovani, J. M. Wang, and J. Van Damme
Role of the autocrine chemokines MIP-1{alpha} and MIP-1{beta} in the metastatic behavior of murine T cell lymphoma
J. Leukoc. Biol., October 1, 2002; 72(4): 780 - 789.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Nansen, J. P. Christensen, S. O. Andreasen, C. Bartholdy, J. E. Christensen, and A. R. Thomsen
The role of CC chemokine receptor 5 in antiviral immunity
Blood, February 15, 2002; 99(4): 1237 - 1245.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. A. Khan, P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, and G. R. Yeaman
Mice Lacking the Chemokine Receptor CCR1 Show Increased Susceptibility to Toxoplasma gondii Infection
J. Immunol., February 1, 2001; 166(3): 1930 - 1937.
[Abstract] [Full Text]