Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scheiffele, P.
Right arrow Articles by Lanka, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scheiffele, P.
Right arrow Articles by Lanka, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 3, Issue of January 20, 1995 pp. 1269-1276
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Initiation of Agrobacterium tumefaciens T-DNA Processing
PURIFIED PROTEINS VirD1 AND VirD2 CATALYZE SITE- AND STRAND-SPECIFIC CLEAVAGE OF SUPERHELICAL T-BORDER DNA IN VITRO(*)

(Received for publication, August 4, 1994; and in revised form, October 12, 1994)

Peter Scheiffele Werner Pansegrau Erich Lanka (§)

From the Max-Planck-Institut für Molekulare Genetik, Abteilung Schuster, Ihnestrasse 73, Dahlem D-14195, Berlin, Federal Republic of Germany

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

T-DNA processing during agroinfection of plants is initiated by site- and strand-specific incision at the T-DNA border sequences of the Ti plasmid. Two proteins are required for this reaction: VirD2 (49.6 kDa), catalyzing a site-specific cleaving-joining reaction on single-stranded DNA in vitro (Pansegrau, W., Schoumacher, F., Hohn, B., and Lanka, E.(1993) Proc. Natl. Acad. Sci. U. S. A. 90, 11538-11542), and VirD1 (16.1 kDa), an accessory protein required for VirD2-mediated specific cleavage of double-stranded DNA. Following efficient overproduction, VirD1 was isolated in active form from inclusion bodies and purified to near homogeneity. The protein was applied together with purified VirD2 protein for specific cleavage of double-stranded T-DNA border sequences in vitro. The reaction proceeds on negative superhelical DNA and requires Mg ions. Relaxed DNA is not cleaved. The 5` terminus of the broken DNA strand is covalently associated with protein, most probably VirD2, and the cleavage site is located at the same position that is found in vivo, indicating that the in vitro reaction mimics the one that takes place in induced agrobacteria. Relaxation of plasmid DNA occurs only upon addition of protein denaturants, suggesting that the DNA in the VirD1/VirD2 complex is topologically constrained by strong protein-DNA interactions. The characteristics of the VirD1/VirD2-mediated cleavage reaction strongly resemble those observed with relaxosomes of IncP plasmids involved in initiation of transfer DNA replication during bacterial conjugation.


INTRODUCTION

Agrobacterium tumefaciens is a prokaryotic plant pathogen that transforms plant cells by a unique interkingdom DNA transfer system. A particular DNA stretch of its 200-kb (^1)tumor-inducing (Ti) plasmid, the T-DNA, is transferred and stably integrated into the plant genome (Winans, 1992; Zambryski, 1992). Expression of the transferred DNA (20-30 kb) in the plant cell leads to autonomous production of the plant hormones auxin and cytokinin, resulting in tumor formation. Furthermore, the T-DNA directs the synthesis of specific amino acid derivatives (opines) that are exported by the transformed plant cell allowing A. tumefaciens to utilize these opines as the sole carbon and nitrogen source for growth (Zambryski et al., 1989).

Functions required for T-DNA transfer are encoded by the virulence (Vir) region (30 kb) of the Ti plasmid. Expression of the DNA transfer machinery specified by this region is stringently regulated. vir gene expression is induced by chemical signal molecules (phenolics and sugars) released from wounded plant cells (Winans, 1992). Recognition of these signals by the sensor protein VirA leads to phosphorylation of VirG protein, upon which VirG activates expression of the other vir operons (virB, virC, virD, virE, and virF) (Jin et al., 1990; Stachel and Zambryski, 1986). DNA processing involves (i) recognition and complexing of 25-bp direct repeats flanking the T-DNA, the T-border sequences, by virD gene products (Filichkin and Gelvin, 1993; Jayaswal et al., 1987; Yanofsky et al., 1986); (ii) single-stranded incisions within the T-borders leading to covalent attachment of the VirD2 protein to the 5` terminus of the T-DNA (Dürrenberger et al., 1989; Howard et al., 1989; Pansegrau et al., 1993a; Young and Nester, 1988); (iii) DNA transport requiring displacement of the T-DNA and its protection by coating with the ssDNA-binding protein VirE2 (Gietl et al., 1987; Christie et al., 1988; Citovsky et al., 1989). The resulting nucleoprotein complex, the T-complex, is exported to the plant cell, probably through a transmembrane pore consisting of gene products specified by the virB operon (Kado, 1994; Kuldau et al., 1990; Lessl and Lanka, 1994; Shirasu et al., 1990; Thompson et al., 1988; Ward et al., 1988). Inside the plant cell, targeting of the T-complex into the nucleus is directed by nuclear localization signals present in VirD2 (Citovsky et al., 1994; Rossi et al., 1993; Tinland et al., 1992) and VirE2 (Citovsky et al., 1992, 1994) using the nuclear import machinery of the plant. Insertion of the T-DNA in one of the host's chromosomes might involve catalysis by the 5`-terminal attached VirD2 protein (Gheysen et al., 1991; Mayerhofer et al., 1991; Pansegrau et al., 1993a).

Data have accumulated that suggest a close relationship between T-DNA transfer from Agrobacterium spp. to plants and IncP plasmid-mediated bacterial conjugation. Sequence relations have been found between four components: the nick regions of T-borders and the IncP transfer origin (Pansegrau and Lanka, 1991; Waters et al., 1991; Waters and Guiney, 1993) and gene clusters of the VirD operon/relaxase operon (Lessl and Lanka, 1994; Pansegrau and Lanka, 1991; Pansegrau et al., 1994a, 1994b; Ziegelin et al., 1991), VirC/leader operon (Pansegrau et al., 1994a), and VirB/Tra2 region of pTi/IncP plasmids (Lessl et al., 1992), respectively. The gene organization of the corresponding operons is highly conserved, and a high degree of sequence identity between the primary structures of gene products indicates evolutionary relationship of the DNA transfer systems (Pansegrau et al., 1994a). Although there is little sequence similarity detectable, the pTi virE2 gene product seems to be functionally analogous to the TraC1 primase of IncP plasmid RP4 concerning DNA binding properties. Both proteins have been shown to be transported together with the DNA to recipient cells and therefore are supposed to coat and protect the ssDNA during transfer (Gietl et al., 1987; Christie et al., 1988; Citovsky et al., 1989, 1992, 1994; Rees and Wilkins, 1990). However, a primase activity has not been detected in the VirE2 protein. (^2)

The pTi VirB region is related to three other macromolecular transport systems, the pilus gene clusters of IncW (^3)and IncN plasmids (Pohlman et al., 1993) and the Ptl operon of Bordetella pertussis mediating export of the pertussis toxin (Weiss et al., 1993). However, the closest relationship exists between the Ti system and IncP plasmids because both the DNA processing and the DNA transport functions are similar in organization and primary structure. The relationship to IncN and IncW plasmids appears to be limited mainly to the DNA transport system. These findings suggest that in the course of the evolution of the different DNA transfer systems modules of different origin have been combined and adapted to form functional conjugation machineries or, in one case, a toxin transport system.

The mechanism of T-DNA transfer shows striking similarity to bacterial conjugation mediated by IncP plasmids; in both systems, a DNA single strand is transferred with the 5` end leading (Al-Doori et al., 1982; Grinter, 1981; Zambryski, 1992). During transfer, the 5` terminus is thought to remain covalently associated with the relaxase (VirD2/TraI) (Dürrenberger et al., 1989; Howard et al., 1989; Pansegrau et al., 1990b, 1993a, 1993b; Young and Nester, 1988). Functional similarity between VirD2 and TraI has also been detected in vitro; VirD2 and TraI catalyze site-specific cleaving-joining reactions on single-stranded oligonucleotides reaching an equilibrium when 35-40% of the input DNA exists in the cleaved form (Pansegrau et al., 1993a, 1993b). The reactions are Mg ion-dependent and occur at the same position, relative to the consensus nick region. Cleavage results in formation of a covalent VirD2/TraI-oligonucleotide adduct in which the protein is attached to the 5`-terminal nucleotide at the nick site. Peptide mapping of such VirD2-oligonucleotide adducts identified tyrosine 29 as the residue that forms a phosphodiester with the nucleotide at the 5` end (Pansegrau et al., 1993a). A mutational analysis of the virD2 gene had also shown that tyrosine 29 is the only tyrosine residue within VirD2 that cannot be replaced without loss of activity (Vogel and Das, 1992a). In agreement with previous studies that assigned the attachment site of the IncP relaxase TraI to tyrosine 22 (Pansegrau et al., 1993b), tyrosine 29 of VirD2 is located within the conserved relaxase motif I (Ilyina and Koonin, 1992; Koonin and Ilyina, 1993; Pansegrau et al., 1994a, 1994b).

In the IncP system, the corresponding reaction on dsDNA in addition to the TraI relaxase requires the accessory protein TraJ (Pansegrau et al., 1990a). TraJ is a specific oriT-binding protein (Ziegelin et al., 1989) proposed to form a nucleoprotein complex with negatively superhelical oriT DNA that can be recognized by TraI (Pansegrau et al., 1990a). VirD1 could play an analogous role in the Ti system since virD1 and virD2 are the only determinants essential for T-border-specific cleavage in vivo.

Any DNA sequence located between T-borders can be transferred efficiently; therefore, plant oncogenes and genes for opine catabolism may be replaced by any other gene of interest. The resulting so-called disarmed vectors are extremely helpful as widely used tools for genetic manipulation or engineering of plant cells by transformation. However, T-DNA transfer is limited in its host range, allowing efficient transformation of most dicotyledonous, but of only a few monocotyledonous, plants. Since monocots are of great economic importance, it is desirable to find efficient methods allowing their genetic transformation. A possible way could consist in generation of the T-complex in vitro and subsequent transfer into plant cells by common methods such as microinjection or particle gun transformation. Since VirD2 and VirE2 possess nuclear localization signals (Citovsky et al., 1992, 1994; Rossi et al., 1993; Tinland et al., 1992), higher transformation rates than with conventional methods are expected. A prerequisite for these experiments is the in vitro reconstitution of the initiation complex active in T-border-specific DNA cleavage.

Here we report the overproduction and purification of VirD1 protein of the A. tumefaciens plasmid pTiC58. Efficient overproduction of VirD1 in Escherichia coli required exchange of the natural ribosome binding site against that of bacteriophage T7 gene 10 and replacement of a cluster of rare Arg codons within the virD1 structural gene. The purified VirD1 protein together with VirD2 relaxase (Pansegrau et al., 1993a) was applied to cleave superhelical plasmid DNA containing T-border sequences in vitro. The in vitro cleavage reaction was shown to mimic the virD1/virD2-dependent T-border cleavage reaction observed in vivo in terms of site and strand specificity, resulting in covalent attachment of the VirD2 relaxase to the 5` terminus of the cleaved DNA strand. Implications for the mechanism of T-DNA processing and functional analogies to DNA processing during bacterial conjugation are discussed.


EXPERIMENTAL PROCEDURES

Bacterial Strains, Plasmids, and Medium

E. coli SCS1 (endA1, hsdR17(r(K)-, m(K)-), supE44, thi-1, recA1, gyrA96, relA1), a DH1 derivative (Hanahan, 1983), was used as host for plasmids. Plasmids pMS119HE (Balzer et al., 1992) and pBR329 have been described previously (Covarrubias and Bolivar, 1982). Plasmids pT7-7 (Sano and Cantor, 1990) and pVir97.89 (Alt-Mörbe and Schröder, 1986), were kindly provided by Stanley Tabor (Harvard Medical School) and Juliane Alt-Mörbe (Institut für Biologie III, Universität Freiburg, Freiburg, Germany), respectively. Substrates for T-border cleavage were constructed by insertion of synthetic complementary oligonucleotides in pBR329: right border of pTiC58, d(GATCCTCTTAGGTTTACCCGCCAATATATCCTGTCAAACACTG) and d(TCGACAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAG); left border of pTiC58, d(GCAATTTGTTTACACCACAATATATCCTGCCACCAGCCGACGT) and d(CGGCTGGTGGCAGGATATATTGTGGTGTAAACAAATTGCTGCA) (the specific nick positions are indicated by an arrow); overdrive of pTiA6: d(CTAGCATCAAACAAACATACACAGCGACTTATTCACACGG) and d(GATCCCGTGTGAATAAGTCGCTGTGTATGTTTGTTTGATG). Substrates were constructed as follows: pPS100, pBR329 (BamHI-SalI, right T-border of pTiC58, 43 bp); pPS101, pPS100 (PstI-AatII, left T-border of pTiC58, 43 bp); pPS110, pPS100 (NheI-BamHI, overdrive of pTiA6, 40 bp); pPS111, pPS101 (NheI-BamHI, overdrive of pTiA6, 40 bp). Cells were grown in YT medium (Miller, 1972) supplemented with 25 mM MOPS (sodium salt; pH 8.0), 0.1% glucose, 0.1% casamino acids, and 25 µg/ml thiamine hydrochloride. When appropriate ampicillin, sodium salt, was added (100 µg/ml).

DNA Methodology

Standard molecular cloning methods were performed as described (Sambrook et al., 1989). Substrates for T-DNA cleavage and plasmid DNA sequencing were purified by ethidium bromide-CsCl gradients. Following treatment with alkali (0.2 M NaOH), DNA sequencing was performed using T7 Sequenase (Pharmacia) and specific synthetic oligonucleotides 18-25 nucleotides in length as primers. Primer extension was performed as described (Pansegrau et al., 1990b).

Site-directed Mutagenesis

Rare Arg codons in virD1 were changed by site-specific oligonucleotide-directed mutagenesis as described by Sayers et al.(1988). Oligonucleotide primer applied for mutagenesis was: d(GTATCACGCCGGCGTATCGAC). The resulting derivatives were examined by nucleotide sequencing.

Proteins

VirD2 protein was purified as described (Pansegrau et al., 1993a). Rabbit antiserum to the VirD1 protein was raised against a TraL/VirD1 fusion protein purified by preparative gel electrophoresis. The fusion protein derived from a gene fusion constructed in the expression plasmid pGZ161-2 (Ziegelin, 1989). E. coli topoisomerase I was generously provided by Eberhard Scherzinger (Max-Planck-Institut für Molekulare Genetik, Berlin). Calf thymus topoisomerase I was purchased from MBI Fermentas.

Solid Phase Immunoassay

Proteins were visualized by immunoblotting as described previously (Towbin et al., 1979). For detection anti-TraL/VirD1 serum (1:500, 2 h) and dichlorotriazinyl aminofluorescein-conjugated goat anti-rabbit IgGs (Jackson ImmunoResearch; 1:100) were used. Fluorescence signals were quantified with the FluorImager 575 (Molecular Dynamics).

In Vitro Reconstitution of T-border Cleavage

Under standard conditions, mixtures of VirD proteins and form I plasmid DNA (0.7 µg) were incubated in a total volume of 20 µl (20 mM Tris-HCl, pH 8.8, 50 mM NaCl, 5 mM MgCl(2), 0.1 mM EDTA) for 45 min at 37 °C. Reactions were stopped by addition of EDTA, SDS, and proteinase K to concentrations of 25 mM, 1% (w/v), and 100 µg/ml, respectively. Following incubation at 37 °C for 10 min, samples were analyzed electrophoretically. The reaction products were quantified by scanning ethidium bromide-stained agarose gels with the FluorImager 575 (Molecular Dynamics). Since form I and form II DNA give different specific fluorescence intensities, the yield of specifically cleaved plasmid DNA was calculated from the decrease of the fluorescence signal of the form I relative to the untreated substrate DNA.


RESULTS

Overproduction of VirD1

Previous attempts in expression vector cloning of virD1 resulted in rather low yields of protein and additional peptides of unexpected size were observed (De Vos and Zambryski, 1989; Jasper et al., 1994). A careful inspection of the nucleotide sequence revealed features that could affect virD1 expression. The initiation codon of virD1 (pTiC58) was proposed to be an AUG located at nucleotide positions 22-24 (here referred to as start 2, Fig. 1) (Yanofsky et al., 1986). An additional potential AUG start codon (start 1) in the same reading frame is located 12 bp upstream (Fig. 1). Potential initiation codons at this position are conserved in at least two additional Ti-type plasmids: pTiA6NC (UUG) (Jayaswal et al., 1987; GenBank accession number M17989) and pRiA4b (AUG) (Hirayama et al., 1988; GenBank accession number X12867). Furthermore, a cluster of three rare CGG Arg codons was noticed 40 bp upstream of the stop codon. Consecutive rare codons are known to stimulate frameshifting or premature termination (Rosenberg et al., 1993). We constructed a set of virD1-overproducing plasmids to study the effect of these two features on gene expression, to determine the translation initiation site, and finally to obtain amounts of VirD1 protein suitable for biochemical analysis.


Figure 1: Construction of virD1 overexpression plasmid pPS20. Upper panel, nucleotide sequence flanking the initiation codons in pTiC58/pVir97.89 (Alt-Mörbe and Schröder, 1986) and a sequence stretch 40 bp upstream of the stop codon. The Shine-Dalgarno sequence (S/D) is indicated by a horizontalline; potential initiation codons are shown as blackboxes with whiteletters. MaeIII restriction enzyme recognition site is marked by a bracket above the sequence. Lowerpanel, to construct the virD1 overexpression plasmids, the 464-bp MaeIII-SacI fragment of pVir97.89 carrying the virD1 reading frame except for the first 10 codons was inserted in the NdeI and SacI sites of the polylinker of the T7 promoter 10/gene 10 S/D expression plasmid pT7-7. The 5` end of the gene was restored using synthetic oligodeoxyribonucleotides (printed in lowercaseletters) to link the SacI cohesive end of the virD1 fragment to the NdeI-end of the vector. The oligonucleotides carried codons from the MaeIII site to start 1 or start 2, respectively. Nucleotides of rare CGG Arg codons 40 bp upstream of the stop codon (nucleotides 1048-1056 of Atuvird, GenBank accession number M33673) indicated by arrows were changed by site-directed mutagenesis. To place the manipulated virD1 gene under the control of the chemically inducible tac promoter a XbaI-SacI fragment (533 bp), carrying the manipulated gene, together with the T7 gene 10 S/D sequence, was inserted in the multi-cloning site of pMS119HE. Resulting overexpression plasmids (Table 1) are: pPS20, carrying alternative Arg codons; pPS13, carrying wild-type Arg codons; pPS22, carrying alternative Arg codons and start 1; pPS15, carrying wild-type Arg codons and start 1. A plasmid encoding the gene under its original translational control was obtained inserting a 530-bp HindIII-SacI fragment from pVir97.89 in the multicloning site of pMS119HE, resulting in pPS9. The amino acid sequence of VirD1 is shown below the nucleotide sequence. The underlined part was confirmed by N-terminal microsequencing. Polypeptides resulting from initiation of translation at start 1 yielded the N-terminal sequence M-E-E-A-M-S-Q-G-S-R.





The virD1 gene of pTiC58 including the original translational initiation site was placed under control of the LacI-regulated tac promoter in the expression vector pMS119HE. The resulting plasmid was called pPS9 (Table 1). To allow effective translational initiation in E. coli fusions of start 1 or start 2 with the S/D sequence of phage T7 gene 10 were constructed that resulted in plasmids pPS15 (start 1) and pPS13 (start 2). The rare Arg codons in these two plasmids were replaced by alternative Arg codons using site-directed mutagenesis. Resulting plasmids were named pPS22 (start 1) and pPS20 (start 2) ( Fig. 1and Table 1). Gene products specified by all the constructs were identified and quantified by immunoblotting (Fig. 2). As expected, cells carrying plasmid pPS9 with the original 5` end of virD1 expressed low amounts of a 16-kDa polypeptide (Fig. 2, lane a). In cells containing plasmid pPS13 (start 2, wild type Arg codons) the yield of this polypeptide was approximately 10 times higher (Fig. 2, lane b). Truncated forms of VirD1 were still produced but were absent in extracts of SCS1(pPS20) containing the alternative Arg codons in virD1 (Fig. 2, lanes b and d; Table 1). In cells carrying constructs with start 1 (pPS22 and pPS15) translation initiated at both, start 1 and 2; consequently two VirD1 polypeptide versions were produced. Four products were observed if the rare Arg codons were present (Fig. 2, lanes c and e; Table 1). The N termini of these four polypeptides were determined by microsequencing. The amino acid sequence of the two upper bands corresponded to peptides derived from start 1, that of the two lower bands to translational initiation at start 2. These results verify that both AUG codons are used for initiation of translation. It also suggests that truncation occurs at the C terminus of VirD1 resulting from premature termination of translation caused by the cluster of rare Arg codons. The N-terminal sequences of the product of SCS1(pPS20) (S/D T7 gene 10/start 2 and alternative Arg codons) and the lower band produced by SCS1(pPS22) (S/D T7 gene 10/start 1 and alternative Arg codons) are identical and correspond to start 2. We concluded that start 2 functions as the predominantly used translational initiation site because the size of the polypeptide specified by pPS9 and that of the smaller one specified by pPS22 are identical. In both constructs the original sequence around start 2 was preserved. In SCS1(pPS20) virD1 translation initiates at start 2 and high levels of VirD1 are produced without contaminating truncated forms; hence, this clone was used for overproduction and subsequent purification of the protein. Following chemical induction of gene expression by IPTG addition to the culture medium, approximately 8% of SDS-soluble cell protein consisted of VirD1 (Fig. 3, lane b).


Figure 2: Solid phase immunoassay of overproduced VirD1 proteins. Extracts of SCS1 cells induced for 4 h by addition of 1 mM IPTG to the culture carrying various plasmids were loaded on a 17.5% polyacrylamide gel containing 0.1% SDS. Following electrophoresis proteins were transferred to a nitrocellulose membrane by electroblotting and detected as described under ``Experimental Procedures.'' Lanea, pPS9 (300 A units of cells); lane b, pPS13 (75 A); lane c, pPS15 (25 A); lane d, pPS20 (51 A); lane e, pPS22 (17 A); lane f, pMS119HE (75 A); lane g, molecular mass standards bovine serum albumin (BSA, 68 kDa) and lysozyme (LYS, 14.3 kDa) labeled with fluorescein isothiocyanate.




Figure 3: Purification of VirD1 protein. Samples were electrophoresed on a 17.5% polyacrylamide gel containing 0.1% SDS. The gel was stained with Serva Blue R. Lane a, SCS1(pPS20), no IPTG was added; lane b, SCS1(pPS20), cells were induced for 4 h with 1 mM IPTG; lanes c-e, fractions I-III (35, 14, and 9 µg of protein, respectively); lane f, molecular mass standards: bovine serum albumin (BSA, 68 kDa), ovalbumin (OVA, 46 kDa), chymotrypsinogen A (CHYA, 25.7 kDa), lysozyme (LYS, 14.3 kDa), and aprotinin (APR, 6.5 kDa).



Purification of VirD1

The protein was purified by a three-step procedure to near homogeneity (Fig. 3, lanes c-e; Table 2). Following induction of SCS1(pPS20) with IPTG, VirD1 was found in inclusion bodies. After extensive washing with 3 M urea of the insoluble pellet formed after lysis and centrifugation, VirD1 was solubilized in buffer containing 8 M urea, 10 mM DTT. The protein was renatured by (NH(4))(2)SO(4) precipitation and stepwise removal of urea. Aggregated molecules that were not properly refolded and contaminating proteins were separated by chromatography on DEAE-Sephacel and phosphocellulose P11. The recovery of this procedure was 8% of approximately 96% pure VirD1. The existence of VirD1 dimers was shown by chemical cross-linking with glutaraldehyde as described elsewhere (Balzer et al., 1992; data not shown).



VirD1 and VirD2 Specifically Cleave T-border Plasmid Form I DNA

In vivo data suggest that T-border cleavage during the initiation of T-DNA transfer is catalyzed by VirD1 and VirD2 (Alt-Mörbe and Schröder, 1986; Yanofsky et al., 1986). Purified VirD2 protein was shown to bear site-specific cleaving and joining activity on ssDNA, but failed to cleave form I, form II, or form III DNA (Pansegrau et al., 1993a). Therefore, we incubated combinations of purified VirD proteins with plasmid DNA containing T-border sequences. Following digestion with proteinase K, the reaction products were analyzed on 0.7% agarose gels (Fig. 4; Table 3). Neither VirD1 nor VirD2 alone mediated conversion of T-border plasmid DNA from form I to form II (Fig. 4, lanes b and c; Table 3). VirD2 alone failed to cleave form I T-border plasmid DNA even when added in 200-fold molar excess (data not shown). If both proteins were present, 35-40% form I DNA of a plasmid containing a unique right border sequence of pTiC58 was converted to form II (Fig. 4, lane e; Table 3). In analogy to the cleavage of ssDNA by VirD2, the reaction requires Mg ions (Fig. 4, lane d; Table 3). Substrate DNA containing one left and one right T-border was converted to 70-75% into form II (Fig. 4, lanes f and g). Since vector DNA under these conditions did not yield significant amounts of form II, cleavage is T-border-specific (Fig. 4, lanes h and i; Table 3). The presence of the overdrive sequence in plasmids pPS110 or pPS111 had no significant influence on the yield of cleaved products (not shown).


Figure 4: Specific cleavage of T-border plasmids catalyzed by VirD1 and VirD2. A, various plasmids were incubated with VirD proteins under conditions described under ``Experimental Procedures'' and electrophoresed in a 0.7% agarose gel (89 mM Tris borate, pH 8.0, 2 mM EDTA) at 1.5 V/cm. Lanes a-e, pPS100 (right border, 0.7 µg of DNA); a, proteins omitted; b, 500 ng of VirD1; c, 60 ng of VirD2; d, 500 ng of VirD1 and 60 ng of VirD2, MgCl(2) omitted; e, 500 ng of VirD1 and 60 ng of VirD2; lanes f and g: pPS101 (right and left border, 0.7 µg of DNA); f, proteins omitted; g, 500 ng of VirD1 and 60 ng of VirD2; lanes h and i: pBR329 (0.7 µg of DNA); h, proteins omitted; i, 500 ng of VirD1 and 60 ng of VirD2. B, schematic diagram of design of T-border plasmids. Synthetic oligonucleotides symbolized by boxes were inserted in resistance genes of plasmid pBR329 (shown as arrows). Base pair coordinates of restriction sites in pBR329(4151) are BamHI (606), SalI (882), PstI (2755), and AatII (3432) (Covarrubias and Bolivar, 1982). The corresponding size of the substrates is given in base pairs.





Previously, a nonspecific DNA relaxation activity was reported for VirD1 containing extracts (Ghai and Das, 1989). Under our conditions and also using the conditions described by Ghai and Das(1989), this activity was never observed with purified VirD1 protein that is active in T-border cleavage (Fig. 4, lane b). E. coli and calf thymus topoisomerase I served as positive controls; upon incubation with the topoisomerases, all of our DNA substrates gave a spectrum of topoisomers independent of whether vector DNA or T-border DNA was used (data not shown). Under our conditions, superhelicity of the DNA was an essential prerequisite for specific T-border cleavage by VirD1/VirD2, and form III and form IV DNA did not act as a substrate (data not shown). This finding is analogous to that of the cleavage reaction at RP4 oriT catalyzed by TraI and TraJ protein, which also required superhelical DNA substrates (Pansegrau et al., 1990a). While the nick regions of RP4 oriT and pTi T-borders share close sequence similarity (Pansegrau and Lanka, 1991; Waters et al., 1991) and VirD2 cleaves RP4 nick region oligonucleotides (Pansegrau et al., 1993a). VirD1 and VirD2 together failed to cleave oriT form I plasmid DNA (data not shown). TraJ instead of VirD1 in the reaction mixture did not stimulate cleavage of RP4 oriT DNA by VirD2 (data not shown). These results indicate the higher degree of specificity of the dsDNA cleavage reaction as compared to ssDNA cleavage and suggest that VirD1 contributes to the stringency of T-border recognition on dsDNA substrates.

The in Vitro Cleavage Reaction by VirD1 and VirD2 Is Strand- and Site-specific

To verify the specificity of the cleavage reaction, products (form II DNA) were linearized with a restriction enzyme and analyzed on denaturing alkaline agarose gels (Fig. 5). Three distinct bands (A/A`, B/B`, C/C`; Fig. 5, lanes AatII and XmnI, respectively) were observed, one corresponding to the full-length linear form of the plasmid (A/A`). The sizes of the two additional fragments with higher mobility indicate cleavage in the T-border sequence. The sum of the fragment sizes matches that of one full-length linear plasmid, demonstrating that scission does occur exclusively at the T-border sequence and nowhere else on the plasmid. Radioactive labeling of the 5` termini only resulted in phosphorylation of fragments A and C (data not shown). The fragment C starting with the 5`-terminal nucleotide of the nick site was blocked, suggesting covalent association with protein. This protein most likely is VirD2, since it was shown to be attached to the T-strand in vivo and in vitro following cleavage of T-border sequences (Pansegrau et al., 1993a; reviewed by Winans, 1992).


Figure 5: Analysis of cleavage products. A, pPS100 form II DNA specifically cleaved by VirD1/VirD2 in vitro was isolated from 0.7% agarose gels. 1.5 µg of DNA were linearized with either XmnI or AatII, denatured in 0.1 M NaOH and electrophoresed for 6 h (3.5 V/cm) on a alkaline 0.7% agarose gel (McDonnell et al., 1977). Lane M contains a 1-kb ladder (Life Technologies, Inc.). B, the physical structure of pPS100 and the corresponding cleavage products including the position of the cleavage site (nic) are drawn schematically.



The in Vitro Reaction Catalyzed by VirD1 and VirD2 Mimics T-border Cleavage in Vivo

Following induction of vir genes, scission of a single strand in the right border sequence initiates T-DNA transfer to plant cells. The T-strand displacement is thought to proceed from this nick with the VirD2 protein covalently bound to the 5` end of the strand (reviewed by Zambryski(1992)). The purified VirD1 and VirD2 proteins catalyze a border-specific cleavage reaction in vitro, resulting in a product covalently modified at its 5` terminus. The position of the nick produced in vitro was determined by primer extension to demonstrate further identity with the reaction taking place in vivo (Fig. 6). These data show that the cleavage site coincides with that determined in vitro by VirD2-mediated oligonucleotide cleavage (Pansegrau et al., 1993a) and deduced from cleaved intermediates obtained from E. coli cells (Dürrenberger et al., 1989).


Figure 6: Nucleotide sequencing of the 5` terminus of specifically cleaved T-border plasmid DNA. I, pPS100 form II DNA (0.5 µg) specifically cleaved by VirD1/VirD2 was used as substrate for primer extension. Reactions were initiated at a 24-mer primer [d(GTGCGGCGACGATAGTCATGCCCC)] hybridizing 77 bp downstream from the nic site. II, as a control template pPS100 form I DNA (2 µg) was used for sequencing reactions.




DISCUSSION

A key event in the initiation of DNA processing for T-DNA transfer resulting in the production of T-complexes is the site- and strand-specific cleavage at the Ti plasmid border sequences. Based on genetic studies, it was demonstrated that this reaction is mediated by products of the Ti plasmid's VirD operon. In particular, the virD1 and virD2 gene products have been shown to be the only Ti-encoded polypeptides required for T-border cleavage (De Vos and Zambryski, 1989; Filichkin and Gelvin, 1993; Jayaswal et al., 1987; Porter et al., 1987; Stachel et al., 1987; Yanofsky et al., 1986). In a previous study, it was also shown that VirD2 alone exerts a site-specific DNA cleaving-joining reaction on single-stranded DNA, indicating that this protein bears the catalytic activity required for DNA scission (Pansegrau et al., 1993a). In vitro experiments employing VirD2 in the presence of dsDNA, either relaxed or supercoiled, failed to detect any border-specific cleavage, suggesting that an essential accessory component for dsDNA cleavage is missing (Pansegrau et al., 1993a). Others reported that even the combination of the purified proteins VirD1 and VirD2 was inactive in specific cleavage of dsDNA (Jasper et al., 1994).

In the present study we demonstrate that the proteins VirD1 and VirD2 together are sufficient to catalyze the T-border-specific cleavage on dsDNA in vitro. The reaction takes place on negative superhelical DNA in the presence of Mg ions. dsDNA cleavage results in covalent attachment of a protein (most likely VirD2) to the DNA 5` terminus as it has been shown for T-DNA single strands that were isolated from bacterial cells (Dürrenberger et al., 1989; Howard et al., 1989; Young and Nester, 1988). The position of the cleaved phosphodiester bond is the same that is found in vivo (Dürrenberger et al., 1989), indicating that the in vitro reaction described here is mimicking that occurring in agrobacteria.

What could the role of VirD1 in the dsDNA cleavage reaction be? Obviously, VirD2 recognizes specific nucleotide sequences in ssDNA; therefore, the VirD2 target surface in dsDNA probably is buried. Binding of VirD1 to the T-border could locally distort the DNA double helix structure, exposing the T-border nick region as a single strand for cleavage by VirD2. Negative supercoiling of the DNA, which is an essential requirement for the reaction to occur, could lower the energy required for local strand separation. Alternatively, VirD1 could assemble in a complex with VirD2 in the absence of DNA, resulting in an altered recognition specificity, directed against dsDNA.

Thus far, there is no clear evidence to decide between the two hypotheses. Complex formation of VirD1 with linear double-stranded DNA under our conditions was not detectable by the fragment retardation assay (not shown). However, negative supercoiling of the DNA might also be a prerequisite for binding of VirD1. On the other hand, detection of complex formation between VirD1 and VirD2 by chemical cross-linking in the absence of DNA and analysis of the products by gel electrophoresis did not yield specific VirD1-VirD2 protein-protein complexes (not shown).

Recently, a topoisomerase activity of type I was described for VirD1-containing extracts (Ghai and Das, 1989). This activity was attributed to VirD1 and proposed to be required for relaxing the DNA in order to prepare it for cleavage by VirD2 (Ghai and Das, 1989). In our hands, the purified VirD1 protein never showed any topoisomerase activity. Assuming that the denaturation/renaturation procedures that were applied in our VirD1 purification protocol restored the protein's activities only partially (indeed, the VirD1 preparation is fully active as an accessory component in dsDNA border cleavage), any hypothetical topoisomerase I activity of VirD1 would be anti-productive for T-complex formation since the cleavage reaction requires negative superhelical DNA. It is therefore extremely unlikely that the topoisomerase activity observed by Ghai and Das(1989) originates from VirD1. It is rather VirD2 that possesses a topoisomerase I-like activity (Pansegrau et al., 1993a). The reaction that is catalyzed by VirD2 on ssDNA is a cleaving-joining reaction that reaches an equilibrium when approximately 35-40% of the substrate exist in the cleaved form (Pansegrau et al., 1993a). The observation that only 35-40% of the input form I plasmid DNA can be converted to form II by the combination VirD1/VirD2, even when the proteins are added in great molar excess, parallels this result and suggests that the reaction on dsDNA is an equilibrium reaction too. However, spontaneous relaxation of supercoiled plasmid DNA containing T-borders in the presence of VirD1 and VirD2 has not been observed, indicating that the cleaved plasmid DNA species might be topologically constrained by strong protein-DNA interactions. Indeed, this has been shown for the analogous TraJ/TraI system encoded by the conjugative plasmid RP4 (videinfra). Application of a TraI mutant that is impaired in the interaction with the oriT nick region (TraI S74A) resulted in spontaneous release of plasmid topoisomers demonstrating continuous cleaving-joining (Pansegrau et al., 1994b). As in the VirD1/VirD2 system, cleaved reaction products could be captured only upon addition of protein-denaturing agents like SDS or proteases.

The reactions described for VirD1/VirD2 strongly resemble those catalyzed by relaxosomes of the IncPalpha plasmid RP4. The RP4 relaxase (TraI) is analogous to VirD2, specifically recognizing single-stranded substrates containing the nick region of the IncP transfer origin (oriT) (Pansegrau et al., 1993b). The corresponding reaction with dsDNA requires the accessory protein TraJ that binds specifically to a target sequence adjacent to the nick region (Pansegrau et al., 1990a; Ziegelin et al., 1989). Formation of the TraJbulletoriT nucleoprotein complex is the first step in a cascade that culminates in the formation of stable relaxosomes (Pansegrau et al., 1990a). It is tempting to speculate that TraJ and VirD1 are functional analogs, although there is only little similarity in their amino acid sequences (Llosa et al., 1994; Pansegrau et al., 1994a). The low degree of amino acid sequence similarity might also reflect different recognition specificities, concerning the target DNA as well as the respective relaxases with which the proteins interact.

The operons encoding the components required for initiation of transfer DNA replication in the Ti and for relaxosome formation in the IncP system are organized in a strikingly similar manner, and the amino acid sequences of several gene products are similar too, indicating that both systems have evolved from a common ancestor (Pansegrau et al., 1994a; Ziegelin et al., 1991). Formation of stable relaxosomes at T-border sequences has not yet been observed (not shown). However, this is conceivable since relaxosome assembly in the IncP systems requires a third polypeptide component: the chaperone-like TraH protein, which is required for stabilization of the nucleoprotein complex assembled at oriT (Pansegrau et al., 1990a). A possible candidate for a TraH-analogue in the Ti system is the product of the virD3 gene that is, like TraH, non-essential for DNA transfer (Kado and Lin, 1993; Vogel and Das, 1992b). The virD3 gene is located downstream of virD2 at a position that corresponds to that of traH in the IncP system (Pansegrau et al., 1994a).


FOOTNOTES

*
This work was supported by Sonderforschungsbereich Grant 344/B2 of the Deutsche Forschungsgemeinschaft (to E. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Max-Planck-Institut für Molekulare Genetik, Abteilung Schuster, Ihnestrasse 73, Dahlem, D-14195 Berlin, Federal Republic of Germany. Tel.: 49-30-8413-1242; Fax: 49-30-8413-1393. Lanka{at}mpimg-berlin-dahlem.mpg.de.

(^1)
The abbreviations used are: kb, kilobase pair(s); dsDNA, double-stranded DNA; ssDNA, single-stranded DNA; MOPS, 3-(N-morpholino)propanesulfonic acid; IPTG, isopropyl-1-thio-beta-D-galactopyranoside; bp, base pair(s); DTT, dithiothreitol.

(^2)
W. Pansegrau and E. Lanka, unpublished data.

(^3)
F. de la Cruz, personal communication.


ACKNOWLEDGEMENTS

We are grateful to Heinz Schuster for generous support. We greatly appreciate the expert technical assistance of Marianne Schlicht. We thank Werner Schröder for synthesizing oligonucleotides and sequencing VirD1 N termini and Karl Rak for preparing the VirD1 antiserum.


REFERENCES

  1. Al-Doori, Z., Watson, M., and Scaife, J. (1982) Genet. Res. 39, 99-103 [Medline] [Order article via Infotrieve]
  2. Alt-Mörbe, J., and Schröder, J. (1986) EMBO J. 5, 1129-1135 [Medline] [Order article via Infotrieve]
  3. Balzer, D., Ziegelin, G., Pansegrau, W., Kruft, V., and Lanka, E. (1992) Nucleic Acids Res. 20, 1851-1858 [Abstract/Free Full Text]
  4. Christie, P. J., Ward, J. E., Winans, S. C., and Nester, E. W. (1988) J. Bacteriol. 170, 2659-2667 [Abstract/Free Full Text]
  5. Citovsky, V., Wong, M. L., and Zambryski, P. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1193-1197 [Abstract/Free Full Text]
  6. Citovsky, V., Zupan, J., Warnick, D., and Zambryski, P. (1992) Science 256, 1802-1805 [Abstract/Free Full Text]
  7. Citovsky, V., Warnick, D., and Zambryski, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3210-3214 [Abstract/Free Full Text]
  8. Covarrubias, L., and Bolivar, F. (1982) Gene (Amst.) 17, 79-89 [CrossRef][Medline] [Order article via Infotrieve]
  9. De Vos, G., and Zambryski, P. (1989) Mol. Plant-Microbe Interact. 2, 43-52 [Medline] [Order article via Infotrieve]
  10. Dürrenberger, F., Crameri, A., Hohn, B., and Koukolíková-Nicola, Z. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 9154-9158 [Abstract/Free Full Text]
  11. Filichkin, S. A., and Gelvin, S. B. (1993) Mol. Microbiol. 8, 915-926 [Medline] [Order article via Infotrieve]
  12. Ghai, J., and Das, A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3109-3113 [Abstract/Free Full Text]
  13. Gheysen, G., Villaroel, R., and Van Montagu, M. (1991) Genes & Dev. 5, 287-297
  14. Gietl, C., Koukolíková-Nicola, Z., and Hohn, B. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 9006-9010 [Abstract/Free Full Text]
  15. Grinter, N. J. (1981) Plasmid 5, 267-276 [CrossRef][Medline] [Order article via Infotrieve]
  16. Hanahan, D. (1983) J. Mol. Biol. 166, 557-580 [Medline] [Order article via Infotrieve]
  17. Hirayama, T., Muranaka, T., Ohkawa, H., and Oka, A. (1988) Mol. & Gen. Genet. 213, 229-237
  18. Howard, E. A., Winsor, B. A., De Vos, G., and Zambryski, P. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 4017-4021 [Abstract/Free Full Text]
  19. Ilyina, T. V., and Koonin, E. V. (1992) Nucleic Acids Res. 20, 3279-3285 [Abstract/Free Full Text]
  20. Jasper, F., Koncz, C., Schell, J., and Steinbiss, H. H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 694-698 [Abstract/Free Full Text]
  21. Jayaswal, R. K., Veluthambi, K., Gelvin, S. B., and Slightom, J. L. (1987) J. Bacteriol. 169, 5035-5045 [Abstract/Free Full Text]
  22. Jin, S., Prusti, R. K., Roitsch, T., Ankenbauer, R. G., and Nester, E. W. (1990) J. Bacteriol. 172, 4945-4950 [Abstract/Free Full Text]
  23. Kado, C. I. (1994) Mol. Microbiol. 12, 17-22 [CrossRef][Medline] [Order article via Infotrieve]
  24. Kado, C. I., and Lin, T. (1993) Mol. Microbiol. 9, 803-812 [CrossRef][Medline] [Order article via Infotrieve]
  25. Koonin, E. V., and Ilyina, T. V. (1993) Biosystems 30, 241-268 [CrossRef][Medline] [Order article via Infotrieve]
  26. Kuldau, G. A., De Vos, G., Owen, J., McCaffrey, G., and Zambryski, P. (1990) Mol. & Gen. Genet. 221, 256-266
  27. Lessl, M., and Lanka, E. (1994) Cell 77, 321-324 [CrossRef][Medline] [Order article via Infotrieve]
  28. Lessl, M., Balzer, D., Pansegrau, W., and Lanka, E. (1992) J. Biol. Chem. 267, 20471-20480 [Abstract/Free Full Text]
  29. Llosa, M., Bolland, S., and de la Cruz, F. (1994) J. Mol. Biol. 235, 448-464 [CrossRef][Medline] [Order article via Infotrieve]
  30. Mayerhofer, R., Koncz-Kalman, Z., Nawrath, C., Bakkeren, G., Crameri, A., Angelis, K., Redei, G. P., Schell, J., Hohn, B., and Koncz, C. (1991) EMBO J. 10, 697-704 [Medline] [Order article via Infotrieve]
  31. McDonnell, M. W., Simon, M. N., and Studier, F. W. (1994) J. Mol. Biol. 110, 119-146
  32. Miller, J. H. (1972) Experiments in Molecular Genetics, p. 433, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  33. Pansegrau, W., and Lanka, E. (1991) Nucleic Acids Res. 19, 3455 [Abstract/Free Full Text]
  34. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., and Lanka, E. (1990a) Proc. Natl. Acad. Sci. U. S. A. 87, 6555-6559 [Abstract/Free Full Text]
  35. Pansegrau, W., Ziegelin, G., and Lanka, E. (1990b) J. Biol. Chem. 265, 10637-10644 [Abstract/Free Full Text]
  36. Pansegrau, W., Schoumacher, F., Hohn, B., and Lanka, E. (1993a) Proc. Natl. Acad. Sci. U. S. A. 90, 11538-11542 [Abstract/Free Full Text]
  37. Pansegrau, W., Schröder, W., and Lanka, E. (1993b) Proc. Natl. Acad. Sci. U. S. A. 90, 2925-2929 [Abstract/Free Full Text]
  38. Pansegrau, W., Lanka, E., Barth, P. T., Figurski, D. H., Guiney, D. G., Haas, D., Helinski, D. R., Schwab, H., Stanisich, V. A., and Thomas, C. M. (1994a) J. Mol. Biol. 239, 623-663 [CrossRef][Medline] [Order article via Infotrieve]
  39. Pansegrau, W., Schröder, W., and Lanka, E. (1994b) J. Biol. Chem. 269, 2782-2789 [Abstract/Free Full Text]
  40. Pohlman, R. F., Liu, F., Wang, L., Moré, M. I., and Winans, S. C. (1993) Nucleic Acids Res. 21, 4867-4872 [Abstract/Free Full Text]
  41. Porter, S. G., Yanofsky, M. F., and Nester, E. W. (1987) Nucleic Acids Res. 15, 7503-7517 [Abstract/Free Full Text]
  42. Rees, C. E., and Wilkins, B. M. (1990) Mol. Microbiol. 4, 1199-1205 [CrossRef][Medline] [Order article via Infotrieve]
  43. Rosenberg, A. H., Goldman, E., Dunn, J. J., Studier, F. W., and Zubay, G. (1993) J. Bacteriol. 175, 716-722 [Abstract/Free Full Text]
  44. Rossi, L., Hohn, B., and Tinland, B. (1993) Mol. & Gen. Genet. 239, 345-353
  45. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  46. Sano, T., and Cantor, C. R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 142-146 [Abstract/Free Full Text]
  47. Sayers, J. R., Schmidt, W., and Eckstein, F. (1988) Nucleic Acids Res. 16, 791-802 [Abstract/Free Full Text]
  48. Shirasu, K., Morel, P., and Kado, C. I. (1990) Mol. Microbiol. 4, 1153-1163 [CrossRef][Medline] [Order article via Infotrieve]
  49. Stachel, S. E., and Zambryski, P. C. (1986) Cell 46, 325-333 [Medline] [Order article via Infotrieve]
  50. Stachel, S. E., Timmerman, B., and Zambryski, P. (1987) EMBO J. 6, 857-863 [Medline] [Order article via Infotrieve]
  51. Thompson, D. V., Melchers, L. S., Idler, K. B., Schilperoort, R. A., and Hooykaas, P. J. (1988) Nucleic Acids Res. 16, 4621-4636 [Abstract/Free Full Text]
  52. Tinland, B., Koukolíková-Nicola, Z., Hall, M. N., and Hohn, B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7442-7446 [Abstract/Free Full Text]
  53. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354 [Abstract/Free Full Text]
  54. Vogel, A. M., and Das, A. (1992a) J. Bacteriol. 174, 303-308 [Abstract/Free Full Text]
  55. Vogel, A. M., and Das, A. (1992b) J. Bacteriol. 174, 5161-5164 [Abstract/Free Full Text]
  56. Ward, J. E., Akiyoshi, D. E., Regier, D., Datta, A., Gordon, M. P., and Nester, E. W. (1988) J. Biol. Chem. 263, 5804-5814 [Abstract/Free Full Text]
  57. Waters, V. L., and Guiney, D. G. (1993) Mol. Microbiol. 9, 1123-1130 [CrossRef][Medline] [Order article via Infotrieve]
  58. Waters, V. L., Hirata, K. H., Pansegrau, W., Lanka, E., and Guiney, D. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1456-1460 [Abstract/Free Full Text]
  59. Weiss, A. A., Johnson, F. D., and Burns, D. L. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2970-2974 [Abstract/Free Full Text]
  60. Winans, S. C. (1992) Microbiol. Rev. 56, 12-31 [Abstract/Free Full Text]
  61. Yanofsky, M. F., Porter, S. G., Young, C., Albright, L. M., Gordon, M. P., and Nester, E. W. (1986) Cell 47, 471-477 [CrossRef][Medline] [Order article via Infotrieve]
  62. Young, C., and Nester, E. W. (1988) J. Bacteriol. 170, 3367-3374 [Abstract/Free Full Text]
  63. Zambryski, P. C. (1992) Annu. Rev. Plant Physiol. & Plant Mol. Biol. 43, 465-490 [CrossRef]
  64. Zambryski, P., Tempe, J., and Schell, J. (1989) Cell 56, 193-201 [CrossRef][Medline] [Order article via Infotrieve]
  65. Ziegelin, G. (1989) Konjugativer Transfer des Plasmids RP4: Die Spezifitätsdeterminanten codieren oriT-Bindungsproteine. Ph.D. dissertation, Freie Universität Berlin, Berlin, Germany
  66. Ziegelin, G., Fürste, J. P., and Lanka, E. (1989) J. Biol. Chem. 264, 11989-11994 [Abstract/Free Full Text]
  67. Ziegelin, G., Pansegrau, W., Strack, B., Balzer, D., Kröger, M., Kruft, V., and Lanka, E. (1991) DNA Seq. Map. 1, 303-327

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Lacroix, A. Loyter, and V. Citovsky
Association of the Agrobacterium T-DNA-protein complex with plant nucleosomes
PNAS, October 7, 2008; 105(40): 15429 - 15434.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. M. Rommens, O. Bougri, H. Yan, J. M. Humara, J. Owen, K. Swords, and J. Ye
Plant-Derived Transfer DNAs
Plant Physiology, November 1, 2005; 139(3): 1338 - 1349.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. J. Jakubowski, E. Cascales, V. Krishnamoorthy, and P. J. Christie
Agrobacterium tumefaciens VirB9, an Outer-Membrane-Associated Component of a Type IV Secretion System, Regulates Substrate Selection and T-Pilus Biogenesis
J. Bacteriol., May 15, 2005; 187(10): 3486 - 3495.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Abu-Arish, D. Frenkiel-Krispin, T. Fricke, T. Tzfira, V. Citovsky, S. G. Wolf, and M. Elbaum
Three-dimensional Reconstruction of Agrobacterium VirE2 Protein with Single-stranded DNA
J. Biol. Chem., June 11, 2004; 279(24): 25359 - 25363.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. A. Caryl, M. C. A. Smith, and C. D. Thomas
Reconstitution of a Staphylococcal Plasmid-Protein Relaxation Complex In Vitro
J. Bacteriol., June 1, 2004; 186(11): 3374 - 3383.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
T. Tzfira, L. R. Frankman, M. Vaidya, and V. Citovsky
Site-Specific Integration of Agrobacterium tumefaciens T-DNA via Double-Stranded Intermediates
Plant Physiology, November 1, 2003; 133(3): 1011 - 1023.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Bako, M. Umeda, A. F. Tiburcio, J. Schell, and C. Koncz
The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants
PNAS, August 19, 2003; 100(17): 10108 - 10113.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. B. Gelvin
Agrobacterium-Mediated Plant Transformation: the Biology behind the "Gene-Jockeying" Tool
Microbiol. Mol. Biol. Rev., March 1, 2003; 67(1): 16 - 37.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. Y. Szpirer, M. Faelen, and M. Couturier
Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1
J. Bacteriol., March 15, 2001; 183(6): 2101 - 2110.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
J. Zhu, P. M. Oger, B. Schrammeijer, P. J. J. Hooykaas, S. K. Farrand, and S. C. Winans
The Bases of Crown Gall Tumorigenesis
J. Bacteriol., July 15, 2000; 182(14): 3885 - 3895.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Relić, L. Rossi, Y. Nagamine, and B. Hohn
Interaction of the DNA modifying proteins VirD1 and VirD2 of Agrobacterium tumefaciens: Analysis by subcellular localization in mammalian cells
PNAS, August 4, 1998; 95(16): 9105 - 9110.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Hansen, R. D. Shillito, and M.-D. Chilton
T-strand integration in maize protoplasts after codelivery of a T-DNA substrate and virulence genes
PNAS, October 14, 1997; 94(21): 11726 - 11730.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Hansen and M.-D. Chilton
"Agrolistic" transformation of plant cells: Integration of T-strands generated in planta
PNAS, December 10, 1996; 93(25): 14978 - 14983.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scheiffele, P.
Right arrow Articles by Lanka, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scheiffele, P.
Right arrow Articles by Lanka, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement