![]()
|
|
||||||||
(Received for publication, January 27, 1995; and in revised form, April 10, 1995)
From the
Macrophage inflammatory protein-1
Chemokines are structurally related 70-90-amino acid
polypeptides whose most widely shared property is the ability to
function as chemoattractants and activating factors for mammalian
leukocytes (reviewed in (1) ). Chemokines form two subfamilies,
Seventeen distinct human chemokines (10
In contrast, cDNAs have been cloned for both
human and mouse forms of the
Several groups have identified specific mouse leukocyte binding
sites for MIP-1
Based on sequence relationships and
the functional analysis described below, we have adopted the following
provisional nomenclature: M3, MIP-1
Figure 1:
Sequence alignment of the human
MIP-1
Figure 2:
Agonist selectivity of the mouse
MIP-1
Figure 3:
Desensitization of calcium transients
activated by the mouse MIP-1
Figure 4:
Calcium mobilization responses to
chemoattractants by leukocytes from normal mouse peripheral blood. A, kinetics and desensitization.
[Ca
Figure 5:
Specific binding of MIP-1
Figure 6:
Promiscuous binding of
The weaker interaction of MCP-1 with
MIP-1
Graham et al.(28) have reported that K562 cells specifically bind
MIP-1
Figure 7:
Distribution of RNA for the mouse
MIP-1
In the present work, we have delineated the amino acid
sequence, RNA distribution, high affinity ligands, agonists, and signal
transduction properties of the first mouse
We named the mouse receptor MIP-1
Clearly, the contact points between chemokine
and receptor necessary for high affinity binding and high potency
calcium mobilizing activity must overlap, but cannot be identical. This
explains how MIP-1
The specificity of RANTES
binding to MIP-1
The similar rank order of potency of MIP-1
Oh et al.(27) have identified small numbers of high affinity
binding sites for mouse MIP-1
Although we were unable to
demonstrate it, the properties shared by MIP-1
The
distribution of transcripts for MIP-1
The multiple size classes of
mRNA observed for MIP-1
MIP-1
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank®/EMBL Data Bank with accession number(s)
U28404[GenBank® Link],
U28405[GenBank® Link], and
U28406[GenBank® Link].
We thank H. L. Tiffany for excellent technical
assistance.
Note Added in Proof-A human eosinophil
chemokine receptor selective for MIP-1
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(MIP-1
) and RANTES,
members of the
chemokine family of leukocyte chemoattractants,
bind to a common seven-transmembrane-domain human receptor. We have now
cloned three related mouse genes: one for a selective MIP-1
receptor (MIP-1
R) and two for orphan receptors provisionally
designated MIP-1
receptor-like 1 and 2 (MIP-1
RL1 and 2).
Their deduced sequences are 80, 62, and 63% identical to the human
MIP-1
/RANTES receptor, respectively. K562 cells stably transfected
with MIP-1
R specifically bound I-human MIP-1
and I-human RANTES with high affinity. The rank order of
chemokine competition for I-human MIP-1
binding was human MIP-1
> mouse MIP-1
RANTES
MIP-1
> MCP-1. However, human RANTES was 100-fold less
potent as a calcium-mobilizing agonist for MIP-1
R than either
human or mouse MIP-1
, which matched the selectivity of mouse
leukocytes for calcium mobilization by MIP-1
and RANTES. No other
or
chemokines tested were agonists for MIP-1
R. RNA for
all three genes was detected in mouse leukocytes, but unique patterns
of expression were identified in solid organs: MIP-1
R, heart,
spleen, and lung; MIP-1
RL1, skeletal muscle; and MIP-1
RL2,
spleen and liver. These data identify potentially important new targets
for
chemokine action in the mouse.
and
, based on the presence or absence of a single amino
acid between the first two of four conserved cysteine residues. Most
chemokines attract and activate neutrophils, whereas all known
chemokines target monocytes but have little if any affect on
neutrophils. The
chemokines macrophage inflammatory
protein-1
(MIP-1
),
(
)MIP-1
,
RANTES, and monocyte chemoattractant protein-1 (MCP-1) also attract
basophils, eosinophils, and lymphocytes with variable
selectivity(1, 2, 3, 4, 5, 6) .
In addition, MIP-1
has been shown to suppress hematopoietic stem
cell proliferation (7, 8, 9, 10) .
and 7
) have been
identified so far (reviewed in (1) and (11) ). One way
to sort out the biological roles of each member of this complex system
is by gene knockout technology in the mouse. However, the mouse
chemokine system may differ fundamentally from the human system. For
example, the human
chemokine interleukin-8 (IL-8) has no known
counterpart in the mouse. Furthermore, only one mouse gene for an IL-8
receptor homologue has been found, whereas two closely related genes
for functional human neutrophil IL-8 receptors have been
cloned(12, 13, 14, 15, 16, 17, 18) .
Mice lacking the IL-8 receptor homologue, created by gene knockout
technology, exhibit expansion of neutrophils and B lymphocytes in the
blood, bone marrow and lymphoid organs, and mobilize neutrophils poorly
to sites of chemical irritation, suggesting a role for this receptor in
both leukocyte differentiation and chemotaxis(14) . The encoded
receptor does not bind human IL-8, but instead binds the related
chemokines mouse KC and human MGSA (melanoma growth-stimulatory
activity)(18) .
chemokines MIP-1
, MIP-1
,
RANTES, and MCP-1 (see (11) for alignment of the amino acid
sequences and for primary references). cDNAs for three human leukocyte
chemokine-selective receptors have been cloned, one that is
selective for MIP-1
and RANTES and two others that are selective
for MCP-1(19, 20, 21) . They are members of
the rhodopsin-like superfamily of heptahelical, G protein-coupled
receptors and exhibit 50% amino acid identity to each other and
30% identity to the IL-8 receptors(22, 23) .
Analysis of human leukocytes with panels of chemokines, by competitive
binding and functional assays, has suggested that genes for additional
receptor subtypes for MIP-1
, RANTES, and MCP-1 may exist, but none
has been reported yet (2, 5, 24, 25, 26) .
and MCP-1(27, 28, 29) .
Here we report the cloning, RNA expression, ligand selectivity, and
signal transduction properties of the first mouse
chemokine
receptor gene, the MIP-1
receptor gene. In addition we have
isolated two highly related genes for putative receptors whose ligands
remain unknown.
Materials
Restriction enzymes, T4 polynucleotide
kinase, and T4 DNA ligase were obtained from New England Biolabs.
[P]dCTP was from Amersham Corp. A random primer
labeling kit was from Boehringer Mannheim. Polymerase chain reaction
(PCR) reagents were from Perkin-Elmer Cetus.
I-Labeled
recombinant human MIP-1
, MIP-1
, RANTES, and MCP-1 (specific
activity 2200 Ci/mmol) were purchased from DuPont NEN. Unlabeled
recombinant human chemokines were purchased from Peprotech (Rocky Hill,
NJ), except for mouse MIP-1
and MIP-1
and human MIP-1
,
which were from R& Systems (Minneapolis, MN), and human I-309,
Mig, and platelet factor 4, and mouse TCA3, which were generous gifts
from M. Krangel, J. Farber, G. LaRosa, and M. Dorf, respectively. In
control experiments, all chemokines used except platelet factor 4,
I-309, MCP-2, and TCA3 were shown to potently induce transient
elevations of [Ca]
using purified human leukocytes (not shown).
Mouse Genomic DNA Library Screening
Approximately
10 million plaques of a 129/SvJ mouse genomic DNA library constructed
in the vector FIX (Stratagene, La Jolla, CA) were hybridized with
a full-length human MIP-1
/RANTES receptor cDNA labeled with
[P]dCTP using previously described
methods(19) . Plaques that corresponded to duplicate
hybridization signals after washing the membranes at 55 °C in 5
SSC for 30 min were purified, and the genomic inserts were
mapped with restriction enzymes. Appropriate restriction fragments of
the genomic inserts of clones M2, M3, and M7 that hybridized to the
probe were isolated by agarose gel electrophoresis and subcloned into
pBluescript SK II (Stratagene). The DNA sequences were determined on
both strands.
Design of Expression Plasmids
The ORFs were
amplified from the corresponding subcloned genomic fragments by PCR
using the sense oligonucleotides
5`-GCTCTAGACTGACCAGTTCCTCAGCAAAGGATGGAGAT for M2,
5`-GCTCTAGACTGTCCTGTAGAAGAGTTTACAATGGAGAT for M3, and
5`-GCTCTAGACATGGTTAATTGTTTCTTTGTTTATTTGT for M7; and the antisense
oligonucleotides 5`-CGG GATCCCGTTGACACCTACGGTCTGAATCAGAAGCCA for M2,
5`-CGGAATTCAGGCCTTTGTTCTGTCCAGGGTCTGAATTA for M3, and
5`-CGAATTCCTTTCAGTCCATGGATAAGTGCAATTTTCTC for M7. To facilitate
subcloning, all of the sense oligonucleotides contained added XbaI sites, and the antisense oligonucleotides contained added EcoRI sites in the case of M2 and M7, and BamHI in
the case of M3 (underlined nucleotides). In addition to the ORF, the
PCR products contained 20-60 base pairs of 5`- and 3`-flanking
sequence. The amplification reaction was performed using 100 ng of
plasmid DNA as a template. The PCR conditions were 94 °C for 5 min,
followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72
°C for 60 s, with a final extension at 72 °C for 10 min. The
PCR products were then digested with appropriate restriction enzymes,
purified by agarose gel electrophoresis using the QIAEX system (Qiagen,
Chatsworth, CA), and subcloned into pBluescript. Expression plasmids
were then constructed by transfer from Bluescript of XbaI/XhoI fragments containing the three cloned ORFs
into the NheI and XhoI sites of the
hygromycin-selectable, stable episomal vector pCEP4 (Invitrogen, San
Diego, CA). The fidelity of the cloned expression plasmids was verified
by DNA sequencing. Construction of an expression plasmid in pCEP4 for
the human MIP-1
/RANTES receptor has been described
previously(30) .
Creation of Stably Transfected Cell
Lines
Non-adherent K562 human erythroleukemia cells were grown
in RPMI 1640-glutamine (Biofluids, Inc., Walkersville, MD) containing
10% fetal bovine serum (complete medium). K562 cells (10
)
in log phase were electroporated in the presence of 20 µg of
plasmid DNA. Electroporation conditions were: 300 µl volume, 250 V,
960 microfarads, with a 0.4-cm gap electroporation cuvette. 48 h later,
cells were seeded at 10
cells/ml in complete medium with
250 µg/ml hygromycin B and selected for 5 days. Subsequently, cells
were maintained in complete medium with 150 µg/ml hygromycin B.
Expression of specific RNA was established by Northern blot
hybridization for each cell line. Neither RNA for the human
MIP-1
/RANTES receptor nor specific binding of MIP-1
,
MIP-1
, MCP-1, or RANTES at 4 °C were detectable in
untransfected K562 cells.
Ligand Binding Analysis
10
cells were
incubated in duplicate with 0.1 nM
I-labeled recombinant human chemokines and varying
concentrations of unlabeled recombinant chemokines. Binding reactions
were in a total volume of 200 µl of RPMI 1640 with 1 mg/ml bovine
serum albumin and 25 mM HEPES, pH 7.4. After incubation for 2
h at 4 °C, the cells were pelleted through a 10% sucrose/PBS
cushion and
emissions were counted. The data were curve-fitted
with the computer program LIGAND (31) to determine the
dissociation constant and number of binding sites.
Isolation of Mouse Leukocytes
Total leukocytes
were isolated by dextran sedimentation from citrated peripheral blood
obtained by cardiac puncture of BALB/c mice. Residual erythrocytes were
lysed in hypotonic saline. The cells were isolated within 2 h after
harvest. They were maintained in phosphate-buffered saline at room
temperature and were studied immediately after purification.
Intracellular [Ca
Cells (10] Measurements
/ml) were incubated in
Hank's buffered saline solution with Ca and
Mg
supplemented with 10 mM HEPES, pH 7.4
(HBSS+), containing 2.5 µM FURA-2 AM (Molecular
Probes, Eugene, OR) for 30 min at 37 °C in the dark. The cells were
subsequently washed twice with HBSS+ and resuspended at 2
10
cells/ml. Two ml of the cell suspension were placed in a
continuously stirred cuvette at 37 °C in a fluorimeter (Photon
Technology Inc., South Brunswick, NJ). Fluorescence was monitored at
= 340 nm,
= 380
nm, and
= 510 nm, and the data presented as
the relative ratio of fluorescence emitted upon sequential excitation
at 340 and 380 nm. Data were collected every 200 ms.
RNA Analysis
Total leukocytes from the peripheral
blood of BALB/c mice were lysed in guanidinium isothiocyanate. Total
RNA was purified by extraction with phenol and chloroform, followed by
precipitation in ethanol. RNA was fractionated by size on a denaturing
agarose gel and transferred to a nylon membrane as described previously (19) . A Northern blot containing 5 µg/lane of
poly(A) RNA from a panel of organs from a BALB/c mouse
was purchased from Clontech (Palo Alto, CA). Northern blots were
hybridized to
P-labeled full-length ORF probes, labeled to
a similar specific activity with a random primer labeling kit
(Boehringer Mannheim).
Sequence Analysis
DNA and protein sequences were
compiled and analyzed using the software package from the University of
Wisconsin Genetics Computer Group (32) on a Cray supercomputer
maintained by the National Cancer Institute Advanced Scientific
Computing Laboratory, Frederick Cancer Research Facility, Frederick,
MD.
Cloning of the Mouse MIP-1
We previously isolated the cDNA and gene for the
human MIP-1
Receptor Gene and Two
Related Genes
/RANTES receptor and reported that, like many other
members of the seven-transmembrane-domain receptor superfamily, the ORF
resides on a single exon(19) . Therefore, to find its mouse
orthologue, we screened an 129/SvJ mouse genomic DNA library at low
stringency with a full-length human receptor cDNA probe. Unexpectedly,
14 clones were isolated that could be assigned to three distinct groups
based on common restriction enzyme cleavage patterns and hybridizing
fragments. Clones M2, M3, and M7 were selected for further study, and
3.3-kb XbaI, 6.0-kb XbaI, and 4.2-kb SacI
fragments, respectively, were subcloned and sequenced. Each ORF was
similar in length and sequence to the human MIP-1
/RANTES receptor
and appeared to lack introns.
receptor (MIP-1
R); M2,
MIP-1
receptor-like 1 (MIP-1
RL1); and M7, MIP-1
receptor-like 2 (MIP-1
RL2). The deduced sequences of MIP-1
R
and the human MIP-1
/RANTES receptor are both 355 amino acids in
length. MIP-1
RL1 and MIP-1
RL2 sequences are 1 and 4 residues
longer, respectively. None of the mouse sequences has predicted sites
for N-linked glycosylation, whereas the human receptor has one
in the N-terminal domain (Fig. 1). The deduced protein
sequence of MIP-1
R is slightly less divergent from that of the
human MIP-1
/RANTES receptor (80% identity) than its DNA sequence
(76% identity). In contrast, the sequences of MIP-1
RL1 and
MIP-1
RL2 are less similar at the protein level (62 and 63%
identity, respectively) than at the DNA level (72 and 71% identity,
respectively) to the human MIP-1
/RANTES receptor, reflecting a
relative increase in the content of non-synonymous substitutions.
/RANTES receptor (huMIP-1
/RANTES R) with the
mouse MIP-1
receptor (MIP-1
R) and two related
putative receptors (MIP-1
RL1 and MIP-1
RL2). Shadedletters indicate residues at each aligned
position that are identical to the human MIP-1
/RANTES receptor
specificity. Dots indicate gaps that were inserted to optimize
the alignment. The locations of predicted membrane-spanning segments
I-VII are noted. Arabicnumbers correspond to
the sequence of human MIP-1
/RANTES receptor and are left
justified.
Signal Transduction and Ligand Selectivity of the Mouse
MIP-1
To determine whether their products are
chemokine receptors, MIP-1
Receptor
R, MIP-1
RL1, and MIP-1
RL2 ORFs
were stably expressed in K562 cells, and ligand-stimulated calcium
mobilization was measured. This response, characteristic of known
leukocyte chemokine receptors, appears to be a consequence of signal
transduction through a phospholipase C-coupled G protein and can be
used to monitor receptor activation in real time. Neither untransfected
K562 cells nor MIP-1
RL1 and MIP-1
RL2 transfectants responded
to mouse MIP-1
, mouse MIP-1
, or mouse TCA3, or to any of the
following human chemokines: MIP-1
, MIP-1
, RANTES, MCP-1,
MCP-2, MCP-3, I-309, Mig, IP-10, IL-8, GRO
, GRO
, NAP-2,
platelet factor 4, and ENA-78, all tested at 100 nM (Fig. 2A and data not shown). In contrast, human
MIP-1
and mouse MIP-1
both induced transient elevations of
[Ca]
in MIP-1
R
transfectants with an EC = 10 and 6 nM,
respectively (Fig. 2, A and B). RANTES was a
much less potent agonist than MIP-1
, having a threshold for
calcium mobilization > 100 nM. None of the other chemokines
listed above, including mouse MIP-1
, were agonists for calcium
mobilization by MIP-1
R.
receptor and its homologues. A, kinetics.
[Ca] was monitored by ratio fluorescence of
FURA-2-loaded K562 cells stably transfected with plasmids containing
ORFs for the mouse MIP-1
receptor (muMIP-1
R) and two
related putative receptors (muMIP-1
RL1 and muMIP-1
RL2). Each column of tracings corresponds
to the ORF indicated at the top. Cells were stimulated at the time
indicated by the arrows with the chemokine indicated at the left of each row of tracings, at the concentration indicated
to the right of the corresponding arrow. The tracings
shown are from a single experiment representative of at least three
separate experiments for each ORF. B, concentration
dependence. The magnitude of the peak of the calcium transient elicited
by the indicated concentration of human (solidcircles) or mouse (opensquares)
MIP-1
from K562 cells stably expressing MIP-1
R is shown. Each
data point represents the peak of one tracing. The data are from a
single experiment representative of two separate
experiments.
After activation, most G
protein-coupled receptors have altered sensitivity to repeated
stimulation with the activating agonist and other agonists. This
phenomenon, known as desensitization, has been described previously for
the human MIP-1
/RANTES receptor and a viral
chemokine
receptor encoded by ORF US28 of human
cytomegalovirus(20, 30) . When MIP-1
R
transfectants were sequentially stimulated, 100 nM MIP-1
markedly attenuated responsiveness of the cells to repeat stimulation
with the same concentration. In contrast, 100 nM RANTES,
MIP-1
, or MCP-1 had no effect on the response to subsequent
stimulation with 100 nM MIP-1
(Fig. 3). This
further demonstrated the high selectivity of MIP-1
R for
MIP-1
.
receptor. Ratio fluorescence was
monitored from FURA-2-loaded K562 cells stably transfected with
MIP-1
R before and during sequential addition of test substances at
the times indicated by the arrows. The concentration and
identity of each stimulus are indicated to the right of each arrow. The tracings are from a single experiment
representative of two separate experiments. hu,
human.
To compare the functional properties of MIP-1
R to
native receptors, leukocytes were isolated from the peripheral blood of
BALB/c mice. As for the MIP-1
R transfectants, human MIP-1
potently induced a calcium flux response in mouse leukocytes (EC = 0.1 nM) whereas human RANTES was much less
potent (100 nM < threshold < 500 nM) (Fig. 4). The desensitization patterns for MIP-1
R and mouse
leukocytes were also concordant (Fig. 4A). After
stimulation with MIP-1
, mouse leukocytes were refractory to repeat
stimulation, but could still respond to the unrelated agonist N-formyl-methionyl-leucyl-phenylalanine (fMLP). In contrast,
pretreatment with 100 nM RANTES had no effect on the response
to 100 nM MIP-1
. While the kinetics of the calcium
transient induced by human MIP-1
were similar for both
MIP-1
R-transfected K562 cells and mouse leukocytes, it is
important to note that the EC values were considerably
different: 10 nMversus 0.1 nM,
respectively. Additional work will be needed to determine the molecular
basis for this difference.
] was monitored by ratio fluorescence of
FURA-2-loaded total leukocytes from peripheral blood of BALB/c mice.
Cells were stimulated at the time indicated by the arrows with
the substance indicated adjacent to each arrow. Human
MIP-1
and RANTES were used. B, concentration dependence.
The magnitude of the peak of the calcium transient elicited by the
indicated concentration of human MIP-1
from mouse leukocytes is
shown. Each data point represents the peak of one tracing, with the
exception of the 100 nM data point, which is the average of 5
tracings, all from the same experiment.
Promiscuous
To directly test the ability of MIP-1
Chemokine Binding to the Mouse
MIP-1
Receptor
R,
MIP-1
RL1, and MIP-1
RL2 to interact with chemokines,
radioligand binding was performed. Neither untransfected K562 cells nor
MIP-1
RL1 and MIP-1
RL2 transfectants specifically bound
radiolabeled MIP-1
, MIP-1
, MCP-1, or RANTES at 4 °C (Fig. 5A and data not shown). MIP-1
R transfectants
were able to specifically bind I-human MIP-1
and I-human RANTES ( Fig. 5and 6). Scatchard
transformation of computer-fitted competition binding curves with
I-human MIP-1
as the radioligand revealed a single
class of binding sites, with apparent K values of 20 and 10 nM for human MIP-1
and
mouse MIP-1
, respectively (Fig. 5, B and C). When unlabeled human MIP-1
from a different supplier
(R& Systems, Minneapolis, MN) was used, an apparent K of 0.41 nM was obtained (Fig. 6A). Peprotech is the source of the human
MIP-1
protein that was iodinated and the competing unlabeled human
MIP-1
used in Fig. 5B.
to K562
cells stably transfected with mammalian
chemokine receptor-like
genes. A, untransfected cells (K562) or cells stably
transfected with the indicated human or mouse genes were incubated in
duplicate with 0.1 nMI- human MIP-1
in the
presence or absence of 500 nM human MIP-1
at 4 °C.
Nonspecific binding was less than 10% of total binding. Data are
representative of >five separate experiments. B and C, concentration-dependent competition for I-human MIP-1
binding to MIP-1
R-transfected
K562 cells. Cells were incubated with 0.1 nMI-human MIP-1
and different concentrations of
unlabeled human (B) and mouse (C) MIP-1
.
Scatchard plots and dissociation constants are shown in the upper
right and lower left of each panel,
respectively.
chemokines to
the mouse MIP-1
receptor. K562 cells stably transfected with
MIP-1
R were incubated with 0.1 nMI-human
MIP-1
(A) or 0.15 nMI-human RANTES (B), and total
binding was measured in the presence of increasing concentrations of
the unlabeled chemokines identified in the inset at the bottomleft of each panel. mu, mouse; hu, human. RANTES, MCP-1, and IL-8 were human forms. Average
total binding was 4000 cpm (A) and 11,500 cpm (B). The average number of binding sites per cell estimated
using LIGAND (31) for
I-human MIP-1
and
unlabeled human MIP-1
data was 173,000. The results shown are from
a single experiment representative of at least two independent
experiments with both radioligands and all unlabeled chemokines. Total
binding of I-human MCP-1 did not exceed background levels
determined in similarly selected control cells. In parallel experiments
with K562 cells stably transfected with MIP-1
RL1 and MIP-1
RL2
encoding plasmids, total binding did not exceed background levels with
any of the four radiolabeled
chemokines.
Binding of I-human MIP-1
and I-human RANTES by
MIP-1
R could be competed by all unlabeled
chemokines tested,
but not by the
chemokine IL-8 (Fig. 6). The rank order and
extent of competition differed depending on the identity of the
radioligand. For I-human MIP-1
, the rank order was
human MIP-1
(R&) > mouse MIP-1
RANTES
MIP-1
> MCP-1; for I-human RANTES, the rank order
was human MIP-1
RANTES > MIP-1
> MCP-1. The
extent of competition by unlabeled MIP-1
and MCP-1 was
consistently greater for the I-MIP-1
-labeled site
than the I-RANTES-labeled site, whereas the extent of
competition by MIP-1
was the same for both sites. The extent of
competition by unlabeled RANTES was consistently less than unlabeled
MIP-1
for both the I-MIP-1
- and I-RANTES-labeled sites. More severe problems with
homologous RANTES competition binding assays have been reported
previously for the human MIP-1
/RANTES receptor expressed in human
embryonic kidney 293 cells(20) . Because of these problems,
accurate calculation of the K for RANTES
binding was not possible.
R suggested by the heterologous competition binding
experiments was supported by the lack of direct binding of I-MCP-1 to the MIP-1
R transfected cells (not shown).
Low levels of I-MIP-1
bound specifically to the
MIP-1
R transfectants (not shown).
at 37 °C and that binding can be competed by several
chemokines, but not by
chemokines. They did not report
binding studies conducted at 4 °C. We could detect specific I-MIP-1
, RANTES, and MCP-1 binding to untransfected
K562 cells at 37 °C, but the levels were very low compared to I-MIP-1
binding to MIP-1
R and human
MIP-1
/RANTES receptor transfectants at 4 and 37 °C (data not
shown). Moreover, untransfected K562 cells reproducibly lacked specific
binding sites for radiolabeled MIP-1
, RANTES, and MCP-1 at 4
°C (n > 5), and reproducibly failed to exhibit a
calcium flux by 16 different chemokines at 37 °C (n >
10). Finally, we were unable to detect RNA for the human
MIP-1
/RANTES receptor in untransfected K562 cells by Northern blot
analysis. We have also shown that human embryonic kidney 293 cell
lines, transiently or stably transfected with MIP-1
R or the human
MIP-1
/RANTES receptor, exhibit calcium flux responses to
chemokines that are concordant with the corresponding K562 stable
transfectants.(
)
Taken together, the data
strongly indicate that the specific binding and calcium flux responses
in the MIP-1
R transfected cells are mediated by the cloned mouse
gene product. The relationship of
chemokine binding to K562 cells
measured at 37 °C to the cloned
chemokine receptors remains
unknown.
Tissue-specific Expression of MIP-1
To determine the tissue distribution of
MIP-1
R, MIP-1
RL1,
and MIP-1
RL2 RNA
R, MIP-1
RL1, and MIP-1
RL2 RNA, the corresponding
radiolabeled complete ORF DNAs were used to probe identical Northern
blots of total RNA from mouse leukocytes (Fig. 7A) and
of poly(A) RNA from mouse solid organs (Fig. 7B) under high stringency conditions. The probes
do not cross-hybridize under these conditions and do not
cross-hybridize to other mouse genes (not shown). Although all three
genes were expressed in mouse leukocytes, each had a unique expression
pattern in solid organs.
receptor and two related putative receptors in mouse
leukocytes and solid organs. A, mouse leukocytes. Each lane
contains 10 µg of total mouse peripheral blood-derived leukocyte
RNA. B, solid organs. Each lane contains 5 µg of
poly(A) RNA from the organs of a BALB/c mouse. For
both A and B, the exact same leukocyte or solid organ
Northern blot was hybridized to the full-length ORF probe indicated at
the bottom of each lane or set of lanes. The final wash was at
68 °C in 0.1
SSC for 1 h. The blot was exposed to Kodak
XAR-2 film in a Quanta III cassette at -80 °C for 96 h for
all six hybridizations. RNA size markers are indicated at the left of each panel. The results were identical when separately prepared
leukocyte and solid organ blots were tested with all three probes. sk., skeletal.
For MIP-1
R, at least three different
specific mRNA bands were consistently identified in mouse leukocyte
RNA. The major band was 2.4 kb, whereas the two minor bands were
3.7 and 6 kb. The major band, but not the minor bands, was also
detected in heart, spleen, and lung samples. It is important to note
that the major band is quite broad and could represent a collection of
mRNA species that differ slightly in length. For MIP-1
RL1, two
different weak bands were identified in mouse leukocyte RNA that were
2.6 and 6 kb. The same probe identified a single 3.7-kb band in
skeletal muscle RNA; no other solid organs were positive. For
MIP-1
RL2, three different mRNA bands were detected in mouse
leukocyte RNA. The two major bands were 2.6 and 3.5 kb, whereas the
minor band was 1.2 kb. All three of these bands were also detected
in spleen and liver samples with the same probe, but not in other solid
organs even after prolonged exposures of the blot.
chemokine receptor,
MIP-1
R. In addition, we have characterized two highly related
genes for putative chemokine receptors whose ligands and human
orthologues remain unknown. All three genes have been mapped to mouse
chromosome 9, in a region of conserved synteny with the gene for the
human MIP-1
/RANTES receptor.(
)
All of the
leukocyte chemokine receptors cloned so far bind either
or
chemokines, but not to chemokines from both classes, and couple to
calcium-mobilizing signal transduction
processes(12, 13, 15, 16, 18, 19, 20, 21, 22) .
The
chemokines MIP-1
and RANTES bind to MIP-1
R with the
highest affinity. Mouse and human forms of MIP-1
were strong
agonists, whereas human RANTES was a very weak agonist for MIP-1
R.
R to convey the high potency
of MIP-1
relative to human RANTES and the other chemokines tested.
The human MIP-1
/RANTES receptor is also more selective for
MIP-1
than for RANTES, whether calcium mobilization is measured in Xenopus oocytes microinjected with receptor cRNA or in
transfected 293 and K562 cells, but the EC values differ
only by
2-fold, much less than for
MIP-1
R(19, 20, 30) . Since human and
mouse RANTES are 85% identical in amino acid sequence(33) , it
is likely that mouse RANTES can also activate MIP-1
R, perhaps with
greater potency than human RANTES. Purified recombinant mouse RANTES
has not been tested yet in functional assays, although supernatants
from 293 cells expressing mouse RANTES have been shown to possess some
chemoattractant activity for human monocytes in
vitro(33) . Interestingly, mouse RANTES contains two fewer
positively charged residues than human RANTES, while MIP-1
R
contains six fewer negatively charged residues than the human
MIP-1
/RANTES receptor in the regions predicted to be available for
ligand binding. These changes might confer differences in activity for
RANTES across species.
and RANTES could effectively cross-compete for
binding to MIP-1
R, while being strong and weak agonists,
respectively. Another example of this is the promiscuous
chemokine receptor encoded by ORF US28 of human
cytomegalovirus, which we have recently characterized(30) .
While MIP-1
, RANTES, MIP-1
, and MCP-1 are equally effective
at competing with I-human MIP-1
for binding to the US28 product expressed in transfected K562 cells, RANTES is a
much more potent agonist than the other three chemokines, when calcium
mobilization is measured. The sequence and functional properties of the
human, mouse, and viral
chemokine receptors may be useful for
targeting residues that are critical for restricting the selectivity of
these receptors to
chemokines.
R could be shown by competition with either
unlabeled RANTES or MIP-1
, whereas for the human MIP-1
/RANTES
receptor, addition of unlabeled RANTES has been reported to cause an
unexplained increase in the cell-associated counts (20) . In
our experiments there were also inconsistencies with the RANTES binding
assay in that the extent of competition at 10,000-fold molar excess
unlabeled RANTES was consistently lower than that observed with
unlabeled MIP-1
(Fig. 6B). Additional binding
interactions of MIP-1
R with MIP-1
and MCP-1 were evident from
heterologous competition binding experiments, and could be shown
directly for MIP-1
. However, we were unable to identify any
functional significance in the form of agonist or antagonist activities
for these interactions by measuring calcium flux responses. In this
case, both human and mouse forms of MIP-1
were tested. It remains
possible that MIP-1
and MCP-1 can bind weakly to the receptor and
activate a different signal transduction pathway not yet examined.
and RANTES for
calcium mobilization by mouse blood-derived leukocytes and by
MIP-1
R in transfected K562 cells, and the detection of MIP-1
R
RNA in leukocytes, together suggest that MIP-1
R mediates the mouse
leukocyte calcium response to these ligands. Further analysis of
leukocyte subsets and functions will be necessary to establish the
general functional importance of this receptor.
on mouse T lymphocytes and the mouse
macrophage cell lines CTLL-R8 and RAW 264.7, but the relationship of
other chemokines to these binding sites is unclear. We were unable to
detect MIP-1
R transcripts in RAW 264.7 total cellular RNA by
Northern blot hybridization, nor did these cells respond to MIP-1
when calcium mobilization was measured (data not shown). Graham et
al.(28) have reported specific binding sites for
MIP-1
on the FDCPmix mouse hematopoietic stem cell line that may
be shared with several other
but not
chemokines. Treatment
with MIP-1
has small and variable effects on the cell
proliferation. Whether MIP-1
R is responsible for these properties
of FDCPmix cells is presently unknown.
RL1 and
MIP-1
RL2 with MIP-1
R (similar sequence and expression in
leukocytes) strongly suggest that their putative ligands are
chemokines. If so, the correct ligand(s) could have been missed in the
panel that we tested if: 1) the putative receptor proteins failed to
fold properly or failed to traffic to the plasma membrane of stably
transfected cells, 2) the putative receptors did not efficiently couple
to calcium-mobilizing signal transduction processes in K562 cells, 3)
the actual ligand is one of our panel that was not used in direct
radioligand binding to transfected cells, or 4) the putative receptors
bind only the mouse form of a human ligand that we tested.
Alternatively, these putative receptors could bind novel
chemokines, or less likely a non-chemokine ligand. The N-terminal
region of MIP-1
RL1 before transmembrane domain I, which is
predicted to be extracellular and accessible to bind ligand, has a net
charge of -1 and contains the sequence Leu-Cys, whereas other
chemokine receptors, including the human MIP-1
/RANTES receptor,
MIP-1
R and MIP-1
RL2, are much more acidic in this region and
have the sequence Pro-Cys. The predicted second extracellular loop of
MIP-1
RL2 between transmembrane domains IV and V is highly acidic,
whereas the corresponding sequences for the MIP-1
/RANTES receptor,
MIP-1
R, and MIP-1
RL1 are all highly basic. It is unlikely
that these striking differences are functionally unimportant.
R, MIP-1
RL1, and
MIP-1
RL2 in solid organs suggests that the targets for
chemokine action may be broader than has been heretofore appreciated.
The expression pattern of MIP-1
RL1 is particularly provocative
since its RNA is found uniquely in skeletal muscle among the solid
organs, and only in trace amounts in leukocytes. The differential RNA
expression patterns shown in Fig. 7imply specialized
tissue-specific functions for the encoded proteins. The present data do
not resolve the cell type(s) accounting for the positive RNA
hybridization signals. Nevertheless, since the three genes are all
expressed in blood leukocytes but have unique expression patterns in
solid organs, it is highly unlikely that the signals in solid organs
arise from leukocytes traversing the local vascular space. Since RNA
for the human MIP-1
/RANTES receptor is found in neutrophils,
monocytes, eosinophils, and T lymphocytes of human peripheral blood,
and in human tonsillar B
lymphocytes(19, 34) ,(
)
we
expect that the hybridization signals for MIP-1
R found in total
mouse leukocyte RNA are the sum of signals arising from RNA in the
corresponding mouse leukocyte subtypes.
R, MIP-1
RL1, and MIP-1
RL2 were
all found using probes that contain only the complete ORF DNA. Since
the ORFs lack introns and are unlikely to be spliced, the multiple
bands that are observed could arise either from differences in the 5`-
and/or 3`-untranslated regions or from cross-hybridization to the
products of distinct genes. The different band sizes revealed by the
three ORF probes on the same blots indicate that the putative
cross-hybridizing genes cannot be MIP-1
R, MIP-1
RL1, or
MIP-1
RL2. Furthermore, high stringency Southern hybridization of
the three probes to restriction endonuclease cleaved total mouse
genomic DNA failed to identify any other cross-hybridizing genes.
The most likely molecular basis for the multiple RNA bands
observed, therefore, is alternative splicing of exons in the
untranslated regions and/or differential usage of alternative
polyadenylation signals in the 3`-untranslated region. In fact, the
human IL-8 receptor genes and the human MIP-1
/RANTES receptor gene
all give rise to multiple distinct mRNAs in these ways (35) .
The genomic organization for MIP-1
R,
MIP-1
RL1, and MIP-1
RL2 is probably similar. It will be
necessary to rigorously define the sequence composition of their
untranslated regions to prove this.
R provides a new
resource for studying the biochemical mechanism by which MIP-1
regulates leukocyte motility and activation in the mouse. Future
studies will also address whether this receptor mediates the effects of
MIP-1
on hematopoiesis. Since MIP-1
R is structurally and
functionally similar to the human MIP-1
/RANTES receptor, both
receptors are likely to play a similar role in vivo. Finally,
the discovery of MIP-1
RL1 and MIP-1
RL2 and their different
tissue-specific expression patterns suggests new targets for the
actions of
chemokines in the mouse.
, RANTES, and MIP-1
has
been cloned. Its deduced sequence is most similar to mouse
MIP-1
RL2(36) .
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
T. WERNER, S. FESSELE, H. MAIER, and P. J. NELSON Computer modeling of promoter organization as a tool to study transcriptional coregulation FASEB J, July 1, 2003; 17(10): 1228 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Onuffer, M. A. McCarrick, L. Dunning, M. Liang, M. Rosser, G.-P. Wei, H. Ng, and R. Horuk Structure Function Differences in Nonpeptide CCR1 Antagonists for Human and Mouse CCR1 J. Immunol., February 15, 2003; 170(4): 1910 - 1916. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Menten, A. Saccani, C. Dillen, A. Wuyts, S. Struyf, P. Proost, A. Mantovani, J. M. Wang, and J. Van Damme Role of the autocrine chemokines MIP-1{alpha} and MIP-1{beta} in the metastatic behavior of murine T cell lymphoma J. Leukoc. Biol., October 1, 2002; 72(4): 780 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nansen, J. P. Christensen, S. O. Andreasen, C. Bartholdy, J. E. Christensen, and A. R. Thomsen The role of CC chemokine receptor 5 in antiviral immunity Blood, February 15, 2002; 99(4): 1237 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Khan, P. M. Murphy, L. Casciotti, J. D. Schwartzman, J. Collins, J.-L. Gao, and G. R. Yeaman Mice Lacking the Chemokine Receptor CCR1 Show Increased Susceptibility to Toxoplasma gondii Infection J. Immunol., February 1, 2001; 166(3): 1930 - 1937. [Abstract] [Full Text] |